CN101638662A

CN101638662A - Phytophthora capsici polygalacturonase (PG) Pcipg5 gene, protein preparation method and application thereof

Info

Publication number: CN101638662A
Application number: CN200910017994A
Authority: CN
Inventors: 张修国
Original assignee: Shandong Agricultural University
Current assignee: Shandong Agricultural University
Priority date: 2009-09-02
Filing date: 2009-09-02
Publication date: 2010-02-03
Anticipated expiration: 2029-09-02
Also published as: CN101638662B

Abstract

The invention belongs to the technical field of biology and in particular provides a polygalacturonase (PG) gene Pcipg5 which is cloned from phytophthora capsici and protein preparation technology thereof. Gene and protein levels prove that the gene is effectively involved in the process that the phytophthora capsici infects hot pepper hosts and results in occurrence of the course of diseases on hot pepper leaves. Plant pathology and cytochemistry technology further prove that after the protein coded by the gene is inoculated onto the hot pepper leaves, obvious withering and shrinking occur onthe inoculated parts of the leaves and the cell walls on the affected parts of the leaves are obviously degraded, namely the gene code is an important protein related to the course of diseases or ispossibly an important target pathogenic gene of a phytophthora capsici PG gene cluster. The invention provides important technical reserve for further developing phytophthora capsici molecule detection technology.

Description

Phytophthora capsici polygalacturonase (PG) Pcipg 5 gene, protein preparation method and application thereof

Technical field

The invention belongs to biology field, specifically, the present invention relates to a kind of separation and encoded protein matter preparation method thereof of phytophthora blight of pepper polygalactunonic acid enzyme gene.In addition, the invention still further relates to the polygalacturonase of this genes encoding to capsicum host's the destruction and the Degradation of cell walls.

Background technology

Pathogenic oomycetes and host make multiple important cell wall degrading enzyme of secretion or zymin in the process mutually, wherein polygalacturonase (PG:EC 3.2.1.15) is a kind of important zymin of various plants cause of disease oomycetes excretory, this fermentoid destroys host's defense system by pectin, the mesogloea of degraded host plant cell wall, closely strengthen the avidity of germ, so this fermentoid is a kind of important virulence factor to the host.Studies show that polygalacturonase is a kind of cell wall-bound proteolytic enzyme, but α in the catalysis pectin molecule-(1,4)-the polygalacturonic acid cleavage, the pectin of degradation of cell wall, cause softening of the cell wall, the various structures and the various zymins of excretory or nosotoxin thereof of infecting that are beneficial to pathogenic bacteria infect the host tissue cell smoothly and cause host's the course of disease to develop.PG is divided into two kinds of endo-type (endo-) and circumscribed-type (exo-), encode by polygene, the performance of coded polygalacturonase there are differences between pathogenic oomycetes PG gene cluster member, and the performance of such enzyme liberating host cell wall is often by single or several crucial Pg synergistic effect of gene.Therefore, explore the pathogenic oomycetes and do mutually with the host that excretory PG is based on cause a disease target Pg gene and encoded protein matter Study on functional properties thereof to the pathogenic effects of host plant in the process, tool important theory and test meaning.

Worldwide, the pathogenic oomycetes easily causes the disease of various plants, has caused serious loss to agriculture production.Data shows that PG is the important virulence factor of various plants cause of disease oomycetes, the Phytophthora capsici disease is a kind of important oomycetes disease, can cause various plants generation serious plant disease, carry out that phytophthora blight of pepper (Phytophthora capsici) polygalactunonic acid enzyme gene separates and the target gene encoded protein is made and the important practice significance of functional analysis tool in a deep going way, can realize the control and the research of the plurality of plant diseases that caused for the pathogenic oomycetes.Before the present patent application, in world wide, except that this research group has reported the pathogenic functional mechanism research of phytophthora blight of pepper polygalacturonase Pcipg 2 genes, yet there are no other crucial Pg gene isolation of phytophthora blight of pepper and encoded protein matter thereof and make and the functional study data information.

Summary of the invention

Based on above-mentioned reason, 1 clone is from the polygalactunonic acid enzyme gene Pcipg 5 and the encoded protein matter manufacturing technology thereof of phytophthora blight of pepper.Be based on gene and protein level, proved that this gene has effectively participated in the process that Phytophthora capsici infects the host and causes the capsicum epidemic disease course of disease to take place, and be based on plant pathology and the cytochemistry technology has proved that the protein of this genes encoding has the performance that causes the capsicum blade to produce shrinkage, necrosis and destruction cell walls.Therefore, this gene is an important target Disease-causing gene of phytophthora blight of pepper polygalactunonic acid enzyme gene bunch, and the present invention provides sufficient tachnical storage for further development Phytophthora capsici germ molecular detection technology.

Polygalactunonic acid enzyme gene provided by the present invention, its gene order is shown in Seq ID No:1; Its protein amino acid sequence is shown in SEQ ID NO:2.This gene open reading frame has 1086 bases, a kind of 361 amino acid whose protein that contain of encoding, molecular weight is 37kDa, 1 signal peptide cutting site amino-acid residue (for the amino acid of the 1-20 in the SEQ ID NO:2 sequence) is arranged, 1 N-glycosylation site (being arranged in the 252-254 amino acid of SEQ ID NO:2 sequence), intronless.

All Pg aminopeptidase gene acid sequence comparisons among the jgi/phycaf7/20609 among this polygalactunonic acid enzyme gene and the JGI, find that 1 Pg gene and Pcipg 5 aminopeptidase gene acid homologies are up to 82.27%, none gene identical with it, so this gene is a new polygalactunonic acid enzyme gene.

Its concrete method for separating and preparing is:

1, separating clone gene concrete steps:

A: adopt the CTAB method to extract phytophthora blight of pepper DNA, make up genome dna library with QIAEXII GEL Extraction Kit reagent, with size is that the dna fragmentation of 1.5Kb-3.0Kb is connected in carrier PUC19, transformed into escherichia coli DH5 α, and PCR identifies the library quality.

B: according to the polygalactunonic acid enzyme gene conserved sequence of the plant of having reported, bacterium, fungi, design degenerated primer P710 (its sequence is shown in Seq ID No:3) and P1150R (its sequence is shown in Seq ID No:4), utilize Pooling-PCR technology screening DNA library (referring to plantjournal, 2000,23:687-695), the positive colony order-checking obtains full length gene.

2, prepare proteinic concrete steps:

A:Pcipg 5 gene yeast expression vector establishments, goal gene is cloned among the expression vector pPIC9K.

B: with above-mentioned recombinant expression vector linearizing, transform pichia spp GS115 competent cell, yeast transformant methyl alcohol utilizes the phenotype plate screening.

C: yeast transformant is cultivated and the polygalacturonase methanol induction is expressed, and the expression product biologic activity detects, SDS-PAGE analyzes the polygalacturonase purifying.

It is all common that bacterium is lived in carrier that the present invention is used and place, and pUC19 is Pcipg 5 gene host carriers, and DH5 α is a host cell, and pPIC9K is Pcipg 5 expression vectors, and (Pichia pastoris) GS115 is this expression of gene host bacterium.

The gene of cloning gained by this method reaches according to its encoded protein matter, can for the transcriptional expression level in the capsicum epidemic disease strain of studying this viroid and in the capsicum epidemic disease strain accurate translation level effective foundation is provided, its concrete detection mode is as follows:

The detection of transcriptional expression level in the capsicum epidemic disease strain:

A: the strong phytophthora blight of pepper inoculation capsicum blade that causes a disease that will be used to clone Pcipg 5 genes.

B: the total RNA of morbidity capsicum blade extracts and cDNA synthesizes.

C: reverse transcription cDNA article one chain is synthetic.

D:RT-PCR detects.

The preparation of E:DIG-DNA probe.

F:RNA shifts, fixing and molecular hybridization detection.

Conventional gene transcript expression detection method has been adopted in the present technique operation, and specific operation process is described in detail in follow-up embodiment.

Accurate translation level detection step in the capsicum epidemic disease strain:

A: the strong phytophthora blight of pepper inoculation capsicum blade that causes a disease that will be used to clone Pcipg 5 genes;

B: extract the crude protein in the above-mentioned sick leaf;

C: the protein Preparation specific corrosioning anteserum that utilizes the Pcipg 5 genetic expression purifying that obtain;

D: after the crude protein that makes in B step changeed the NC film, utilize above-mentioned specific corrosioning anteserum to carry out Western Blot and analyze (the goat-anti rabbit of adopting the HRP mark in the experiment be two anti-).

Conventional gene translation detection of expression method has been adopted in the present technique operation, and detailed process is described in detail in follow-up embodiment.

Has the effect that destroys capsicum blade and degradation of cell wall for the polygalacturonase of further verifying Pcipg 5 genes encodings provided by the present invention simultaneously, the protein that the invention provides this genes encoding is inoculated the method for capsicum blade and the electron microscopic observation manufacturing technology of degradation of cell wall, the concrete operations step:

A:Pcipg 5 genetic expression purifying proteins are inoculated healthy capsicum blade.

B: get the fixing and processed of the capsicum leaf sample of inoculating expression and purification albumen and presenting manifest symptom.

C: soak into then, embedding and section statining.

D: electron microscopic observation.

The pathogenic protein inoculation method is to use for reference the sophisticated operative technique of similar research, and electron microscopic observation is made and belonged to the routine operation technology, and concrete operations are described in detail in follow-up embodiment.Further proved at phytophthora blight of pepper and capsicum host by this technology and to have made in the process destruction capsicum blade that the protein tool of this genes encoding obviously falls and the performance of degradation of cell wall mutually.Present technique provides valuable reference for exploring the pathogenic Study on functional properties of other cell wall degrading enzyme gene cluster member.

In sum, the invention provides polygalactunonic acid enzyme gene Pcipg 5 and the protein manufacturing technology thereof of 1 clone from phytophthora blight of pepper.Be based on gene and protein level, proved that this gene has effectively participated in the process that Phytophthora capsici infects the host and causes the capsicum epidemic disease course of disease to take place, and the protein that is based on the cytochemistry technology and has proved this genes encoding has the performance of destroying leaf tissue cell and cell wall structure thereof, makes the position that is injured produce tangible symptom.Therefore, this gene is an important target Disease-causing gene of coding Phytophthora capsici pectin methyl esterase gene cluster, and the present invention provides sufficient tachnical storage for further developing the germ molecular detection technology.

Description of drawings

Fig. 1 .Pcipg 5 expression vector synoptic diagram

Amp among the figure, Kana are respectively ammonia benzyl resistance and Ka Na resistance, and 5 ' AOX1 is a promotor, 3 ' AOX1 is a transcription terminator, and His6 is a Histidine dehydrogenase gene selection markers, and EcoR I and Not I are double enzyme site, Pcipg 5 is a goal gene, and Stu I is the linearizing site;

Fig. 2 .Pcipg 5 genetic expression purifying protein results

M among the figure: standard protein; 1 is empty carrier pPIC9K expression of results; 2 is the expressions of results of Pcipg 5 genes in pichia spp GS115; 3 is Pcipg 5 genetic expression protein purification results, and 3 illustrated protein bands show the albumen that has obtained this genetic expression purifying;

The RT-PCR detected result of Fig. 3 .Pcipg 5 genes transcriptional expression level in the capsicum epidemic disease leaf

A:1,3,5,7 are the sick leaf cDNA of every interval 1d detected result in the 7d behind the phytophthora blight of pepper inoculation capsicum blade of participating in the experiment; CK+ is the cDNA detected result of phytophthora blight of pepper; CK-is the cDNA detected result of healthy capsicum blade; B: the amplification of capsicum host β-actin gene; C:CK-is the RNA amplification of healthy capsicum blade; 1,3,5,7 RNA amplifications for the sick leaf of every interval 1d capsicum behind the inoculation 7d; CK+ is the RNA amplification of phytophthora blight of pepper of participating in the experiment.RT-PCR shown in the figure A detects image strip brightness to be strengthened gradually, and the enhancing of the capsicum blade (1d-7d) of inoculation phytophthora blight of pepper along with the blade occurring degree is described, the transcriptional expression level of this gene in the sick leaf of capsicum strengthens gradually;

The Northern Blot detected result of Fig. 4 .Pcipg 5 genes transcriptional expression level in the capsicum epidemic disease leaf

A:1,3,5,7 detected results for the sick leaf RNA of every interval 1d in the phytophthora blight of pepper inoculation capsicum blade 7d; CK+ is the RNA detected result (positive control) of phytophthora blight of pepper of participating in the experiment; CK-is the RNA detected result (negative control) of healthy capsicum blade; B: the RNA quality examination result of sick leaf and healthy leaves; Probe by the preparation of Pcipg 5 genes shown in the figure A strengthens gradually with sick leaf (1d-7d) the RNA hybridization signal intensity of inoculating phytophthora blight of pepper, explanation is in the 7d of inoculation phytophthora blight of pepper, along with increasing the weight of of occurring degree, the transcriptional expression level of this gene in the sick leaf of capsicum strengthens gradually;

Comprehensive RT-PCR and Northern Blot detected result show that phytophthora blight of pepper infects the capsicum blade and causes in the process of blade morbidity, and in the 7d of germ inoculation capsicum blade, this gene transcript expression level strengthens gradually;

The Western Blot detected result of Fig. 5 .Pcipg 5 genes accurate translation level in the capsicum epidemic disease blade

1d, 3d, 5d, 7d are phytophthora blight of pepper inoculation capsicum blade 7d, the accurate translation level detection result of every interval 1d Pcipg 5 genes in sick leaf; CK-is the detected result of healthy leaves crude protein; CK+ is the detected result of phytophthora blight of pepper crude protein;

The result shows that phytophthora blight of pepper infects the capsicum blade and causes in the process of morbidity that this gene translation expression level strengthens gradually;

Fig. 6 .Pcipg 5 genetic expression purifying proteins are to capsicum blade cell wall degradation electron microscopic observation result

A:Pcipg 5 genetic expression purifying proteins are to the degradation effect of capsicum blade cell walls, shown in the sword head; B: after the passivation of expression and purification albumen capsicum blade cell walls is not had destruction, (positive control) shown in the sword head; C: sterilized water does not have any destruction to capsicum blade cell walls, (negative control) shown in the sword head.The result shows the albumen of this genetic expression acquisition to the tangible degradation effect of capsicum blade cell walls tool, and the albumen of inferring this genes encoding thus is a kind of albumen of tool degradation of cell wall performance, or is a kind of pathogenesis-related proteins to a certain extent;

Embodiment

Embodiment provided by the present invention, all according to the normal experiment condition, as Sambrook equimolecular cloning experimentation handbook (NewYork:Gold Spring Harbor Laboratory Press, 1989), or Draper, the described operative technique rules of J etc. (Blackwell Science Press, 1988), or press the suggestion experiment condition of manufacturer.

Embodiment 1 (the phytophthora blight of pepper genome dna library of participating in the experiment structure)

Choose strong cause a disease and the active Phytophthora capsici bacterial strain of the high PGs of tool be the material of participating in the experiment, the structure genome dna library, concrete steps are as follows:

(1) adopt the CTAB method to extract phytophthora blight of pepper genome high quality DNA.

(2) the genomic dna ultrasonic wave interrupts, and the dna fragmentation of the 1.5Kb-3.0Kb that electrophoresis detection obtains adopts QIAEXII GELExtraction Kit test kit to reclaim purifying.

(3) genomic library is identified, after the dna fragmentation connection carrier of suitable size, transformed into escherichia coli DH5 α gets 20 μ L bacterium liquid and is coated with and contains Amp, the LB flat board of X-gal and IPTG, blue hickie screening.

(4) at random picking 96 clones carry out bacterium colony PCR and identify and sequencing analysis, guarantee that the dna fragmentation success ratio of having inserted required size among 96 clones reaches more than 80%.

Embodiment 2 (gene clone and order-checking)

According to polygalactunonic acid enzyme gene sequences Design degenerated primer P710 (its sequence is shown in Seq ID No:3) that has reported and P1150R (its sequence is shown in Seq ID No:4), utilize Pooling-PCR method screening-gene group library, sharp separation obtains a plurality of gene members of goal gene family.

1.96 the total plasmid DNA of individual clone is extracted (alkaline lysis)

(1) intestinal bacteria that will contain plasmid are inoculated in substratum 96 deep-well plates that contain microbiotic LB, and 37 ℃, the 220rpm concussion is to the logarithmic growth later stage.

(2) the bacterium liquid of cultivating is moved in the 80mL centrifuge tube, 4 ℃, the centrifugal 15min of 8000rpm abandons supernatant.

(3) with the thalline of centrifugal acquisition in filling 5mL solution I [50mM Tris-HCl (pH8.0), 10mM EDTA (pH8.0)] centrifuge tube in suspend again, slowly shake 10min in shaking table, add the N,O-Diacetylmuramidase (concentration is 10mg/mL) of 0.5mL then, leave standstill 10min.

(4) add 10mL solution II [0.2M NaOH, 1%SDS] mixing, place 10min under the room temperature.

(5) add 7.5mL frozen soln III[5MKAC60mL, Glacial acetic acid 11.5mL, H in every pipe ₂O28.5mL], fully mixing is placed 10min in the ice cube surface, and is shaken mixing 3 times.

(6) 4 ℃, the centrifugal 10min of 10000rpm, repeated centrifugation is precipitated to till the full scale clearance to macromole DNA.

(7) get supernatant, add the Virahol of 0.6 times of volume, mix under the room temperature of back and place 10min, under the room temperature, the centrifugal 15min of 10000rpm gets precipitation and washes twice with 70% ethanol, is inverted the centrifuge tube drying then.

(8) DNA is dissolved in the 3mL TE, and the extract after the dissolving is moved in the centrifuge tube of 50mL, adds equal-volume refrigerated 5mol/LLiCl, after mixing is placed on ice cube 2-5min, and 4 ℃, the centrifugal 10min of 10000rpm (precipitation macromole RNA).

(9) supernatant is moved in the clean centrifuge tube of 30-50mL, add the Virahol of 0.6 times of volume, mix, precipitate 10min under the room temperature, the centrifugal 10min of 10000rpm.

(10) outwell supernatant, be inverted centrifuge tube, remove remaining supernatant, wash 2 times, be inverted the dry several minutes of centrifuge tube with 70% ethanol.

(11) precipitation is dissolved in 1mLTE or the water, preserves stand-by down for-20 ℃.

2.16 the total plasmid DNA of individual clone is extracted

Step is the same, and various solution usage are aforesaid 1/6.

3. the mono-clonal plasmid DNA is extracted

(1) intestinal bacteria that will contain plasmid are inoculated in and contain in an amount of antibiotic LB substratum, and 37 ℃, the 220-250rpm concussion is cultured to logarithmic phase.

(2) get 1ml bacterium liquid to the centrifuge tube of 1.5ml, the centrifugal 1min of 8000rpm removes supernatant, collects thalline.

(3) solution I of adding 200 μ L precoolings, concussion suspension thalline.

(4) add 400 μ L solution II, put upside down centrifuge tube mixing for several times, the centrifugal 5min of 12000rpm.

(5) solution III of adding 300 μ L precoolings is put upside down mixing liquid, puts ice cube surface 5min, the centrifugal 5min of 12000rpm, and supernatant changes in the another centrifuge tube.

(6) add equal-volume phenol/chloroform/primary isoamyl alcohol, concussion mixing, the centrifugal 5min of 12000rpm.

(7) the upper strata water changes in the another centrifuge tube, adds the equal-volume Virahol, and room temperature is placed 10min behind the mixing, and the centrifugal 10min of 12000rpm removes supernatant.

(8) precipitation is washed 2 times with 70% ethanol, is inverted dry.

(9) return and be dissolved among the 30 μ L TE (the RNA enzyme that contains 20 μ g), get 5 μ L electrophoresis detection after, place-20 ℃ of preservations.

4.Pooling-PCR screening-gene group library

Adopt 96 deep-well plates (2.2mL) to cultivate mono-clonal, the clone that each deep-well plates is cultivated is divided into 6 Matrix Pool with this Super Pool again as a Super Pool, extracts Super Pool plasmid, as positive control, water is as negative control with genomic dna.

The PCR response procedures is: 95 ℃ of 4min; 94 ℃ of 1min, 55 ℃ of 30s, 72 ℃ of 1min, totally 35 circulations; Last 72 ℃ are extended 10min.

Reaction system is: ddH ₂O (32.5 μ L), 10 * buffer (5 μ L), MgCL ₂(4 μ L), dNTP (4 μ L), P710 (1 μ L), P1150R (1 μ L), DNA (2 μ L), TaqE (0.5 μ L).

Get 10 μ L reaction product electrophoresis, determine to contain the order gene monoclonal, serve the order-checking of the biological company limited of Hai Boya.Carry out homologous sequence relatively by the blast program among the NCBI to obtaining full length gene, determine goal gene.Infer amino acid sequence corresponding according to the full length gene sequence, calculate goal gene encoded protein matter molecular weight, be about 37kDa.

Implementation column 3 (genetic expression and protein purification)

1.Pcipg 5 gene mature peptide sequences are separated

(1) according to acquired Pcipg 5 full length gene dna sequence dnas, be that template is carried out the RT-PCR amplification with the RNA of the phytophthora blight of pepper of participating in the experiment, obtain its cDNA total length.

(2) according to its cDNA total length, primer is expressed in design, removes signal peptide sequence and 3 ', 5 ' non-coding area sequence, and upstream primer (Pcipg 5F: its sequence shown in Seq ID No:5,

5 '-TATA GAATTCCACCACCACCACCACCACGACGACGACGACAAGACACCCATGATCCGTCAGGC-3 ') introduce EcoR I restriction enzyme site, (Pcipg 5R: its sequence is shown in Seq ID No:6 for downstream primer

5 '-TATA GCGGCCGCTTAGCACTTGACAGTGCTGG-3 ') introduce Not I restriction enzyme site, amplified production contains the maturation protein sequence of Pcipg 5 genes encodings.

Reaction system is 50 μ L: amplification Pcipg 5 full length genes obtain cDNA template (2 μ L), 10 * buffer (5 μ L), dNTP (4 μ L), Pcipg 5F (1 μ L), Pcipg 5R (1 μ L), TaqE (0.5 μ L), ddH ₂O (32.5 μ L)

The PCR response procedures is: 94 ℃ of 10min; 94 ℃ of 30min, 67.3 ℃ of 45s, 72 ℃ of 1min, totally 35 circulations; Last 72 ℃ are extended 10min.

Get 10 μ L reaction product and carry out 1% agarose gel electrophoresis analysis, check order then, obtain Pcipg 5 expressed sequences, goal gene reclaims and connects and pGEM-T Easy Vector then, transformed into escherichia coli DH5 α, blue hickie screening, plasmid DNA enzyme are cut evaluation, screening positive clone plasmid pGEM-T/Pcipg5.

2.Pcipg 5 gene Pichia anomala expressions

2.1 the structure of Yeast expression carrier

(1) EcoR I and Not I double digestion pGEM-T/Pcipg5 plasmid reclaim and insert segment.

(2) the expression plasmid of yeast pPIC9K with same double digestion is connected transformed into escherichia coli DH5 α.

(3) the DH5 α after the conversion obtains bacterium colony and extract plasmid after 37 ℃ of shaking tables spends the night through the Amp resistance screening.

(4) the recombinant plasmid pPIC9K/Pcipg 5 enzymes evaluation of cutting and check order.

2.2 recombinant expression vector linearizing

Carry out the linearizing enzyme with Stu I restriction enzyme (being positioned at 5 ' AOX, 1 zone) and cut, to obtain GS115His ⁺Mut ⁺The phenotype transformant, reaction system is:

(1) get plasmid pPIC9K/Pcipg510 μ L (10-20 μ g), add 5 μ L 10X H buffer after, add Stu I 3 μ L again.

(2) add ddH ₂O 22 μ L, cumulative volume are 40 μ L (empty carrier pPIC9K linearizing reaction system is identical).

Behind (3) 37 ℃ of reaction 4h, the reaction solution electrophoresis detection that takes a morsel enzyme is cut effect.

(4) after enzyme cuts, with linearized vector DNA electrophoresis, reclaim test kit with UNIQ-10 pillar DNA glue and reclaim and purifying purpose segment ,-20 ℃ of preservations are in order to transforming.

2.3 yeast conversion

2.3.1 pichia spp GS115 competent cell preparation

(1) inoculation pichia spp GS115 is in 3mL YPD liquid nutrient medium, and 30 ℃ of shaking culture are spent the night, and get 1mL then in 50mL YPD liquid nutrient medium, and 30 ℃, shaking culture 16-18h, OD600=1.3～1.5,4 ℃, the centrifugal 5min of 3400rpm.

(2) with the ice-cold sterilized water re-suspended cell of 50mL, use the ice-cold sterilized water re-suspended cell of 25mL then, the same centrifugal.

(3) with the ice-cold 1M sorbyl alcohol re-suspended cell of 5mL, the same centrifugal.

(4) the same centrifugal, with the ice-cold 1M sorbyl alcohol of 0.5mL re-suspended cell, final volume is 1.5mL, and the preparation competent cell is used for transforming.

2.3.2 recombinant expression vector pPIC9K/Pcipg5 transformed competence colibacillus cell

(1) gets 80 μ L yeast competent cells and 5-20 μ g linearizing recombinant expression vector (being dissolved in 5-10 μ L TE) (empty carrier is done contrast).

(2) sample is added the 0.2cm electricity revolving cup of precooling, electricity changes behind the ice bath 5min.

(3) add the ice-cold sorbyl alcohol of 1mL 1mol/L in electric revolving cup, after go in the new centrifuge tube.

(4) yeast after will transforming is placed 1-2h down in 30 ℃.

(5) get 200-600 μ L bacterium liquid and be applied on the MD flat board, be inverted for 30 ℃ and cultivate 2-3d, behind the detection transformant, carry out Mut ⁺/ Mut ^sPhenotypic screen.

2.3.3 yeast transformant screening and evaluation

2.3.3.1 yeast transformant methyl alcohol utilizes the phenotype plate screening

(1) the yeast transformant correspondence is inoculated in MD and MM flat board.

Cultivate 2-4d for (2) 30 ℃, measure bacterium colony size and quantity.

(3) be selected in all and can identify positive colony with PCR then at the yeast transformant of MD and the dull and stereotyped normal growth of MM.

2.3.3.2 yeast transformant extracting genome DNA

(1) get yeast cell, the centrifugal 1min of 12000rpm absorbs supernatant.

(2) add 600 μ l sorbyl alcohol buffer, add about 50 μ l Lyt icase, abundant mixing, 30 ℃/30min, the centrifugal 10min of 4000rpm abandons supernatant, abolishes yeast cells wall.

(3) add the resuspended precipitation of 200 μ l damping fluids, fully mixing.

(4) add 20 μ l Proteinase K solution, mixing.

(5) add 220 μ l GB damping fluids, fully mixing is placed 10min, the centrifugal cap wall globule of removing for 70 ℃.

(6) add 220 μ l dehydrated alcohols, abundant mixing, the centrifugal cap wall globule of removing.

(7) add among the adsorption column CB2, the centrifugal 30s of 12000rpm outwells waste liquid, then adsorption column is put into collection tube again.

(8) add 500 μ l, 700 μ l GD damping fluids respectively in adsorption column, the centrifugal 30s of 12000rpm outwells waste liquid respectively, all adsorption column CB2 is put into collection tube.

(9) the centrifugal 2min of 12000rpm outwells waste liquid, places the room temperature number minute to dry.

(10) adsorption column is changed in the new centrifuge tube, Dropwise 5 0-200 μ l elution buffer TE, room temperature is placed 2-5min, and the centrifugal 2min of 12000rpm is collected in the centrifuge tube.

2.3.3.3pPIC9K AOX 1 universal primer is identified

Reaction system 50 μ L:

(1) adds the AOX1 universal primer: 5 ' AOX1:1 μ L, 3 ' AOX1:1 μ L.

(2) add 10 * PCR Buffer (Mg ²⁺Free) 5 μ L.

(3) add MgCl ₂(25mmol/L) 4 μ L.

(4) dNTP mixes (2.5mmol/Leach) 4 μ L.

(5) recombination yeast genomic dna 5 μ L.

(6) Tap polysaccharase (5U/ μ L) 0.5 μ L.

(7)ddH ₂O?29.5μL。

Amplification reaction condition: 94 ℃ of 4min; 94 ℃ of 1min, 54 ℃ of 30s, 72 ℃ of 1min, 35 circulations; 72 ℃ of 10min get 10 μ L PCR products and detect.

2.3.3.4Pcipg 5 gene-specific primers are identified

Reaction system:

(1) adds each 1 μ L of Pcipg5 gene specific primer Pcipg 5F (20 μ mol/L) and Pcipg 5R (20 μ mol/L).

(2) add 10 * PCR Buffer (Mg ²⁺Free) 5 μ L.

(3) add MgCl ₂(25mmol/L) 4 μ L.

(4) add dNTP and mix (2.5mmol/Leach) 4 μ L.

(5) add reorganization pastoris genomic dna 5 μ L.

(6) add Tap polysaccharase (5U/ μ L) 0.5 μ L.

(7) add ddH ₂O 29.5 μ L.

Amplification reaction condition: 94 ℃ of 10min; 94 ℃ of 30s, 67.3 ℃ of 45s, 72 ℃ of 1min, totally 35 circulations; Last 72 ℃ are extended 10min.

2.3.3.5 foreign gene multiple copied transformant screening

(1) an amount of YPD substratum of preparation, the 100mg/mL G418 stock solution of adding proper volume, mixing shop system is dull and stereotyped, and preparation contains G418 (0mg/mL, 0.25mg/mL, 0.5mg/mL, 1.00mg/mL, 2.00mg/mL, YPD flat board 4.00mg/mL) of different concns.

(2) draw the 2mL sterilized water to each contain His ⁺The MD flat board of transformant is scraped with aseptic spreader and to be got bacterium colony, and thalline is resuspended in the aqua sterilisa.

(3) after bacteria suspension mixes, go in the aseptic centrifuge tube of 50mL vortex vibration 5-10s, spectrophotometric determination cell concn.

(4) get 1 * 105 somatic cells respectively and coat the YPD flat board that contains different G418 concentration that has prepared.

(5) 30 ℃ cultivate 2-5d after, picking to the bacterium colony of G418 maximum concentration tool resistance in YPD plate streaking purifying, as polygalacturonase abduction delivering bacterial strain to be selected.

2.4 yeast transformant is cultivated and the polygalacturonase abduction delivering

(1) picking is inoculated in the 250mL that fills 25mL BMGY substratum to shake in the bottle to the G418 tool the most positive bacterium colony of high resistance level, and 28-30 ℃ of shaking culture (250-300rpm) 16-18h to growing logarithmic phase, transforms pPIC9K empty carrier GS115 bacterial strain and is contrast.

(2) the centrifugal 5min of 5000rpm reclaims yeast cell, abandons supernatant, cell is resuspended in the BMMY substratum of proper volume, and the OD600 value reaches 1.0.

(3) place 500ml to shake bottle nutrient solution, 28-30 ℃ of shaking table concussion cultivated.

(4) 24h adds 100% methyl alcohol to final concentration 0.5%, successive induction at interval.

(5) the 24h sampling once to 168h, is got inducing culture liquid 1mL in the 1.5mL centrifuge tube at every turn at interval, the centrifugal 2-3min of maximum speed of revolution, and it is all frozen in-70 ℃ of refrigerator-freezers to get supernatant liquor and cell precipitation.

(6) expression product SDS-PAGE analyzes, and utilizes the DNS method to measure the polygalacturonase activity of abduction delivering then.

2.5 polygalacturonase fusion rotein purifying

2.5.1 the preparation of protein sample

(1) the yeast transformant culture of collection abduction delivering, the centrifugal 30min of 6000rpm abandons precipitation, gets supernatant.

(2) supernatant liquor is added (NH according to 60% saturation ratio ₄) ₂SO ₄The precipitation polygalacturonase, the centrifugal 30min of 8000rpm, collecting precipitation.

(3) after precipitation suspends again with 8ml Native Binding Buffer, dialysed overnight reject salt ion, the dialysis product is a protein sample to be purified.

2.5.2 protein purification step

2.5.2.1Ni-NTA the gel-purified post is prepared

(1) draw the 1.5ml gel resin and be added in the 10ml gel-purified Ni-NTA post, the slight centrifugal resin precipitated that makes is flow to end clear liquid to the pillar bottom.

(2) add 6ml distilled water, suspending resin again.

(3) the slight centrifugal resin precipitated that makes is flow to end clear liquid to the pillar bottom.

(4) add 6ml Native Binding Buffer, suspending resin again.

(5) continuous repeating step is 3 three times.

(6) continuous repeating step 4-5 is three times.

2.5.2.2 polygalacturonase purifying

(1) gets soluble proteins 8ml and inject the Ni-NTA post.

(2) the soft stirring suspends resin in protein liquid, and absorption 30-60min removes supernatant.

(3) with 8ml Native Wash Buffer flushing, make resin precipitated, remove supernatant to the pillar bottom.

(4) repeating step is 3 three times.

(5) with 8-12ml Native Elution Buffer eluted protein.

(6) repeating step 5 is once collected elution samples, gets the 1ml elutriant and carries out the SDS-PAGE analysis.

(7) elutriant is dialysed with distilled water, the ion that desalts obtains pure fusion rotein, after SDS-PAGE analyzes, measures the activity of purifying protein according to the method described above.

Implementation column 4 (RT-PCR of Pcipg 5 genes transcriptional expression level in the capsicum epidemic disease leaf and Northern Blot detect)

1. the phytophthora blight of pepper of participating in the experiment inoculation capsicum blade

(1) phytophthora blight of pepper of participating in the experiment is cultivated 7d on OMA matrix.

(2) utilize Petri solution to induce the generation sporocyst, handle 30min for 4 ℃ and induce the generation zoospore, being mixed with concentration is 1 * 105/ml zoospore suspension.

(3) sessile drop method is inoculated healthy capsicum blade, observes the disease symptom.

2. the total RNA of the sick Ye of capsicum extracts with cDNA synthetic

(1) the sick leaf of the capsicum of

inoculation

1d, 3d, 5d, 7d is got the 0.1g sample respectively and is carried out liquid nitrogen grinding after the DEPC water treatment, moves into the 1ml Trizol gentle and quiet 5min that puts of solution chamber.

(2) add the 0.2mL chloroform, the thorough mixing mixing, 4 ℃ of centrifugal 15min of following 12000rpm draw supernatant, repeat one to multiple time.

(3) draw supernatant, every 1ml Trizol adds 0.25 times of Virahol and 0.25 times of RNA precipitation agent, abundant mixing, and room temperature is placed 10min, 4 ℃ of centrifugal 10min of following 12000rpm.

(4) collect the RNA precipitation, with 75% washing with alcohol 2 times, repeated centrifugation.

(5) exhaust residual ethanol, or residual ethanol is vapored away.

(6) add 50-100 μ l DEPC treating water, down preserve standby in-70 ℃ RNA solution.

3. cDNA first chain is synthesized in reverse transcription

(1) get the total RNA of 1-2 μ g, add ddH2O to 9.5 μ L, 75 ℃ of sex change 5min, ice bath 5min is centrifugal a little.

(2) add 10X amplification buffer 2 μ L.

(3) add 10mmol/L dNTP mixed solution 2 μ L.

(4) add 25mmol/LMgCl ₂4 μ L.

(5) add primer Oligo-dT 1 μ L.

(6) add RNA enzyme inhibitors 0.5 μ L.

(7) add ThermoScript II M-MLV 1 μ L.

(8) the total system 20 μ L of reaction.

(9) after reaction solution mixed, room temperature was placed 10min, and 42 ℃ of temperature are bathed 60min, and 10min is placed in 85 ℃ of water-baths.

(10) add 180 μ L ddH ₂The O mixing, centrifugal a little ,-20 ℃ are descended to preserve, and establish 3 of negative controls and are respectively: 1. add all required reagent of first chain cDNA reaction, do not add template ribonucleic acid; 2. add all reagent except that ThermoScript II; 3. add all reagent except that primer.

4.RT-PCR

Reaction system: (1) adds distilled water 32.5 μ L; 10 * buffer, 5 μ L; MgCL ₂4 μ L; DNTP 4 μ L; Primer RT-5F: its sequence shown in Seq ID No:7,1 μ L; RT-5R: its sequence shown in Seq ID No:8,1 μ L; CDNA2 μ L, TaqE 0.5 μ L.

Amplification condition: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 1min, 64 ℃ of annealing 30s, 72 ℃ are extended 30s, 30 circulations; 72 ℃ are extended 10min, get 10 μ L PCR products, 1% agarose gel electrophoresis and detect.

β-actin reference system is the same, and primer is: β-actinF (its sequence is shown in Seq ID No:9); β-actinR (its sequence is shown in Seq ID No:10).

β-actin amplification condition: 94 ℃ of pre-sex change 4min; 94 ℃ of sex change 1min, 62 ℃ of annealing 1min, 72 ℃ are extended 30s, 30 circulations, 72 ℃ are extended 10min, through 1% agarose gel electrophoresis analysis.

5.Northern?Blot

5.1 the sick leaf method for extracting total RNA of capsicum is the same

5.2DIG-DNA probe mark preparation

(1) in a centrifuge tube, add 1 μ g RT-PCR amplified production in the distilled water of sterilization to final volume be 16 μ L.

(2) boiling water bath 10min places the ice bath cooling rapidly, denatured DNA.

(3) fully shake up DIG-High Prime, add 4 μ L in denatured DNA solution, mix also of short duration centrifugal.

(4) 37 ℃ of temperature are bathed 1h or are spent the night.

(5) add 2 μ L 0.2M EDTA (pH8.0) or 65 ℃ of temperature bath 10min with termination reaction.

5.3RNA shift with fixing

5.3.1 preparing gel

(1) get among the MOPS that the 0.72g agarose is dissolved in 56.7ml, heating is melted about postcooling to 60 ℃, adds 37% formaldehyde solution 3.3ml and cools off in the glue box.

(2) get 30 μ L RNA and add mixing in isopyknic sample-loading buffer.

Behind (3) 65 ℃ of incubation 15min, put into ice bath immediately and cool off, centrifugal 5s.

(4) before the application of sample,, subsequently sample is added to the gel well with gel prerunning 5min.

(5) gel is immersed in the 1X formaldehyde gel electrophoretic buffer 3-4V/cm voltage electrophoresis.

(6) take out gel behind the electrophoresis, with the drip washing of DEPC treating water for several times, each 3min.

(7) gel is soaked twice in 20 * SSC, each 15min removes the formaldehyde in the gel.

(8) nylon membrane is soaked 30min in 20 * SSC.

(9) utilizing hydrocone type to change embrane method commentaries on classics film spends the night.

(10) change film after, with 2XSSC vacuolar membrane 5-10min under room temperature, be sandwiched between two layers of filter paper and dry, then at 80 ℃ of roasting 2h or uv irradiating 5min with fixing RNA.

5.3.2 molecular hybridization

The DIG Easy Hyb (10mL/10cm of (1) preheating appropriate volume ²Film), in hybrid pipe, shakes film prehybridization 30min gently to 68 ℃.

(2) boil digoxin one labeled DNA probe 5min, ice/water-bath cooling fast makes it sex change (approximately 25ng/mL DIG EasyI-Iyb).

(3) add the DIG Easy Hyb (3.5mL/100cm of sex change digoxigenin labeled dna probe to preheating ²) in the film, fully mixing also avoids producing foam.

(4) outwell prehybridization solution, probe/hybridization mixed solution is added on the film, in hybrid heater, 68 ℃ of incubation 4h or spend the night, and mix and shake.

5.3.3 immunology detection

(1) washes film with 2XSSC and 0.5XSSC respectively, behind each 5min, in cleaning buffer solution, wash nylon membrane 1-5min again.

(2) incubation 30min in the 100mL lock solution.

(3) incubation 30min in the 20mL antibody-solutions.

(4) in 100mL rinsing damping fluid, wash 15min.

(5) detect balance 2-5min in the damping fluid at 20mL.

(6) drip developing solution on the film, behind the 15-25 ℃ of incubation 5min, 37 ℃ of incubation wet film 10min.

(7) the X-ray sheet is in 5-25 ℃ of development 15-25min.

Implementation column 5 (the Western Blot of Pcipg5 gene accurate translation level in the sick leaf of capsicum epidemic disease detects)

1, the sick leaf method for extracting total RNA of capsicum epidemic disease is the same

2, Pcipg 5 genetic expression albumen specific corrosioning anteserums preparation

(1) the Pcipg 5 genetic expression purifying proteins with preparation are diluted to 1mg/mL, make antigen liquid.

(2) get an amount of purifying protein liquid and hatch in 1: 1 ratio adding Freund's incomplete adjuvant, about hatching 45min, preparation contains the antigen oil-emulsion of 500 μ g/mL expression products approximately.

(3) get 1 healthy rabbits and carry out immunity with emulsive Pcipg 5 genetic expression albumen, continuous immunity 3 times, be 1 week each immune pitch time, carries out the 4th immunity after 1 week, gets blood after two weeks.

(4) blood sample is positioned over 4 ℃ of refrigerator-freezers, the precipitation of spending the night is drawn an amount of serum then.

(5) utilize the agar diffusion method to detect the serum titer and the specialization of preparation.

3、Western?Blot

3.1SDS-PAGE electrophoretic analysis is the same.

3.2 electrotransfer step

(1) cuts with gel nitrocellulose filter of the same size (NC film) and in methyl alcohol, soak 30min, make film to translucent.

(2) filter paper and sponge are soaked in electricity changes among the damping fluid PBST (adding Tween-20 50ul in the PBS damping fluid of 100mL mixes) to using.

(3) adopting electricity to change liquid (25mM Tris pH8.0,192mM glycine, 20% methyl alcohol) transforms.

(4) conversion process with 100V voltage 150mA current transfer 1-2h, transforms 30min with 100V voltage 240mA electric current earlier then.

(5) behind the SDS-PAGE electrophoresis, place distilled water to clean 2 times gel.

(6) according to sponge pad, filter paper, gel, the NC film, filter paper, the order of sponge pad, on the electrotransfer instrument, adding the 1.5L electricity changes damping fluid with gel sets.

(7) be negative pole according to gel, the NC film is an anodic order electrophoresis, and electricity changes to be reflected under 4 ℃ and carries out.

3.2 a fusion rotein and a resistive connection close step

(1) get the NC film be soaked in 15ml blocking-up damping fluid (add skim-milk in the PBST damping fluid, additional proportion is w/v=5: 100), the level 1-2h that slowly vibrates then.

(2) use 25ml PBST buffer solution elution surface confining liquid 3 times, each wash-out 5min.

(3) film is gone to contain in the anti-solution, an anti-configuration is tired with reference to it, according to 1: 1000 ratio and blocking-up damping fluid uniform mixing, and the level 2-3h that slowly vibrates then.

(4) change buffer solution elution NC film with the 20ml electricity, each 5min.

3.3 two resistive connections close and develop the color

(1) contain an anti-NC film and go to (two anti-solution are with blocking damping fluid according to 1: 200 dilution proportion) in two anti-(goat anti-rabbit igg of HRP mark) solution, room temperature is slowly shaken 2-3h.

(2) electricity consumption is changeed damping fluid 20ml wash-out 3-4 time, each 5min, and film is transferred to dark locating.

(3) the DAB colouring reagents box that provides according to Beijing Xi Kai company carries out color operation, and film is gone to wherein, and dark condition is colour developing 5-20min down.

(4) treat that protein band develops the color when clear, uses 20ml ddH ₂The O termination reaction is taken a picture with digital camera or gel imaging system then.

Implementation column 6 (Pcipg 5 genetic expression purifying proteins are to the destruction and the cell wall degradation of capsicum blade)

1, Pcipg 5 genetic expression purifying proteins inoculation capsicum vane operation

(1) Pcipg 5 genetic expression purifying proteins being diluted to concentration is 700 μ g/mL.

(2) utilize needle punching, the expression and purification albumen of suitable concentration is inoculated in the capsicum blade of 4-6 leaf phase.

(3) adopt same inoculation method, (concentration is that passivation albumen, the sterilized water of 1 * 105mL), 700 μ g/mL is inoculated in healthy capsicum blade of the same period with Phytophthora capsici zoospore suspension.

The results expression purifying protein cause inoculating leaf-shrinkage, and the albumen after passivation is consistent with sterilized water, and the capsicum blade is not almost had any destruction to the tangible destruction of capsicum blade tool.

2, Pcipg 5 genetic expression purifying proteins are to the destruction symptom of capsicum blade and the transmission electron microscope observing of degradation of cell wall

2.1 observation of symptoms

(1) the proteic capsicum blade observation of symptoms of inoculation.

(2) the capsicum blade observation of symptoms of inoculation zoospore.

(3) positive, negative control capsicum blade observation of symptoms comprehensively compares the destruction of Pcipg 5 genetic expression purifying proteins to the capsicum blade.

2.2 transmission electron microscope observing

(1) sampling and fixing: during the albumen inoculation capsicum blade 1-7d, 24h takes a sample once at interval, and the fritter sample of getting is put into 2.5% glutaraldehyde solution, bleeds, and guarantees that cell is fixing rapidly.

(2) dehydrating step: 70% acetone 15min-80% acetone 14min-90% acetone 15min-100% acetone, 2 * 10min, guarantee that embedding medium infiltrates in the cell fully, all drives away ICW.

(3) soak into and the embedding step: with the material of processed after Resins, epoxy and dodecyl succinic anhydride soak into 1d, in porous rubber embedding template, handle, in 45 ℃ of baking boxs, handle 12h then, in 60 ℃ of baking boxs, handle 36h again and make the resin polymerization sclerosis, form embedded block.

(4) section and dyeing

1. repair piece: embedded block as in the clamper, is placed the miter angle degree with tissue under the anatomical lens, remove embedding medium, and accomplish cone shape.

2. semithin section location: utilize ultramicrotome will handle material and cut into the section of thickness for 1-10 μ m, use the small brushes dislocation then on slide glass, heating flattens section, to be dried after, use Toluidine blue staining, observation by light microscope is located then.

3. ultrathin section(ing): will cut into slices after the cutting with automatic clinical microtome, and be positioned over and carry on the nethike embrane.

4. dyeing: ultrathin section(ing) is dyeed with acetic acid uranium.

(5) electron microscopic observation, photograph

1. observe: will make the degraded of complete ultrathin section(ing) observation of cell wall under 30,000 times of transmission electron microscopes.

2. take a picture: the material of selecting cell walls to obtain obvious degradation is taken a picture, and its result as shown in Figure 6.

＜110〉Shandong Agricultural University

＜120〉Phytophthora capsici pectin methyl esterase Pcipg 5 genes, proteic preparation method and application thereof

<160>10

<210>1

<211>1086

<212>DNA

＜213〉Phytophthora capsici (Phytophthora capsici)

<220>

<221>sig_peptide

<222>(1)…(60)

<221>CDS

<222>(1)…(1086)

<400>1

atg?aag?ctc?ttc?tcc?act?gtc?acc?gca?gcc?ctc?gcg?ctc?cta?gcc?acc 48

Met?Lys?Leu?Phe?Ser?Thr?Val?Thr?Ala?Ala?Leu?Ala?Leu?Leu?Ala?Thr

1 5 10 15

acc?gtc?aac?gga?aca?ccc?atg?atc?cgt?cag?gca?gaa?gaa?gcc?tca?acc 96

Thr?Val?Asn?Gly?Thr?Pro?Met?Ile?Arg?Gln?Ala?Glu?Glu?Ala?Ser?Thr

20 25 30

tgt?acc?ctc?tcc?ggc?acg?tac?aag?tcc?ggc?acc?gac?atc?tcg?tcc?tgc 144

Cys?Thr?Leu?Ser?Gly?Thr?Tyr?Lys?Ser?Gly?Thr?Asp?Ile?Ser?Ser?Cys

35 40 45

agc?acg?ctc?acc?atc?ggc?act?ctg?agc?gtt?cct?gcc?ggt?gtc?acg?ctg 192

Ser?Thr?Leu?Thr?Ile?Gly?Thr?Leu?Ser?Val?Pro?Ala?Gly?Val?Thr?Leu

50 55 60

gac?ctg?agc?aag?gcc?aag?acg?ggc?gct?aac?atc?aag?atc?tcc?ggt?acc 240

Asp?Leu?Ser?Lys?Ala?Lys?Thr?Gly?Ala?Asn?Ile?Lys?Ile?Ser?Gly?Thr

65 70 75 80

gtc?acg?ttc?ggc?cag?aag?aag?tgg?gcc?ggt?ccg?ctc?gtg?ttg?ctt?ggc 288

Val?Thr?Phe?Gly?Gln?Lys?Lys?Trp?Ala?Gly?Pro?Leu?Val?Leu?Leu?Gly

85 90 95

ggc?agt?aac?ctc?aag?gtc?agc?ggg?tcc?ggt?act?ctt?gac?ggt?cag?ggg 336

Gly?Ser?Asn?Leu?Lys?Val?Ser?Gly?Ser?Gly?Thr?Leu?Asp?Gly?Gln?Gly

100 105 110

tct?tgg?tac?tgg?aag?caa?ggg?cag?tcg?atc?act?cgc?cca?gta?ttc?ttc 384

Ser?Trp?Tyr?Trp?Lys?Gln?Gly?Gln?Ser?Ile?Thr?Arg?Pro?Val?Phe?Phe

115 120 125

cgt?ctc?cag?aac?gtc?ctc?agc?tca?act?gtt?tct?gga?ttt?act?att?aag 432

Arg?Leu?Gln?Asn?Val?Leu?Ser?Ser?Thr?Val?Ser?Gly?Phe?Thr?Ile?Lys

130 135 140

aac?atg?ccg?ttc?cgt?acc?ttc?agc?att?gtc?acc?tgc?aag?gat?acg?aca 480

Asn?Met?Pro?Phe?Arg?Thr?Phe?Ser?Ile?Val?Thr?Cys?Lys?Asp?Thr?Thr

145 150 155 160

ctg?tcg?gga?ctt?acg?atc?gac?tcg?agc?gct?ggc?aac?ggc?ctg?gcc?aag 528

Leu?Ser?Gly?Leu?Thr?Ile?Asp?Ser?Ser?Ala?Gly?Asn?Gly?Leu?Ala?Lys

165 170 175

aac?aca?gac?ggc?ttc?gac?ctg?act?aag?aac?aac?cat?atc?acg?atc?acc 576

Asn?Thr?Asp?Gly?Phe?Asp?Leu?Thr?Lys?Asn?Asn?His?Ile?Thr?Ile?Thr

180 185 190

ggc?aac?aag?atc?tac?aac?cag?gat?gac?tgt?ttg?gca?atg?cag?tcc?agt 624

Gly?Asn?Lys?Ile?Tyr?Asn?Gln?Asp?Asp?Cys?Leu?Ala?Met?Gln?Ser?Ser

195 200 205

acg?aac?acc?gta?ttc?agc?aac?aac?tac?tgc?agt?ggc?ggt?cac?ggt?atc 672

Thr?Asn?Thr?Val?Phe?Ser?Asn?Asn?Tyr?Cys?Ser?Gly?Gly?His?Gly?Ile

210 215 220

tcc?atc?gga?tcg?ctc?ggt?gga?acc?gct?gtc?aac?caa?ggt?tcc?acg?gtc 720

Ser?Ile?Gly?Ser?Leu?Gly?Gly?Thr?Ala?Val?Asn?Gln?Gly?Ser?Thr?Val

225 230 235 240

cag?ggc?ctc?acg?gtc?aag?ggc?aac?acc?atc?gtc?aat?agc?acc?aac?ggc 768

Gln?Gly?Leu?Thr?Val?Lys?Gly?Asn?Thr?Ile?Val?Asn?Ser?Thr?Asn?Gly

245 250 255

ctc?cgc?atc?aag?acc?atc?gtg?gat?ctc?aag?ggt?ctt?gtg?tct?gat?gtc 816

Leu?Arg?Ile?Lys?Thr?Ile?Val?Asp?Leu?Lys?Gly?Leu?Val?Ser?Asp?Val

260 265 270

acg?tac?acc?gac?aac?aag?ctg?agc?aac?gtc?aag?aac?gcc?atc?gtg?atc 864

Thr?Tyr?Thr?Asp?Asn?Lys?Leu?Ser?Asn?Val?Lys?Asn?Ala?Ile?Val?Ile

275 280 285

cac?tcg?gac?tac?agc?aag?tcc?aag?ggc?gga?tac?acc?ggt?aag?gcc?acg 912

His?Ser?Asp?Tyr?Ser?Lys?Ser?Lys?Gly?Gly?Tyr?Thr?Gly?Lys?Ala?Thr

290 295 300

agc?gca?gtg?acc?atc?aag?gac?atc?acc?gtc?tcg?ggt?ctc?tca?ggt?acg 960

Ser?Ala?Val?Thr?Ile?Lys?Asp?Ile?Thr?Val?Ser?Gly?Leu?Ser?Gly?Thr

305 310 315 320

gcg?acc?aac?ctg?tac?gac?atc?gtg?gcc?aac?tcc?aag?gtg?gtg?tcc?aac 1008

Ala?Thr?Asn?Leu?Tyr?Asp?Ile?Val?Ala?Asn?Ser?Lys?Val?Val?Ser?Asn

325 330 335

tgg?aag?ttc?tcg?ggc?atc?act?gtc?aag?gca?tcc?aag?acg?ggc?aag?tgc 1056

Trp?Lys?Phe?Ser?Gly?Ile?Thr?Val?Lys?Ala?Ser?Lys?Thr?Gly?Lys?Cys

340 345 350

agc?ggt?caa?ccc?agc?act?gtc?aag?tgc?taa 1086

Ser?Gly?Gln?Pro?Ser?Thr?Val?Lys?Cys?***

355 360

<210>2

<211>361

<212>PRT

＜213〉Phytophthora capsici (Phytophthora capsici)

<220>

<221>SIGNAL

<222>(1)…(20)

<400>2

Met?Lys?Leu?Phe?Ser?Thr?Val?Thr?Ala?Ala?Leu?Ala?Leu?Leu?Ala?Thr

1 5 10 15

Thr?Val?Asn?Gly?Thr?Pro?Met?Ile?Arg?Gln?Ala?Glu?Glu?Ala?Ser?Thr

20 25 30

Cys?Thr?Leu?Ser?Gly?Thr?Tyr?Lys?Ser?Gly?Thr?Asp?Ile?Ser?Ser?Cys

35 40 45

Ser?Thr?Leu?Thr?Ile?Gly?Thr?Leu?Ser?Val?Pro?Ala?Gly?Val?Thr?Leu

50 55 60

Asp?Leu?Ser?Lys?Ala?Lys?Thr?Gly?Ala?Asn?Ile?Lys?Ile?Ser?Gly?Thr

65 70 75 80

Val?Thr?Phe?Gly?Gln?Lys?Lys?Trp?Ala?Gly?Pro?Leu?Val?Leu?Leu?Gly

85 90 95

Gly?Ser?Asn?Leu?Lys?Val?Ser?Gly?Ser?Gly?Thr?Leu?Asp?Gly?Gln?Gly

100 105 110

Ser?Trp?Tyr?Trp?Lys?Gln?Gly?Gln?Ser?Ile?Thr?Arg?Pro?Val?Phe?Phe

115 120 125

Arg?Leu?Gln?Asn?Val?Leu?Ser?Ser?Thr?Val?Ser?Gly?Phe?Thr?Ile?Lys

130 135 140

Asn?Met?Pro?Phe?Arg?Thr?Phe?Ser?Ile?Val?Thr?Cys?Lys?Asp?Thr?Thr

145 150 155 160

Leu?Ser?Gly?Leu?Thr?Ile?Asp?Ser?Ser?Ala?Gly?Asn?Gly?Leu?Ala?Lys

165 170 175

Asn?Thr?Asp?Gly?Phe?Asp?Leu?Thr?Lys?Asn?Asn?His?Ile?Thr?Ile?Thr

180 185 190

Gly?Asn?Lys?Ile?Tyr?Asn?Gln?Asp?Asp?Cys?Leu?Ala?Met?Gln?Ser?Ser

195 200 205

Thr?Asn?Thr?Val?Phe?Ser?Asn?Asn?Tyr?Cys?Ser?Gly?Gly?His?Gly?Ile

210 215 220

Ser?Ile?Gly?Ser?Leu?Gly?Gly?Thr?Ala?Val?Asn?Gln?Gly?Ser?Thr?Val

225 230 235 240

Gln?Gly?Leu?Thr?Val?Lys?Gly?Asn?Thr?Ile?Val?Asn?Ser?Thr?Asn?Gly

245 250 255

Leu?Arg?Ile?Lys?Thr?Ile?Val?Asp?Leu?Lys?Gly?Leu?Val?Ser?Asp?Val

260 265 270

Thr?Tyr?Thr?Asp?Asn?Lys?Leu?Ser?Asn?Val?Lys?Asn?Ala?Ile?Val?Ile

275 280 285

His?Ser?Asp?Tyr?Ser?Lys?Ser?Lys?Gly?Gly?Tyr?Thr?Gly?Lys?Ala?Thr

290 295 300

Ser?Ala?Val?Thr?Ile?Lys?Asp?Ile?Thr?Val?Ser?Gly?Leu?Ser?Gly?Thr

305 310 315 320

Ala?Thr?Asn?Leu?Tyr?Asp?Ile?Val?Ala?Asn?Ser?Lys?Val?Val?Ser?Asn

325 330 335

Trp?Lys?Phe?Ser?Gly?Ile?Thr?Val?Lys?Ala?Ser?Lys?Thr?Gly?Lys?Cys

340 345 350

Ser?Gly?Gln?Pro?Ser?Thr?Val?Lys?Cys ***

355 360

<210>3

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉n=a or c or g or t

<222>(5)

<220>

<221>misc_feature

＜223〉n=a or g

<222>(8，16)

<220>

<221>misc_feature

＜223〉n=a or c or t

<222>(11)

<220>

<221>misc_feature

＜223〉n=c or t

<222>(14)

<220>

<221>misc_feature

＜223〉n=g or t

<222>(17)

<400>3

acggncangg?ngcntnntac?tgg 23

<210>4

<211>23

<212>DNA

＜213〉artificial sequence

<400>4

gatgatggtc?ttgatgcgga 20

<210>5

<211>63

<212>DNA

＜213〉artificial sequence

<400>5

tatagaattc?caccaccacc?accaccacga?cgacgacgac?aagacaccca?tgatccgtca 60

ggc 63

<210>6

<211>32

<212>DNA

＜213〉artificial sequence

<400>6

tatagcggcc?gcttagcact?tgacagtgct?gg 32

<210>7

<211>24

<212>DNA

＜213〉artificial sequence

<400>7

gggtccggta?ctcttgacgg?tcag 24

<210>8

<211>24

<212>DNA

＜213〉artificial sequence

<400>8

cacgatggcg?ttcttgacgt?tgct 24

<210>9

<211>22

<212>DNA

＜213〉artificial sequence

<400>9

ctgggacgac?atggagaaga?tc 22

<210>10

<211>21

<212>DNA

＜213〉artificial sequence

<400>10

cgctccgtca?ggatcttcat?c 21

Claims

1. phytophthora blight of pepper polygalacturonase Pcipg 5 genes, the protein that it is characterized in that this coded by said gene has the capsicum of the causing blade position that is injured and produces shrinkage and necrosis, and the be injured cell walls at position of blade is significantly degraded, its gene order is shown in Seq ID No:1; Its protein amino acid sequence is shown in the SEQ ID NO:2.

2. phytophthora blight of pepper polygalacturonase Pcipg 5 gene isolation are cloned and proteinic preparation method, and its step is as follows:

1) Pcipg 5 gene isolation clone's concrete steps:

A: adopt the CTAB method to extract phytophthora blight of pepper DNA, make up genome dna library with the suggestion of QIAEXII GEL Extraction Kit reagent, with size is that the dna fragmentation of 1.5Kb-3.0Kb is connected in carrier PUC19, transformed into escherichia coli DH5 α, and PCR identifies the library quality.

B: according to the polygalactunonic acid enzyme gene conserved sequence of reporting plant, bacterium, fungi, design degenerated primer P710 (its sequence is shown in Seq ID No:3) and P1150R (its sequence is shown in Seq ID No:4), utilize Pooling-PCR technology screening DNA library, the positive colony order-checking obtains the full length gene sequence.

2) prepare proteinic concrete steps:

The structure of A:Pcipg 5 gene yeast expression vectors, goal gene is cloned among the expression vector pPIC9K.

B: after above-mentioned recombinant expression vector linearizing, transform pichia spp GS115 competent cell, yeast transformant methyl alcohol utilizes the plate screening of phenotype.

C: the cultivation of yeast transformant and the methanol induction of polygalacturonase are expressed, and the expression product biologic activity detects, SDS-PAGE analyzes the polygalacturonase purifying.

3. the protein by Pcipg 5 genes encodings is applied to the cell wall degradation effect at the inoculation Folium Capsici sheet destruction and the position that is injured is detected.