CN104694645A - Functional mark S5-n-j-i of rice S5 gene and genetic typing method - Google Patents

Abstract

The invention discloses a functional mark S5-n-j-i of a rice S5 gene. The mark S5-n-j-i comprises six primers comprising S5-n-F, S5-n-R, S5-i-F, S5-j-R, S5-O-F and S5-O-R. The invention also discloses a genetic typing method of the functional mark S5-n-j-i of the rice S5 gene. The genetic typing method comprises the following steps: extracting rice genomic DNA; by taking the extracted genomic DNA as a template, building a PCR reaction system, and adding the primers to carry out PCR amplification; and carrying out polyacrylamide gel electrophoresis on the PCR amplification product and determining gene types. By virtue of the adoption of the ARMS-PCR technology and the multiplex PCR technology, the enzyme digestion of the PCR product is not required; a plurality of times of PCR amplification is not required; the sequencing is not required; the genetic typing method is simple and convenient to operate and low in cost, and has the effect of saving time.

Description

A kind of functional indicia S5-n-j-i of paddy rice S5 gene and methods of genotyping

Technical field

The invention belongs to plant biotechnology field, be specifically related to a kind of functional indicia of paddy rice S5 gene, the invention still further relates to a kind of method of functional indicia's gene type of paddy rice S5 gene.

Background technology

Research shows, be positioned at the key gene that the chromosomal hybrid dysgenesis locus S5 of paddy rice No. 6 is the fertility of regulation and control subspecies indica and japonica hybrid, this gene encoding production is aspartyl protease.S5 gene has triallelic system, is indica type S5 respectively ⁱ, round-grained rice type S5 ^jwith Wide compability type S5 ⁿthree kinds of allelotypes.Long-grained nonglutinous rice and the l-asparagine proteolytic enzyme coded by japonica rice cause the abortion of first familiar generation blastular because the difference of a SNP causes the amino acid whose difference (phenylalanine/leucines of 273) of encoding.The S5 albumen of Wide compability rice varieties, owing to having lacked N end signal peptide, causes afunction, and hybridizing with long-grained nonglutinous rice or japonica rice does not affect hybrid fertile.

S5 is introduced in indica and japonica subspecies paddy rice cross breeding parent ⁿallelotrope, can break reproduction isolation, effectively overcome indica and japonica subspecies hybrid dysgenesis, there is sizable using value.But research also shows, S5 generally ⁿ/ S5 ⁱor S5 ⁿ/ S5 ^jthese two kinds of heterozygous genotypes fertility are relatively than S5 ⁱs5 ⁱor S5 ^js5 ^jtwo kinds of genotype of isozygotying are low, are therefore tested and appraised, design and make hybrid strain contain identical S5 ⁱor S5 ^jallelotrope is good selection in breeding.

At present, according to wide compatibility gene S 5 between indica and japonica subspecies ⁿthere is the feature of 136bp fragment deletion at the 6th karyomit(e), reported InDel and marked S5136 and mark S5-t1, the limitation of this type of mark is only can to S5 ⁿmonoallelic carries out somatotype, and cannot to Xian round-grained rice allelotrope S5 ⁱor S5 ^jcarry out somatotype.Also report is had by amplification Xian, the section that there are differences between round-grained rice sequence carry out enzyme in conjunction with celery endonuclease CELI to it and cut qualification, but because this mark employs special endonuclease CEL I, be difficult to widespread use, this mark also only can distinguish S5 simultaneously ⁱor S5 ^jthese two kinds of allelotrope.Therefore, develop effective, reliable, the Rapid identification that new functional indicia realizes S5 allelotype, in indica-japonica heterosis, germplasm identification, breeding population screening, there is important value.

Summary of the invention

The object of this invention is to provide a kind of functional indicia S5-n-j-i of paddy rice S5 gene, utilize this mark, increase 2 variant sites in a PCR system simultaneously, distinguishes differentiation 3 kinds of genotype, improve detection efficiency.

The present invention also provides the methods of genotyping of a kind of functional indicia S5-n-j-i of paddy rice S5 gene.

First technical scheme of the present invention is, a kind of functional indicia S5-n-j-i of paddy rice S5 gene, described mark S5-n-j-i is made up of 6 primers S5-n-F, S5-n-R, S5-i-F, S5-j-R, S5-O-F and S5-O-R, wherein, the nucleotide sequence of S5-n-F is as shown in SEQ ID No.1, be specially: 5 ,-TATGACCAGCACCATCTTCG-3 '; The nucleotide sequence of S5-n-R, as shown in SEQ ID No.2, is specially: 5 '-GAGGGACACTCCAACTCGTC-3 '; The nucleotide sequence of S5-i-F, as shown in SEQ ID No.3, is specially: 5 '-CCCTGATATTCTGAGTTACAAGGCA ctC-3 '; The nucleotide sequence of S5-j-R, as shown in SEQ ID No.4, is specially: 5 '-GGTCTCGTCAGTGGGCAAGCAGTAG ttT-3 '; The nucleotide sequence of S5-O-F, as shown in SEQID No.5, is specially: 5 '-GCAAGATGGTGACAGACACGCT-3 '; The nucleotide sequence of S5-O-R, as shown in SEQ ID No.6, is specially: 5 '-CAGTGAGTAGGTTGGCCTGTTGATT-3 '; Base with underscore in above-mentioned primer sequence is the base mismatch introduced.

Second technical scheme of the present invention is, the methods of genotyping of a kind of functional indicia S5-n-j-i of paddy rice S5 gene, utilizes above-mentioned functional indicia S5-n-j-i, specifically implement according to following steps:

The extraction of step 1, oryza sativa genomic dna;

Step 2, utilize the genomic dna extracted in step 1 to be template, build PCR reaction system, add above-mentioned primer and carry out pcr amplification;

Step 3, pcr amplification carried out polyacrylamide gel electrophoresis detection and carries out genotype judgement.

Feature of the present invention is also,

In step 1, the extraction of oryza sativa genomic dna is specifically implemented according to following steps:

(1) get proper amount of fresh blade to be placed on and to add liquid nitrogen in 2mL centrifuge tube and smash to pieces, in centrifuge tube, add 1mL CTAB extract, shake up;

(2) be placed in water-bath or the thermostat container of 65 DEG C, shake gently once every 10min, take out after 30-45min;

(3) after cooling 2min, add chloroform-isoamyl alcohol (24: 1) to full packages, acutely shake up and down, make both mix;

(4) centrifuge tube takes out after putting into the centrifugal 10min of whizzer 15,000r/min;

(5) careful Aspirate supernatant is in new sterile centrifugation tube, then adds the Virahol of 600 μ L precoolings, shakes gently up and down, Virahol is fully mixed with water layer;

Place 20min, DNA is fully precipitated for (6)-20 DEG C;

(7) 10,000r/min moments are centrifugal, outwell liquid immediately, then stood upside down by centrifuge tube on the paper handkerchief spread out;

(8) upright centrifuge tube after 1min, adds ethanol and the 80 μ L 3M NaAc solution of 720 μ L 70%, shakes gently, flick tip with finger, DNA is precipitated and swims in liquid;

(9) at least place 30min, impurity is fully dissolved;

(10) 10,000r/min moments are centrifugal, outwell liquid immediately, add the ethanol of 800 μ L 70% by DNA rinsing 20-30min again;

The centrifugal 3-5min of (11) 15,000r/min, outwells liquid immediately, is stood upside down by centrifuge tube on the paper handkerchief spread out;

(12) upright centrifuge tube after several minutes, ventilating kitchen inner drying DNA;

(13) add 100 μ L 1 × TE Buffer, DNA is fully dissolved;

(14)-20 DEG C of preservations, for subsequent use are placed in.

In step 2, specific PCR reaction system is as follows: the template DNA of 1 μ L, each 0.3 μ L of 4 primers of 10 μm/L, and 7.5 μ L 2 × Power Taq PCR Master Mix, all the other supply 15 μ L by two steaming aqua sterilisa ddH2O.

PCR response procedures in step 2 is: 94 DEG C of denaturation 5min; 35 circulations, each circulation is: 94 DEG C of 40sec, 57 DEG C of 40sec, 72 DEG C of 30sec; 72 DEG C extend 10min again.

In step 3, pcr amplification is carried out polyacrylamide gel electrophoresis detection and carries out genotype judging to be specially: by amplified production through 8.0% native polyacrylamide gel electrophoresis, pass through 0.1%AgNO ₃dyeing, utilizes BIORAD gel imaging system to observe, take pictures and read tape; Genotype is judged:

If amplified production is 363bp, 305bp and 154bp totally 3 fragments, show tags idiotype is S5 ⁱs5 ⁱgenotype, be general rice variety, electrophoretic band is three bands;

If amplified production is 363bp, 305bp and 206bp totally 3 fragments, show tags idiotype is S5 ^js5 ^jgenotype, be general japonica rice variety, electrophoretic band is three bands;

If amplified production is 305bp, 227bp and 154bp totally 3 fragments; Show tags idiotype is S5 ⁿs5 ⁿgenotype, for. Wide compability rice varieties, electrophoretic band is three bands.

8.0% native polyacrylamide gel electrophoresis deposition condition is: electrophoretic buffer 1 × TBE, voltage 110V, time 2.5h.

The invention has the beneficial effects as follows: functional indicia S5-n-j-i of the present invention, utilize ARMS-PCR technology, can specific detection SNP site, associating double PCR technology can increase 2 functional variants sites simultaneously, therefore only need to carry out a pcr amplification and electrophoresis, gene type can be carried out to 3 kinds of allelotrope in different rice material S5 sites, and can be used as a kind of molecule marker application breeding cross, the segregating population that backcrosses identifies, improves molecular marker assisted selection breeding efficiency.The present invention is application ARMS-PCR technology and multiple PCR technique, does not need enzyme to cut PCR primer, does not need to carry out repeatedly pcr amplification, do not need order-checking, easy and simple to handle, to save time and cheap.

Accompanying drawing explanation

Fig. 1 be functional label S5-n-F of the present invention and S5-n-R primer in conjunction with target site design diagram, allelic variation site is respectively with gray background mark, and primer base mismatch identifies with underscore;

Fig. 2 be functional label S5-i-F, S5-j-R, S5-O-F and S5-O-R primer of the present invention in conjunction with target site design diagram, allelic variation site respectively with gray background mark, primer base mismatch identifies with underscore;

Fig. 3 be the present invention utilize functional indicia S5-n-j-i to identify S5n, S5i are for C, S5j genotype, wherein, M:DNA ladder; 1: long-grained nonglutinous rice " 9311 "; 2: japonica rice " Japan is fine "; 3: Wide compability paddy rice " C815S "; 4: long-grained nonglutinous rice " bright extensive 63 "; 5: japonica rice " IRAT106 "; 6: Wide compability paddy rice " 02428 ".

Embodiment

Below in conjunction with embodiment, the present invention is described in detail, and embodiment for ease of better understanding the present invention, but is not limitation of the present invention.Experimental technique in following implementation method is ordinary method, and involved experiment material is routine biochemistry reagent.

Thought of the present invention is: tetra-primer ARMS-PCR PCR (ARMS-PCR) can carry out special equipotential amplification for SNP site.For known variant sites, design 1 pair of outer primer and 1 pair of specificity inner primer respectively in both sides, Auele Specific Primer 3 ' terminal bases must drop on the position of catastrophe point, thus optionally increase saltant type and wild-type genes of individuals.Multiplex PCR (multiplex PCR), also known as Multiplex PCR or composite PCR, it is in same PCR reaction system, add that two to above primer, amplifies the pcr amplification of multiple nucleic acid fragment simultaneously.The present invention is based on the principle of ARMS-PCR, devise the S5 of one group of primer specific amplification S5 gene ⁱor S5 ^jtwo kinds of allelic SNP site, apply double PCR technology simultaneously, and co-design InDel marks specific amplified S5 ⁿ136bp fragment deletion in the sequence.Utilize this mark, increase 2 variant sites in a PCR system simultaneously, distinguishes differentiation 3 kinds of genotype, improve detection efficiency.

The foundation of the functional label method of embodiment 1 paddy rice S5 gene

1. design of primers

Respectively at Wide compability rice varieties 02428, rice variety 9311 and japonica rice variety Japan fine S5 gene, amplification order-checking is carried out to paddy rice S5 gene, obtain nucleotide sequence.To S5 ⁿ, S5 ⁱand S5 ^jthree kinds of allelotrope carry out gene comparision, to make a variation (S5 at the InDel of 136bp (42bp+94bp) the individual base of first exon and 5 ' upstream noncoding region for three ⁿfor disappearance, S5 ⁱ, S5 ^jfor not lacking), the C/A of the 1234th base makes a variation (S5 ⁿ, S5 ⁱfor C, S5 ^jfor A), design S5 gene function mark S5-n-j-i, described mark S5-n-j-i is made up of 6 primers S5-n-F, S5-n-R, S5-i-F, S5-j-R, S5-O-F and S5-O-R, primer sequence (5 '-3 ') as follows:

S5-n-F(SEQ ID No.1)：TATGACCAGCACCATCTTCG；

S5-n-R(SEQ ID No.2)：GAGGGACACTCCAACTCGTC；

S5-i-F(SEQ ID No.3)：CCCTGATATTCTGAGTTACAAGGCA CTC；

S5-j-R(SEQ ID No.4)：GGTCTCGTCAGTGGGCAAGCAGTAG TTT；

S5-O-F(SEQ ID No.5)：GCAAGATGGTGACAGACACGCT；

S5-O-R(SEQ ID No.6)：CAGTGAGTAGGTTGGCCTGTTGATT；

(base with underscore in primer sequence is the base mismatch introduced).

2. amplified fragments analysis

S5 ⁿs5 ⁿtype amplifies 3 bar segment by primer S5-n-F, S5-n-R, S5-i-F and S5-O-R, is 305bp (SEQ ID No.7), 227bp (SEQ ID No.8) and 154bp (SEQ ID No.9) respectively; S5 ⁱs5 ⁱtype amplifies 3 bar segment by primer S5-n-F, S5-n-R, S5-i-F and S5-O-R, and dividing is separately 363bp (SEQ ID No.10), 305bp (SEQ ID No.7) and 154bp (SEQ ID No.9); S5 ^js5 ^jtype amplifies 3 bar segment by primer S5-n-F, S5-n-R, S5-i-R, S5-O-F, and dividing is separately 363bp (SEQ ID No.9), 305bp (SEQ ID No.7) and 206bp (SEQ ID No.11).

Embodiment 2 utilizes S5-n-j-i labeled analysis 6 rice varieties S5 genotype

1. the extraction of oryza sativa genomic dna

Test materials comprises 6 rice varieties, is long-grained nonglutinous rice " 9311 "-numbering 1, " bright extensive 63 "-numbering 4 respectively; Japonica rice " Japan is fine "-numbering 2, " IRAT106 "-numbering 5; Wide compability paddy rice " 02428 "-numbering 3, " C815S "-numbering 6.Choose paddy rice individual plant tender leaf, adopt CTAB method to extract oryza sativa genomic dna, concrete steps are as follows: (1) is got proper amount of fresh blade and is placed on and adds liquid nitrogen in 2mL centrifuge tube and smash to pieces, adds 1mL CTAB extract, shake up in centrifuge tube; (2) be placed in water-bath or the thermostat container of 65 DEG C, shake gently once every 10min, take out after 30-45min; (3) after cooling 2min, add chloroform-isoamyl alcohol (24: 1) to full packages, acutely shake up and down, make both mix; (4) centrifuge tube takes out after putting into the centrifugal 10min of whizzer 15,000r/min; (5) careful Aspirate supernatant is in new sterile centrifugation tube, then adds the Virahol of 600 μ L precoolings, shakes gently up and down, Virahol is fully mixed with water layer; Place 20min, DNA is fully precipitated for (6)-20 DEG C; (7) 10,000r/min moments are centrifugal, outwell liquid immediately, then stood upside down by centrifuge tube on the paper handkerchief spread out; (8) upright centrifuge tube after 1min, adds ethanol and the 80 μ L 3M NaAc solution of 720 μ L 70%, shakes gently, flick tip with finger, DNA is precipitated and swims in liquid; (9) at least place 30min, impurity is fully dissolved; (10) 10,000r/min moments are centrifugal, outwell liquid immediately, add the ethanol of 800 μ L 70% by DNA rinsing 20-30min again; The centrifugal 3-5min of (11) 15,000r/min, outwells liquid immediately, is stood upside down by centrifuge tube on the paper handkerchief spread out; (12) upright centrifuge tube after several minutes, ventilating kitchen inner drying DNA; (13) add 100 μ L 1 × TE Buffer, DNA is fully dissolved; (14)-20 DEG C of preservations, for subsequent use are placed in.

2. functional indicia S5-n-j-i increases

Functional indicia S5-n-j-i is utilized to carry out pcr amplification, reaction system is 15 μ L, comprising: the template DNA of 1 μ L, each 0.3 μ L of 4 primers of 10 μm/L, 7.5 μ L 2 × Power Taq PCRMaster Mix, all the other are supplied by two steaming aqua sterilisa (ddH20).PCR response procedures: 94 DEG C of denaturation 5min, (94 DEG C of 40sec, 57 DEG C of 40sec, 72 DEG C of 30sec) 35 circulation, 72 DEG C extend 10min again.At Gene the enterprising performing PCR amplification of PCR System 9700 type PCR instrument (Applied Biosystems, USA).

3. the polyacrylamide gel electrophoresis of amplified production detects and genotype judgement

Amplified production, through 8.0% native polyacrylamide gel electrophoresis (electrophoretic buffer 1 × TBE, voltage 110V, time 2.5h), is dyeed by 0.1%AgN03, utilizes BIORAD gel imaging system to observe, take pictures and read tape.Genotype is judged:

Amplified production is 363bp, 305bp and 154bp totally 3 fragments, and show tags idiotype is S5 ⁱs5 ⁱgenotype, in Fig. 3, the 1st, 4 is detected sample;

Amplified production is 363bp, 305bp and 206bp totally 3 fragments, and show tags idiotype is S5 ^js5 ^jgenotype, the 2nd, 5 in Fig. 3 is detected sample;

Amplified production is 305bp, 227bp and 154bp totally 3 fragments; Show tags idiotype is S5 ⁿs5 ⁿgenotype, the 3rd, 6 in Fig. 3 is detected sample.

Said gene type sentence read result and material meet, and prove that the mark developed effectively can distinguish three kinds of genotype.

Claims (7)

1. the functional indicia S5-n-j-i of a paddy rice S5 gene, it is characterized in that, described mark S5-n-j-i is made up of 6 primers S5-n-F, S5-n-R, S5-i-F, S5-j-R, S5-O-F and S5-O-R, wherein, the nucleotide sequence of S5-n-F, as shown in SEQ ID No.1, is specially: 5 '-TATGACCAGCACCATCTTCG-3 the nucleotide sequence of S5-n-R, as shown in SEQ ID No.2, is specially: 5 '-GAGGGACACTCCAACTCGTC-3 the nucleotide sequence of S5-i-F, as shown in SEQ ID No.3, is specially: 5 '-CCCTGATATTCTGAGTTACAAGGCA ctC-3 the nucleotide sequence of S5-j-R, as shown in SEQ ID No.4, is specially: 5 '-GGTCTCGTCAGTGGGCAAGCAGTAGTTT-3 the nucleotide sequence of S5-O-F, as shown in SEQ ID No.5, is specially: 5 '-GCAAGATGGTGACAGACACGCT-3 the nucleotide sequence of S5-O-R, as shown in SEQ ID No.6, is specially: 5 '-CAGTGAGTAGGTTGGCCTGTTGATT-3 base with underscore in above-mentioned primer sequence is the base mismatch introduced.

2. a methods of genotyping of the functional indicia S5-n-j-i of paddy rice S5 gene, is characterized in that, utilizes the functional indicia S5-n-j-i described in claim 1, specifically implements according to following steps:

The extraction of step 1, oryza sativa genomic dna;

Step 2, utilize the genomic dna extracted in step 1 to be template, build PCR reaction system, add the primer described in claim 1 and carry out pcr amplification;

Step 3, pcr amplification carried out polyacrylamide gel electrophoresis detection and carries out genotype judgement.

3. the methods of genotyping of the functional indicia S5-n-j-i of paddy rice S5 gene according to claim 2, is characterized in that, in described step 1, the extraction of oryza sativa genomic dna is specifically implemented according to following steps:

(1) get proper amount of fresh blade to be placed on and to add liquid nitrogen in 2mL centrifuge tube and smash to pieces, in centrifuge tube, add 1mL CTAB extract, shake up;

(2) be placed in water-bath or the thermostat container of 65 DEG C, shake gently once every 10min, take out after 30-45min;

(3) after cooling 2min, add chloroform-isoamyl alcohol (24: 1) to full packages, acutely shake up and down, make both mix;

(4) centrifuge tube takes out after putting into the centrifugal 10min of whizzer 15,000r/min;

(5) careful Aspirate supernatant is in new sterile centrifugation tube, then adds the Virahol of 600 μ L precoolings, shakes gently up and down, Virahol is fully mixed with water layer;

Place 20min, DNA is fully precipitated for (6)-20 DEG C;

(7) 10,000r/min moments are centrifugal, outwell liquid immediately, then stood upside down by centrifuge tube on the paper handkerchief spread out;

(8) upright centrifuge tube after 1min, adds ethanol and the 80 μ L 3M NaAc solution of 720 μ L 70%, shakes gently, flick tip with finger, DNA is precipitated and swims in liquid;

(9) at least place 30min, impurity is fully dissolved;

(10) 10,000r/min moments are centrifugal, outwell liquid immediately, add the ethanol of 800 μ L 70% by DNA rinsing 20-30min again;

The centrifugal 3-5min of (11) 15,000r/min, outwells liquid immediately, is stood upside down by centrifuge tube on the paper handkerchief spread out;

(12) upright centrifuge tube after several minutes, ventilating kitchen inner drying DNA;

(13) add 100 μ L 1 × TE Buffer, DNA is fully dissolved;

(14)-20 DEG C of preservations, for subsequent use are placed in.

4. the methods of genotyping of the functional indicia S5-n-j-i of paddy rice S5 gene according to claim 2, it is characterized in that, in described step 2, specific PCR reaction system is as follows: the template DNA of 1 μ L, the each 0.3 μ L of 4 primers of 10 μm/L, 7.5 μ L 2 × Power Taq PCR Master Mix, all the other supply 15 μ L by two steaming aqua sterilisa ddH2O.

5. the methods of genotyping of the functional indicia S5-n-j-i of paddy rice S5 gene according to claim 4, is characterized in that, the PCR response procedures in described step 2 is: 94 DEG C of denaturation 5min; 35 circulations, each circulation is: 94 DEG C of 40sec, 57 DEG C of 40sec, 72 DEG C of 30sec; 72 DEG C extend 10min again.

6. the methods of genotyping of the functional indicia S5-n-j-i of paddy rice S5 gene according to claim 5, it is characterized in that, in described step 3, pcr amplification is carried out polyacrylamide gel electrophoresis detection and carries out genotype judging to be specially: by amplified production through 8.0% native polyacrylamide gel electrophoresis, pass through 0.1%AgNO ₃dyeing, utilizes BIORAD gel imaging system to observe, take pictures and read tape; Genotype is judged:

If amplified production is 363bp, 305bp and 154bp totally 3 fragments, show tags idiotype is S5 ⁱs5 ⁱgenotype, be general rice variety, electrophoretic band is three bands;

If amplified production is 363bp, 305bp and 206bp totally 3 fragments, show tags idiotype is S5 ^js5 ^jgenotype, be general japonica rice variety, electrophoretic band is three bands;

If amplified production is 305bp, 227bp and 154bp totally 3 fragments; Show tags idiotype is S5 ⁿs5 ⁿgenotype, for. Wide compability rice varieties, electrophoretic band is three bands.

7. the method for functional indicia's gene type of paddy rice S5 gene according to claim 6, is characterized in that, described 8.0% native polyacrylamide gel electrophoresis deposition condition is: electrophoretic buffer 1 × TBE, voltage 110V, time 2.5h.