CN102154463A - Method for screening safflower containing hydroxysafflor yellow A (HSYA) and 4-[11'-hydroxyl-11'-sulfydryl-11'-[1'-[2'-(N-O)]-isoquinolyl]-1-phenylformic acid] (IQBA) - Google Patents

Abstract

The invention relates to the technical field of bioscience, in particular to a method for screening safflower containing hydroxysafflor yellow A (HSYA) and 4-[11'-hydroxyl-11'-sulfydryl-11'-[1'-[2'-(N-O)]-isoquinolyl]-1-phenylformic acid] (IQBA). The contents of two active ingredients, i.e., HSYA and IQBA of safflower directly influence the quality of the safflower. The expression characteristics of HSYA and IQBA are analyzed by adopting cDNA-AFLP (complementary Deoxyribonucleic Acid-Amplified Fragment Length Polymorphism), a differential expression gene closely relevant to the two active ingredients, i.e., HSYA and IQBA is separated out, and the characteristic genotype of the gene and the accuracy of a cDNA-AFLP method are further verified by undergoing an RT-PCR (Reverse Transcriptase-Polymerase Chain Reaction). A specific DNA fragment obtained by the screening method disclosed by the invention has a nucleotide sequence shown as SEQ ID NO:1. In the screening method, the specific DNA fragment is used for screening safflower varieties containing two active ingredients, i.e., HSYA and IQBA, so that good conditions for realizing directional control of high-quality character of safflower are further provided.

Description

A kind of screening method that contains the safflower of HSYA and IQBA

Technical field

The present invention relates to the bio-science technical field, be specifically related to a kind of screening method that contains two kinds of effective constituent hydroxyl radical carthamin yellow carthamus As and 4-{11 '-hydroxyl-11 '-sulfydryl-11 '-{ 1 '-[2 '-(N → O)-isoquinolyl] }-benzoic safflower of 1-.

Background technology

Safflower Carthmus tmctorius L. is the dry tubiform floret of feverfew safflower, and clinical application is extensive.Main chemical compositions has flavonoid, indoles, lignanoids, alkyl diol class etc.Hydroxyl radical carthamin yellow carthamus A (Hydroxysafflor yellow A wherein, be called for short HSYA) be the important activity composition of safflower, have resist myocardial ischemia, cerebral ischemia, anticoagulant, multiple pharmacological effect such as anti-oxidant, cardiovascular and cerebrovascular diseases there is good preventive and therapeutic effect, has good application prospects (Wu Wei, Li Jinrong, Piao Yongzhe, Dong Ningning, Jin Ming. hydroxyl radical carthamin yellow carthamus A is alleviated the effect research of rat heart muscle injury of mitochondria. Chinese Pharmaceutical Journal, 2006,41 (16): 1225-1227; Jin Ming, Gao Zichun, Wang Jifeng. the research of the rabbit platelet activation that hydroxyl radical carthamin yellow carthamus A inhibition PAF brings out. Beijing University of Chinese Medicine's journal, 2004,27 (5): 32; Jin Wu, Li Jinrong, Wu Wei. the hydroxyl radical carthamin yellow carthamus A Antioxidation Effects. herbal medicine, 2004,35 (6): 665; Shi Feng, Yan Liu's literary composition, the chemical ingredients of safflower and pharmacological research progress, the time precious traditional Chinese medical science traditional Chinese medicines, 2006,17 (9): 1666-1667); 4-{11 '-hydroxyl-11 '-sulfydryl-11 '-{ 1 '-[2 '-(N → O)-isoquinolyl] }-1-phenylformic acid (being called for short IQBA) be the inventor from Chinese medicine safflower, study acquisition another have compound (the Ge Zhang of cerebral ischemia provide protection; Mei-Li Guo; Run-Ping Li; Ying Li; Han-Ming Zhang; Zhong-Wu Su.A NOVEL COMPOUND FROM FlosCarthami AND ITS BIOACTIVITY.Chemistry of Natural Compounds.2009,45:339-341).Therefore, the height of HSYA and IQBA content in the safflower directly influences the quality of safflower quality.Safflower correlation of attributes functional gene is studied, significant to the output and the quality that improve safflower.

Previous research work, the inventor uses the cDNA-AFLP technology and carries out the differential expression analysis in conjunction with the BSA method to containing with the safflower of hydroxyl carthamin yellow A-containing not, invent a kind of method of screening the safflower variety of hydroxyl carthamin yellow A-containing and obtained Chinese patent (Chinese patent ZL 200810037322.8, invention and created name: a kind of screening method of safflower of hydroxyl carthamin yellow A-containing).Contain the many safflowers of effective composition kind in order more effectively to screen, the inventor proceeds research, has invented the novel method that another kind of screening contains the safflower of two kinds of effective constituent HSYA and IQBA.

Summary of the invention

The object of the invention provide a kind of HSYA of containing and IQBA the screening method of safflower.

The present invention uses the cDNA-AFLP technology and carries out the differential expression analysis in conjunction with the BSA method to containing with the safflower that does not contain HSYA and IQBA, finds in safflower and HSYA and closely linked 1 gene of IQBA, and this gene has the nucleotide sequence shown in SEQ ID No.1.Concrete grammar is as follows:

The present invention is a female parent with the safflower strain No.16 that contains HSYA and IQBA, the safflower No.25 that does not contain HSYA and IQBA is that male parent is hybridized, and obtains F1 for seed, and F1 carries out from accompanying each other for the F2 seed that obtains for seed, continue plantation, obtain F2 from simple grain F2 seed and amount to 215 individual plants for colony.Carry out following steps then:

1. according to F ₂Have or not for the HSYA of colony and the content of IQBA, get the F that equivalent contains HSYA and IQBA ₂Individual corolla blended together the pond was arranged generation, and other gets the F that does not contain HSYA and IQBA ₂In generation,, individual corolla blended together no pond;

2. extract the total RNA of safflower, reverse transcription becomes double-stranded cDNA;

By cDNA-AFLP to containing HSYA and IQBA and not containing the differential expression analysis of the safflower of HSYA and IQBA, in the combination of primers of PstI-CT/MseI-AG, obtain TDF-1 one bar segment;

4. this bar segment is reclaimed clone and order-checking.TDF-1 has the nucleotide sequence shown in SEQ ID No.1.

The invention provides the screening method of the safflower of a kind of HSYA of containing and IQBA, this method is to identify in the safflower gene with the cDNA sequence analysis method to contain just like a nucleotide sequence shown in the SEQ ID No.1.

Above-mentioned sequence analysis method comprises terminal rapid amplifying (RACE) method of RT-PCR method, Northerning Bloting method and cDNA etc.

Aforesaid method may further comprise the steps:

A, according to TDF-1 (SEQ ID No.1) sequences Design and synthetic RT-PCR primer,

TDF-1 primer: 5 '-CTTGCAGCCCGATGTGA-3 '

5’-CACCATAATAAGCCACCT-3’

Total RNA of B, extraction safflower;

C, be template, turn over and be transcribed into the first chain cDNA with the total RNA of safflower;

D, be that template adds the synthetic primer, carry out pcr amplification with the first chain cDNA;

E, agarose electrophoresis, the ultraviolet colour developing;

F, order-checking.

In the safflower that contains HSYA and IQBA, obtain and SEQ ID No.1 identical sequence gene, and in the safflower that does not contain HSYA and IQBA, do not obtain, prove the reliability of cDNA-AFLP experiment.

The method that contains the safflower of HSYA and IQBA according to above-mentioned screening, at the safflower variety that contains HSYA and IQBA and the safflower variety that do not contain HSYA and IQBA adopting said method between totally 18 Different Red flower varieties, all finding has the gene fragment identical with TDF-1 in the safflower that contains HSYA and IQBA, and does not exist in the safflower that does not contain HSYA and IQBA.

The present invention provides novel method for the safflower variety that screening contains HSYA and IQBA, and then is that the orientation regulation and control that realize the high-quality proterties of safflower lay the foundation.

Description of drawings

Fig. 1: the silver of safflower cDNA-AFLP differential expression dyes the result.

Wherein arrow is represented TDF-1; M:DL 2000 DNA average molecular marks; 1: do not contain the HSYA pond; 2: contain the HSYA pond; 3: male parent; 4-7: the F that does not contain HSYA and IQBA ₂For individual plant; 8: female parent; 9-21: the F that contains HSYA and IQBA ₂For individual plant; Primer: PstI-CT/MseI-AG

Fig. 2: cDNA-AFLP differential expression fragment is in the checking result of RT-PCR.

1-5 wherein: the F that does not contain HSYA and IQBA ₂For individual plant; 6-10: the F2 that contains HSYA and IQBA is for individual plant

Embodiment

Describe the present invention below in conjunction with drawings and Examples.

Embodiment 1: the segmental separation of TDF-1 of the present invention

1. use efficient liquid-phase chromatography method, tlc and determined by ultraviolet spectrophotometry F ₂For the HSYA of colony and the content of IQBA, detect it and have or not.

2. respectively get the safflower corolla that contains and do not contain HSYA and IQBA according to measurement result, extract total RNA, and change into double-stranded cDNA.

3. make up the near isogene pond that contains and do not contain HSYA and IQBA, get each the 1 μ g of cDNA that contains HSYA and IQBA individual plant, totally 10 strains blend together the pond; Other get do not contain HSYA and IQBA each 1 μ g of cDNA individual plant totally 10 strains blend together no pond.

4.cDNA-AFLP differential expression analysis:

(1) restriction enzyme digestion is connected with joint: adopt PstI and two kinds of restriction enzymes of MseI to the cDNA double digestion, enzyme is cut time 37 ℃ of 6h; Use T then ₄Dna ligase is connected with the MseI joint PstI with endonuclease bamhi, 16 ℃ of 12h.

(2) segmental pre-amplification: this research is done template with the connection product, adopts pre-amplification combination of primers P ₀₀/ M ₀₀(5 '-GACTGCGTACATGCAG-3 '/5 '-GATGAGTCCTGAGTAA-3 ').To connecting 10 times of product dilutions.On Biometra PTC-200 type PCR instrument, increase: 94 ℃ of 3min, 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 1min, 30 circulations by following program; 72 ℃ of 5min; 4 ℃ of insulations.Pre-expansion volume increase thing detects on 1.5% sepharose, and-20 ℃ of preservations are standby.

(3) selective amplification: adopt selective amplification combination of primers P _{+ NN}/ M _{+ NN}(5 '-GACTGCGTACATGCAGNN-3 '/5 '-GATGAGTCCTGAGTAANN-3 ' (N represents ACGT, N represent ACGT any one, P1-P16 totally 16 primers, M1-M16 totally 16 primers)), to 150 times of pre-expansion product dilutions.Choosing is expanded reaction system and is done slightly inching according to systems such as Bachem.Amplification program: 94 ℃ of 3min, 94 ℃ of 30s, 65 ℃ of every circulations of 30s reduce by 0.7 ℃, 12 circulations of 72 ℃ of 1min, 94 ℃ of 30s, 56 ℃ of 30s of annealing temperature.30 circulations of 72 ℃ of 1min, 72 ℃ of 10min; 4 ℃ of insulations.Amplified production detects at 1.5% agarose, and-20 ℃ of preservations are standby.

(4) electrophoresis of cDNA-AFLP amplified production: the voltage by 30V/em carries out the 30min prerunning.Amplified production: bromjophenol blue mixes 95 ℃ sex change 8min, immediately ice baths at 8: 3.Application of sample behind the urea that removal diffuses out when prerunning, 1800V electrophoresis, constant voltage.

(5) silver dyes detection: fixing glue: glue is immersed in the stationary liquid vibration 20min disappears to the electrophoresis dye colour.With ultrapure washing glue three times, each 8min.Dyeing 30min.Glue is immersed in the ultrapure water, takes out draining, puts into and fill the colour developing of precooling colour developing liquid immediately: glue shakes on shaking table to Form board tape or visible first band occurring.Glue is gone in the colour developing liquid of remaining 1 liter of precooling, continue to develop the color 3-5min or extremely whole bands display.Add 1 liter of fixing/stop bath, on shaking table, react 2-3min, the color development stopping reaction.With ultrapure water rinsing polyacrylamide gel twice, each 5min, room temperature is placed dried glue, as shown in Figure 1.

5.TDF-1 separating clone and order-checking: primer PstI-CT/MseI-AG screening obtains 1 specific fragment TDF-1, reclaim polymorphism TDF fragment from PAGE glue, and be that template is made PCR with this fragment, the agarose amplified production adopts Watson a small amount of glue to reclaim test kit and reclaims, reclaim polymorphic bands and be connected among the pMD-18T vector, and Transformed E .coli DH5 α.By ammonia benzyl resistance screening transformant, select positive colony, will be sent to the order-checking of Introgen company after the positive colony expansion doubly, recording sequence is bp, shown in SEQ ID No.1.

SEQ?ID?No.1(TDF-1)136bp

CGGCGGCCGGATTTGAAGTGGAGAAACGGGTGGTAACAAGATCTTGCA

GCCGATGTGAGCAGAAGGTGGCTTATTATGGTGGCGGGCGTTCATCGCT

GGCGATATACAAGCCGGCAATGCTGTCAATGGTGGCAAT

Embodiment 2:RT-PCR verifies TDF-1 genetic expression:

A, according to TDF-1 (SEQ ID No.1) sequences Design and synthetic RT-PCR primer,

5’-CTTGCAGCCCGATGTGA-3’(SEQ?ID?No.2)

5’-CACCATAATAAGCCACCT-3’(SEQ?ID?No.3)

Total RNA of B, extraction Jimusar safflower;

C, be template, turn over and be transcribed into the first chain cDNA with the total RNA of safflower;

D, be template, add the synthetic primer, carry out pcr amplification with the first chain cDNA;

E, agarose electrophoresis, the ultraviolet colour developing.

F, order-checking.

In the safflower that contains HSYA and IQBA, obtain and SEQ ID No.1 identical sequence gene, and in not containing HSYA and IQBA safflower, do not obtain, prove the reliability of cDNA-AFLP experiment, as shown in Figure 2.

Embodiment 3: the application of this screening method:

1. extract the total RNA of safflower that each place of production contains and do not contain HSYA and IQBA respectively, change into double-stranded cDNA.

2. use the PstI-CT/MseI-AG combination of primers, with implementing 1 method the safflower that contains HSYA and IQBA and do not contain HSYA and IQBA is carried out the analysis of cDNA-AFLP differential expression, at Hami safflower, the Jimusar safflower, Changji safflower, Xinxiang safflower, Heze safflower, Haozhou safflower, the Jianyang safflower, the Kaifeng safflower, Zhengzhou safflower, Chengdu safflower, the Weishan safflower, Jiuquan safflower obtains 1 specific fragment in the safflower of Kunming, and the Ruoqiang safflower, the Tacheng safflower, the Urumchi safflower, the Qingxu safflower does not obtain in the safflower of Hainan.

3. the above-mentioned safflower variety that contains this specific fragment all contains HSYA and IQBA through measuring with the high performance liquid phase method; And do not contain the kind of above-mentioned this bar segment, all do not contain HSYA and IQBA.

4. this bar segment is reclaimed, clone and order-checking, all identical with the TDF-1 sequence.

5. carry out the RT-PCR checking with the method for implementing 2, find at the safflower variety that contains HSYA and IQBA as Hami safflower, Jimusar safflower, Changji safflower, Xinxiang safflower, Heze safflower, Haozhou safflower, the Jianyang safflower, Kaifeng safflower, Zhengzhou safflower, the Chengdu safflower, Weishan safflower, Jiuquan safflower, exist in the safflower of Kunming, and the safflower variety that do not contain HSYA and IQBA is as Ruoqiang safflower, Tacheng safflower, the Urumchi safflower, the Qingxu safflower does not exist in the safflower of Hainan.

Claims (3)

1. the screening method of a hydroxyl carthamin yellow A-containing and 4-{11 '-hydroxyl-11 '-sulfydryl-11 '-{ 1 '-[2 '-(N → O)-isoquinolyl] }-benzoic safflower of 1-is characterized in that this method is to identify in the safflower gene with the cDNA sequence analysis method to contain just like the nucleotide sequence shown in the SEQ ID No.1.

2. the screening method of a kind of hydroxyl carthamin yellow A-containing according to claim 1 and 4-{11 '-hydroxyl-11 '-sulfydryl-11 '-{ 1 '-[2 '-(N → O)-isoquinolyl] }-benzoic safflower of 1-is characterized in that cDNA sequence analysis method wherein is the terminal rapid amplifying method of RT-PCR method, Northerning Bloting method or cDNA.

3. the screening method of a kind of hydroxyl carthamin yellow A-containing according to claim 1 and 2 and 4-{11 '-hydroxyl-11 '-sulfydryl-11 '-{ 1 '-[2 '-(N → O)-isoquinolyl] }-benzoic safflower of 1-is characterized in that this method may further comprise the steps:

A, design and synthesize following RT-PCR primer;

5’-CTTGCAGCCCGATGTGA-3’

5’-CACCATAATAAGCCACCT-3’

Total RNA of B, extraction safflower;

C, be template, turn over and be transcribed into the first chain cDNA with the total RNA of safflower;

D, be that template adds the synthetic primer, carry out pcr amplification with the first chain cDNA;

E, agarose electrophoresis, the ultraviolet colour developing;

F, order-checking.

Images