CN101845441B - Composite porcine alpha-IFN gene and recombinant vector thereof - Google Patents
Composite porcine alpha-IFN gene and recombinant vector thereof Download PDFInfo
- Publication number
- CN101845441B CN101845441B CN2010101250576A CN201010125057A CN101845441B CN 101845441 B CN101845441 B CN 101845441B CN 2010101250576 A CN2010101250576 A CN 2010101250576A CN 201010125057 A CN201010125057 A CN 201010125057A CN 101845441 B CN101845441 B CN 101845441B
- Authority
- CN
- China
- Prior art keywords
- ifn
- ppicz
- mpoifn
- porcine alpha
- yeast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to a composite porcine alpha-IFN gene and a recombinant vector thereof, and belongs to the technical field of genetic engineering biological products. The newly designed gene sequences of composite porcine alpha-IFN are recombined to pPICZ alpha-A vectors, and the vectors are electronically transformed into yeast competent cells; and the positive identification, and the screening and the induced expression of high copy yeast strains are carried out. A pichia pastoris expression system is used for expressing foreign genes so as to be favorable for the commercial production of porcine IFN. Compared with the natural IFN which is expressed by yeast, the expression level of the protein which is expressed by genome increases by 3.17 times. The fluorescent quantitative PCR result shows that the level of PRVmRNA after PK-15 cells treated by 10-6mg/ml of the composite porcine alpha-IFN are re-infected with PRV is obviously lower than the level of PRVmRNA after the PK-15 cells which are not treated by the composite porcine alpha-IFN are infected with the PRV, and the level of PRVmRNA decreases by 37 times.
Description
One, technical field
The gene order of a kind of composite porcine alpha-IFN of the present invention and recombinant vectors thereof belong to the genetically engineered biological product technique field.Compare with natural porcine alpha-IFN, stronger antiviral activity is arranged, can be used for the anti-system and the early treatment of the various virus diseases of pig targetedly.
Two, background technology
Interferon, rabbit is one of most important cytokine of animal body, has wide spectrum, antiviral function efficiently, and immunity system is played crucial regulating effect.As far back as 1986, Lefevre etc. just once did to study in great detail to porcine alpha-IFN gene and porcine alpha-IFN.Obtained a fragment that contains alpha-IFN gene, sequential analysis shows that this segment has a successive to contain the open reading frame of 190 codons, have an appointment 5 ' zone of 100 Nucleotide of upstream from start codon, tool TATTTAA sequence (having confirmed that now the TATTTAA sequence is present in most porcine alpha-IFN genes), be considered to modified Hogness-Goldberg box, yet in the 499bp in terminator codon downstream, do not have AATAAA or ATTAAA class poly VITAMIN B4 site.70～80 amino acids of the ripe porcine alpha-IFN of this genes encoding have a potential N-glycosylation site.The code sequence of this gene and HuIFN-α 1 Nucleotide is shown 78.5% homology, and amino acids coding and HuIFN-α 1 have 64% homology, is the highest with people's homology in all known pig IFN-α genes.Usefulness HuIFN-α 1 such as Lefevre in 1986 make probe and isolate more than 10 porcine alpha-IFN gene and pseudogene from the pig gene pools, and measure the wherein gene order of 2 genes: PoIFN-α 1 and PoIFN-α 2.Calling sequence 5 ' CATATG 3 ' before first codon TGT of ripe porcine alpha-IFN encoding sequence such as nineteen ninety Lefevre, i.e. an initiator codon and a NdeI restriction enzyme site, thus gone out porcine alpha interferon protein at expression in escherichia coli.The gained porcine alpha-IFN is recombinant porcine alpha 1 a type Interferon, rabbit, and molecular weight is 17.5kDa, has identical N terminal amino acid sequence (disappearance Met) with natural porcine alpha-IFN.The antiviral activity of recombinant porcine alpha 1 type Interferon, rabbit is higher 6 times than natural leukocyte interferon of pig at least on the homologous pig cell.But what they used is combined expression vector, and expression amount is lower, is about 5%, and target protein exists with soluble form, and available affinity chromatography method is purifying in a small amount, is difficult to use in actual production.Nineteen ninety-five Moore BR points out that Interferon, rabbit has huge using value as a kind of broad-spectrum disease resistance toxic agent; Piasecki E is to pig natural interferon (Natural porcine interferons, PoIFNs) activity is studied, discovery in the Interferon, rabbit family of pig, the species specificity of porcine alpha-IFN a little less than, can on cells such as pig, ox, people and muroid, produce active.Ch in sangaram in 1999 etc. studies show that pig IFN-α can effectively suppress the vigor of foot and mouth disease virus, and calendar year 2001 Riffault etc. studies show that the piglet that infects TGEV, can produce the IFN-α of anti-TGEV in the gut epithelium tissue rapidly.Thank to the pig IFN-α gene that employing pcr clones such as petrel obtain and form 166 amino acid of encoding altogether by 501 Nucleotide; Domestic scholars Chen Taos in 2002 etc. successfully give expression to the recombinant interferon gene in pichia yeast expression system and escherichia expression system; expression product accounts for the ratio of bacterial protein between 20%～35%; expression product has antiviral activity, for the large-scale production of genetic engineering interferon and application provide may.Usefulness such as Moraes were expressed the recombinant adenovirus Ad5-IFN-α of pig IFN-α (comprising signal peptide) and were expressed FMDV (Foot-and-mouth disease virus in 2003; foot and mouth disease virus) A24P1 albumen and the proteic recombinant adenovirus of FMDV A12 3C (Ad5A24) carry out combined immunization to the pig body and make it obtain protection, resist attack and the achieving success of foot and mouth disease virus.The bright report that waits of domestic Qin Yao: leukocyte interferon of pig can obviously disturb the propagation of Porcine epidemic diarrhea virus in the ligation intestinal segment of sucking pig; Zheng Yong ripples in 2003 etc. are done clinical trial with leukocyte interferon of pig, and test-results shows if directly treat, and more can significantly improve the cure rate to infected animal; Zhang Quanjun in 2005 etc. find that with clinical expanding test leukocyte interferon of pig to the diarrhoea that sucking piglets and some viral diarrhea of weanling pig, bacterial diarrhea or virus, bacteria mixed infection cause, all has good preventing and treatment to use by experiment; The recombinant adenovirus rAd-poIFN-α of structures such as Du Yijun in 2006 has shown the activity of stronger anti-Schweineseuche virus in the supernatant of inoculation PK-15 cell at the expression product that obtains on the HEK-293A cell (containing pig IFN-α).
The nineties, U.S. Amgen works out the compound alpha Interferon, rabbit of a kind of brand-new people: Infergen.This Interferon alfacon-1 is a kind of non-natural Interferon, rabbit, and the acquisition of 166aa sequence is by the scanning to several natural alpha hypotype Interferon, rabbit sequences, and modal amino acid is transferred to each corresponding position.For ease of molecular configuration, 4 amino acid have also been changed in addition.The homology of Infergen sequence and alpha II type Interferon, rabbit is 88%, with the homology of beta Interferon, rabbit be 30%, and the more any natural alpha Interferon, rabbit of similarity wants high.Experimental results show that: the more natural Interferon, rabbit of the activity of the anti-multiple virus of Infergen is high 5 times, is that to obtain its antiviral activity be 1 * 10 to standard by WHO people source interferon anti-reflecting virus strategy
9U/mg.For further research Interferon, rabbit effect and expansion Interferon, rabbit are in the development and application of biological field, we have carried out the research work of pig new composite Interferon, rabbit:
Selecting the interferon-alpha hypotype of the stronger kind of wild-type and disease resistance when designing this Interferon, rabbit is template; The Interferon, rabbit aminoacid sequence of collecting is compared with softwares such as DANMAN or Lasergene DNAstar,, select the highest amino acid of the frequency of occurrences, splice an artificial Interferon, rabbit aminoacid sequence template with the amount of selecting admission principle.Lasergene DNAstar analyzes new Interferon, rabbit amino acid structure, with other expression or not the marking protein structure compare: structure is simple more to be helped expressing more; After having determined aminoacid sequence, transform the new forms of interferon gene order according to the inclined to one side preferendum of having a liking for codon partially, little or the codon frequency of occurrences is not really under the extreme case in preferendum difference partially, select GC content high have a liking for codon partially, the gene GC content of yeast expression is controlled at about 45%, near the genomic GC content of yeast itself.Determine after the good new gene order to have designed 14 primers altogether with Primer Premier 5.0 softwares according to its Design of length primer, according to amplification length routinely amplification condition react and increase.
Induce by inducer to produce pig IFN-α, because of the source less, many restrictions such as cost height, purifying process complexity cost an arm and a leg, and have limited clinical largely and application scientific research.Its product mainly exists with the active inclusion body form of lifeless matter in the prokaryotic expression system, must carry out loaded down with trivial details subsequent disposal work such as sex change, renaturation to inclusion body if will seek out the recombinant protein of biologically active, and the loss amount of recombinant protein is big and also very high to staff's state of the art requirement in the follow-up work of treatment, and this is unfavorable for suitability for industrialized production.Therefore, yeast expression system (J.L.Cereghino, J.M.Cregg, Heterologous protein expression in the methylotrophic yeast Pichia pastoris) is adopted in this test.It is simple that this expression system has a nutritional requirement, and growth is fast, and is easy to operate, is easy to cultivate, cost is low, and density height, fermentation technique are very ripe, advantages such as potentiality with scale operation gene engineering product, the foreign protein content in the fermented supernatant fluid is very low, easilier produces on a large scale.
Three, summary of the invention
Technical problem the objective of the invention is to the porcine alpha-IFN structure is transformed, develop a kind of production method and recombinant expression vector thereof of gene order of compound reorganization non-natural porcine alpha-IFN, reach high expression level, high stable, high secretion, highly active production, can be widely used in the anti-system and the early treatment of the various virus diseases of pig, and the overall immunity that strengthens swinery.
Technical scheme
A kind of composite porcine alpha-IFN gene, its sequence are SEQ ID NO.1, and size is 501bp;
The application of above-mentioned composite porcine alpha-IFN gene comprises:
(1) contains the structure and the evaluation of composite porcine alpha-IFN gene Yeast expression carrier
Design primer after the described composite porcine alpha-IFN gene SEQ of the claim 1 of synthetic ID NO.1 added EcoRI and two restriction enzyme sites of XbaI, the product of this porcine alpha-IFN gene of pcr amplification is with after pPICZ α-the A yeast vector is connected, enzyme is cut, T4 DNA Ligase connection is spent the night, connect product transformed competence colibacillus E.coli DH5 α and obtain recombinant expression vector, recombinant expression vector carries out double digestion again to be identified, enzyme is sure to down, and size then is accredited as positive carrier for the band of 501bp, what the right-on positive carrier of determined dna sequence was structure contains porcine alpha-IFN gene Yeast expression carrier, called after PpICZ α-MPoIFN α;
(2) preparation of yeast pichia spp X-33 competent cell
(3) contain composite porcine alpha-IFN gene Yeast expression carrier electricity and be transformed into yeast X-33 competent cell
Above-mentioned Yeast expression carrier PpICZ α-MPoIFN α 10 μ L that contain porcine alpha-IFN gene after the linearizing of SacI enzyme learn from else's experience, with the above-mentioned yeast pichia spp of 80 μ L X-33 competent cell mixing, the electricity of transferring to the 0.2cm of ice precooling then transforms in the cup, places 5min on ice; Electricity is transformed cup to be placed on the electroporation apparatus and to shock by electricity once with pulsed current, electric shock finishes, the 1mol sorbyl alcohol that adds the precooling of 1mL ice immediately, mixing, move in the Eppendof pipe of 1.5mL, place 28 ℃ of constant incubators, cultivate 1h, getting 250 μ L conversion products then is coated with on the YPDS substratum plate that contains 100 μ g/mLZeocin (bleomycin) resistances, put 28 ℃ of constant temperature culture 2-4 days, the recombination microzyme that contains PpICZ α-MPoIFN α that will grow on the YPDS substratum is dropped into capable positive identification;
(4) contain the positive identification of PpICZ α-MPoIFN α carrier restructuring yeast strains
(1) extracts the genomic dna that contains PpICZ α-MPoIFN α carrier restructuring yeast strains
(2) be used for the AOX1 primer of positive identification:
Upstream: 5 '-gactggttccaattgagaagc-3 ' downstream: 5 '-gcaaatggcattctgacatcc-3 '
(3) pcr amplification is identified: with the pastoris genomic dna is template, with the AOX1 primer is that Auele Specific Primer carries out pcr amplification, obtaining the amplified fragments total length is the band of 1089bp, then for containing the recombination yeast positive strain of PpICZ α-MPoIFN α carrier, called after X-33/PpICZ α-MPoIFN α;
(5) abduction delivering of X-33/PpICZ α-MPoIFN α
Picking two strain bacterial strains are connected to the BMGY liquid nutrient medium of 25mL respectively from the YPDS substratum plate that contains above-mentioned bacterial strains, are cultured to OD through 28 ℃ of shaking tables
600During=2-6, the centrifugal 5min results of room temperature 1500rpm/min thalline, the thalline of results is suspended in the triangular flask of 500mL with the BMMY nutrient solution of 100mL, place 28 ℃ of shaking tables to carry out abduction delivering, every 24h adds the methyl alcohol that final concentration is a volume ratio 1% in substratum, to keep the inductive continuous expression, the supernatant of X-33/PpICZ α-MPoIFN alpha expression that the centrifuging collection is cultivated when inducing 72h carries out purifying;
(6) purifying of X-33/PpICZ α-MPoIFN alpha expression product
The X-33/PpICZ α of the above-mentioned collection of ammonium sulfate precipitation-MPoIFN alpha expression supernatant with 45%, the centrifugal 30min of 12000rpm/min outwells supernatant, and the resuspended albumen precipitation of 0.9M ammonium sulfate is crossed drainage column (Phenyl Sepharose then
TM6FastFlow) desalination, the albumen after the desalination have promptly obtained the expressing protein of composite porcine alpha-IFN gene of the present invention again behind anion-exchange column (Q Sepharose Fast Flow) purifying;
Beneficial effect
The composite porcine alpha-IFN of the pichia genetic engineering bacterium production that the present invention adopts has been compared following advantage with the natural porcine alpha-IFN of traditional mode of production with the natural porcine alpha-IFN with escherichia coli expression:
The gene amplification of A expression porcine alpha-IFN maturation protein is simple and convenient: do not want the gene that template just can amplify expression porcine alpha-IFN maturation protein as long as design primer.
Composite porcine alpha-IFN method and program that B obtains biologically active are all simple: only need to collect a supernatant of expressing and dialyse and need not purifying after desalination, filtration sterilization are handled and can drop into clinical use;
C toxicological harmless material: yeast can not secreted and attach some to the virulent toxin of porcine somatic cell as the foreign protein of escherichia coli expression;
D purity height: the SDS-PAGE result of the porcine alpha-IFN of yeast expression shows that through thin layer scanning the purpose band of recombination yeast porcine alpha-IFN accounts for 80% of total expression protein content;
E broad-spectrum disease resistance toxic action: existing data at home and abroad shows that pig interferon all has good inhibitory effect to the virus of the various virus diseases of pig, especially early treatment and the prevention to some strong spreading venereal diseases toxicity diseases such as blue otopathy, foot and mouth disease has good effect, can contain the popular and outburst of the virus disease of various pig transmissibles to a great extent;
The F antivirus action is strong: this novel gene group expressed proteins is compared with the natural porcine alpha-IFN of yeast expression, and better antiviral activity is arranged, and it resists 100TCID on the PK-15 cell
50The effect of VSV virus infection has improved 44.4 times.
G has powerful immunoregulation effect: the successful example that clinical medicine is used for Interferon, rabbit SARS, hepatitis and treatment of various virus disease and prevention provides reliable foundation for treatment and the anti-system that composite porcine alpha-IFN is used for the various virus diseases of swinery.
The successful development of composite porcine alpha-IFN, and a series of advantage of suitability for industrialized production and the powerful antiviral function be convenient to that it had bring new situation will for the anti-system of China's pig virus disease.With the gene order of the newly-designed composite porcine alpha-IFN of the present invention pPICZ α-A carrier of recombinating, be incorporated into specific position on the yeast by electric transform mode then.And adopt the pichia yeast expression system expression alien gene, help pig interferon and commercially produce.The albumen of this genomic expression is compared with the natural interferon of yeast expression, and its expression amount has improved 3.17 times.Detect the antiviral activity of this composite porcine alpha-IFN with the PK-15-VSV system, improved 44.4 times than the natural porcine alpha-IFN of yeast expression.This Interferon alfacon-1 of 100U can suppress 100TCID fully on the PK-15 cell
50Vesicular stomatitis virus and the attack of Pseudorabies virus.
Four, description of drawings
Fig. 1: composite porcine alpha-IFN gene PCR product electrophoretic analysis
1, dna molecular amount standard; 2, pcr amplification purpose fragment
Fig. 2: the enzyme of PpICZ α-MPoIFN α positive colony carrier is cut evaluation
1, the empty plasmid enzyme is cut contrast; 2, the PpICZ α-MPoIFN α of EcoR I and XbaI enzyme cutting; 3, the 4500DNA molecular weight standard
Fig. 3: the PCR of recombination microzyme identifies
1, X-33/PpICZ α-MPoIFN α; 2, the not empty yeast X-33 contrast in the reorganization; 3, the 4500DNA molecular weight standard
Fig. 4: the composite porcine alpha-IFN SDS-PAGE of X-33/PpICZ α-MPoIFN alpha expression analyzes and westernblot identifies 1, Protein Marker; 2, X-33/pPICZa expresses supernatant; 3, the composite porcine alpha-IFN expression product; 4, composite porcine alpha-IFN westernblot result
Fig. 5: Interferon, rabbit suppresses the MTT result of PK-15 cell
1,2,3,4,5,6,7,8 is respectively that concentration is 0,0.156,0.313,0.625,1.25,2.5,5,10 Interferon, rabbit
Fig. 6: Interferon, rabbit suppresses the SYBR Green I real-time fluorescence quantitative PCR result that PRVmRNA expresses
1, the PRV contrast; 2, natural porcine alpha-IFN; 3, composite porcine alpha-IFN
The biomaterial preservation
Strain X-33/PpICZ α-MPoIFN α belonged to pichia pastoris phaff (Pichia pastoris), was preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, preserving number: CGMCC NO.3570 on 01 18th, 2010.
Five, embodiment
One, test materials
Escherichia coli DH5a, yeast X-33 and pPICZ α-A carrier are all available from the handsome company in Shanghai; Used chemical reagent and test kit are all available from Takara company; Phenyl Sepharose
TM6Fast Flow and Q Sepharose FastFlow are available from Shanghai GE company; PK-15 cell (porcine kidney cell), VSV (bubble type Stomatovirus), PRV (porcine pseudorabies virus) and the natural interferon-alpha of pig are public (Cao Ruibing etc., a kind of new pig alpha-interferon genes clone and at expression in escherichia coli, Journal of Agricultural Biotechnology JournalofA griculturalBiotechnology 2004,12 (3): 278 ~ 282).
Two, test design and production method
(1) recombinate the NEW TYPE OF COMPOSITE porcine alpha-IFN on the pichia spp gene order design and amplification
(A) search the gene order of porcine alpha-IFN on GenBank, selecting wild-type and 27 stronger porcine alpha-IFN hypotypes of disease resistance is template;
(B) 27 porcine alpha-IFNs will selecting compare by softwares such as DANMAN or Lasergene DNAstar, with the amount of selecting admission principle, splice an artificial Interferon, rabbit aminoacid sequence template, this amino acid sequence translation is become nucleotide sequence SEQ ID NO.1, according to the inclined to one side preferendum of codon, all use zymic inclined to one side preferendum codon (Zhao Xiang, Huo Jing, Li Yuyang instead; The codon usage analysis of pichia spp).Gene GC content is controlled at about 45%, near the genome GC of yeast content own (Graham Sinclair, Francis Y.M.Choy. Synonymous codon usagebias and the exp ression of human glucocerebro sidase in the methylotrophic
(C) the novel porcine alpha-IFN nucleotide sequence 522bp that will add restriction enzyme site and protectiveness base designs primer, with Primer Premier 5.0 design primers, designs 14 primers such as tables 1 altogether.
(D) the SOE method is carried out pcr amplification,
Reaction system:
5×Prime STAR Buffer 10.0μL；Prime STA 0.4μL；
50pmol/ μ L upstream primer 1.0 μ L; DNTP 4.0 μ L;
50pmol/ μ L downstream primer 1.0 μ L;
ddH
2O 33.6μL；
95 ℃ of 5min are set, 94 ℃ of 15s subsequently, 54 ℃ of 15s, 72 ℃ of 15s, totally 30 circulations, 72 ℃ of 10min after the end loop on the PCR instrument; The PCR product is carried out agarose gel electrophoresis identify the porcine alpha-IFN gene size that obtains.
With top system primer being increased in twos, reclaim the PCR product then, is that template is carried out following system amplification with the PCR product again:
5×Prime STAR Bufier 10.0μL；Prime STAR 0.4μL；
50pmol/ μ L upstream primer 0.25 μ L; DNTP 4.0 μ L;
50pmol/ μ L downstream primer 0.25 μ L; Template 1 2.0 μ L;
95 ℃ of 5min are set, 94 ℃ of 15s subsequently, 54 ℃ of 15s, 72 ℃ of 15s, totally 30 circulations, 72 ℃ of 10min after the end loop on the PCR instrument; The PCR product is carried out agarose gel electrophoresis identify the porcine alpha-IFN gene size that obtains.
The gene fragment size that amplifies the PCR product is at last seen Fig. 1 for 522bp;
Table 1
| Primer | 5’-3’ |
| SRpIFN-1 | GCGGAATTCATGTGTGATTTGCCACAAACTCATTCCTTGGCTCATACTAGAGCTTTGAG |
| ARpIFN-2 | CAGGAGAATGGAGAAATTCTTCTCATTTGAGCCAACAATCTCAAAGCTCTAGTATGAG |
| SRpIFN-3 | AAGAATTTCTCCATTCTCCTGTTTGGATCATAGAAGAGATTTCGGTTCTCCACATGAAG |
| ARpIFN-4 | CCATAGCTTGAGCCTTCTGAACTTGGTTACCACCCAAAGCTTCATGTGGAGAACCGAAA |
| SRpIFN-5 | TCAGAAGGCTCAAGCTATGGCTTTGGTTCATGAAATGTTGCAACAAACTTTCCAGTTGT |
| ARpIFN-6 | GATTCGTTCCAAGCAGCAGCAGAACCTTCAGTGGAGAACAACTGGAAAGTTTGTTGC |
| SRpIFN-7 | TGCTGCTGCTTGGAACGAATCTTTGTTGCATCAATTCTGTACTGGTTTGGATCAGCAGT |
| ARpIFN-8 | CCAGCTTCTTGCATAACACAAGCTTCCAAATCTCTCAACTGCTGATCCAAACCAGTA |
| SRpIFN-9 | TGTGTTATGCAAGAAGCTGGTTTGGAAGGTACTCCATTGTTGGAGGAGGATTCC |
| ARpIFN-10 | GTCAATCTATGGAAGTATCTCTTAACAGCCAAGATGGAATCCTCCTCCAACAAT |
| SRpIFN-11 | GATACTTCCATAGATTGACTTTGTACTTGCAAGAGAAGTCTTACTCTCCATGTGCTT |
| ARpIFN-12 | GAGGAGAAGGATCTCATAACTTCAGCTCTAACAATTTCCCAAGCACATGGAGAGTAAG |
| SRpIFN-13 | AGTTATGAGATCCTTCTCCTCTTCTACTAACTTGCAAGATAGATT |
| ARpIFN-14 | CCGTCTAGATTATTCCTTCTTTCTCAATCTATCTTGCAAGTTAGTA |
(2) contain the structure and the evaluation of composite porcine alpha-IFN gene Yeast expression carrier
The composite porcine alpha-IFN gene SEQ ID NO.1 of synthetic is added behind EcoRI and two restriction enzyme sites of XbaI the design primer with this porcine alpha-IFN gene of pcr amplification SEQ ID NO.1, amplified production and pPICZ α-A yeast vector carry out EcoRI and XbaI double digestion respectively, reclaim enzyme and cut product, T4 DNA Ligase connection is spent the night, connect product Transformed E .coli DH5 α competent cell and obtain recombinant expression vector, recombinant expression vector carries out the double digestion evaluation that enzyme is EcoR I and XbaI again, enzyme is sure to down, and size then is accredited as positive carrier for the band of 501bp, positive carrier is served extra large handsome company carry out determined dna sequence, sequencing meets SEQ ID NO.1 fully, what its positive carrier was structure contains porcine alpha-IFN gene Yeast expression carrier, called after PpICZ α-MPoIFN α; See Fig. 2;
(3) preparation of yeast competent cell
A single bacterium colony on the picking pichia spp X-33 bacterium flat board is transferred in 2mLYPD (Pichia Expression Kit) test tube, after 28 ℃ of 250rpm constant temperature shake the activation 12h that spends the night, the pichia spp X-33 bacterium liquid of getting after the activation of 500 μ L is transferred in the triangular flask of aseptic 5mLYPD substratum of containing of 50mL, bottleneck is tightened with three layers of sterile gauze, 28 ℃ of constant temperature shaking table 250rpm sway and cultivate about 20h, treat bacterium liquid OD
600During=1.3-1.5, the 4 ℃ of centrifugal 1min results of 2500rpm/min pichia spp X-33 thalline, thalline is iced pre-cold water washing twice with 1mL successively, 1mol sorbyl alcohol with the precooling of 1mL ice washs again, 4 ℃ of centrifugal 1min of 2500rpm/min ice the 1mol sorbyl alcohol suspension thalline of precooling, behind the Eppendof pipe of the 1.5mL that packing is different at last with 0.8mL, put 4 ℃ stand-by, be the yeast pichia spp X-33 competent cell of preparation;
(4) the expression vector electricity that contains X-33/PpICZ α-MPoIFN α is transformed into yeast
(1) learn from else's experience above-mentioned Yeast expression carrier 10 μ L that contain porcine alpha-IFN gene after the linearizing of SacI enzyme, with the above-mentioned yeast pichia spp of 80 μ L X-33 competent cell mixing, the electricity of transferring to the 0.2cm of ice precooling then transforms in the cup, places 5min on ice;
(2) electricity being transformed cup is placed on the electroporation apparatus and shocks by electricity once the electric shock condition with pulsed current: voltage 1500V, electric capacity 25uF, resistance 200 Ω, time 5ms;
(3) electric shock finishes, the 1mol sorbyl alcohol that adds the precooling of 1mL ice immediately, mixing, move in the Eppendof pipe of 1.5mL, place 28 ℃ of constant incubators, cultivate 1h, get 250 μ L conversion products then and be coated with on the YPDS substratum plate that contains 100 μ g/mLZeocin resistances, put 28 ℃ of constant temperature culture 2-4 days, the recombination microzyme that contains PpICZ α-MPoIFN α that will grow on the YPDS substratum is dropped into capable positive identification;
(5) contain the positive identification of X-33/PpICZ α-MPoIFN α carrier restructuring yeast strains
(1) extracts pastoris genomic dna: the recombination yeast bacterium colony that contains PpICZ α-MPoIFN α carrier of growing on the above-mentioned YPDS substratum is chosen to the YPDS liquid nutrient medium that contains 100 μ g/mLZeocin, 28 ℃ of shaking tables are cultivated 36h-48h, extract pastoris genomic dna then from this bacterium liquid: the bacterium liquid of getting 1mL is put into the Eppendof pipe, the centrifugal 1min of 12000rpm/min, abandon supernatant, with the resuspended thalline of the aqua sterilisa of 1mL, repeat twice, the aqua sterilisa that adds 100 μ L then, 100 ℃ were boiled 10 minutes, cleared up the yeast cell wall, put into liquid nitrogen then and froze 30 minutes, 100 ℃ were boiled 10 minutes, 12000rpm/min centrifuging and taking supernatant liquor is pastoris genomic dna, is that template is carried out PCR positive identification (Linder with it, S., Schliwa, M., Kube-Granderath, E., 1996.Direct PCR screening of P.pastoris clones.BioTechniques);
(2) be used for the AOX1 primer of positive identification:
Upstream: 5 '-gactggttccaattgagaagc-3 ' downstream: 5 '-gcaaatggcattctgacatcc-3 '
(3) pcr amplification is identified
With the pastoris genomic dna is template, is that Auele Specific Primer carries out pcr amplification with the AOX1 primer, and the pcr amplification system is:
10×PCR Buffer： 5.0μL；10mM dNTPs： 1.0μL；
20pmol/ μ L 5 ' AOX1 primer: 0.5 μ L; Genomic dna template: 5.0 μ L;
20pmol/ μ L 3 ' AOX1 primer: 0.5 μ L; Taq enzyme: 0.5 μ L;
The aqua sterilisa complement is long-pending to 50 μ L
Amplification program: 95 ℃ of 5min, 94 ℃ of 1min, 54 ℃ of 1.5min, 72 ℃ of 2.5min, 30 circulations, 72 ℃ of 7min, amplification finishes, and gets 5 μ L reaction solutions and does the agarose gel electrophoresis observation, and obtaining the amplified fragments total length is the band of 1101bp, then for containing the recombination yeast positive strain of PpICZ α-MPoIFN α carrier, called after X-33/PpICZ α-MPoIFN α; See: Fig. 3;
(6) abduction delivering of X-33/PpICZ α-MPoIFN α
Picking two strain bacterial strains are connected to the BMGY liquid nutrient medium (Pichia Expression Kit) of 25mL respectively from the YPDS substratum plate that contains above-mentioned bacterial strains, are cultured to OD through 28 ℃ of shaking tables
600During=2-6, the centrifugal 5min results of room temperature 1500rpm/min thalline, the thalline of results is suspended in the triangular flask of 500mL with the BMMY nutrient solution of 100mL, place 28 ℃ of shaking tables to carry out abduction delivering, every 24h adds the methyl alcohol that final concentration is a volume ratio 1% in substratum, to keep the inductive continuous expression, the supernatant of collecting X-33/PpICZ α-MPoIFN alpha expression of cultivating when inducing 72h carries out purifying;
(7) purifying of X-33/PpICZ α-MPoIFN alpha expression product
The X-33/PpICZ α of the above-mentioned collection of ammonium sulfate precipitation-MPoIFN alpha expression supernatant with 45%, the centrifugal 30min of 12000rpm/min outwells supernatant, and the resuspended albumen precipitation of 0.9M ammonium sulfate is crossed drainage column (Phenyl Sepharose then
TM6FastFlow) desalination, the albumen after the desalination have promptly obtained the expressing protein of composite porcine alpha-IFN gene of the present invention again behind anion-exchange column (Q Sepharose Fast Flow) purifying;
Simultaneously to different period expression product samplings, carry out SDS-PAGE electrophoresis (U.K.Laemmli, Cleavage ofstructural proteins during assembly of the head of bacteriophage T4) finds between 14.4KD and 21.5KD, to have on the electrophorogram of the supernatant when having induced 72h the tangible protein electrophoresis band of an about 19KD, with the prediction molecular weight identical, carry out purifying after the SDS-PAGE electrophoresis see Fig. 4;
(8) mensuration of target protein concentration
With the determined by ultraviolet spectrophotometry sample of nucleic acid-protein analyser light receipts value, according to protein content in the formula calculation sample at the 280nm wavelength.
Formula is: protein concn (mg/ml)=(OD
280* extension rate)/optical extinction coefficient
(9) westenblot of X-33/PpICZ α-MPoIFN alpha expression product identifies
With the natural porcine alpha-IFN immune rabbit of purifying, the preparation polyvalent antibody is an anti-SPA-HRP (staphylococcal protein A) with this polyvalent antibody and is done two and anti-do the westernblot evaluation.The yeast X-33 that transforms recombinant plasmid X-33/PpICZ α-MPoIFN α has the colour developing of differential protein band at about 19KD place; See: Fig. 5;
(10) inhibition of cell proliferation of the composite porcine alpha-IFN of X-33/PpICZ α-MPoIFN alpha expression on the PK-15 cell measured
A, the composite porcine alpha-IFN MTT on the PK-15 cell measures
PK-15 cell numeration back is diluted to appropriate density with the DMEM nutritive medium that contains 10% calf serum, with 2 * 10
3The concentration in/hole is added drop-wise to 96 orifice plates, places 37 ℃, 5%CO
2Treat in the incubator that cell attachment becomes individual layer (about 17-18h) back with the DMEM nutritive medium that contains 10% calf serum the composite porcine alpha-IFN of yeast expression to be carried out the twice doubling dilution, 10 μ g/ml, 5 μ g/ml, 2.5 μ g/ml, 1.25 μ g/ml, 0.625 μ g/ml, 0.313 μ g/ml, each concentration is done five repetitions.On the 96 porocyte culture plates with the composite porcine alpha-IFN sample of twice doubling dilution with 100 μ l/ holes respectively behind the pre-treatment PK-15 cell 72h, it is the MTT of 5mg/ml that every hole adds 20 μ l concentration, places 37 ℃, 5%CO
2Continue in the incubator to cultivate 4 hours, every then hole adds 200 μ lDMSO (dimethyl sulfoxide (DMSO)) and stops cultivating, and is placed on reading under the 570nm wavelength in ten minutes in vibration on the vibrator;
B, the composite porcine alpha-IFN MTT measurement result on the PK-15 cell
As shown in Figure 5, composite porcine alpha-IFN can more effectively suppress the propagation of PK-15 cell than the natural porcine alpha-IFN of equal in quality.
The bioactive mensuration of composite porcine alpha-IFN of (11) yeast expression, and carry out specific activity with natural pig a Interferon, rabbit
The activity of A, (1) composite porcine alpha-IFN anti-VSV on the PK-15 cell
After treating that the PK-15 cell grows up to individual layer in 96 porocyte culture plates, nutritive medium inclines, wash twice with keeping liquid, every hole adds composite porcine alpha-IFN and each the 100 μ L of natural porcine alpha-IFN that do continuous 10 times of dilutions with 1640 nutritive mediums that contain 10% calf serum, and each extent of dilution is inoculated four holes.Tissue Culture Plate is placed 5%CO
2, continuing in 37 ℃ of cell culture incubators to cultivate, supernatant is removed in the 24h hypsokinesis, washes twice with keeping liquid, and every hole adds 100 μ L 1000TCID
50/ mLVSV virus liquid is established the negative control that does not add Interferon, rabbit simultaneously and is not added viral blank, and supernatant discarded behind the absorption 1h adds the liquid of keeping that contains 2% calf serum, places 37 ℃, 5%CO
2Continue to cultivate the malicious positive porocyte pathology of causing a disease in the cell culture incubator and reach 75%, about 24h puts observations under the inverted microscope, is final result with last record result, calculates Interferon, rabbit according to the Reed-Muench formula and tires.The test triplicate.The high dilution that suppresses 50% cytopathic Interferon, rabbit is decided to be 1 Interferon, rabbit unit.
A, (2) SYBR Green I real-time fluorescence quantitative PCR detect the activity of composite porcine alpha-IFN anti-PRV on the PK-15 cell
After treating that the PK-15 cell grows up to individual layer in 24 porocyte culture plates, the nutritive medium that inclines washes twice with keeping liquid, and every hole adds with the 1640 nutritive mediums dilution 10 that contains 10% calf serum
-6Each 100 μ L of composite porcine alpha-IFN.Tissue Culture Plate is placed 5%CO
2, continuing in 37 ℃ of cell culture incubators to cultivate, supernatant is removed in the 24h hypsokinesis, washes twice with keeping liquid, and every hole adds 100 μ L 1000TCID
50/ mlPRV virus liquid is established the blank that virus is shone and do not added to the feminine gender that does not add Interferon, rabbit simultaneously, and supernatant discarded behind the absorption 1h adds the liquid of keeping that contains 2% calf serum, places 37 ℃, 5%CO
2Extract viral DNA after continuing in the cell culture incubator to cultivate 24h.
Extract test kit with Takara company viral DNA and extract PRVDNA, be dissolved in the 30ml ultrapure water, be used for SYBR Green I real-time fluorescence quantitative PCR and detect by its process specifications.Amplification and detection fluorescence on the full-automatic real-time fluorescence quantitative PCR instrument of ABI company 7300 types.Adopt glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as confidential reference items simultaneously.Used PCR primer GAPDH-F:5-ACTCACTCTTCTACCTTTGATGCT-3;
GAPDH-R：5-TGTTGCTGTAGCCAAATTCA-3；PRV-F：5-CTCGCCATCGTCAGCAA-3；
PRV-R：-GCTGCTCCTCCATGTCCTT-3。Contain 2 * SYBR Green PCRMasterMix, 12.5 μ L in the 25 μ LPCR reaction systems, each 1 μ L of the upstream and downstream primer of 10pmol/L, DNA2 μ L, 2.5mMdNTP2 μ L, TaqDNA polysaccharase 0.25 μ L, ultrapure water 6.25 μ L.The amplification parameter is: 95 ℃ of 30s, 95 ℃ of 10s, 55 ℃ of 15s, 72 ℃ of 30s, totally 40 circulations.After reaction finishes, carry out the mensuration of melting curve, reaction conditions is: 95 ℃ of 15s, 60 ℃ of 1min, 95 ℃ of 15s, 60 ℃ of 15s.Reaction finishes the back by ABI PRISM7300SDS software (Applied Biosystems) software analysis data.
The result of B, (1) anti-VSV
Observe visible positive control hole after 24 hours at PK-15 cell upper accepting water blister Stomatovirus and occur 100% serious pathology fully, and add in the cell hole of composite porcine alpha-IFN of the yeast expression carry out 10 times of doubling dilutions 10
8Do not see any cytopathy, the PK cell no abnormality seen in the negative control hole.The biologic activity that draws composite porcine alpha-IFN from The above results is 1.716 * 10
8, the biologic activity of natural pig a Interferon, rabbit is 3.873 * 10
6, the biologic activity of composite porcine alpha-IFN is 44.4 times of biologic activity of natural porcine alpha-IFN;
The specific activity of table 2 composite porcine alpha-IFN and natural pig a Interferon, rabbit
B, (2) SYBR Green I real-time fluorescence quantitative PCR detect the active result of composite porcine alpha-IFN anti-PRV on the PK-15 cell
Carry out quantitative fluorescent PCR after getting the cell suspension extracting viral DNA behind each winding poison 24h.Adopt 2
-Δ Δ CtMethod is carried out the relative quantification of PRV, Fig. 6 shows, PRVmRNA level in the cell hole of access Interferon, rabbit significantly is lower than the level in the control group, compares with control group, and the level of PRVmRNA has reduced by 37 times and 14 times respectively in the cell hole of access composite porcine alpha-IFN and natural porcine alpha-IFN.
Can illustrate that according to above experimental result the NEW TYPE OF COMPOSITE porcine alpha-IFN is successfully developed, this research is laid a good foundation for the application of composite porcine alpha-IFN in pig industry.
Sequence table
＜110〉Agricultural University Of Nanjing
＜120〉a kind of composite porcine alpha-IFN gene and recombinant vectors thereof
＜130〉specification sheets
<140>00
<141>2009-03-12
<160>17
<170>PatentIn version 3.1
<210>1
<211>501
<212>DNA
＜213〉synthetic
<220>
＜221〉porcine alpha-IFN gene sequence
<222>(1)..(501)
<223>
<400>1
atgtgtgatt tgccacaaac tcattccttg gctcatacta gagctttgag attgttggct 60
caaatgagaa gaatttctcc attctcctgt ttggatcata gaagagattt cggttctcca 120
catgaagctt tgggtggtaa ccaagttcag aaggctcaag ctatggcttt ggttcatgaa 180
atgttgcaac aaactttcca gttgttctcc actgaaggtt ctgctgctgc ttggaacgaa 240
tctttgttgc atcaattctg tactggtttg gatcagcagt tgagagattt ggaagcttgt 300
gttatgcaag aagctggttt ggaaggtact ccattgttgg aggaggattc catcttggct 360
gttaagagat acttccatag attgactttg tacttgcaag agaagtctta ctctccatgt 420
gcttgggaaa ttgttagagc tgaagttatg agatccttct cctcttctac taacttgcaa 480
gatagattga gaaagaagga a 501
<210>2
<211>59
<212>DNA
＜213〉synthetic
<220>
＜221〉primer SRpIFN-1
<222>(1)..(59)
<223>
<400>2
gcggaattca tgtgtgattt gccacaaact cattccttgg ctcatactag agctttgag 59
<210>3
<211>58
<212>DNA
＜213〉synthetic
<220>
<221>ARpIFN-2
<222>(1)..(58)
<223>
<400>3
caggagaatg gagaaattct tctcatttga gccaacaatc tcaaagctct agtatgag 58
<210>4
<211>59
<212>DNA
＜213〉synthetic
<220>
<221>S RpIFN-3
<222>(1)..(59)
<223>
<400>4
aagaatttct ccattctcct gtttggatca tagaagagat ttcggttctc cacatgaag 59
<210>5
<211>59
<212>DNA
＜213〉synthetic
<220>
<221>ARpIFN-4
<222>(1)..(59)
<223>
<400>5
ccatagcttg agccttctga acttggttac cacccaaagc ttcatgtgga gaaccgaaa 59
<210>6
<211>59
<212>DNA
＜213〉synthetic
<220>
<221>S RpIFN-5
<222>(1)..(59)
<223>
<400>6
tcagaaggct caagctatgg ctttggttca tgaaatgttg caacaaactt tccagttgt 59
<210>7
<211>57
<212>DNA
＜213〉synthetic
<220>
<221>ARpIFN-6
<222>(1)..(57)
<223>
<400>7
gattcgttcc aagcagcagc agaaccttca gtggagaaca actggaaagt ttgttgc 57
<210>8
<211>59
<212>DNA
＜213〉synthetic
<220>
<221>S RpIFN-7
<222>(1)..(59)
<223>
<400>8
tgctgctgct tggaacgaat ctttgttgca tcaattctgt actggtttgg atcagcagt 59
<210>9
<211>57
<212>DNA
＜213〉synthetic
<220>
<221>ARpIFN-8
<222>(1)..(57)
<223>
<400>9
ccagcttctt gcataacaca agcttccaaa tctctcaact gctgatccaa accagta 57
<210>10
<211>54
<212>DNA
＜213〉synthetic
<220>
<221>S RpIFN-9
<222>(1)..(54)
<223>
<400>10
tgtgttatgc aagaagctgg tttggaaggt actccattgt tggaggagga ttcc 54
<210>11
<211>54
<212>DNA
＜213〉synthetic
<220>
<221>ARpIFN-10
<222>(1)..(54)
<223>
<400>11
gtcaatctat ggaagtatct cttaacagcc aagatggaat cctcctccaa caat 54
<210>12
<211>57
<212>DNA
＜213〉synthetic
<220>
<221>S RpIFN-11
<222>(1)..(57)
<223>
<400>12
gatacttcca tagattgact ttgtacttgc aagagaagtc ttactctcca tgtgctt 57
<210>13
<211>58
<212>DNA
＜213〉synthetic
<220>
<221>A RpIFN-12
<222>(1)..(58)
<223>
<400>13
gaggagaagg atctcataac ttcagctcta acaatttccc aagcacatgg agagtaag 58
<210>14
<211>45
<212>DNA
＜213〉synthetic
<220>
<221>S RpIFN-13
<222>(1)..(45)
<223>
<400>14
agttatgaga tccttctcct cttctactaa cttgcaagat agatt 45
<210>15
<211>46
<212>DNA
＜213〉synthetic
<220>
<221>A RpIFN-14
<222>(1)..(46)
<223>
<400>15
ccgtctagat tattccttct ttctcaatct atcttgcaag ttagta 46
<210>16
<211>21
<212>DNA
＜213〉synthetic
<220>
＜221〉AOX1 primer upstream
<222>(1)..(21)
<223>
<400>16
gactggttcc aattgagaag c 21
<210>17
<211>21
<212>DNA
＜213〉synthetic
<220>
＜221〉AOX1 primer downstream
<222>(1)..(21)
<223>
<400>17
gcaaatggca ttctgacatc c 21
Claims (4)
1. composite porcine alpha-IFN gene, its nucleotides sequence is classified SEQ ID NO.1 as, and size is 501bp.
2. the expression production method of a porcine alpha-IFN comprises:
(1) contains the structure and the evaluation of composite porcine alpha-IFN gene Yeast expression carrier
Design primer after the described composite porcine alpha-IFN gene SEQ of the claim 1 of synthetic ID NO.1 added EcoR I and two restriction enzyme sites of XbaI, the product of this porcine alpha-IFN gene of pcr amplification is with after pPICZ α-the A yeast vector is connected, enzyme is cut, T4DNA Ligase connection is spent the night, connect product transformed competence colibacillus E.coli DH5 α and obtain recombinant expression vector, recombinant expression vector carries out double digestion again to be identified, enzyme is sure to down, and size then is accredited as positive carrier for the band of 501bp, what the right-on positive carrier of determined dna sequence was structure contains porcine alpha-IFN gene Yeast expression carrier, called after PpICZ α-MPoIFN α;
(2) preparation of yeast pichia spp X-33 competent cell
(3) contain composite porcine alpha-IFN gene Yeast expression carrier electricity and be transformed into yeast X-33 competent cell
Above-mentioned Yeast expression carrier PpICZ α-MPoIFN α 10 μ L that contain porcine alpha-IFN gene after the linearizing of SacI enzyme learn from else's experience, with the above-mentioned yeast pichia spp of 80 μ L X-33 competent cell mixing, the electricity of transferring to the 0.2cm of ice precooling then transforms in the cup, places 5min on ice; Electricity is transformed cup to be placed on the electroporation apparatus and to shock by electricity once with pulsed current, electric shock finishes, the 1mol sorbyl alcohol that adds the precooling of 1mL ice immediately, mixing moves in the Eppendof pipe of 1.5mL, places 28 ℃ of constant incubators, cultivate 1h, get 250 μ L conversion products then and be coated with on the YPDS substratum plate that contains 100 μ g/mL bleomycin resistances, put 28 ℃ of constant temperature culture 2-4 days, the recombination microzyme that contains PpICZ α-MPoIFN α carrier that will grow on the YPDS substratum is dropped into capable positive identification;
(4) contain the positive identification of PpICZ α-MPoIFN α carrier restructuring yeast strains
(1) extracts the genomic dna that contains PpICZ α-MPoIFN α carrier restructuring yeast strains
(2) be used for the AOX1 primer of positive identification:
Upstream: 5 '-gactggttccaattgagaagc-3 ' downstream: 5 ' gcaaatggcattctgacatcc-3 '
(3) pcr amplification is identified: with the pastoris genomic dna is template, with the AOX1 primer is that Auele Specific Primer carries out pcr amplification, obtaining the amplified fragments total length is the band of 1089bp, then for containing the recombination yeast positive strain of PpICZ α-MPoIFN α carrier, called after X-33/PpICZ α-MPoIFN α;
(5) abduction delivering of X-33/PpICZ α-MPoIFN α
Picking two strain bacterial strains are connected to the BMGY liquid nutrient medium of 25mL respectively from the YPDS substratum plate that contains X-33/PpICZ α-MPoIFN α bacterial strain, are cultured to OD through 28 ℃ of shaking tables
600During=2-6, the centrifugal 5min results of room temperature 1500rpm/min thalline, the thalline of results is suspended in the triangular flask of 500mL with the BMMY nutrient solution of 100mL, place 28 ℃ of shaking tables to carry out abduction delivering, every 24h adds the methyl alcohol that final concentration is a volume ratio 1% in substratum, to keep the inductive continuous expression, the supernatant of X-33/PpICZ α-MPoIFN alpha expression that the centrifuging collection is cultivated when inducing 72h carries out purifying;
(6) purifying of X-33/PpICZ α-MPoIFN alpha expression product
The expression supernatant of the X-33/PpICZ α-MPoIFN α of the above-mentioned collection of ammonium sulfate precipitation with 45%, the centrifugal 30min of 12000rpm/min, outwell supernatant, 0.9M the resuspended albumen precipitation of ammonium sulfate, cross drainage column Phenyl SepharoseTM 6Fast Flow desalination then, the albumen after the desalination has promptly obtained the expressing protein of composite porcine alpha-IFN gene again behind anion-exchange column Q Sepharose Fast Flow purifying.
3. constructed Yeast expression carrier PpICZ α-MPoIFN α in the described method of claim 2.
4. the X-33/PpICZ α-MPoIFN α restructuring yeast strains that is obtained in the described method of claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101250576A CN101845441B (en) | 2010-03-16 | 2010-03-16 | Composite porcine alpha-IFN gene and recombinant vector thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101250576A CN101845441B (en) | 2010-03-16 | 2010-03-16 | Composite porcine alpha-IFN gene and recombinant vector thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101845441A CN101845441A (en) | 2010-09-29 |
| CN101845441B true CN101845441B (en) | 2011-10-12 |
Family
ID=42770260
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101250576A Expired - Fee Related CN101845441B (en) | 2010-03-16 | 2010-03-16 | Composite porcine alpha-IFN gene and recombinant vector thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101845441B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102229944B (en) * | 2011-06-03 | 2013-02-06 | 北京伟嘉人生物技术有限公司 | Method for preparing recombinant porcine alpha-interferon |
| CN104878016A (en) * | 2015-05-22 | 2015-09-02 | 江苏恒丰强生物技术有限公司 | Compound porcine alpha interferon gene and synthetic method thereof |
| CN104878017A (en) * | 2015-05-22 | 2015-09-02 | 江苏恒丰强生物技术有限公司 | Porcine alpha interferon gene and synthetic method thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1611604A (en) * | 2003-12-23 | 2005-05-04 | 青岛宝依特生物技术研究所 | Swine alpha-interferon gene synthesis, expression vector establishment and product preparing method |
| CN1970774A (en) * | 2006-12-13 | 2007-05-30 | 广东省农业科学院兽医研究所 | Porcine alpha-interferon recombinant adenovirus and its construction method and application |
| CN101157724A (en) * | 2007-11-06 | 2008-04-09 | 中国科学院微生物研究所 | Modified recombinant porcine alpha interferon protein and coding gene and uses thereof |
| CN101209345A (en) * | 2006-12-26 | 2008-07-02 | 河南农业大学 | Animal genetic engineering interferon alpha and gamma composite preparations and production method and clinical application thereof |
| CN101289666A (en) * | 2008-03-28 | 2008-10-22 | 王明丽 | Method for preparing recombination porcine alpha-type interferon |
| CN101302516A (en) * | 2008-05-08 | 2008-11-12 | 华南农业大学 | Modified pig alpha-interferon genes, construction of expression vector and preparation of protein thereof |
| CN101392256A (en) * | 2007-09-21 | 2009-03-25 | 黑龙江省农业科学院畜牧研究中心 | Gene synthesis of wild boar alpha-interferon, vector construction and method for producing outcome |
-
2010
- 2010-03-16 CN CN2010101250576A patent/CN101845441B/en not_active Expired - Fee Related
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1611604A (en) * | 2003-12-23 | 2005-05-04 | 青岛宝依特生物技术研究所 | Swine alpha-interferon gene synthesis, expression vector establishment and product preparing method |
| CN1970774A (en) * | 2006-12-13 | 2007-05-30 | 广东省农业科学院兽医研究所 | Porcine alpha-interferon recombinant adenovirus and its construction method and application |
| CN101209345A (en) * | 2006-12-26 | 2008-07-02 | 河南农业大学 | Animal genetic engineering interferon alpha and gamma composite preparations and production method and clinical application thereof |
| CN101392256A (en) * | 2007-09-21 | 2009-03-25 | 黑龙江省农业科学院畜牧研究中心 | Gene synthesis of wild boar alpha-interferon, vector construction and method for producing outcome |
| CN101157724A (en) * | 2007-11-06 | 2008-04-09 | 中国科学院微生物研究所 | Modified recombinant porcine alpha interferon protein and coding gene and uses thereof |
| CN101289666A (en) * | 2008-03-28 | 2008-10-22 | 王明丽 | Method for preparing recombination porcine alpha-type interferon |
| CN101302516A (en) * | 2008-05-08 | 2008-11-12 | 华南农业大学 | Modified pig alpha-interferon genes, construction of expression vector and preparation of protein thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101845441A (en) | 2010-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101338314B (en) | Recombined chicken alpha interferon gene and recombinant vector thereof | |
| CN102041263B (en) | Chicken alpha interferon/interleukin 2 chimeric gene | |
| CN101736062B (en) | Method for preparing recombinant porcine alpha interferon standard substance | |
| CN101845441B (en) | Composite porcine alpha-IFN gene and recombinant vector thereof | |
| CN102796758A (en) | Recombinant porcine alpha interferon and application thereof in preparing medicines for treating Porcine cytomegalovirus (PCMV) | |
| CN102198265B (en) | Method for degrading streptococcus suis biofilm by applying phage lyase | |
| CN107474142A (en) | Promote polypeptide and its relevant biological material and the application of destination protein secretion | |
| CN101638662A (en) | Phytophthora capsici polygalacturonase (PG) Pcipg5 gene, protein preparation method and application thereof | |
| CN109929014A (en) | A kind of inhibition chicken congenital immunity reaction chicken Marek's disease virus protein and its application | |
| CN100469879C (en) | Method for preparing recombinant chicken alpha-interferon and its recombinant vector | |
| CN103450355A (en) | Recombined bovine alpha interferon and application thereof | |
| CN107286255A (en) | It is a kind of by OVA, chicken interferon gamma and chicken interferon α fusion protein constituted and preparation method thereof | |
| CN107266587A (en) | A kind of recombinant bovine long-acting interferon α and prepare fusion protein of this long-acting interferon and preparation method thereof | |
| CN101434958A (en) | Method for preparing porcine alpha-interferon | |
| CN106868035A (en) | A kind of preparation method of restructuring horse Interferon alpha 1 | |
| CN108486127A (en) | 6 α of dog interferon-α, 7 recombinant proteins and the preparation method and application thereof | |
| CN103613668A (en) | Long-acting fusion interferon for dogs and cats, as well as preparation method and application thereof | |
| CN1242065C (en) | Pig breeding and respiratory syndrome recombined adenovirus and vaccine | |
| CN103014015A (en) | Gene segment for coding porcine interferon-gamma and application of gene segment | |
| CN102229944B (en) | Method for preparing recombinant porcine alpha-interferon | |
| CN110343164A (en) | A kind of pig interferon alpha-mutant and its preparation method and application of 7 site mutation of high activity | |
| CN107254000A (en) | A kind of fusion protein being made up of sheep albumin and sheep interferon gamma and preparation method thereof and a kind of restructuring sheep long-acting interferon γ | |
| CN107383204A (en) | A kind of fusion protein being made up of sheep interleukin 2, sheep interferon gamma and sheep interferon-tau and preparation method thereof | |
| CN108864300A (en) | Chicken Albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a breeder long-acting interferon | |
| CN107286251A (en) | It is a kind of by cattle interleukins-2 2, Bov IFN γ and Bov IFN α fusion protein constituted and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111012 Termination date: 20140316 |