CN103866004B - A kind of identify Fugu rubripes (Temmincket Schlegel) parent child relationship molecule marking method and micro-satellite and test kit - Google Patents
A kind of identify Fugu rubripes (Temmincket Schlegel) parent child relationship molecule marking method and micro-satellite and test kit Download PDFInfo
- Publication number
- CN103866004B CN103866004B CN201410033662.9A CN201410033662A CN103866004B CN 103866004 B CN103866004 B CN 103866004B CN 201410033662 A CN201410033662 A CN 201410033662A CN 103866004 B CN103866004 B CN 103866004B
- Authority
- CN
- China
- Prior art keywords
- micro
- parent
- child relationship
- pure
- elimination factor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides the method and micro-satellite primers thereof and test kit that utilize molecule marking method to identify the pure parent child relationship in red fin east, 44 pairs of selected micro-satellite primers are stable at the pure pcr amplification reaction in red fin east, amplified fragments is clear, polymorphism is high.Use this technology, the pure individuality in red fin east of the different familys mixed can be made a distinction, contribute to fast, accurately differentiate that the red fin east of different family is pure, to the pure conservation in red fin east, breeding combo and selection and use, there is great using value.
Description
Technical field
The invention belongs to molecular marking technique field, relate to the method and micro-satellite primers thereof and test kit that utilize molecule marking method to identify the pure parent child relationship in red fin east.
Background technology
Red fin east pure (Takifugurubripes) belongs to Osteichthyes (Osteichthyes), pure shape order (Tetraodontiformes), pure suborder (Tetraodontoidei), pure Superfamily (Tetraodntoidea), pure section (Tetraodontidae), east sheerly (Takifugu), be commonly called as " filefish ", mainly originate in Bohai and Yellow Seas and the East Sea of China, be then mainly distributed in the coastal and Korea peninsula of Japan abroad.The pure fine and tender taste in red fin east, delicious flavour, high protein and low fat, containing abundant VITAMIN and trace element, have the good reputation of " king in fish ".Have comparatively comprehensively good character although red fin east is pure, can say without kind in present stage actual breeding process, the selection and use pure about red fin east is studied also relatively less.Therefore, by genetic improvement means, cultivate the excellent dew kind in red fin east of economic characters or new lines is very important.
From current Research foundation analysis, improve the pure Major Economic in red fin east and adopt many families selecting breeding technique to be comparatively effective means.Many family selective breedings technology is mainly: set up multiple family full-sibs with male and female 1:1 combo, by cultivation contrast experiment, analyze the proterties such as the growth of each family, disease-resistant, degeneration-resistant, quality, through too much for good character combination, select the more excellent new variety of economic characters or new lines.In cultivation in this experiment, normally different family raised in independently tank, this just needs to take large breeding facility and tank.At present, also by carrying out electronic marker to individuality, then mixing is raised in a large cement pit, to reduce the impact of environment on different family, but also there is certain drawback in this method: carrying out electronic marker money at individuality still needs different family to be raised in independent tank 4-5 month, just can carry out electronic marker when whose body weight reaches about 50g.In addition, cultivate fry in independent tank than great Chi in the fry growth that cultivates slow.In addition, the cost of individual electronic marker is also higher, and an average electronic marker board wants about 20 yuan.
Therefore, searching out a kind of precise Identification parent child relationship when not affecting fish bulk-growth, distinguishing different family fast and accurately, will effectively promote the seed selection process of the dew kind in red fin east.
Summary of the invention
The present invention aims to provide the method and micro-satellite primers thereof and test kit that utilize molecule marking method to identify the pure parent child relationship in red fin east, contribute to fast, accurately differentiating that the red fin east of different family is pure, in the pure selection and use in red fin east and hereditary conservation, have great using value.
One aspect of the present invention relates to a kind of micro-satellite primers identifying the pure parent child relationship in red fin east, it is characterized in that, described primer is for the pure genomic different linkage group in red fin east.
Preferably, described primer is selected from the 3-10 couple in following primer pair:
More preferably, described primer is made up of following primer pair:
| Title | Forward primer DNA sequence dna (5 '-3 ') | Reverse primer DNA sequence dna (5 '-3 ') |
| f1360 | ggacttcagctctggtcctg | ggtgcgactgcttccatcta |
| f1407 | caaagacgttcacccacaga | accgtctctgcctttgacag |
| f333 | tgtcctctggacctgtgttg | ctcccacacatgaagacacg |
| f1752 | ggatgtggaacaatctgctt | gctgaagtcattcatgggaag |
| f1077 | ctgaaagggaaaagcagcaa | cacgtcagaagctgcgatta |
The present invention relates to a kind of test kit identifying the pure parent child relationship in red fin east on the other hand, comprises the micro-satellite primers of the pure parent child relationship in qualification red fin east described in first aspect present invention.
Further aspect of the present invention relates to a kind of molecule marking method identifying the pure parent child relationship in red fin east, adopts following steps:
(1) 44 are selected to carry out PCR reaction to special micro-satellite primers, the special micro-satellite primers title of this 44 couple and sequence list following (see table 1):
Table 144 pair micro-satellite primers
The selection of above-mentioned micro-satellite primers is based on following principle: for target sequence number of alleles many, have height polymorphism, there is not linkage relationship each other, be distributed in multiple different linkage group etc.
(2) gather the fin ray of family parent to be measured and filial generation, extract genomic dna.
Preferably, TIANGEN marine animal genome DNA extracting reagent kit is utilized to carry out the extraction of genomic dna.
(3) be template with the genomic dna of step (2), 44 pairs of micro-satellite primers selected by step (1) carry out pcr amplification respectively.
Preferably, when carrying out pcr amplification, it is 25 μ L that PCR reacts cumulative volume, comprising: 10 × Buffer2.5 μ L, Mg
2+(25mmol/L) 1 μ L, dNTPs (each 2mmol/L) 1 μ L, forward and reverse primer (10 μm of ol/L) each 1 μ L, masterplate DNA1 μ L (50ng/ μ L), Taq DNA polymerase 1U, add appropriate ddH
2o.
Preferably, PCR response procedures is: 94 DEG C of denaturation 3min, and 30 circulations (72 DEG C extend 30s for 94 DEG C of sex change 30s, annealing 30s), last 72 DEG C extend 10min.
(4) pcr amplification product of step (3) is detected through 8% native polyacrylamide gel electrophoresis, with 1% cma staining 10min after electrophoresis, nitrite ion colour developing 10min.Gel is in the imaging of HPscanjetG4010 scanner.
(5) by the electrophoresis detection result digitized processing of PCR, analyze with genetic analysis software.
Preferably, the genetic analysis software conventional with this area and calculation formula carry out digitized processing to electrophoretic band, calculate the elimination factor (see table 2) of each microsatellite marker.According to elimination factor height, select the microsatellite marker (see table 3) of first 10 of sequence, the accumulation elimination factor scope of 3-10 microsatellite marker is 95.79%-99.99% (see table 4).Utilize 5 elimination factors preceding microsatellite marker that sorts to combinationally use, complete the parenthood determination of family parent and filial generation.
Preferably, in step (5), gel analysis software Gel-ProAnalyzer4.5 and genetic analysis software CERVUSVersion3.0 is used to analyze.
(6) according to the parent child relationship of parent and filial generation, just the pure family plot in Different Red fin east can be separated.
The title of table 244 microsatellite marker and elimination factor
| Title | Elimination factor | Linkage group | Title | Elimination factor | Linkage group |
| f1176 | 0.542 | 1 | f1407 | 0.647 | 1 |
| f810 | 0.428 | 2 | f791 | 0.298 | 2 |
| f1064 | 0.054 | 3 | f1055 | 0.307 | 3 |
| f1732 | 0.359 | 4 | f1012 | 0.537 | 4 |
| f1752 | 0.62 | 5 | f133 | 0.647 | 5 |
| f1487 | 0.419 | 6 | f112 | 0.595 | 6 |
| f1062 | 0.566 | 7 | f1408 | 0.467 | 7 |
| f1102 | 0.535 | 8 | f1316 | 0.527 | 8 |
| f1202 | 0.366 | 9 | f1077 | 0.615 | 9 |
| f171 | 0.533 | 10 | f1422 | 0.535 | 10 |
| f663 | 0.358 | 11 | f1641 | 0.533 | 11 |
| f1367 | 0.565 | 12 | f1061 | 0.324 | 12 |
| f98 | 0.58 | 13 | f809 | 0.563 | 13 |
| f503 | 0.523 | 14 | f573 | 0.56 | 14 |
| f935 | 0.556 | 15 | f637 | 0.563 | 15 |
| f1235 | 0.534 | 16 | f1680 | 0.306 | 16 |
| f1326 | 0.565 | 17 | f1066 | 0.611 | 17 |
| f1356 | 0.531 | 18 | f1385 | 0.575 | 18 |
| f1129 | 0.384 | 19 | f667 | 0.572 | 19 |
| f1403 | 0.583 | 20 | f665 | 0.598 | 20 |
| f139 | 0.43 | 21 | f1621 | 0.391 | 21 |
| f840 | 0.358 | 22 | f1360 | 0.662 | 22 |
The title of front 10 microsatellite markers of table 3 elimination factor and linkage group
| Title | Elimination factor | Sequence | Linkage group | Title | Elimination factor | Sequence | Linkage group |
| f1360 | 0.662 | 1 | 22 | f1066 | 0.611 | 6 | 17 |
| f1407 | 0.647 | 2 | 1 | f665 | 0.598 | 7 | 20 |
| f333 | 0.647 | 3 | 5 | f112 | 0.595 | 8 | 6 |
| f1752 | 0.62 | 4 | 5 | f1403 | 0.583 | 9 | 20 |
| f1077 | 0.615 | 5 | 9 | f98 | 0.58 | 10 | 13 |
Table 4 microsatellite marker quantity and accumulation elimination factor
| Site quantity | Accumulation elimination factor | Number of sites | Accumulation elimination factor |
| 3 | 95.79％ | 7 | 99.90％ |
| 4 | 98.38％ | 8 | 99.96％ |
| 5 | 99.38％ | 9 | 99.98％ |
| 6 | 99.76％ | 10 | 99.99％ |
The invention has the beneficial effects as follows:
Use this technology, the pure individuality in red fin east of the different familys mixed can be made a distinction, contribute to the pure conservation in red fin east, breeding combo and selection and use.44 pairs of micro-satellite primers selected by the present invention are stable at the pure pcr amplification reaction in red fin east, amplified fragments is clear, polymorphism is high.
Accompanying drawing explanation
Fig. 1 according to genetic distance, the sibship dendrogram of 5 familys;
Fig. 2 according to genetic distance, the sibship dendrogram of 7 familys;
Fig. 3 according to genetic distance, the sibship dendrogram of 8 familys.
Embodiment:
The present embodiment is invention preferred embodiment, its principles all and basic structure identical with the present invention, all belong in protection scope of the present invention.
Embodiment 1
A kind of molecule marking method identifying the pure parent child relationship in red fin east of the present invention, adopts following technological step:
Pure 5 familys in red fin east totally 272 tail fishes, containing 5 couples of parents, adopt from center, China Aquatic Science Research Institute Bei Dai River experiment centre.Gather the belly fin ray of every tail fish, extract genomic dna with TIANGEN marine animal genome DNA extracting reagent kit.With got genomic dna for template, carry out pcr amplification respectively with the microsatellite marker of first 5 of elimination factor, it is 25 μ L that PCR reacts cumulative volume, comprising: 10 × Buffer2.5 μ L, Mg
2+(25mmol/L) 1 μ L, dNTPs (each 2mmol/L) 1 μ L, forward and reverse trip primer (10 μ rnol/L) each 1 μ L, masterplate DNA1 μ L (50ng/ μ L), Taq DNA polymerase 1U, add appropriate ddH
2o.PCR response procedures is: 94 DEG C of denaturation 3min, and 30 circulations (72 DEG C extend 30s for 94 DEG C of sex change 30s, annealing 30s), last 72 DEG C extend 10min.PCR primer amplified production detects through 8% native polyacrylamide gel electrophoresis, and after cma staining, colour developing, gel is in the imaging of HPscanjetG4010 scanner.By the electrophoresis detection result digitized processing of PCR, analyze with Gel-ProAnalyzer4.5 gel analysis software and CERVUSVersion3.0, complete the parenthood determination of family progeny and parent, utilize the parent child relationship of parent and filial generation, distinguish the pure family in Different Red fin east (see table 5 and Fig. 1).
The paternity test result of table 55 family
Wherein the microsatellite marker title of first 5 of elimination factor and sequence information as follows:
| Title | Forward primer DNA sequence dna (5 '-3 ') | Reverse primer DNA sequence dna (5 '-3 ') | Linkage group elimination factor sorts |
| f1360 | ggacttcagctctggtcctg | ggtgcgactgcttccatcta | 220.6621 |
| f1407 | caaagacgttcacccacaga | accgtctctgcctttgacag | 10.6472 |
| f333 | tgtcctctggacctgtgttg | ctcccacacatgaagacacg | 50.6473 |
| f1752 | ggatgtggaacaatctgctt | gctgaagtcattcatgggaag | 50.624 |
| f1077 | ctgaaagggaaaagcagcaa | cacgtcagaagctgcgatta | 90.6155 |
Embodiment 2
A kind of molecule marking method identifying the pure parent child relationship in red fin east of the present invention, adopts following technological step:
Pure 7 familys in red fin east totally 313 tail fishes, containing 7 couples of parents, adopt from center, China Aquatic Science Research Institute Bei Dai River experiment centre.Gather the belly fin ray of every tail fish, extract genomic dna with TIANGEN marine animal genome DNA extracting reagent kit.With got genomic dna for template, carry out pcr amplification respectively with the microsatellite marker of first 5 of elimination factor, it is 25 μ L that PCR reacts cumulative volume, comprising: 10 × Buffer2.5 μ L, Mg
2+(25mmol/L) 1 μ L, dNTPs (each 2mmol/L) 1 μ L, forward and reverse primer (10 μm of ol/L) each 1 μ L, masterplate DNA1 μ L (50ng/ μ L), Taq DNA polymerase 1U, add appropriate ddH
2o.PCR response procedures is: 94 DEG C of denaturation 3min, and 30 circulations (72 DEG C extend 30s for 94 DEG C of sex change 30s, annealing 30s), last 72 DEG C extend 10min.PCR primer amplified production detects through 8% native polyacrylamide gel electrophoresis, and after cma staining, colour developing, gel is in the imaging of HPscanjetG4010 scanner.By the electrophoresis detection result digitized processing of PCR, analyze with Gel-ProAnalyzer4.5 gel analysis software and CERVUSVersion3.0, complete the parenthood determination of family progeny and parent, utilize the parent child relationship of parent and filial generation, distinguish the pure family in Different Red fin east (see table 6 and Fig. 2).
The paternity test result of table 67 family
Wherein the microsatellite marker title of first 5 of elimination factor and sequence information as follows:
| Title | Forward primer DNA sequence dna (5 '-3 ') | Reverse primer DNA sequence dna (5 '-3 ') linkage group elimination factor sorts |
| f1360 | ggacttcagctctggtcctg | ggtgcgactgcttccatcta | 220.6621 |
| f1407 | caaagacgttcacccaeaga | accgtctctgcctttgacag | 10.6472 |
| f333 | tgtcctctggaectgtgttg | ctcccacacatgaagacacg | 50.6473 |
| f1752 | ggatgtggaacaatctgctt | gctgaagtcattcatgggaag | 50.624 |
| f1077 | ctgaaagggaaaagcagcaa | caegtcagaagctgcgatta | 90.6155 |
Embodiment 3
A kind of molecule marking method identifying the pure parent child relationship in red fin east of the present invention, adopts following technological step:
Pure 8 familys in red fin east totally 359 tail fishes, containing 8 couples of parents, adopt from center, China Aquatic Science Research Institute Bei Dai River experiment centre.Gather the belly fin ray of every tail fish, extract genomic dna with TIANGEN marine animal genome DNA extracting reagent kit.With got genomic dna for template, carry out pcr amplification respectively with the microsatellite marker of first 5 of elimination factor, it is 25 μ L that PCR reacts cumulative volume, comprising: 10 × Buffer2.5 μ L, Mg
2+(25mmol/L) 1 μ L, dNTPs (each 2mmol/L) 1 μ L, forward and reverse primer (10 μm of ol/L) each 1 μ L, masterplate DNA1 μ L (50ng/ μ L), Taq DNA polymerase 1U, add appropriate ddH
2o.PCR response procedures is: 94 DEG C of denaturation 3min, and 30 circulations (72 DEG C extend 30s for 94 DEG C of sex change 30s, annealing 30s), last 72 DEG C extend 10min.PCR primer amplified production detects through 8% native polyacrylamide gel electrophoresis, and after cma staining, colour developing, gel is in the imaging of HPscanjetG4010 scanner.By the electrophoresis detection result digitized processing of PCR, analyze with Gel-ProAnalyzer4.5 gel analysis software and CERVUSVersion3.0, complete the parenthood determination of family progeny and parent, utilize the parent child relationship of parent and filial generation, distinguish the pure family in Different Red fin east (see table 7 and Fig. 3).
The paternity test result of table 78 family
Wherein the microsatellite marker title of first 5 of elimination factor and sequence information as follows:
| Title | Forward primer DNA sequence dna (5 '-3 ') | Reverse primer DNA sequence dna (5 '-3 ') | Linkage group elimination factor sorts |
| f1360 | ggacttcagctctggtcctg | ggtgcgactgcttccatcta | 220.6621 |
| f1407 | caaagacgttcacccacaga | accgtctctgcctttgacag | 10.6472 |
| f333 | tgtcctctggacctgtgttg | ctcccacacatgaagacacg | 50.6473 |
| f1752 | ggatgtggaacaatctgctt | gctgaagtcattcatgggaag | 50.624 |
| f1077 | ctgaaagggaaaagcagcaa | cacgtcagaagctgcgatta | 90.6155 |
Above embodiment is only unrestricted for illustration of the present invention, and the present invention is also not limited only to above-mentioned citing, and all do not depart from technical scheme and the improvement thereof of the spirit and scope of the present invention, and it all should be encompassed in protection scope of the present invention.
Claims (9)
1. identify a micro-satellite primers group for Fugu rubripes (Temmincket Schlegel) parent child relationship, it is characterized in that, described primer is for the genomic different linkage group of Fugu rubripes (Temmincket Schlegel); Described primer is selected from the 3-10 couple in following primer pair:
2. micro-satellite primers group according to claim 1, is characterized in that, described primer sets is made up of following primer pair:
3. identify a test kit for Fugu rubripes (Temmincket Schlegel) parent child relationship, it is characterized in that, comprise the micro-satellite primers group of the qualification Fugu rubripes (Temmincket Schlegel) parent child relationship according to any one of claim 1 to 2.
4. identify that the molecule marking method of Fugu rubripes (Temmincket Schlegel) parent child relationship is characterized in that adopting following steps for one kind: (1) selects following 44 to carry out PCR reaction to special micro-satellite primers;
(2) gather the fin ray of different family parent and offspring individual, extract genomic dna;
(3) be template with the genomic dna of step (2), 44 pairs of micro-satellite primers selected by step (1) carry out pcr amplification;
(4) detect through 8% native polyacrylamide gel electrophoresis the PCR primer amplified production of step (3), after cma staining, colour developing, gel is in the imaging of HPscanjetG4010 scanner;
(5) by the electrophoresis detection result digitized processing of PCR, analyze with genetic analysis software;
(6) obtain the elimination factor of each microsatellite marker, add up the accumulation elimination factor of 3-10 mark; Utilize the marker combination of first 5 of elimination factor to use, complete the parenthood determination of family progeny and parent;
(7) utilize the parent child relationship of parent and filial generation, just Different Red fin dongfang globe fish family plot can be separated.
5. method according to claim 4, is characterized in that, in step (3), when carrying out pcr amplification, it is 25 μ L that PCR reacts cumulative volume, comprising: 10 × Buffer2.5 μ L, the Mg of 25mmol/L
2+the masterplate DNA1 μ L of each 1 μ L, the 50ng/ μ L of forward and reverse primer of the dNTPs1 μ L of 1 μ L, each 2mmol/L, 10 μm of ol/L, Taq DNA polymerase 1U, adds appropriate ddH
2o.
6. method according to claim 4, is characterized in that, in step (3), PCR response procedures is: 94 DEG C of denaturation 3min, 94 DEG C of sex change 30s, and the 30s--72 DEG C of extension 30s that anneal carries out 30 circulations, and last 72 DEG C extend 10min.
7. method according to claim 4, is characterized in that, in step (5), the genetic analysis software of use is Gel-ProAnalyzer4.5 gel analysis software and CERVUSVersion3.0.
8. method according to claim 4, is characterized in that, in step (6), carries out digitized processing with genetic analysis software to electrophoretic band, calculates the elimination factor of each microsatellite marker; According to elimination factor height, select the microsatellite marker of first 10 of sequence, the accumulation elimination factor scope of 3-10 microsatellite marker is 95.79%-99.99%; 5 elimination factors preceding microsatellite marker that sorts is utilized to complete the parenthood determination of family parent and filial generation.
9. method according to claim 4, is characterized in that, in step (6), microsatellite marker title and the sequence information of first 5 of elimination factor are as follows:
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410033662.9A CN103866004B (en) | 2014-01-24 | 2014-01-24 | A kind of identify Fugu rubripes (Temmincket Schlegel) parent child relationship molecule marking method and micro-satellite and test kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410033662.9A CN103866004B (en) | 2014-01-24 | 2014-01-24 | A kind of identify Fugu rubripes (Temmincket Schlegel) parent child relationship molecule marking method and micro-satellite and test kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103866004A CN103866004A (en) | 2014-06-18 |
| CN103866004B true CN103866004B (en) | 2016-03-02 |
Family
ID=50905008
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410033662.9A Expired - Fee Related CN103866004B (en) | 2014-01-24 | 2014-01-24 | A kind of identify Fugu rubripes (Temmincket Schlegel) parent child relationship molecule marking method and micro-satellite and test kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103866004B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834517B (en) * | 2017-03-23 | 2020-07-17 | 辽宁省海洋水产科学研究院 | SSR (simple sequence repeat) labeled primer group for parent-child identification of parva and application of SSR labeled primer group |
| CN109852703B (en) * | 2019-04-02 | 2022-02-11 | 南京师范大学 | SNP molecular marker related to fugu obscurus fullness and application thereof |
| CN111057771B (en) * | 2020-01-14 | 2021-10-19 | 南京师范大学 | SNP molecular marker for distinguishing 'Zhongyang No. 1' from common fugu obscurus and application thereof |
| CN112322758B (en) * | 2020-12-09 | 2022-03-01 | 中国水产科学研究院黄海水产研究所 | Microsatellite marker primer related to low temperature resistance of takifugu rubripes and application thereof |
| CN113005203A (en) * | 2021-03-27 | 2021-06-22 | 中国水产科学研究院珠江水产研究所 | Microsatellite marking method for identifying paternity of scleropages formosus |
| CN114438220B (en) * | 2022-01-05 | 2023-12-01 | 中国水产科学研究院长江水产研究所 | Method for evaluating release of erythroculter |
-
2014
- 2014-01-24 CN CN201410033662.9A patent/CN103866004B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| 5个红鳍东方鲀养殖群体微卫星DNA遗传多态性分析;陆丽君 等;《渔业科学进展》;20130831;第34卷(第4期);第30页 * |
| 红鳍东方鲀F1代混养群体的基因型鉴定及QTL分析;刘秀云 等;《水产科学》;20081231;第27卷(第12期);643页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103866004A (en) | 2014-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103866004B (en) | A kind of identify Fugu rubripes (Temmincket Schlegel) parent child relationship molecule marking method and micro-satellite and test kit | |
| CN103757113B (en) | Microsatellite fluorescent multiple PCR (Polymerase Chain Reaction) method used in paternity testing of grass carps | |
| CN102134593B (en) | Gender-specific microsatellite marker for Cynoglossus semilaevis and application of same in identification of superfemale Cynoglossus semilaevis | |
| CN103416333B (en) | A kind of construction method of the Environment of Litopenaeus vannamei Low basic population based on hereditary information and merit | |
| Vij et al. | Barcoding of Asian seabass across its geographic range provides evidence for its bifurcation into two distinct species | |
| Johansson et al. | Influence of habitat discontinuity, geographical distance, and oceanography on fine‐scale population genetic structure of copper rockfish (Sebastes caurinus) | |
| CN103387980A (en) | Microsatellite loci of portunus trituberculatus and primer | |
| CN104561355B (en) | Multiplex-PCR method for parentage assignment of scapharca broughtonii | |
| CN109055580B (en) | Molecular marker related to growth in C-type scavenger receptor of litopenaeus vannamei and application | |
| CN105603098A (en) | Microsatellite marker primers used for penaeus monodon microsatellite family identification, identification method and application | |
| CN111304337B (en) | SRAP molecular marker, kit and method for identifying pelteobagrus fulvidraco, pelteobagrus vachelli and filial generation and application | |
| CN105002267A (en) | Penaeus japonicus molecule marking method and application | |
| Insani et al. | Comparing genetic Mystacoleucus marginatus and Mystacoleucus padangensis (Cypriniformes: Cyprinidae) based on Cythochrome C Oxidase sub unit I (COI) gene | |
| CN104694660B (en) | The method of egg-shaped pompano family paternity test | |
| CN102382878B (en) | Molecular marking method for discriminating different family of Cyprinus carpiovar jian | |
| CN110331217A (en) | A kind of microsatellite marker paternity identification primer, method and application suitable for bolti, Oreochromis aureus and its cenospecies | |
| CN114480666B (en) | Method for distinguishing black sea bream and two filial generations thereof by using ISSR molecular markers | |
| CN114717302A (en) | Molecular marker, kit and method for distinguishing genders of triangular breams | |
| CN111394478B (en) | PCR (polymerase chain reaction) microsatellite primer and method for paternity test of large yellow croaker by using same | |
| CN102758022B (en) | Internal transcribed spacer (ITS2) molecular marker identifying method for aquaculture of catfish hybrids | |
| CN105779614A (en) | Sinkiang Alaska grayling heritable variation detection method utilizing microsatellite marker Thymalag | |
| CN108841930B (en) | Paramisgurnus dabryanus microsatellite family identification method and application thereof | |
| CN107287323B (en) | Molecular breeding method of new species cynoglossus semilaevis | |
| CN106811509A (en) | With the molecular labeling SVmc2 of hasked millet color gene close linkage | |
| CN104818341B (en) | A kind of saladifish microsatellite marker Epinmoss detection primer and method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160302 Termination date: 20180124 |