CN109576389A - A kind of molecular labeling, identification method and application for identifying rice Tolerant to low P gene Pup1 - Google Patents
A kind of molecular labeling, identification method and application for identifying rice Tolerant to low P gene Pup1 Download PDFInfo
- Publication number
- CN109576389A CN109576389A CN201811579279.8A CN201811579279A CN109576389A CN 109576389 A CN109576389 A CN 109576389A CN 201811579279 A CN201811579279 A CN 201811579279A CN 109576389 A CN109576389 A CN 109576389A
- Authority
- CN
- China
- Prior art keywords
- pup1
- low
- gene
- rice
- tolerant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to genetic engineerings and genetic breeding field, more particularly to a kind of molecular labeling for identifying rice Tolerant to low P gene Pup1, identification method and application, the molecular labeling is Pup1-M1, the Pup1-M1 is primer pair, including downstream primer Pup1-M1-R shown in nucleotide sequence the upstream primer Pup1-M1-F as shown in sequence table SEQ ID NO.1 and sequence table SEQ ID NO.2, the molecular labeling and Pup1 identification method based on the molecular labeling, it can be used for identifying different rice varieties with the presence or absence of Tolerant to low P gene Pup1, during rice Tolerant to low P marker assisted selection, not only operating method is simple, it expends low, and it is not influenced by environmental conditions, it can be easy, quickly, efficiently breeding is resistance to Low-phosphorous rice varieties substantially increase the Breeding Efficiency of rice Tolerant to low P kind.
Description
Technical field
The present invention relates to genetic engineering and genetic breeding field, in particular to a kind of identification rice Tolerant to low P gene Pup1's
Molecular labeling, identification method and application.
Background technique
Rice is one of most important cereal crops in China, but pursues high fertilizer and water condition simply in long-term breeding practice
Under high yield, the problem of ignoring plant recovery of nutrient, cause to need in production largely to apply fertilizer.
Phosphorus is one of plant normal growth development institute's essential nutrient element, since phosphatic chemical characteristic consolidates it easily
Surely become the stationary state phosphorus that is difficult to be utilized of crop, cause available phosphorus content in soil very low, thus need in agricultural production according to
Demand of the crop to phosphorus is maintained by applying a large amount of phosphate fertilizer.Increasing the p application rate not only results in a large amount of wasting of resources, Er Qiehui
Bring a series of environmental problem.
Currently, the agricultural production in China be faced with from traditional extensive production mode to " it is environmentally friendly, it is resource-effective
The transformation of type " production method.It widelys popularize few investment, the Agriculture Production Modes that fecund goes out, not only contributes to increase farmers' income,
It more can protect environment, ensure the sustainable development of agricultural.Therefore, excavate the potentiality that utilize of rice itself phosphorus efficiency, breeding and
Tolerant to low P kind is planted, by improving phosphate fertilizer utilization efficiency, Phosphorus fertilizer usage is reduced and exactly realizes the most effective approach of this target
One of.
It is existing studies have shown that the heredity of rice Tolerant to low P belongs to complicated quantitative character, by controlled by multiple genes, and with
The close interaction of environment.So far, have identified clone of multiple rice Tolerant to low P genes to come, wherein Pup1 comes from Bangladesh
Rice.But in current molecular mark, the report for carrying out molecular breeding using Pup1 gene is still less, does not have more
There is the report in terms of the molecular labeling of based on PCR technology detection Pup1 gene, affects the gene in rice Tolerant to low P molecule mark
Remember the popularization and application in breeding process.
Summary of the invention
In order to overcome the above-mentioned deficiencies of the prior art, the invention proposes points of identification rice Tolerant to low P gene Pup1 a kind of
Son label, identification method and application, can easy, fast and efficiently breeding Tolerant to low P rice varieties, substantially increase rice
The Breeding Efficiency of Tolerant to low P kind.
To achieve the goals above, the technical scheme adopted by the invention is that:
The present invention provides a kind of molecular labeling for identifying rice Tolerant to low P gene Pup1, the molecular labeling is Pup1-
M1, the Pup1-M1 are primer pair, including nucleotide sequence upstream primer Pup1- as shown in sequence table SEQ ID NO.1
Downstream primer Pup1-M1-R shown in M1-F and sequence table SEQ ID NO.2.
Preferably, the acquisition methods of the molecular labeling of identification rice Tolerant to low P gene Pup1, comprising the following steps:
The nucleotide sequence for downloading Pup1 gene from Genbank by accession number AB458444, utilizes online design of primers
Software Primer1 carries out molecular labeling design, obtains molecular labeling described in claim 1.
The present invention also provides a kind of method using above-mentioned molecular markers for identification rice Tolerant to low P gene Pup1, this method
The following steps are included:
S1, the genomic DNA for extracting rice varieties to be measured；
S2, using the genomic DNA obtained in S1 step as template, using Pup1-M1-F and Pup1-M1-R as upstream and downstream primer
Carry out PCR amplification；
S3, the PCR product obtained in S2 step is separated by electrophoresis by 2% Ago-Gel, through bromination, ingot contaminates
Gel is placed in gel imaging system after color and is imaged；
S4, result judgement: observation S3 step in electrophoretic image, if the segment of 238bp size can be amplified, show by
Tolerant to low P gene Pup1 is carried in detection rice varieties；If no amplified fragments occur, show to be detected scarce in rice varieties
Weary Tolerant to low P gene Pup1.
Preferably, the genomic DNA of the rice varieties is extracted using CTAB method.
It is furthermore preferred that the CTAB extraction method of the rice varieties genomic DNA, comprising the following steps:
Z1, it is fitted into the centrifuge tube of 2mL after shredding 0.5g fresh paddy rice blade, and is put into a steel in centrifuge tube
Then pearl is charged with 600 μ L CTAB extracting solutions, cover pipe lid and be placed on proof press and vibrated with the speed of 23~26r/s
1min；
During which Z2,65 DEG C of water-bath 30min are mixed 1 time every 10min concussion；
Z3, centrifuge tube is opened, 600 μ L chloroforms are added and sufficiently shaken up, is centrifuged after standing 5min with the revolving speed of 12000rpm
8min；
Z4, from 400 μ L supernatants are drawn in the 2mL centrifuge tube of Z3 step into preprepared 1.5mL centrifuge tube, so
The dehydrated alcohol of 1mL -20 DEG C of process pre-coolings in advance is added in 1.5mL centrifuge tube afterwards, shakes up to be placed in -20 DEG C of refrigerators and stands
20min is finally centrifuged 10min with the revolving speed of 12000rpm；
Z5, the liquid in the 1.5mL centrifuge tube of Z4 step is outwelled, it is past after the white flock precipitate in centrifuge tube air-dries
200 μ L ddH are wherein added2O, jiggling makes precipitating dissolution obtain the genomic DNA of rice varieties, is finally placed in -20 DEG C of guarantors
It deposits spare.
Preferably, the reaction system of the PCR amplification are as follows: 2 μ L of 10xPCR reaction buffer, concentration are the Pup1- of 5pM
M1-F primer and each 0.5 μ L, 25ng/ μ L DNA profiling of 1 μ L, 10mM dNTP, 2 μ L, 5U/ μ L TaqDNA of Pup1-M1-R primer
0.5 μ L of polymerase, adds ddH2O complements to 20 μ L.
Preferably, the response procedures of the PCR amplification are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 30s, 55 DEG C are annealed
30s, 72 DEG C of extension 45s, 35 circulations；72 DEG C re-extend 10min, 4 DEG C of cooling 10min.
Preferably, the voltage of the electrophoretic separation is 120~130V, and electrophoresis time is 30~40min.
The present invention also provides a kind of application of above-mentioned molecular labeling in rice Tolerant to low P molecular mark.
The present invention also provides a kind of methods using above-mentioned molecular markers for identification rice Tolerant to low P gene Pup1 in rice
Application in Tolerant to low P molecular mark.
Compared with prior art, the beneficial effects of the present invention are:
The present invention passes through the Carriage of multiple Rice Variety Analysis Tolerant to low P gene Pup1 being sequenced, finds not every
A kind includes Pup1 gene, on this basis, a kind of point of based on PCR technology is devised for the characteristic of Pup1 gene
Sub- label-Pup1-M1, and the Pup1 identification method based on the molecular labeling is established, which can be used for identifying not
It whether there is Tolerant to low P gene Pup1 with rice varieties, be applied to during rice Tolerant to low P marker assisted selection, not only operate
Method is simple, and consuming is low, and is not influenced by environmental conditions, can rice that is easy, fast and efficiently selecting Tolerant to low P
Kind substantially increases the Breeding Efficiency of rice Tolerant to low P kind；Meanwhile Tolerant to low P gene Pup1 is also promoted in rice molecular
Application in terms of breeding, is worthy to be popularized.
Detailed description of the invention
Fig. 1 is position of the molecular labeling Pup1-M1 in gene Pup1 sequence in the embodiment of the present invention；
Fig. 2 is 23 electrophoretograms for trying rice material genomic DNA in the embodiment of the present invention.
Note: in Fig. 1, the letter with underscore indicates the design position of Pup1-M1；In Fig. 2, swimming lane 1-23 distinguishes table
Show: Kasalath, middle morning 35, Hunan morning Xian 45, Zhejiang 733, river agriculture morning B, gold 23B, IR58025B, Zhenshan 97B, five rich B, the rich B in day,
93-11, Huang Huazhan, five mountains silk seedling, nine fragrant viscous, another name for Sichuan Province is extensive 498, Cheng Hui 727, it is bright extensive 63, dual anti-it is bright account for, China accounts for, more light, imperial round-grained rice
31, Shennong-265 and OryzasativaLcv.Nipponbare.
Specific embodiment
Specific embodiments of the present invention will be further explained below.It should be noted that for these implementations
The explanation of mode is used to help understand the present invention, but and does not constitute a limitation of the invention.In addition, the experiment in following embodiments
Method is unless otherwise specified conventional method, the materials, reagents and the like used in the following examples, unless otherwise specified,
Commercially obtain.
Embodiment:
The present invention provides a kind of molecular labeling for identifying rice Tolerant to low P gene Pup1, the molecular labeling is Pup1-
M1, the Pup1-M1 are primer pair, including nucleotide sequence upstream primer Pup1- as shown in sequence table SEQ ID NO.1
Downstream primer Pup1-M1-R shown in M1-F and sequence table SEQ ID NO.2, see Table 1 for details for sequence information.
The molecular labeling specifically obtains in accordance with the following methods:
The nucleotide sequence for downloading Pup1 gene from Genbank by accession number AB458444 using ncbi database, should
Nucleotide sequence carries out molecular labeling using online primer-design software Primer1 and sets as shown in sequence table SEQ ID NO.3
Meter, obtains molecular labeling-Pup1-M1 described in claim 1, position of the Pup1-M1 in Pup1 sequence is as shown in Figure 1, band
The letter of underscore indicates the design position of Pup1-M1.
Resistance to less salt cultivar identification is carried out to for examination rice material with above-mentioned molecular labeling, selects 23 different rice altogether
Kind be used as try rice material, be respectively: Kasalath, middle morning 35, Hunan morning Xian 45, Zhejiang 733, river agriculture morning B, gold 23B,
IR58025B, Zhenshan 97B, five rich B, the rich B, 93-11 in day, Huang Huazhan, five mountains silk seedling, nine fragrant viscous, another name for Sichuan Province is extensive 498, Cheng Hui 727, bright
Extensive 63, it is dual anti-it is bright account for, China accounts for, more light, imperial round-grained rice 31, Shennong-265 and OryzasativaLcv.Nipponbare；It is known that kind Kasalath (Gamuyao
R,Chin J H,Pariasca-Tanaka J,et al.The protein kinase Pstol1from traditional
rice confers tolerance of phosphorus deficiency[J].Nature,2012,488(7412):535-
539；Chin J H,Gamuyao R L,Dalid C,et al.Developing rice with high yield under
phosphorus deficiency:Pup1sequence to application[J].Plant physiology,2011,
156:1202-1216.) and (Du H, Yu Y, Ma Y, the et al.Sequencing and de novo assembly of another name for Sichuan Province extensive 498
of a near complete indica rice genome[J].Nature communications,2017,8:15324.)
In contain homozygous or heterozygous Tolerant to low P gene Pup1, in OryzasativaLcv.Nipponbare without containing Tolerant to low P gene Pup1 (Gamuyao R,
Chin J H,Pariasca-Tanaka J,et al.The protein kinase Pstol1from traditional
rice confers tolerance of phosphorus deficiency[J].Nature,2012,488(7412):535-
539.) the case where Tolerant to low P gene Pup1, is carried in remaining rice varieties is unknown.Specific authentication step is as follows:
S1, above-mentioned 23 genomic DNAs for trying rice material, specific extraction process packet are extracted respectively using CTAB method
Include following steps:
Z1, it is fitted into the centrifuge tube of 2mL after shredding 0.5g fresh paddy rice blade, and is put into a steel in centrifuge tube
Then pearl is charged with 600 μ L CTAB extracting solutions, cover pipe lid and be placed on proof press and vibrated with the speed of 23r/s
1min；
During which Z2,65 DEG C of water-bath 30min are mixed 1 time every 10min concussion；
Z3, centrifuge tube is opened, 600 μ L chloroforms are added and sufficiently shaken up, is centrifuged after standing 5min with the revolving speed of 12000rpm
8min；
Z4, from 400 μ L supernatants are drawn in the 2mL centrifuge tube of Z3 step into preprepared 1.5mL centrifuge tube, so
The dehydrated alcohol of 1mL -20 DEG C of process pre-coolings in advance is added in 1.5mL centrifuge tube afterwards, shakes up to be placed in -20 DEG C of refrigerators and stands
20min is finally centrifuged 10min with the revolving speed of 12000rpm, at this moment will form white flock precipitate, i.e. DNA in centrifuge tube；
Z5, the liquid in the 1.5mL centrifuge tube of Z4 step is outwelled, it is past after the white flock precipitate in centrifuge tube air-dries
200 μ L ddH are wherein added2O, jiggling makes precipitating dissolution obtain the genomic DNA of rice varieties, is finally placed in -20 DEG C of guarantors
It deposits spare.
S2, respectively using the genomic DNA obtained in S1 step as template, using Pup1-M1-F and Pup1-M1-R as upstream and downstream
Primer carries out PCR amplification；
The reaction system of PCR amplification are as follows: 2 μ L of 10xPCR reaction buffer, concentration be 5pM Pup1-M1-F primer and
2 μ L, 5U/ μ L Taq DNA polymerase of each 0.5 μ L, 25ng/ μ L DNA profiling of 1 μ L, 10mM dNTP of Pup1-M1-R primer, 0.5 μ
L adds ddH2O complements to 20 μ L；
The response procedures of PCR amplification are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C extend
45s, 35 circulations；72 DEG C re-extend 10min, 4 DEG C of cooling 10min；
S3,30min is carried out to the PCR product obtained in S2 step with the constant voltage of 120V by 2% Ago-Gel
Electrophoretic separation, gel is placed in gel imaging system imaging of taking pictures after bromination ingot dyeing, and by the image of electrophoresis guarantor
It deposits spare；
S4, result judgement: (Fig. 2) is had found by the electrophoretic image in observation S3 step, kind Kasalath and another name for Sichuan Province extensive 498
The segment of 238bp size can be amplified, OryzasativaLcv.Nipponbare then occurs without amplified fragments, and amplification and Kasalath, another name for Sichuan Province is extensive 498, day
This fine actual conditions is consistent, it was demonstrated that accuracy of the molecular labeling Pup1-M1 in identification Tolerant to low P rice varieties application；Together
When, it is found by testing result, it is middle morning 35, Hunan morning Xian 45, Zhejiang 733, river agriculture morning B, gold 23B, IR58025B, Zhenshan 97B, five rich
B, the rich B, 93-11 in day, Huang Huazhan, five mountains silk seedling, nine fragrant viscous, Cheng Hui 727, it is bright extensive 63, dual anti-it is bright account for, China accounts for, more light, imperial round-grained rice 31
With in this 20 rice varieties of Shennong-265 in addition to agriculture morning B in river amplifies the segment of 238bp size, the equal nothing of remaining rice varieties
Amplified fragments occur, and show at these for trying in rice varieties in addition to kind Kasalath, river agriculture morning B and another name for Sichuan Province extensive 498, remaining water
Lack Tolerant to low P gene Pup1 in rice varieties, provides theoretical direction for the breeding of the resistance to less salt kind of rice, while confirming
Molecular labeling Pup1-M1 and Pup1 identification method based on the molecular labeling can be applied to rice Tolerant to low P molecule auxiliary and educate
During kind, can it is easy, fast and efficiently select the rice varieties of Tolerant to low P, and then greatly improve rice Tolerant to low P product
The Breeding Efficiency of kind.
The molecular labeling of 1 rice Tolerant to low P gene Pup1 of table
| Gene | Molecular labeling | Sequence (5 ' -3 ') |
| Pup1 | Pup1-M1-F | CGAAGCCAGTTTGTTATCCAC |
| Pup1 | Pup1-M1-R | CAGAAATGCCTGCTATCACATC |
Above the embodiments of the present invention are described in detail, it should be noted that relates in claims of the present invention
And when numberical range, it is thus understood that any one numerical value is optional between two endpoints and two endpoints of each numberical range
With since the step method of use is same as the previously described embodiments, repeating in order to prevent, the preferred implementation of description of the invention
Example, once a person skilled in the art knows basic creative concepts, then other change can be made to these embodiments
More and modify.So it includes preferred embodiment and all changes for falling into the scope of the invention that the following claims are intended to be interpreted as
More and modify.
It is obvious to those skilled in the art that in the case where not departing from the principle of the invention and spirit, to these
Embodiment carries out a variety of change, modification, replacement and modification, still falls in protection scope of the present invention.
Sequence table
<110>Jiangxi Academy of Agricultural Sciences
<120>a kind of molecular labeling, identification method and application for identifying rice Tolerant to low P gene Pup1
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 1
cgaagccagt ttgttatcca c 21
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 2
cagaaatgcc tgctatcaca tc 22
<210> 3
<211> 2975
<212> DNA
<213>rice Tolerant to low P gene (Pup1)
<400> 3
gcagcttcct tgtaattaaa gaaagagatt aaggataagg caatcaatct tatcccatgt 60
acataggtat ccggattata agggataccg tacaatatcc aatcgttcgg cctggctcta 120
tataaagggc atcggaggaa acccaagggg cttagacttt caaccatact ccacttacgc 180
cccatcggat attctactgc tgatttttgg ccgatctttg atttctattg ggccctactg 240
ataaacagta attttggata tatgggtcaa aatatcagcg aaattgcaat cctttaggat 300
catccgtcga cttttagggc ttaataaaaa cttcctttac tttaaaaaaa caaatcacgt 360
actccatcca tcaaaaagaa aactagaact ccacgcgaca tattctagta taccgaattt 420
ggacagagat atatccaaat tcattgtgct atttggtttt ttaggatgga gggagtatat 480
atactaactc tattacctga cttgcttctc aatggccaga tgcatggaca tggaaaggtc 540
gcttatcgcg gaagaagagg ataacgatat gtaagttttt acatttcttc ttccacgcac 600
cgtcgttcgt gttttttttt tctttctatt gtgtgcgaaa agtgaatgta acaagtagtg 660
actggcccgt acgttcaaat ttgagaaatg taaaacacaa cagaaacaac tctgatttta 720
tacgccctgt ttttactcac aatgacttgt ttggcaaatc caaatcccca cctatcctca 780
gggatgggaa gccacttggc cttgccaaac gaagcctaga ggagcaaata atgttgcagt 840
atgcaaaaga tgccctccaa agtcctgatg gcagctggca tgtagtgatc aataaagaag 900
gctgaaactt gctagcccgg ttggttcgaa ctaatgaact aaactgagtc aagacaatgt 960
tggatgtaat tgacgggtaa taagaggaag atatatatag aagcaaacat atcctatata 1020
tgcatatgag tgttcacgtg tacactctac acatgccaac taacaaatat caacagaagt 1080
tatagaaaat aatggatatg tatttttaat agtattatat gtacttgtta cgtatcatct 1140
tcaaattcat catgtgtgga gagcaataaa aagacaaaat tctgataggc ttataacctt 1200
aaaattgttg gaatttctct tattttttag gcaaaaacct aatgaatttg aggttaagac 1260
tttacgcata catatgtaat actatacata gtttttttct aatttttttc taaattggta 1320
agtatgaagt gtgcatgcga aacttttgtg cacatgacat atttacatat aaagagtaat 1380
catgaggcat aatacatcta tcaaatcgag aggtttgcac gttctggtca acactatgaa 1440
tataacgttg ggagaagaag agctcttatt ctcgaacagt cgtactccgc tgtatatgtc 1500
gtgattagtg atagatttat agccaatatt ttaatttgat gattttattg tgttgcatat 1560
atgatatata atttggatgt tattttctta acaatctagg tcaagctatg tcgcagaacc 1620
gagttaggca accacacttt tacttgttag cgagccaaaa gataaaatga tcaccgtttc 1680
ccaatgggtc taaagcgaac cgaagccagt ttgttatcca cggttactag cgtggtttcg 1740
tagcaaacta gcaatcttgc cttcatttga aaagtaaaag ttctttataa aggccttcct 1800
acttgagtgg aaaaaaagta gataaattag cagaaacagt tcttcaatat gatcgacatg 1860
ttaccgtaca tcattgactc atgtagatta tttttgtctc ctggtatttt tttccagatg 1920
tgatagcagg catttctggc tcatttgggt tattcatagt tctcatattc ttcatatggc 1980
acaagaaacg ttacggatta atgctgctct gtcaaagggc atcaaagaat gcaccaagga 2040
tagaatcttt cctacaaaag caagaaactt caaacccaaa aagatacact ctctctgaag 2100
tgaaaagaat gactaaatct tttgctcaca agcttggcag aggtggcttt ggtactgttt 2160
ataaaggtag cctgcctgat ggccgtgaga tagccgtcaa gatgctaaag gataccaagg 2220
gtgatgggga ggaattcata aatgaggttg ctggcattag taaaacttct catatcaatg 2280
ttgttaacct tctaggtttt tcccttcaag ggtcaaaaag agctctgatc tatgagtaca 2340
tgcccaatgg ttcacttgat agatattctt ttggcgatag ctctgtccaa ggagataaca 2400
ccctgagctg ggatagactg ttcaatatta ttgtcgggat tgctcgaggg ctggagtatc 2460
tccactgtca ttgcaacatt cgcattgtgc attttgatat caaacctcaa aacattctac 2520
tggctcaaga tttctgtcca aagatctctg attttggcct gtcaaaattg tgccatctaa 2580
aggagagcag aatttcgatc aacggactaa gaggaacacc tggctacatt gcacctgaag 2640
tgttttccag gcagtatgga tctgccagca gcaaatctga tgtctacagc tatggaatgg 2700
tggtccttga gatggctggt gcaaagaaaa acatcaacgt tagtacaggt agtagcagca 2760
aatattttcc ccaatggtta tacgataatt tggaccagtt ttgttgcccc acgggcgaga 2820
ttagtagcca gaccaccgat cttgtaagga agatggttgt cgttggtttg tggtgcatac 2880
aactcgtacc tacagatcga ccgtccatga gagaagtcct tgagatgttg gaaagcaacg 2940
gtagggactt accgttgcca ccaaaagggc tttga 2975
Claims (10)
1. a kind of molecular labeling for identifying rice Tolerant to low P gene Pup1, it is characterised in that: the molecular labeling is Pup1-M1,
The Pup1-M1 is primer pair, including nucleotide sequence upstream primer Pup1-M1-F as shown in sequence table SEQ ID NO.1
With downstream primer Pup1-M1-R shown in sequence table SEQ ID NO.2.
2. a kind of acquisition methods of molecular labeling for identifying rice Tolerant to low P gene Pup1 according to claim 1, special
Sign is: the following steps are included:
The nucleotide sequence for downloading Pup1 gene from Genbank by accession number AB458444, utilizes online primer-design software
Primer1 carries out molecular labeling design, obtains molecular labeling described in claim 1.
3. a kind of method using molecular markers for identification rice Tolerant to low P gene Pup1 described in claim 1, it is characterised in that:
The following steps are included:
S1, the genomic DNA for extracting rice varieties to be measured；
S2, using the genomic DNA obtained in S1 step as template, using Pup1-M1-F and Pup1-M1-R as upstream and downstream primer carry out
PCR amplification；
S3, the PCR product obtained in S2 step is separated by electrophoresis by 2% Ago-Gel, after bromination ingot dyeing
Gel is placed in gel imaging system and is imaged；
S4, result judgement: the electrophoretic image in observation S3 step shows to be detected if the segment of 238bp size can be amplified
Tolerant to low P gene Pup1 is carried in rice varieties；If no amplified fragments occur, show to lack in detected rice varieties resistance to
Low-phosphorous gene Pup1.
4. the method for molecular markers for identification rice Tolerant to low P gene Pup1 according to claim 3, it is characterised in that: described
The genomic DNA of rice varieties is extracted using CTAB method.
5. the method for molecular markers for identification rice Tolerant to low P gene Pup1 according to claim 4, it is characterised in that: described
The CTAB extraction method of rice varieties genomic DNA, comprising the following steps:
Z1, it is fitted into the centrifuge tube of 2mL after shredding 0.5g fresh paddy rice blade, and is put into a steel ball in centrifuge tube, so
After be charged with 600 μ L CTAB extracting solutions, cover pipe lid and be placed on proof press and 1min is vibrated with the speed of 23~26r/s；
During which Z2,65 DEG C of water-bath 30min are mixed 1 time every 10min concussion；
Z3, centrifuge tube is opened, 600 μ L chloroforms are added and sufficiently shaken up, 8min is centrifuged with the revolving speed of 12000rpm after standing 5min；
Z4, from drawing 400 μ L supernatants in the 2mL centrifuge tube of Z3 step into preprepared 1.5mL centrifuge tube, it is then past
The dehydrated alcohol of 1mL -20 DEG C of process pre-coolings in advance is added in 1.5mL centrifuge tube, shakes up to be placed in -20 DEG C of refrigerators and stands
20min is finally centrifuged 10min with the revolving speed of 12000rpm；
Z5, the liquid in the 1.5mL centrifuge tube of Z4 step is outwelled, after the white flock precipitate in centrifuge tube air-dries thereto
200 μ L ddH are added2O, jiggling makes precipitating dissolution obtain the genomic DNA of rice varieties, and it is standby to be finally placed in -20 DEG C of preservations
With.
6. the method for molecular markers for identification rice Tolerant to low P gene Pup1 according to claim 3, it is characterised in that: described
The reaction system of PCR amplification are as follows: 2 μ L of 10xPCR reaction buffer, concentration are that the Pup1-M1-F primer of 5pM and Pup1-M1-R draw
2 μ L, 5U/ μ L Taq DNA polymerase of each 0.5 μ L, 25ng/ μ L DNA profiling of 1 μ L, 10mM dNTP of object, 0.5 μ L, adds ddH2O is mended
Enough to 20 μ L.
7. the method for molecular markers for identification rice Tolerant to low P gene Pup1 according to claim 3, it is characterised in that: described
The response procedures of PCR amplification are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 45s are followed for 35 times
Ring；72 DEG C re-extend 10min, 4 DEG C of cooling 10min.
8. the method for molecular markers for identification rice Tolerant to low P gene Pup1 according to claim 3, it is characterised in that: described
The voltage of electrophoretic separation is 120~130V, and electrophoresis time is 30~40min.
9. a kind of molecular labeling for identifying rice Tolerant to low P gene Pup1 according to claim 1 is in rice Tolerant to low P molecule
Application in marker-assisted breeding.
10. the method for molecular markers for identification rice Tolerant to low P gene Pup1 according to claim 3 is in rice Tolerant to low P point
Application in sub- marker-assisted breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811579279.8A CN109576389A (en) | 2018-12-24 | 2018-12-24 | A kind of molecular labeling, identification method and application for identifying rice Tolerant to low P gene Pup1 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811579279.8A CN109576389A (en) | 2018-12-24 | 2018-12-24 | A kind of molecular labeling, identification method and application for identifying rice Tolerant to low P gene Pup1 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109576389A true CN109576389A (en) | 2019-04-05 |
Family
ID=65931463
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811579279.8A Pending CN109576389A (en) | 2018-12-24 | 2018-12-24 | A kind of molecular labeling, identification method and application for identifying rice Tolerant to low P gene Pup1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109576389A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104694645A (en) * | 2015-03-04 | 2015-06-10 | 郭涛 | Functional mark S5-n-j-i of rice S5 gene and genetic typing method |
-
2018
- 2018-12-24 CN CN201811579279.8A patent/CN109576389A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104694645A (en) * | 2015-03-04 | 2015-06-10 | 郭涛 | Functional mark S5-n-j-i of rice S5 gene and genetic typing method |
Non-Patent Citations (1)
| Title |
|---|
| JOONG HYOUN CHIN等: "Developing rice with high yield under phosphorus deficiency: Pup1 sequence to application", 《PLANT PHYSIOLOGY》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108192990B (en) | SNP molecular marker related to watermelon peel background color and application thereof | |
| CN106868135B (en) | Primer and method for identifying soybean male sterile line | |
| CN109913573A (en) | The molecular labeling of the close linkage of wheat grains per spike main effect QTL and its application | |
| CN109385466A (en) | The KASP Functional marker of resistance gene of rice blast Pi2 a kind of and its application | |
| CN107190092A (en) | For identify cabbage bloom the morning and evening molecular labeling, primer pair and molecule labelling method and application | |
| CN109055395A (en) | A kind of photoperiod insensitiveness Hd1 allele and its molecular labeling and application | |
| CN110512025A (en) | A kind of molecular labeling and its application with powdery mildew resistance gene in wheat PmJM23 close linkage | |
| CN104672315B (en) | Control gene and to Cucumber Roll palpus character related SNP marker of the cucumber without tendril character | |
| CN106521021B (en) | Gene marker for identifying haplotype of rice grain width and grain weight GS5 gene and application | |
| CN108396031B (en) | Gene for regulating and controlling height of cotton plant on land and application thereof | |
| CN102690812B (en) | Molecular marker SIsv0067 closely linked with millet Heading date gene | |
| CN108998563A (en) | The primer of accurate identification grape pomace color and its application | |
| CN109609678A (en) | A kind of molecular labeling and application for predicting collard internal lobe color | |
| CN109295247A (en) | Compact linkage molecule label yau403, primer and the application of the anti-clubroot CRd gene of Chinese cabbage | |
| CN105821153B (en) | The relevant molecular labeling of rape cracking resistance angle character main effect QTL and application | |
| CN107574171A (en) | A kind of corn salt resistance main effect QTL and its related gene, molecular labeling and application | |
| CN103773836A (en) | Method for rapid detection of transgenic rice line TT51-1 | |
| CN103333886A (en) | Functional marker for analyzing rice blast resistance gene by using DNA (Deoxyribose Nucleic Acid) melting temperature | |
| CN109576389A (en) | A kind of molecular labeling, identification method and application for identifying rice Tolerant to low P gene Pup1 | |
| CN102690817B (en) | With the closely linked molecular labeling SIsv0659 of millet pollen color gene | |
| CN109234412A (en) | The quickly method of the fast erythroculter ilishaeformis of the detection speed of growth and molecular labeling used | |
| CN102690818B (en) | Molecular marker SIsv0832 closely linked with millet Heading date gene | |
| CN111705157B (en) | PCR marker and primer for screening I-type S haplotypes of cabbage self-incompatible line | |
| CN105349677B (en) | Recover round-grained rice Rice Resistance black streak dwarf site and molecule labelling method | |
| CN111549172B (en) | Watermelon leaf posterior green gene linkage site and CAPS marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190405 |
|
| RJ01 | Rejection of invention patent application after publication |