CN104694660B - The method of egg-shaped pompano family paternity test - Google Patents

The method of egg-shaped pompano family paternity test Download PDF

Info

Publication number
CN104694660B
CN104694660B CN201510128615.7A CN201510128615A CN104694660B CN 104694660 B CN104694660 B CN 104694660B CN 201510128615 A CN201510128615 A CN 201510128615A CN 104694660 B CN104694660 B CN 104694660B
Authority
CN
China
Prior art keywords
egg
parent
shaped pompano
family
primers
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201510128615.7A
Other languages
Chinese (zh)
Other versions
CN104694660A (en
Inventor
骆剑
陈国华
张国庆
吴光灿
王珺
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hainan University
Original Assignee
Hainan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hainan University filed Critical Hainan University
Priority to CN201510128615.7A priority Critical patent/CN104694660B/en
Publication of CN104694660A publication Critical patent/CN104694660A/en
Application granted granted Critical
Publication of CN104694660B publication Critical patent/CN104694660B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6848Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of method of egg-shaped pompano family paternity test, for the example that mixed family is prepared using multi-parent strain, 11 pairs of micro-satellite primers that genetic diversity is high, amplification efficiency is stable are filtered out.With reference to Capillary Electrophoresis order-checking and software analysis, the purpose of detection egg-shaped pompano family individuality parent child relationship is reached.By the method for the present invention, egg-shaped pompano paternity test accuracy rate can reach more than 90%.

Description

The method of egg-shaped pompano family paternity test
Technical field
The present invention relates to fish breeding and molecular marking technique field, and in particular to one kind is using microsatellite molecular marker mirror Determine the method that egg-shaped pompano raises together with family progeny parent.
Background technology
Egg-shaped pompano is subordinate to Perciformes (Perciformes), Scad sections (Carangidae), silvery pomfret Scad subfamilies (Trachinotinae), silvery pomfret Scad category (Trachinotus), is commonly called as golden silvery pomfret, yellow cured silvery pomfret etc., is a kind of warm water fishes at the middle and upper levels, It is distributed widely in the torrid zone, subtropical seas, with fast growth, meat tenderness is delicious, the features such as being of high nutritive value, as me The coastal pond in state south and the Important Economic kind of cage culture.
In the last few years, egg-shaped pompano market demand significantly rose, and had become the most large of southern marine fish Species, more than 200,000 tons of current China's gold silvery pomfret marketable fish annual production, just there are 500 tons of ice only Zhanjiang fish trade market daily Fresh egg-shaped pompano trading volume.So big market is also very huge to the demand of egg-shaped pompano seed.Egg-shaped pompano is Water warm seawater fish, egg-shaped pompano is concentrated mainly on the ground such as Hainan, Guangdong, Fujian by temperature conditions culturing area.And Hainan is located in subtropical zone, torrid areas, and ocean temperature is of a relatively high, the hatching and nursery of suitable egg-shaped pompano.At present, three provinces and regions All egg-shaped pompanos cultivate seed both from Hainan Region.Due to the phenomenon of egg-shaped pompano generally existing inbreeding, cause Seed germplasm is degenerated, slow-growing, is increasingly highlighted the problems such as disease breaks out.The man of wild origin that traditional seed breeding industry is used is domestic Pattern is faced with huge challenge, for egg-shaped pompano carry out fine-variety breeding become for aquaculture researcher it is extremely urgent appoint Business.
Family selective breeding is the important foundation means of fish breeding, is to be substantially better than its parent according to certain or a few proterties Category, production performance are significantly higher than being mixed with different types of primitive horde for its relatives and select some defect individuals and reserve seed for planting, and set up several Individual or several familys simultaneously raise up seed, and by generation compared with initial population and check variety, selecting and remain, those meet original selection The excellent system of index, and then carry out strain performance measurement.In fish breeding, family selective breeding is particularly important, nearly all to educate The step for being required to by family selective breeding into species.The foundation of current Technique in Fishes family is generally handed over 1 (hero) using 1 (female) With production filial generation.The family negligible amounts that such mode is set up, and it is affected by environment larger individually to manage each family, it is right Families selecting is unfavorable;And individual physical markings are carried out to mixed family, it is extremely difficult in the case of more family.It is right at present The judgement for breeding maturity and male and female sex in egg-shaped pompano is relatively difficult, also and does not apply to the mode of production of 1 pair 1.Therefore it is right In the foundation of egg-shaped pompano family and the identification of family be always insoluble problem, the avette silvery pomfret for largely hindering Scad breeding works.
Microsatellite DNA (Microsatellites DNA) is a kind of moderate being distributed widely in eukaryotic gene group Repetitive sequence.Microsatellite marker is widely used in population genetic variations point with its rich polymorphism, the advantage of codominant inheritance The fields such as analysis, character analysis, Germplasm Identification, Parentage determination, genetic mapping.The microsatellite hereditary information of parent can be by breeding Filial generation is passed to, micro-satellite labeling technique distinguishes individual affiliated family by detecting the individual microsatellite difference of different parent-offsprings.Mesh It is preceding there is not yet by microsatellite marker be used for egg-shaped pompano Parentage determination report.
The content of the invention
It is avette silvery pomfret it is an object of the invention to provide a kind of method that utilization microsatellite marker identifies egg-shaped pompano family Scad breedings provide the molecular labeling instrument of paternity test.
To achieve these goals, the technical scheme is that:A kind of side of egg-shaped pompano family paternity test is provided Method, the method comprises the following steps:
1) selection egg-shaped pompano build is larger, and individual 87 tail, as parent, parent's mixing is carried out the speed of growth faster Artificial propagation;10,000 tails are randomly selected when fry grows to 10 centimeters and is transferred to cage culture, as the family group for paternity test Body;
2) selecting step 1) egg-shaped pompano breed parent isozyme, extract genomic DNA, with DNA as template, choosing Nested PCR amplification is carried out with 51 pairs of micro-satellite primers;
3) step 2) described in nested PCR amplification method refer in PCR system comprising 3 primers:Locus specificity forward direction is drawn Thing, its 5 ' end adds M13 sequences (5 '-TGTAAAACGACGGCCAGT-3 ');Locus specificity reverse primer;FAM、PET、 The M13 universal primers of tetra- kinds of fluorescence labelings of VIC, NED;PCR reaction systems 20ul:50ng DNA, 2ul dNTP (2.5mM), 2ul10 × Buffer mixture, 1U rTaq, 0.4ul containing plus universal primer M13 forward primer (10mM), 0.5ul is anti- To primer, the fluorescence labeling universal primer of 0.1ul, ddH2O is supplied;
4) egg-shaped pompano parent in 51 PCR primers of microsatellite locus through ABI3730 type Genetic Analysers, according to fluorescence Mark carries out genotyping, using Genemapper3.7 software sunykatuib analyses, filters out and is adapted to identify that egg-shaped pompano raises together with house Effective microsatellite locus 11 of system:ZD13、ZD15、TBG008、ZD02、ZD03、ZD04、ZD11、ZD12、ZD01、ZD10、 TBG016;
5) 10,000 filial generations of egg-shaped pompano were raised together with into for 7 monthly ages, 2000 tails individuality is randomly selected, in every muscle of back of fish Implantation electronic marker and clip each individual isozyme, extract genes of individuals group DNA, selecting step 4) in 11 it is effectively micro- Satellite site, analyzes the genotype of filial generation;
6) different filial generations are entered using the softwares of PAPA 2.0 in 11 genotype of microsatellite locus according to parent and filial generation Row is distinguished, and identifies the Parent of offspring individual.
Wherein step 4) described in 11 couple effectively micro-satellite primers nucleotide sequence it is as follows.
The egg-shaped pompano paternity test micro-satellite primers of table 1
* four kinds of M13 primers of fluorescence labeling are respectively synthesized, are used cooperatively with egg-shaped pompano primer
The present invention has advantages below:
1. the present invention prepares mixed family by the way of parent fish population breeds, without artificial one-to-one pairing breeding.Can It is not easily distinguishable for male and female sex and the uppity egg-shaped pompano artificial propagation of maturity and family breeding structure, greatly solution Determine the problem of this type fish family fine-variety breeding.
2. in the present invention filial generation of mixed family since embryonated egg to this stage of marketable fish all under same environment Cultivation, can avoid the error caused by independent family breeding environment difference, improve the degree of accuracy of family selective breeding.
3. the present invention need not maintain huge isolation from nursery by the way of family is cultivated in mixing to half adult fish stage Breeding facility, greatlys save management and aquaculture cost.
4. the present invention uses nested PCR amplification method, from tetra- kinds of fluorescence labelings of FAM, PET, VIC, NED to universal primer M13 is marked, and using the end of microsatellite forward primer 5 ' plus the method for M13 sequences, during for identifying individual more, can be greatly saved The expense of primer fluorescence labeling.
Brief description of the drawings
The PCR amplifications of Fig. 1 primers TBG008;
The PCR amplifications of Fig. 2 primers ZD15;
Fig. 3 ZD02 sites allele goes out peak figure;
Fig. 4 ZD03 sites allele goes out peak figure;
Specific embodiment
1) egg-shaped pompano family breed and filial generation cultivation
87 tail defect individuals are selected from egg-shaped pompano natural population (Hainan Region) as parent, is planted in its muscle of back Enter electronic marker and measure each individual growth traits data.Every fritter fin ray of parent's clip one, is stored in 95% alcohol In, it is stored in -20 DEG C.Parent carries out artificial induced spawning by injecting the method for hormone, and 87 tail parent populations are injected, and injects the side of hormone Method:Disposable injection human chorionic gonadtropin (HCG), injection dosage:200IU/kg;Luteotropin releasing hormone d-ala analog (LHRH-A2), injection dosage:3ug/kg.87 tail parent population common property 10kg embryonated eggs, it is 4 mu to take 1.2kg embryonated eggs and be put into area Hatched in pond, after the cultivation of the tail of prelarva 1,120,000 being estimated after 1d 60 days, prelarva average length is 10 centimeters, randomly selects 10,000 Bar is transferred to 6m × 6m cage cultures.2200 tails are randomly selected from 10,000 when cultivating for 7 monthly age it is transferred to another 6m × 6m net cage and supports Grow and squeeze into electronic marker, Taking Pictures recording growth traits and clip each filial generation tail fin tissue are stored in 95% alcohol, are preserved In -20 DEG C.Parent and the individual genomic DNA of family are extracted using ammonium acetate method.
2) screening of PCR primer and amplification reaction system
Have chosen 51 egg-shaped pompano microsatellite locus enter performing PCR amplification, most site expanding effect it is not good or Difference is smaller in egg-shaped pompano colony, finally filters out that 11 pairs of genetic polymorphisms are high, and the primer of amplification efficiency stabilization is used for avette Silvery pomfret Scad paternity tests, 11 pairs of effective microsatellite marker amplimers and condition are as shown in table 1.PCR reaction systems are 20ul:10× PCR Buffer 2ul, dNTP mixture (2.5mM each) 2ul, TaKaRa Taq 0.2ul (5U/ul) (precious bioengineering Dalian Co., Ltd produces), the end of 10umol/L forward primers 5 ' adds M13 universal primers 0.4ul, 10umol/L reverse primer 0.5ul, 10umol/L M13 fluorescent primers 0.1ul.Amplified reaction is completed in ABI2720PCR systems, and PCR programs are:94℃ Predegeneration 5min;94 DEG C of denaturation 30s;Tm annealing 30s;72 DEG C of extension 30s, reaction carries out 32 circulations, 94 DEG C of denaturation 30s;53 DEG C annealing 30s;72 DEG C of extension 30s, reaction carries out 8 circulations;It is last to extend 10min at 72 DEG C.Wherein Tm values are different according to table 1 Primer annealing temperature sets.The amplification of Fig. 1, Fig. 2 exposition microsatellite locus.
3) microsatellite locus genotyping
After the completion of PCR reactions, posting to Beijing physico-chemical analysis center carries out machine testing, and detecting instrument used is ABI3730 Genetic Analysers.Genotyping is done with software Gene Mapper3.7, parent and filial generation microsatellite position are read respectively Point gene type.Fig. 3, Fig. 4 are the peak figure of moiety site.
4) effectively selection and egg-shaped pompano the paternity test analysis of microsatellite locus
Using step 4) method analyze 87 tail egg-shaped pompano parents and 2200 odd amount in addition to the round numbers generation in 51 pairs of bases of microsatellite locus Because of type, by the genotype of unknown parent's sex module simulation multiplication family filial generation in software PAPA 2.0 and parent genotype With relation, screen 11 microsatellite locus (ZD13, ZD15, TBG008, ZD02, ZD03, ZD04, ZD11, ZD12, ZD01, ZD10, TBG016) paternity test accuracy rate can reach 90.625% (table 2).
5) interpretation of result
96 tails are expanded in 11 microsatellite locus raise together with family progeny to 87 tail egg-shaped pompano parents and 2200 tails And Genotyping.The softwares of genotype application Gene Mapper 3.7 are analyzed, egg-shaped pompano paternity test application PAPA 2.0 The unknown parent's sex module of software is analyzed.To ensure the accuracy of experimental result, only guaranteed all microsatellite seats are complete The match is successful in portion, and meets the just confirmation parent child relationship of parent's mating system.It is final to confirm the father and mother that 87 tails raise together with filial generation, parent-offspring Identification rate is 90.625%.
The tail of 2 egg-shaped pompano of table 96 individuality paternity test information table
Above disclosed is only presently preferred embodiments of the present invention, can not limit the right of the present invention with this certainly Scope, therefore the equivalent variations made according to the claims in the present invention, still fall within the scope that the present invention is covered.

Claims (1)

1. a kind of method of egg-shaped pompano family paternity test, the method comprises the following steps:
1) selection egg-shaped pompano build is larger, and parent, as parent, is mixed into pedestrian's work to the speed of growth by individual 87 tail faster Breeding;10,000 tails are randomly selected when fry grows to 10 centimeters and is transferred to cage culture, as the family colony for paternity test;
2) selecting step 1) egg-shaped pompano breed parent isozyme, extract genomic DNA, with DNA as template, from 51 Nested PCR amplification is carried out to micro-satellite primers;
3) step 2) described in nested PCR amplification method refer in PCR system comprising 3 primers:Locus specificity forward primer, its 5 ' ends add the-TGTAAAACGACGGCCAGT-3 ' of M13 sequences 5 ';Locus specificity reverse primer;FAM, PET, VIC, NED tetra- Plant the M13 universal primers of fluorescence labeling;The μ L of PCR reaction systems 20:50ng DNA, 2 μ L dNTP, 2 10 × Buffer of μ L Mixture, 1U rTaq, 0.4 μ L containing plus universal primer M13 forward primer 10mM, 0.5 μ L reverse primers, 0.1 μ L's is glimmering Signal universal primer, ddH2O is supplied;
4) egg-shaped pompano parent in 51 PCR primers of microsatellite locus through ABI3730 type Genetic Analysers, according to fluorescence labeling Genotyping is carried out, using Genemapper3.7 software sunykatuib analyses, is filtered out and is adapted to identify that egg-shaped pompano raises together with family Effective microsatellite locus 11:ZD13、ZD15、TBG008、ZD02、ZD03、ZD04、ZD11、ZD12、ZD01、ZD10、 TBG016;Described 11 effective microsatellite locus are to be expanded to obtain by following primer sequence 5 ' -3 ':
ZD13-F:TGTAAAACGACGGCCAGTGGCTAGCTTTGCATTGTGTG;
ZD13-R:CAGCCCAGTCAGTCCCTACT;
ZD15-F:TGTAAAACGACGGCCAGTGACGTGTTCCACAGCAAGAA;
ZD15-R:AGGAATGGTCCCAAAGAATG;
TBG008-F:TGTAAAACGACGGCCAGTTCGCGACAAACTTTAACTCATCTC;
TBG008-R:AGCATTTTCACCTCCTCCATTG;
ZD02-F:TGTAAAACGACGGCCAGTTTTAGGACACCATCCCCTCA;
ZD02-R:GCTCCTGTGGAGGACAGAGA;
ZD03-F:TGTAAAACGACGGCCAGTATATCAGCGTCCACCCAAAC;
ZD03-R:CTTTTCCATCTCTCCCCTCA;
ZD04-F:TGTAAAACGACGGCCAGTGCTTGTGGAGACCATGACG;
ZD04-R:CTCCTGGAGGAACTGTGGAG;
ZD11-F:TGTAAAACGACGGCCAGTAGAGAGCAGGACGTCCAAAA;
ZD11-R:CTTTTCCATCTCTCCCCTCA;
ZD12-F:TGTAAAACGACGGCCAGTCCACCATCAATCAGCTGTCA;
ZD12-R:AGGTGCTCCACAGATGTTCC;
ZD01-F:TGTAAAACGACGGCCAGTTGCTTGAAAAATCAGGCAAG;
ZD01-R:TGCCAGGGAAAAGAGAGAGA;
ZD10-F:TGTAAAACGACGGCCAGTGGTCTGTAGAGAACCAGAACAGTC;
ZD10-R:GCTCCTGTGGAGGACAGAGA;
TBG016-F:TGTAAAACGACGGCCAGTTCTAGAAATACATCCTGGGTCACT;
TBG016-R:GAACCGGAGTCTGTAAACAAGAT;
5) 10,000 filial generations of egg-shaped pompano were raised together with into for 7 monthly ages, randomly selects 2000 tails individuality, in every muscle of back implantation of fish Electronic marker and clip each individual isozyme, extract genes of individuals group DNA, selecting step 4) in 11 effective microsatellites Site, analyzes the genotype of filial generation;
6) area is carried out to different filial generations using the softwares of PAPA 2.0 in 11 genotype of microsatellite locus according to parent and filial generation Point, identify the Parent of offspring individual.
CN201510128615.7A 2015-03-24 2015-03-24 The method of egg-shaped pompano family paternity test Active CN104694660B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510128615.7A CN104694660B (en) 2015-03-24 2015-03-24 The method of egg-shaped pompano family paternity test

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510128615.7A CN104694660B (en) 2015-03-24 2015-03-24 The method of egg-shaped pompano family paternity test

Publications (2)

Publication Number Publication Date
CN104694660A CN104694660A (en) 2015-06-10
CN104694660B true CN104694660B (en) 2017-06-09

Family

ID=53342208

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510128615.7A Active CN104694660B (en) 2015-03-24 2015-03-24 The method of egg-shaped pompano family paternity test

Country Status (1)

Country Link
CN (1) CN104694660B (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109457035B (en) * 2018-11-26 2020-09-18 中国水产科学研究院南海水产研究所 SSR fluorescence labeling primer for parent-child identification of trachinotus ovatus and application thereof
CN110150190B (en) * 2019-06-28 2021-10-26 海南晨海水产有限公司 Colony breeding method for egg-shaped pompano
CN110521637B (en) * 2019-08-26 2021-11-09 中国水产科学研究院南海水产研究所 Method for constructing full-sibling family of egg-shaped pompano
CN111088370B (en) * 2020-01-20 2022-06-21 中国水产科学研究院南海水产研究所 Sex-specific molecular marker primer for Trachinotus ovatus, identification method and application of sex-specific molecular marker primer
CN117051130B (en) * 2023-10-11 2023-12-22 中国水产科学研究院南海水产研究所 SNP molecular marker associated with streptococcus agalactiae resistance of trachinotus ovatus and application thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103131769A (en) * 2011-12-02 2013-06-05 汕头大学医学院 Molecular biological method of identifying trachinotus ovatus

Also Published As

Publication number Publication date
CN104694660A (en) 2015-06-10

Similar Documents

Publication Publication Date Title
CN104694660B (en) The method of egg-shaped pompano family paternity test
Jerry et al. Parentage determination of Kuruma shrimp Penaeus (Marsupenaeus) japonicus using microsatellite markers (Bate)
CN104357553B (en) A kind of Pelteobagrus fulvidraco microsatellite Parentage determination method
CN111088370B (en) Sex-specific molecular marker primer for Trachinotus ovatus, identification method and application of sex-specific molecular marker primer
CN102653785B (en) Identifying method of megalobrama amblycephala family by microsatellite
CN107502663A (en) A kind of channel catfish microsatellite Parentage determination method
CN106172129A (en) A kind of fish growth and the comprehensive selection-breeding of multiple anti-adversity and verification method
CN106818552B (en) Method for inducing artificial gynogenesis of siniperca chuatsi by heterologous sperms
CN103798169A (en) Method for quickly establishing improved breeding system of YY super-male pelteobagrus fulvidraco
CN106399530A (en) Spinibarbus dneticulatus microsatellite family identification method
CN105969882A (en) Haplotype SNP molecular marker associated with rapid growth of Ictalures punctatus and detection method and application thereof
CN109349222A (en) A kind of method that molecule auxiliary cultivates short-foot layer of green-shell egg strain
CN105918184B (en) A kind of method of selection cross all-male Pelteobagrus fulvidraco improved seeds
CN104351096A (en) Paramisgurnus dabryanus selective breeding method
CN110331217A (en) A kind of microsatellite marker paternity identification primer, method and application suitable for bolti, Oreochromis aureus and its cenospecies
CN105177143A (en) Method for identifying hippocampus kelloggi family by virtue of microsatelite
CN102487860B (en) Method for screening megalobrama amblycephala group combinations with hybrid vigor
Jerry et al. Application of DNA parentage analyses for determining relative growth rates of Penaeus japonicus families reared in commercial ponds
CN103966316B (en) A kind of diploid loach micro-satellite Parentage determination method and application thereof
CN110241225A (en) The SNP marker of species identification for river Puffer combines
CN109439771A (en) A method of hybridization porgy family is identified using microsatellite marker
CN110878363B (en) Detection method and application of correlation between VIPR1 gene and chicken testicular character
CN107354234A (en) A kind of primer pair of the method for being used to screen the high glycogen content parent shellfish of long oyster and its related SNP mark
CN113981103A (en) Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellites, detection kit and identification method
CN108841930B (en) Paramisgurnus dabryanus microsatellite family identification method and application thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant