CN101845414B

CN101845414B - Method for preparing hydroxyalkanoate homopolymer and special bacteria thereof

Info

Publication number: CN101845414B
Application number: CN2010101613141A
Authority: CN
Inventors: 陈国强
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2010-04-28
Filing date: 2010-04-28
Publication date: 2012-07-18
Anticipated expiration: 2030-04-28
Also published as: CN101845414A

Abstract

The invention discloses a method for preparing hydroxyalkanoate homopolymer and special bacteria thereof. Recombinant pseudomonas putida is prepared by the method comprising the following steps of: depriving coding functions of 3-hydroxyfatty acyl-coenzyme A dehydrogenase coding gene and 3-ketoacyl coenzyme A thiolase coding gene in pseudomonas putida to obtain recombinant pseudomonas putida, and recording the recombinant pseudomonas putida as recombinant pseudomonas putida I. Experiments prove that the hydroxyalkanoate homopolymer, particularly medium and long-chain hydroxyalkanoate homopolymer (C4-C14), can be obtained by using the recombinant bacteria organism to synthesize polyhydroxyalkanoate. The obtained hydroxyalkanoate homopolymer has high purity and high yield. The method of the invention can synthesize the medium and long-chain hydroxyalkanoate homopolymer with random length, and overcomes the defect that only one 3-hydroxybutyrate (HB) homopolymer can be obtained by biosynthesis in the prior art. Therefore, the method of the invention has broad application prospect in the biosynthesis field of the hydroxyalkanoate homopolymer.

Description

A kind of method and special bacterium thereof for preparing hydroxyalkanoate homopolymer

Technical field

The present invention relates to a kind of method and special bacterium thereof for preparing hydroxyalkanoate homopolymer.

Background technology

Polyhydroxyalkanoate (Polyhydroxyalkanoates is called for short PHA) is a kind of can in extracellular microbial, the existence with granular inclusion form by polyester in many mikrobe synthetic born of the same parents, is the interior a kind of carbon source of bacterium born of the same parents and the reserve of the energy.Because its physical material performance close with plastics and biodegradable performance are called as biodegradable plastic.Polyhydroxyalkanoate has following structure: wherein, and m=1,2,3 or 4, common m=1; N representes the polymerization degree; R is the alterable height side chain, can be saturated or unsaturated, straight or branched, aliphatics or aromatic group.When the R=ethyl or when following, be short chain PHA; When the R=heptyl or when above, be long-chain PHA; When being situated between, be medium chain PHA.

The result of study of field of tissue engineering technology shows that PHA also has excellent biological compatibility in recent years, is very potential bio-medical material.PHA can be divided three classes according to the difference of monomer whose structure: short chain PHA, the carbonatoms of monomer whose be less than 6, like poly 3-hydroxy butyrate PHB, and 3-hydroxybutyric acid valeric acid copolyesters PHBV; Long-chain copolymerization PHA in the short chain had both contained short chain PHA monomer, long-chain PHA monomer in containing again, as gather 3-hydroxybutyric acid capronate; Middle long-chain PHA contains carbonatoms and is not less than 6 monomer.The PHA that different monomers is formed has different physical propertiess, for example intensity, ductility, crystallization rate etc.Along with the rising of long-chain 3-hydroxy fatty acid monomer content, the variation of matter has taken place in middle long-chain PHA performance, become from softness even viscosity have elasticity, percent crystallinity and rigidity.In general, mikrobe can only be synthesized the homopolymer of poly 3-hydroxy butyrate PHB, and the monomer of other PHA can only exist with the form of multipolymer.Also do not find to have the mikrobe wild strain that can synthesize non-PHB homopolymer at present.Because the more distinctive performances of homopolymer add from homopolymer to obtain the chiral hydroxyl group fatty acid mono easily, so carry out the synthetic very necessity that seems of the mikrobe of homopolymer.

Pseudomonas putida (Pseudomonas putida) can be a carbon source with lipid acid or its salt, and biosynthesizing obtains polyhydroxyalkanoate.Pseudomonas putida Pseudomonas putida KT2442 is a long-chain PHA synthetic type culture in the strain research.

Summary of the invention

An object of the present invention is to provide a kind of recombinant pseudomonas putida.

Recombinant pseudomonas putida provided by the present invention is as following 1), 2), 3), 4) or 5) shown in:

1) said recombinant pseudomonas putida is according to the preparation of the method that comprises the steps: 3-hydroxyl fatty acyl-CoA dehydrogenase encoding sox and the encoding function of 3-keto acyl coenzyme A thiolase encoding sox of using in the pseudomonas that stinks of are lost; Obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida I;

2) said recombinant pseudomonas putida is to prepare according to the method that comprises the steps: make the encoding function forfeiture of the 3-hydroxyl acyl lipophorin thiophorase encoding sox among the said recombinant pseudomonas putida I; Obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida II;

3) said recombinant pseudomonas putida is to prepare according to the method that comprises the steps: in said recombinant pseudomonas putida II, import Poly-synthetase-coding gene and 4-maloyl group thiophorase encoding sox; Obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida III;

4) said recombinant pseudomonas putida is to prepare according to the method that comprises the steps: the encoding sox and the pha synthesizing enzyme encoding sox that in said recombinant pseudomonas putida II, import the protein-bonded encoding sox of PHA particle, enoyl coenzyme A hydratase; Obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida IV;

5) said recombinant pseudomonas putida is according to the preparation of the method that comprises the steps: the encoding function of encoding sox of encoding sox and the fatty acyl-CoA dehydrogenase of the 3-hydroxyl fatty acyl-CoA dehydrogenase among the said recombinant pseudomonas putida II is lost; Obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida V.

Above-mentioned 1) shown in the recombinant pseudomonas putida, said 3-hydroxyl fatty acyl-CoA dehydrogenase encoding sox and the encoding function forfeiture of 3-keto acyl coenzyme A thiolase encoding sox of using in the pseudomonas that stinks of realizes through homologous recombination; The method of said homologous recombination comprises the steps: in the said pseudomonas putida that sets out to import in the sequence table DNA shown in the sequence 2 among the DNA shown in the sequence 1 and sequence table; The encoding sox generation homologous recombination of the 3-hydroxyl fatty acyl-CoA dehydrogenase in the said sequence table in DNA shown in the sequence 1 and the said pseudomonas putida that sets out; The encoding sox generation homologous recombination of the 3-keto acyl coenzyme A thiolase in the said sequence table in DNA shown in the sequence 2 and the said pseudomonas putida that sets out obtains said recombinant pseudomonas putida I;

Above-mentioned 2) shown in the recombinant pseudomonas putida, said the encoding function forfeiture of the 3-hydroxyl acyl lipophorin thiophorase encoding sox among the said recombinant pseudomonas putida I is realized through homologous recombination; The method of said homologous recombination comprises the steps: in said recombinant pseudomonas putida I, to import DNA shown in the sequence 3 in the sequence table; The encoding sox generation homologous recombination of the 3-hydroxyl acyl lipophorin thiophorase in the said sequence table among DNA shown in the sequence 3 and the said recombinant pseudomonas putida I obtains said recombinant pseudomonas putida II;

Above-mentioned 3) in the recombinant pseudomonas putida, said Poly-synthetase-coding gene and 4-maloyl group thiophorase encoding sox import through recombinant vectors shown in;

Said recombinant vectors prepares according to following method: plasmid pKSSE5.3 is carried out enzyme with restriction enzyme BamHI and EcoRI cut, reclaim big fragment, note is made big fragment I; Carrier pBBR1-MCS2 is carried out enzyme with restriction enzyme BamHI and EcoRI cut, reclaim the big fragment of carrier, note is made big fragment II; Said big fragment I is connected with said big fragment II, obtains said recombinant vectors;

Above-mentioned 4) in the recombinant pseudomonas putida, the encoding sox and the pha synthesizing enzyme encoding sox of the protein-bonded encoding sox of said PHA particle, enoyl coenzyme A hydratase import through recombinant vectors shown in; Said recombinant vectors is that KpnI and EcoRI site that the fusion gene that the encoding sox of the protein-bonded encoding sox of said PHA particle, pha synthesizing enzyme encoding sox and enoyl coenzyme A hydratase constitutes inserts carrier pBBR1-MCS2 are obtained; The protein-bonded encoding sox of said PHA particle is positioned at the upper reaches of said fusion gene, and said pha synthesizing enzyme encoding sox is positioned at the middle reaches of said fusion gene, and the encoding sox of said enoyl coenzyme A hydratase is positioned at the downstream of said fusion gene;

Above-mentioned 5) shown in the recombinant pseudomonas putida, the encoding function forfeiture of the encoding sox of said encoding sox that makes the 3-hydroxyl fatty acyl-CoA dehydrogenase among the said recombinant pseudomonas putida II and fatty acyl-CoA dehydrogenase realizes through homologous recombination; The method of said homologous recombination comprises the steps: in said recombinant pseudomonas putida II to import in the sequence table DNA shown in the sequence 10 among the DNA shown in the sequence 9 and sequence table; The encoding sox generation homologous recombination of the 3-hydroxyl fatty acyl-CoA dehydrogenase in the said sequence table among DNA shown in the sequence 9 and the said recombinant pseudomonas putida II; The encoding sox generation homologous recombination of the fatty acyl-CoA dehydrogenase in the said sequence table among DNA shown in the sequence 10 and the said recombinant pseudomonas putida II obtains said recombinant pseudomonas putida V.

Above-mentioned 1) shown in the recombinant pseudomonas putida, in the said sequence table in DNA shown in the sequence 1 and the sequence table DNA shown in the sequence 2 import through recombinant vectors; Said recombinant vectors is that XbaI and HindIII site that the fusion gene that DNA shown in the sequence 2 in DNA shown in the sequence 1 in the said sequence table and the table constitutes inserts the carrier pK18mobSacB that sets out are obtained; DNA shown in the sequence 1 is positioned at the upper reaches of fusion gene in the said sequence table, and DNA shown in the sequence 2 is positioned at the downstream of fusion gene in the said table;

Above-mentioned 2) in the recombinant pseudomonas putida, DNA shown in the sequence 3 imports through recombinant vectors in the said sequence table shown in; Said recombinant vectors is that HindIII and XmaI site that DNA shown in the sequence 3 in the said sequence table inserts the carrier pK18mobSacB that sets out are obtained;

Above-mentioned 3) in the recombinant pseudomonas putida, the nucleotide sequence of said Poly-synthetase-coding gene is shown in sequence in the sequence table 4 shown in, and the nucleotide sequence of said 4-maloyl group thiophorase encoding sox is shown in sequence in the sequence table 5; Said Poly-synthetase-coding gene is positioned at the upper reaches of said fusion gene, and said 4-maloyl group thiophorase encoding sox is positioned at the downstream of said fusion gene;

Above-mentioned 4) in the recombinant pseudomonas putida, the nucleotide sequence of the protein-bonded encoding sox of said PHA particle is shown in sequence in the sequence table 6 shown in, and the nucleotide sequence of the encoding sox of said enoyl coenzyme A hydratase is shown in sequence in the sequence table 7; The nucleotide sequence of said pha synthesizing enzyme encoding sox is shown in sequence in the sequence table 8;

Said recombinant vectors obtains according to following method: the genomic dna with Aeromonas hydrophila 4AK4 is a template, to carrying out pcr amplification, obtains the PCR product with following primer; With restriction enzyme KpnI and EcoRI said pcr amplification product is carried out double digestion, reclaim gene fragment; With restriction enzyme KpnI and EcoRI carrier pBBR1-MCS2 is carried out double digestion, reclaim enzyme and cut big fragment; Said gene fragment and said enzyme are cut big fragment be connected, obtain said recombinant vectors;

Above-mentioned 5) shown in the recombinant pseudomonas putida, in the said sequence table in DNA shown in the sequence 9 and the sequence table DNA shown in the sequence 10 import through recombinant vectors; Said recombinant vectors is that HindIII and BamHI site that the fusion gene that DNA shown in the sequence 10 in DNA shown in the sequence 9 and the sequence table in the said sequence table constitutes inserts the carrier pK18mobSacB that sets out are obtained; DNA shown in the sequence 9 is positioned at the upper reaches of said fusion gene in the said sequence table, and DNA shown in the sequence 10 is positioned at the downstream of said fusion gene in the said sequence table.

In above-mentioned arbitrary described recombinant pseudomonas putida, the said carrier that sets out is pK18mobSacB or pBBR1-MCS2; The said pseudomonas putida that sets out is strain Pseudomonas putida KTOY06.

The application of above-mentioned arbitrary described recombinant pseudomonas putida in the preparation polyhydroxyalkanoate also belongs to protection scope of the present invention.

Last purpose of the present invention provides a kind of method for preparing polyhydroxyalkanoate.

The method for preparing polyhydroxyalkanoate provided by the present invention comprises the steps: that with lipid acid, solubility soap or gamma-butyrolactone be carbon source, carries out biosynthesizing with above-mentioned arbitrary said recombinant pseudomonas putida, obtains polyhydroxyalkanoate.

In the aforesaid method, the said biosynthetic method above-mentioned arbitrary said recombinant pseudomonas putida that comprises the steps: to ferment obtains containing the fermented liquid of said recombinant pseudomonas putida; In the said fermented liquid that contains recombinant pseudomonas putida, adding said lipid acid or said solubility soap or said gamma-butyrolactone, is to continue to cultivate 39h under 30 ℃ the condition in temperature, obtains polyhydroxyalkanoate.

In the aforesaid method, said lipid acid is valeric acid, caproic acid, enanthic acid, sad, n-nonanoic acid, capric acid, LAURIC ACID 99 MIN or myristic acid, and said solubility soap is natrium valericum, Sodium n-caproate, enanthic acid sodium, Sodium octoate, n-nonanoic acid sodium or Sodium decanoic acid.

In the aforesaid method, said polyhydroxyalkanoate is hydroxyalkanoate homopolymer or hydroxy fatty acid ester copolymer;

Said biosynthetic method is following 1), 2), 3), 4) or 5) shown in:

1) said recombinant pseudomonas putida is recombinant pseudomonas putida I, and said solubility soap is enanthic acid sodium, and the chemical formula of said polyhydroxyalkanoate is suc as formula shown in the I, and the number-average molecular weight of said polyhydroxyalkanoate is 252 * 10 ³Da, the weight-average molecular weight of said polyhydroxyalkanoate is 455 * 10 ³Da; The concentration of said enanthic acid sodium in the said fermented liquid that contains pseudomonas putida is 5g/L;

2) said recombinant pseudomonas putida is recombinant pseudomonas putida II, and said solubility soap is Sodium n-caproate, and the chemical formula of said polyhydroxyalkanoate is suc as formula shown in the II-1, and the number-average molecular weight of said polyhydroxyalkanoate is 206 * 10 ³Da, the weight-average molecular weight of said polyhydroxyalkanoate is 272 * 10 ³Da; The concentration of said Sodium n-caproate in the said fermented liquid that contains pseudomonas putida is 10g/L;

Said recombinant pseudomonas putida is recombinant pseudomonas putida II, and said solubility soap is Sodium octoate, and the chemical formula of said polyhydroxyalkanoate is suc as formula shown in the II-2, and the number-average molecular weight of said polyhydroxyalkanoate is 148 * 10 ³Da, the weight-average molecular weight of said polyhydroxyalkanoate is 180 * 10 ³Da; The concentration of said Sodium n-caproate in the said fermented liquid that contains pseudomonas putida is 10g/L;

3) said recombinant pseudomonas putida is recombinant pseudomonas putida III, and said carbon source is a gamma-butyrolactone, and the chemical formula of said polyhydroxyalkanoate is shown in formula III, and the number-average molecular weight of said polyhydroxyalkanoate is 487 * 10 ³Da, the weight-average molecular weight of said polyhydroxyalkanoate is 854 * 10 ³Da; The concentration of said gamma-butyrolactone in the said fermented liquid that contains pseudomonas putida is 5g/L;

4) said recombinant pseudomonas putida is recombinant pseudomonas putida IV: said solubility soap is natrium valericum, and the chemical formula of said polyhydroxyalkanoate is suc as formula shown in the IV, and the number-average molecular weight of said polyhydroxyalkanoate is 815 * 10 ³Da, the weight-average molecular weight of said polyhydroxyalkanoate is 1056 * 10 ³Da; The concentration of said natrium valericum in the said fermented liquid that contains pseudomonas putida is 5g/L;

5) said recombinant pseudomonas putida is recombinant pseudomonas putida V: said solubility soap is Sodium decanoic acid, and the chemical formula of said polyhydroxyalkanoate is suc as formula shown in the V-1, and the number-average molecular weight of said polyhydroxyalkanoate is 248.6 * 10 ³Da, the weight-average molecular weight of said polyhydroxyalkanoate is 361.4 * 10 ³Da; The concentration of said Sodium decanoic acid in the said fermented liquid that contains pseudomonas putida is 2g/L;

Said recombinant pseudomonas putida is recombinant pseudomonas putida V: said lipid acid is LAURIC ACID 99 MIN, and the chemical formula of said polyhydroxyalkanoate is suc as formula shown in the V-2, and the number-average molecular weight of said polyhydroxyalkanoate is 119.4 * 10 ³Da, the weight-average molecular weight of said polyhydroxyalkanoate is 155.5 * 10 ³Da; The concentration of said LAURIC ACID 99 MIN in the said fermented liquid that contains pseudomonas putida is 6g/L;

Said recombinant pseudomonas putida is recombinant pseudomonas putida V: said lipid acid is myristic acid, and the chemical formula of said polyhydroxyalkanoate is suc as formula shown in the V-3; The concentration of said myristic acid in the said fermented liquid that contains pseudomonas putida is 4g/L;

In the aforesaid method; The said fermented liquid that contains recombinant pseudomonas putida is to obtain according to the method that comprises the steps: said recombinant pseudomonas putida is inoculated in the LB-Km liquid nutrient medium; Be to cultivate under 30 ℃ the condition in temperature, obtain said fermented liquid; Said LB-Km liquid nutrient medium is made up of yeast extract, peptone, NaCl, sulphuric acid kanamycin and water; The concentration of yeast extract in the LB-Km liquid nutrient medium is 5g/L; The concentration of peptone in the LB-Km liquid nutrient medium is 10g/L; The concentration of NaCl in the LB-Km liquid nutrient medium is 10g/L, and the concentration of sulphuric acid kanamycin in the LB-Km liquid nutrient medium is 50 μ g/mL.

In the recombinant pseudomonas putida of the present invention, passing through of having knocks out some gene (like PP2047) in the beta-oxidation approach of lipid acid, makes its forfeiture encoding function, thereby the beta-oxidation approach of the lipid acid in this bacterium is contained; Have plenty of on the basis that the beta-oxidation approach of lipid acid is contained; Further some gene (like phaG) in the de novo synthesis of lipid acid is knocked out; Thereby the de novo synthesis of the lipid acid in this bacterium is contained, realized that the de novo synthesis of lipid acid and the beta-oxidation approach of lipid acid are contained simultaneously; Have plenty of on the basis that the de novo synthesis of the beta-oxidation approach of lipid acid and lipid acid is contained simultaneously, further in bacterium, import polyhydroxyalkanoate synthetic genes involved (like orfZ).

Because the beta-oxidation approach of lipid acid and the de novo synthesis of lipid acid are all weakened in the recombinant pseudomonas putida of the present invention; Make lipid acid or solubility soap substrate neither get into the de novo synthesis that the beta-oxidation approach does not get into lipid acid yet; Thereby the carbochain of substrate neither also is not increased by excision; Guarantee the homogeneity of substrate carbon chain lengths, make the substrate of carbon chain lengths homogeneous get into the polyhydroxyalkanoate route of synthesis, the synthetic hydroxyalkanoate homopolymer that obtains.

No matter experiment showed, all can to obtain hydroxyalkanoate homopolymer with above-mentioned any reorganization bacterium biosynthesizing polyhydroxyalkanoate, especially in long-chain hydroxyalkanoate homopolymer (C ₄-C ₁₄).The polyhydroxyalkanoate homopolymer purity that obtains is high, output is high.The inventive method can synthesize the middle long-chain polyhydroxyalkanoate homopolymer of random length, overcome the defective that biosynthesizing in the prior art can only obtain the homopolymer of 3-butyric ester (HB).Therefore, the inventive method will have broad application prospects in the biosynthesizing field of the homopolymer of hydroxy fatty acid.

Description of drawings

Fig. 1 is the collection of illustrative plates of plasmid pK18mobSacB.

Fig. 2 is for gathering 4 butyric ester nuclear magnetic resonance maps.

Fig. 3 is for gathering the hydroxyl valerate nuclear magnetic resonance map.

Fig. 4 is for gathering the hydroxycaproic ester nuclear magnetic resonance map.

Fig. 5 is for gathering hydroxyl heptanoate nuclear magnetic resonance map.

Fig. 6 is for gathering hydroxydecanoic acid ester nuclear magnetic resonance map.

Embodiment

Employed experimental technique is ordinary method like no specified otherwise among the following embodiment.

Used material, reagent etc. like no specified otherwise, all can obtain from commercial sources among the following embodiment.

Yeast extract is available from Britain OXOID company, and catalog number is LP-0042; Peptone is available from Britain OXOID company, and catalog number is LP-0021;

The LB liquid nutrient medium: every liter of substratum contains the 5g/L yeast extract, the 10g/L peptone, and 10g/L NaCl, all the other are water.

LB-Km liquid nutrient medium: form by yeast extract, peptone, NaCl, sulphuric acid kanamycin and water; The concentration of yeast extract in the LB-Km liquid nutrient medium is 5g/L; The concentration of peptone in the LB-Km liquid nutrient medium is 10g/L; The concentration of NaCl in the LB-Km liquid nutrient medium is 10g/L, and the concentration of sulphuric acid kanamycin in the LB-Km liquid nutrient medium is 50 μ g/mL.

The LB-Km solid medium: every liter of substratum contains 15g/L agar, the 5g/L yeast extract, and the 10g/L peptone, 10g/L NaCl and 50 μ g/mL sulphuric acid kanamycins, all the other are water.

The LBS-Amp solid medium: every liter of substratum contains 15g/L agar, the 5g/L yeast extract, and the 10g/L peptone, 10g/L NaCl and 100 μ g/mL penbritins, all the other are water.

The LB-Km-Amp solid medium: every liter of substratum contains 15g/L agar, the 5g/L yeast extract, and the 10g/L peptone, 10g/L NaCl, 50 μ g/mL sulphuric acid kanamycins and 100 μ g/mL penbritins, all the other are water.

Strain Pseudomonas putida strain KT2442 (van der Meer, J R, van Neerven, A R; DeVries, E J, et al.Cloning and characterization of plasmid-encoded genes for thedegradation of 1; 2-dichloro-, 1,4-dichloro-; And 1,2,4-trichlorobenzene ofPseudomonas sp.strain P51.J Bacteriol 173 (1): 6-15 Jan 1991) (provided by Tsing-Hua University).

Plasmid pK18mobSacB (

A; Tauch A;

W; Et al.Small mobilizblemulti-purpose cloning vectors derived from the Escherichia coli plasmids pK18 andpK19:selection of defined deletions in the chromosome of Corynebacterium glutamicum.Gene 1994 145:69-73) (is provided by Tsing-Hua University).The collection of illustrative plates of plasmid pK18mobSacB is as shown in Figure 1.

Intestinal bacteria E.coli S17-1 ATCC No.47055 is available from ATCC.

Strain Pseudomonas putida KTOY06 (SP Ouyang; RC Luo; Q Liu; Et al.Production ofpolyhydroxyalkanoates with high 3-hydroxydodecanoate monomer content by fadB andfadA knockout mutant of Pseudomonas putida KT2442.Biomacromolecules 2007 8:2504-2511) (is provided by Tsing-Hua University).

The construction step of strain Pseudomonas putida KTOY06: Pseudomonas putida KT2442 3-hydroxyl fatty acyl-CoA dehydrogenase gene (3-hydroxyacyl-CoA dehydrogenase; FadB) and 3-keto acyl coenzyme A thiolase gene (3-ketoacyl-CoA thiolase, fadA) structure of deletion mutantion strain:

1, the structure that is used for the escherichia coli cloning carrier of deletion mutantion Pseudomonas putida KT2442 fadB and fadA gene

1) genomic dna with Pseudomonas putida strain KT2442 is a template; Under the guiding of primer P1:ATTTCTAGAGCAGATGATGGCCTTC and P2:CTGAAGCTTTGTAATGCCGGTATAC; Two genes that pcr amplification links to each other; Comprise 3-keto acyl coenzyme A thiolase gene fadA fragment (in the sequence table sequence 11 from 5 ' terminal 1498-2674 position Nucleotide) and 3-hydroxyl fatty acyl-CoA dehydrogenase gene fadB fragment (in the sequence table sequence 11 from 5 ' end 1-1467 position Nucleotide); With restriction enzyme XbaI and HindIII pcr amplification product is carried out double digestion, reclaim the endonuclease bamhi that size is about 2.8kb;

2) with restriction enzyme XbaI and HindIII plasmid pK18mobSacB is carried out double digestion, reclaim endonuclease bamhi;

3) with step 1) and step 2) the recovery fragment be connected with the T4DNA ligase enzyme; After ligation is accomplished; The method that connects product electricity consumption conversion is imported to E.coli S17-1 (ATCC numbering: 47055); Transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h;

4) mono-clonal that on LB-Km solid culture flat board, grows of picking; It is inoculated in the LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm, extracts plasmid; And with restriction enzyme XbaI and HindIII plasmid is carried out enzyme and cut evaluation; The result obtains the dna fragmentation of size for 5.699kb and 2.783kb, further plasmid is carried out sequence verification, and the sequence that the result obtains is correct; The plasmid that shows structure is correct, with making up correct fadA and the segmental escherichia coli cloning carrier of the fadBPCR called after pSPK10 of containing.

5) with restriction enzyme SalI plasmid pSPK10 is carried out enzyme and cut, reclaim the endonuclease bamhi of 6.648kb;

6) the recovery fragment of step 5) is carried out from connecting with the T4DNA ligase enzyme; After ligation is accomplished; The method that connects product electricity consumption conversion is imported to E.coli S17-1 (ATCC numbering: 47055), transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h;

7) mono-clonal that on LB-Km solid culture flat board, grows of picking is inoculated into it in LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm; Extract plasmid, and with restriction enzyme XbaI and HindIII plasmid is carried out enzyme and cut evaluation, the result produces the dna fragmentation of size for 5.699kb and 0.949kb; Further sequence verification; The sequence that records shows that the plasmid of structure is correct shown in sequence in the sequence table 11, with making up correct suicide plasmid called after pSPK11.

2, knock out fadB and fadA gene among the Pseudomonas putida KT2442 through the suicide plasmid pSPK11 that builds, obtain mutant strain Pseudomonas putida KTOY06 engineering strain

1) the reorganization bacterium E.coli S17-1 (pSPK11) that contains plasmid pSPK11 that obtains in the picking step 1 is inoculated into it in LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm; Simultaneously with Pseudomonas putidaKT2442 inoculation in the LB liquid nutrient medium; Shaking table is cultivated 12h under 30 ℃, 200rpm, and the nutrient solution of respectively getting the above-mentioned two kinds of bacterial strains of 0.5mL then is mixed in the same aseptic tubule, centrifugal 2 minutes of 8000rpm; Abandoning supernatant; Add the aseptic LB liquid nutrient medium of 1mL again, behind the resuspended bacterium, placed 30 ℃ of incubators 1 hour; One ring mixed bacteria liquid is coated on the LB-Km-Amp solid culture flat board through strok method with the aseptic inoculation ring, in 30 ℃ of incubators, cultivated 24h;

2) mono-clonal that on LB-Km-Amp solid culture flat board, grows of picking is seeded to it in LB-Amp liquid nutrient medium, and shaking table is cultivated 24h under 30 ℃, 200rpm;

3) with the aseptic inoculation ring through strok method with one the ring 2) in the bacterium liquid that obtains coat on the LBS-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h;

4) 3) in LBS-Amp solid culture flat board on 20 single bacterium colonies of picking, numbering, and in order each single bacterium colony being seeded in respectively on the dull and stereotyped and LB-Km solid culture flat board of LBS-Amp solid culture is cultivated 24h in 30 ℃ of incubators.

5) can only on LBS-Amp solid culture flat board, grow in the step on the picking and the single bacterium colony that can not on LB-Km solid culture flat board, grow simultaneously, be seeded to respectively in the LB-Amp liquid nutrient medium, shaking table is cultivated 24h under 30 ℃, 200rpm;

6) with 5) in the nutrient solution that obtains respectively get 1ml, centrifugal, remove supernatant, resuspended with 200 μ l sterilized waters.Resuspended bacterium liquid was placed boiling water bath 10 minutes.After the cooling, be template, under the guiding of primer P1:ATTTCTAGAGCAGATGATGGCCTTC and P2:CTGAAGCTTTGTAATGCCGGTATAC, carry out pcr amplification and identify, again plasmid is checked order with this bacterium liquid.Pcr amplification obtains 949bp size fragment as a result, and it is also correct to record sequence, proves that the plasmid structure that makes up is correct, and also proof reorganization bacterium is correct, with this mutant strain called after Pseudomonas putida KTOY06.

Structure and the biosynthesizing of embodiment 1, mutant strain Pseudomonas putida KTOY08

One, the structure of mutant strain Pseudomonas putida KTOY08

(1) structure of suicide plasmid pSPK09

1) genomic dna with Pseudomonas putida strain KT2442 is a template; Under the guiding of primer P1:ATTTCTAGAGCTGAACCCGGATGGC and P2:AATAAGCTTGCCGAAGCGCAGGATC; Two genes that pcr amplification links to each other; 3-keto acyl coenzyme A thiolase gene (fadAx) and 3-hydroxyl fatty acyl-CoA dehydrogenase gene (fadB2x) carry out double digestion with restriction enzyme XbaI and HindIII to pcr amplification product, reclaim the endonuclease bamhi that size is about 2.7kb.

2) with restriction enzyme XbaI and HindIII plasmid pK18mobSacB is carried out double digestion, reclaim the endonuclease bamhi that size is about 5.699kb;

4) mono-clonal that on LB-Km solid culture flat board, grows of picking; It is inoculated in the LB-Km liquid nutrient medium; Shaking table is cultivated 12h under 37 ℃, 200rpm, extracts plasmid, and with restriction enzyme XbaI and HindIII plasmid is carried out enzyme and cut evaluation; The result produces the dna fragmentation of size for 5.699kb and 2.692kb, with making up the correct escherichia coli cloning carrier called after pSPK08 that contains fadAx and fadB2x complete genome.

5) with restriction enzyme SalI plasmid pSPK08 is carried out enzyme and cut, reclaim the endonuclease bamhi of 6.775kb; Part fragment in this step in fadAx complete genome and the fadB2x complete genome is excised, and the non-complete fragment of remaining fadAx is shown in sequence in the sequence table 2, and the non-complete fragment of remaining fadB2x is shown in sequence in the sequence table 1.

6) the recovery fragment of step 5) is carried out from connecting with the T4 dna ligase; After ligation is accomplished; The method that connects product electricity consumption conversion is imported to E.coli S17-1 (ATCC numbering: 47055), transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h; The mono-clonal that picking grows on LB-Km solid culture flat board.

7) checking: the mono-clonal that step 6) is obtained is inoculated in the LB-Km liquid nutrient medium; Shaking table is cultivated 12h under 37 ℃, 200rpm; Extract plasmid; And with restriction enzyme XbaI and HindIII plasmid is carried out enzyme and cut evaluation, the result obtains the dna fragmentation of size for 5.699kb and 1.066kb, explains that plasmid construction is correct; Again plasmid is checked order; The result shows; The segmental fusion fragment sequence of fadB2x upper reaches fragment and fadAx downstream that inserts is the fusion sequence of sequence 1 and sequence 2 formations; Merge fragment and be positioned between the XbaI and HindIII site of the carrier pK18mobSacB that sets out, further the plasmid structure of proof structure is correct; With making up correct plasmid called after pSPK09.

The E.coli S17-1 note that will contain plasmid pSPK09 is made reorganization bacterium E.coli S17-1 (pSPK09).

(2) plasmid pSPK09 transforms strain Pseudomonas putida KTOY06, obtains mutant strain Pseudomonasputida KTOY08

Contain the Amp resistant gene among the strain Pseudomonas putida KTOY06; Contain the Km resistant gene among the plasmid pSPK09;

1) the reorganization bacterium E.coli S17-1 (pSPK09) that contains plasmid pSPK09 that obtains in the picking step () is inoculated into it in LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm; Simultaneously with Pseudomonas putidaKTOY06 inoculation in the LB-Amp liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm; The nutrient solution of respectively getting the above-mentioned two kinds of bacterial strains of 0.5mL then is mixed in the same aseptic tubule; Centrifugal 2 minutes of 8000rpm, abandoning supernatant adds the aseptic LB liquid nutrient medium of 1mL again; Behind the resuspended bacterium; Placed 30 ℃ of incubators 1 hour, and through strok method one ring mixed bacteria liquid was coated on the LB-Km-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h with the aseptic inoculation ring;

5) can only on LBS-Amp solid culture flat board, grow in the picking step 4) and the single bacterium colony that can not on LB-Km solid culture flat board, grow simultaneously.

6) checking: single bacterium colony that step (5) is obtained is seeded to respectively in the LB-Amp liquid nutrient medium, and shaking table is cultivated 24h under 30 ℃, 200rpm; The nutrient solution that obtains is respectively got 1ml, and is centrifugal, removes supernatant, resuspended with 200 μ l sterilized waters.Resuspended bacterium liquid was placed boiling water bath 10 minutes.After the cooling, be template, under the guiding of primer P1:ATTTCTAGAGCTGAACCCGGATGGC and P2:AATAAGCTTGCCGAAGC GCAGGATC, carry out pcr amplification with this bacterium liquid.Pcr amplification product is checked order.DNA (being the downstream fragment of fadAx) shown in DNA shown in sequence that records and the sequence 1 (being the upper reaches fragment of fadB2x) and the sequence 2 is compared; Comparison result matees fully; Explain that homologous recombination has taken place the fadB2x gene in DNA shown in the sequence 1 and the Pseudomonas putida KTOY06 genome; Homologous recombination has taken place in the fadAx gene in DNA shown in the sequence 2 and the Pseudomonas putida KTOY06 genome, and the fadB2x gene in the Pseudomonas putida KTOY06 genome and most of fragment of fadAx gene are knocked out.With the most of fragment of fadB2x gene and fadAx gene by the Pseudomonas putida KTOY06 called after Pseudomonas putida KTOY08 after knocking out.

Two, obtain PHA with mutant strain Pseudomonas putida KTOY08 biosynthesizing

Enanthic acid sodium is available from Shanghai traditional Chinese medicines group;

Transform the shake flat experiment of long-chain PHA in the lipid acid production with Pseudomonas putida KTOY08.

(1) biosynthesizing

1) Pseudomonas putida KTOY08 is inoculated in the LB-Km liquid nutrient medium; Shaking table is cultivated 12h under 30 ℃, 200rpm; Ratio in 5% (V/V) is inoculated into bacterium liquid in the LB-Km liquid nutrient medium again; Shaking table is cultivated 9h under 30 ℃, 200rpm, obtains containing the fermented liquid of Pseudomonas putida KTOY08;

2) enanthic acid sodium is joined in the fermented liquid that contains Pseudomonas putida KTOY08 in the step 1), the concentration that makes enanthic acid sodium in the fermented liquid is 5g/L, and the continuation shaking table is cultivated 39h under 30 ℃, 200rpm then, obtains the fermented liquid after the biosynthesizing;

3) the biosynthesizing fermented liquid that obtains centrifugal 5 minutes at 8000rpm is collected thalline.

4) thalline of collecting is resuspended with deionized water, and 8000rpm is centrifugal 5 minutes then, collects thalline.

5) thalline of collecting is resuspended with 70% aqueous ethanolic solution, 8000rpm is centrifugal 5 minutes then, collects thalline.

6) collect the thalline obtain and under freezing conditions carry out vacuum and drain and spend the night, obtain dry mycelium, be used for gas chromatographic analysis.

7) dry mycelium is weighed put into reaction kettle, add chloroform, 100 ℃ of reactions 4 hours down with 1: 10 ratio (volume ratio).

8) chloroform that is dissolved with PHA in the reaction kettle is used filter paper filtering, obtain mother liquor and ice ethanol sedimentation according to 1: 10 ratio (volume ratio) adding.

9) collecting precipitation carries out the normal temperature vacuum and drains, and the product that obtains is last PHA homopolymer, is used for NMR analysis.

(2) product checking

Somatic cells dry weight in the fermented liquid after detection of biological is synthetic (CDW, g/L) and PHA content (wt%), form.

Cultivate and finish the back according to document (Ouyang, S.P.; Liu, Q.; Fang, L.; Chen; G.Q.Constructionof pha-Operon-Defined Knockout Mutants of Pseudomonas putida KT2442 and theirApplications in Poly (hydroxyalkanoate) Production.Macromol.Biosci.2007; 7,227-233) described method:

1) get the about 30mg of dry mycelium in exsiccant esterification pipe, add the 2ml chloroform, 2ml esterifying liquid (methanol solution of 3% vitriol oil) is in 100 ℃ of reaction 4h;

2) add 1ml deionized water, mixing, hold over night;

3) take off layer liquid 0.5 μ l and carry out the chromatography of gases analysis.

1, homopolymer structure verification

The detection method that PHA forms: gas chromatographic analysis and NMR analysis;

The molecular structural formula of homopolymer:

Number-average molecular weight is 252 * 10 ³(or weight-average molecular weight is 455 * 10 to Da ³Da); The nuclear magnetic resonance map of homopolymer PHHp (a: gather the hydroxycaproic ester proton nmr spectra as shown in Figure 5; B: gather the hydroxycaproic ester carbon-13 nmr spectra).

2, PHA content detecting method: gas chromatographic analysis and NMR analysis; The calculation formula of PHA content

PHA content=each monomer content sum

Monomer content=slope of standard curve * monomer peak area/interior mark peak area;

The result: mutant strain KTOY08 is being under the culture condition of single carbon source with enanthic acid sodium, can form the homopolymer (table 1) that only contains 3-hydroxyl enanthic acid (3Hp) by synthon.

Table 1, P.putida KTOY08 transform the synthetic PHA of fatty acid biological

The structure of embodiment 2, strain Pseudomonas putida KTOY08-G and biosynthesizing

One, the structure of engineering strain Pseudomonas putida KTOY08-G

(1) structure of recombinant vectors pKQQ01

1) genomic dna with Pseudomonas putida KT2442 is a template; Carry out pcr amplification with primer phaG-up-1 and phaG-up-2, obtain the upper reaches fragment (sequence 3 is from shown in the Nucleotide of 5 ' terminal 1-448 position in the sequence table) of 3-hydroxyl acyl lipophorin thiophorase encoding sox (3-hydroxyacyl-acylcarrier protein-coenzyme A transferase or be PhaG); With restriction enzyme XbaI and HindIII pcr amplification product is carried out double digestion, reclaim the endonuclease bamhi that size is about 400bp;

Genomic dna with Pseudomonas putida KT2442 is a template; Carry out pcr amplification with primer phaG-down-1 and phaG-down-2, obtain the downstream fragment (sequence 3 is from shown in the Nucleotide of 5 ' terminal 449-913 position in the sequence table) of 3-hydroxyl acyl lipophorin thiophorase encoding sox (3-hydroxyacyl-acylcarrier protein-coenzyme A transferase or be PhaG); With restriction enzyme XbaI and XmaI pcr amplification product is carried out double digestion, reclaim the endonuclease bamhi that size is about 400bp;

phaG-up-1：ATAGAT? AAGCTT?TATCGTGAACTGACGGCCAATGAGA

phaG-up-2：GC? TCTAGA?GCGATAGAACTCCGTGTAAACCCGA

phaG-down-1：GC? TCTAGA?GCAAGCATGTGGGCAGAAGCCAGTTCA

phaG-down-2：AT? CCCGGG?CATGGGCCAGGTCAAGGCAGGA

2) with restriction enzyme XbaI and HindIII plasmid pK18mobSacB is carried out double digestion, reclaim enzyme and cut big fragment;

3) the phaG upper reaches fragment enzyme of step 1) is cut product and step 2) the big fragment of recovery be connected with the T4 dna ligase; After ligation is accomplished; Import to intestinal bacteria E.coli S17-1 (ATCC numbering: 47055) with connecting the method for product with chemical conversion; Transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h;

4) mono-clonal that on LB-Km solid culture flat board, grows of picking; It is inoculated in the LB-Km liquid nutrient medium; Shaking table is cultivated 12h under 37 ℃, 200rpm, extracts plasmid, and with restriction enzyme XbaI and HindIII plasmid is carried out enzyme and cut evaluation; Positive plasmid can produce the dna fragmentation of size for 448bp and 5696bp after enzyme is cut, with making up the correct segmental escherichia coli cloning carrier of the phaG upper reaches PCR called after pKQQ01-1 that contains.

5) with restriction enzyme XbaI and XmaI plasmid pKQQ01-1 is carried out enzyme and cut, reclaim the endonuclease bamhi of 6145bp;

6) the phaG downstream fragment of step 1) and the recovery fragment of step 5) are connected with the T4 dna ligase; After ligation is accomplished; Import to E.coli S17-1 (ATCC numbering: 47055) with connecting the method for product with chemical conversion; Transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h; The mono-clonal that picking grows on LB-Km solid culture flat board.

7) checking: the mono-clonal that step 6) is obtained is inoculated in the LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm, extracts plasmid, and with restriction enzyme XbaI and XmaI plasmid is carried out enzyme and cut evaluation.The result obtains the dna fragmentation of size for 467bp and 6145bp; Again plasmid is checked order; The result shows; The sequence that records is shown in sequence in the sequence table 3, and the gene shown in the sequence 3 (be the segmental fusion gene of upper reaches fragment and downstream of PhaG gene, but be not complete PhaG gene) is positioned between the HindIII and XmaI site of the carrier pK18mobSacB that sets out in the sequence table; The plasmid structure that confirm to make up is correct, with making up correct two sections segmental escherichia coli cloning carriers of PCR of phaG upstream and downstream called after pKQQ01 that contains.

The E.coli S17-1 called after reorganization bacterium E.coli S17-1 (pKQQ01) that will contain plasmid pKQQ01.

(2) structure of engineering strain Pseudomonas putida KTOY08-G

1) the reorganization bacterium E.coli S17-1 (pKQQ01) that contains plasmid pKQQ01 that obtains in the picking step () is inoculated into it in LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm; Simultaneously with Pseudomonas putidaKTOY08 inoculation in the LB liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm; The nutrient solution of respectively getting the above-mentioned two kinds of bacterial strains of 0.5mL then is mixed in the same aseptic tubule; Centrifugal 2 minutes of 8000rpm, abandoning supernatant adds the aseptic LB liquid nutrient medium of 1mL again; Behind the resuspended bacterium; Placed 30 ℃ of incubators 1 hour, and through strok method one ring mixed bacteria liquid was coated on the LB-Km-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h with the aseptic inoculation ring;

5) can only on LBS-Amp solid culture flat board, grow in the step on the picking and the single bacterium colony that can not on LB-Km solid culture flat board, grow simultaneously.

6) checking: single bacterium colony that step 5) is obtained is seeded to respectively in the LB-Amp liquid nutrient medium, and shaking table is cultivated 24h under 30 ℃, 200rpm; The nutrient solution that obtains is respectively got 1ml, and is centrifugal, removes supernatant, resuspended with 200 μ l sterilized waters.Resuspended bacterium liquid was placed boiling water bath 10 minutes.After the cooling, be template, under the guiding of primer P1:ATTTCTAGAGCAGATGATGGCCTTC and P4:ATACCCGGGCCGGAGTAGATGC GGAACGACAACG, carry out pcr amplification with this bacterium liquid.The pcr amplification product that the amplified fragments size is about 800bp checks order.With DNA shown in sequence that records and the sequence 3 (is the segmental fusion fragment of upper reaches fragment and downstream of PhaG gene; But be not complete PhaG gene) compare; Comparison result matees fully; Explain that homologous recombination has taken place the phaG gene in DNA shown in the sequence 3 and the Pseudomonas putida KTOY08 genome, most of fragment of the phaG gene in the Pseudomonas putida KTOY08 genome is knocked out.With most of fragment of phaG gene by the Pseudomonas putida KTOY08 called after Pseudomonas putida KTOY08-G after knocking out.Principle of homologous recombination judge to take place: at first the sequence size of amplification will be about 913bp, then the result of order-checking will with the segmental fusion gene of upper reaches fragment and downstream of above-mentioned phaG gene, but be not that complete phaG gene is complementary.If under situation about not knocking out, use these two primers of phaG-up-1 and phaG-down-2 to carry out PCR as template in other words with genome; The sequence that obtains so will be 1552bp; This 1552bp comprises the segmental fusion gene of upper reaches fragment and downstream of above-mentioned phaG gene; But the most of fragment that also comprises the phaG gene simultaneously, then having recombinated most of fragment of phaG gene successfully of recombinating only stayed the segmental fusion gene of upper reaches fragment and downstream of phaG gene.

Two, with engineering strain Pseudomonas putida KTOY08-G biosynthesizing, obtain PHA

Transform the shake flat experiment of long-chain PHA in the lipid acid production with Pseudomonas putida KTOY08-G.

(1) biosynthesizing

Sodium n-caproate is available from Shanghai traditional Chinese medicines group; Sodium octoate is available from Shanghai traditional Chinese medicines group;

1) Pseudomonas putida KTOY08-G is inoculated in the LB-Km liquid nutrient medium; Shaking table is cultivated 12h under 30 ℃, 200rpm; Ratio in 5% (V/V) is inoculated into bacterium liquid in the LB-Km liquid nutrient medium again; Shaking table is cultivated 9h under 30 ℃, 200rpm, obtains containing the fermented liquid of Pseudomonas putida KTOY08-G;

2) respectively Sodium n-caproate and Sodium octoate are joined in the fermented liquid that contains Pseudomonas putida KTOY08-G in the step 1); Make the concentration of Sodium n-caproate in the fermented liquid, Sodium octoate be 10g/L; The continuation shaking table is cultivated 39h under 30 ℃, 200rpm then, obtains the fermented liquid after the biosynthesizing.

3) method of acquisition thalline: with consistent described in the embodiment 1.

(2) product checking

Cultivate and finish the back according to document (Ouyang, S.P.; Liu, Q.; Fang, L.; Chen; G.Q.Constructionof pha-Operon-Defined Knockout Mutants of Pseudomonas putida KT2442 and theirApplications in Poly (hydroxyalkanoate) Production.Macromol.Biosci.2007; 7,227-233) described method: the pre-treating process of thalline is with consistent described in the embodiment 1.

Product checking when 1, being substrate with the Sodium n-caproate

(1) detection method of PHA composition: gas chromatographic analysis and NMR analysis;

Result: the molecular structural formula of homopolymer:

Number-average molecular weight is 206 * 10 ³(or weight-average molecular weight is 272 * 10 to Da ³Da); The nuclear magnetic resonance map of homopolymer HHx (a: gather the hydroxycaproic ester proton nmr spectra as shown in Figure 4; B: gather the hydroxycaproic ester carbon-13 nmr spectra).

(2) PHA content detecting method: gas chromatographic analysis and NMR analysis; The calculation formula of PHA content is with consistent described in the embodiment 1.

The result: mutant strain KTOY08 is being under the culture condition of single carbon source with Sodium n-caproate, can form the homopolymer that only contains 3-hydroxycaproic acid (3HHx), (table 2) by synthon.

Product checking when 2, being substrate with the Sodium octoate

Result: the molecular structural formula of multipolymer:

The number-average molecular weight of multipolymer is 148 * 10 ³(or weight-average molecular weight is 180 * 10 to Da ³Da);

(2) PHA content detecting method: gas chromatographic analysis and NMR analysis; The calculation formula of PHA content

PHA content=each monomer content sum

The result: mutant strain KTOY08 is being under the culture condition of single carbon source with Sodium octoate, can form the multipolymer that contains 3-hydroxycaproic acid (3HHx) and 3-Hydroxyoctanoic acid (3HO), (table 2) by synthon.

Table 2.P.putida KTOY08-G transforms the synthetic PHA of fatty acid biological.

The structure of embodiment 3, strain Pseudomonas putida KTHH06 and biosynthesizing PHA

Carrier pKSSE5.3 (Hein S;

B; Gottschalk G, Steinb ü chel A.Biosynthesis ofpoly (4-hydroxybutyric acid) by recombinant strains of Escherichia coli.FEMSMicrobiol.Lett.1997; 153:411-418.) (providing by Tsing-Hua University);

Contain among the carrier pKSSE5.3 and come from the genomic Poly-synthetase-coding gene of the true bacteria of Luo Shi (Ralstonia eutropha) (phbC gene); The nucleotide sequence that comes from the genomic Poly-synthetase-coding gene of the true bacteria of Luo Shi (Ralstonia eutropha) (phbC gene) is 1767bp shown in sequence in the sequence table 4.

Carrier pBBR1-MCS2 (Michael E.Kovach; Philip H.Elzer; D.Steven Hill et al.Fournew derivatives of the broad-host-range cloning vector pBBR1MCS, carrying differentantibiotic-resistance cassettes.Gene.1995; 166:175-176.) (providing by Tsing-Hua University);

Contain among the carrier pBBR1-MCS2 and come from Ke Shi clostridium (Clostridium kluyveri) genomic 4-maloyl group thiophorase encoding sox (orfZ gene); The nucleotide sequence that comes from Ke Shi clostridium (Clostridium kluyveri) genomic 4-maloyl group thiophorase encoding sox (orfZ gene) is 1290bp shown in sequence in the sequence table 5.

One, the structure of strain Pseudomonas putida KTHH06

(1) structure of carrier pBHH01

1) plasmid pKSSE5.3 is carried out enzyme with restriction enzyme BamHI and EcoRI and cut, obtain 2 dna fragmentations of 4520bp and 2943bp, reclaiming size is the 5420bp dna fragmentation.

Carrier pBBR1-MCS2 is carried out enzyme with restriction enzyme BamHI and EcoRI cut, obtain 2 dna fragmentations of 18bp and 5126bp, reclaiming size is the 5126bp dna fragmentation.

2) two dna fragmentations of 5420bp bp and 5126bp with step 1) are connected with the T4 dna ligase; After ligation is accomplished; Import to E.coli S17-1 (ATCC numbering: 47055) with connecting the method for product with chemical conversion; Transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h;

3) mono-clonal that on LB-Km solid culture flat board, grows of picking is inoculated into it in LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm, extracts plasmid, and with restriction enzyme BamHI and EcoRI plasmid is carried out enzyme and cut evaluation.The result obtains enzyme and cuts the plasmid that the back produces big or small 5420bp and two dna fragmentations of 5126bp, and positive plasmid is with the correct escherichia coli cloning carrier called after pBHH01 that contains phbC and orfZ (Ralstonia eutropha) gene that obtains.

With the further sequence verification of pBHH01; The result shows; Gene shown in the sequence 4 (phbC gene) constitutes fusion gene (the fusion gene sequence is the sequence after sequence 4 merges with sequence 5) with gene (orfZ gene) shown in the sequence 5; The phbC gene is positioned at the upper reaches of fusion gene, and the orfZ gene is positioned at the downstream of fusion gene.

The E.coli S17-1 note that will contain pBHH01 is made reorganization bacterium E.coli S17-1 (pBHH01).

(2) plasmid pBHH01 transforms Pseudomonas putida KTOY08-G

1) the reorganization bacterium E.coli S17-1 (pBHH01) that contains plasmid pBHH01 that obtains in the picking step () is inoculated into it in LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm; Simultaneously with Pseudomonas putidaKTOY08-G inoculation in the LB liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm; The nutrient solution of respectively getting the above-mentioned two kinds of bacterial strains of 0.5mL then is mixed in the same aseptic tubule; Centrifugal 2 minutes of 8000rpm, abandoning supernatant adds the aseptic LB liquid nutrient medium of 1mL again; Behind the resuspended bacterium; Placed 30 ℃ of incubators 1 hour, and through strok method one ring mixed bacteria liquid was coated on the LB-Km-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h with the aseptic inoculation ring;

2) mono-clonal that on LB-Km-Amp solid culture flat board, grows of picking.

3) checking: from the mono-clonal that step (2) obtains, extract plasmid, with restriction enzyme BamHI and EcoRI plasmid is carried out enzyme and cut evaluation, the result, obtaining size is 5420bp and two dna fragmentations of 5126bp, confirms that the plasmid that imports in the mono-clonal is pBHH01.The mutant strain KTOY08-G called after Pseudomonas putida KTHH06 that will contain plasmid pBHH01.

Two, with the synthetic PHA of strain Pseudomonas putida KTHH06

Transform the shake flat experiment that lipid acid is produced PHA with Pseudomonas putida KTHH06.

Gamma-butyrolactone is available from Shanghai traditional Chinese medicines group.

(1) biosynthesizing

1) Pseudomonas putida KTHH06 is inoculated in the LB-Km liquid nutrient medium; Shaking table is cultivated 12h under 30 ℃, 200rpm; Ratio in 5% (V/V) is inoculated into bacterium liquid in the LB-Km liquid nutrient medium again; Shaking table is cultivated 9h under 30 ℃, 200rpm, obtains containing the fermented liquid of Pseudomonas putida KTHH06;

2) gamma-butyrolactone is joined in the fermented liquid that contains Pseudomonas putida KTHH06 in the step 1); Make that the concentration of gamma-butyrolactone is 5g/L in the fermented liquid; The continuation shaking table is cultivated 39h under 30 ℃, 200rpm then, obtains the fermented liquid after the biosynthesizing.

(2) product checking

1, homopolymer structure verification

The detection method that P4HB forms: gas chromatographic analysis and NMR analysis;

The molecular structural formula of homopolymer:

Number-average molecular weight is 487 * 10 ³(or weight-average molecular weight is 854 * 10 to Da ³Da);

The nuclear magnetic resonance map of homopolymer P4HB (a: poly butyric ester proton nmr spectra as shown in Figure 2; B: the poly butyric ester carbon-13 nmr spectra).

2, PHA content detecting method: gas chromatographic analysis and NMR analysis; The calculation formula of PHA content is with identical described in the embodiment 1.

The result: mutant strain KTOY08 is being under the culture condition of single carbon source with gamma-butyrolactone, can form the homopolymer that only contains 4 hydroxybutyric acid (4HB), (table 3) by synthon.

The above results shows, in the presence of gamma-butyrolactone, and the formation (table 3) of 4 hydroxybutyric acid (HD) homopolymer P4HB.

Table 3.P.putida KTHH06 transforms the synthetic PHA of fatty acid biological.

The structure of embodiment 4, strain Pseudomonas putida KTHH08 and biosynthesizing

One, the structure of strain Pseudomonas putida KTHH08

Bacterial strain has a liking for that the segmental nucleotide sequence of the protein-bonded encoding sox of PHA particle (phaP) is shown in sequence in the sequence table 6 in aqueous vapor sporangium (Aeromonas hydrophila) the 4AK4 genome, and bacterial strain is had a liking for the segmental nucleotide sequence of encoding sox (phaJ) of enoyl coenzyme A hydratase in aqueous vapor sporangium (Aeromonashydrophila) the 4AK4 genome shown in sequence in the sequence table 7; Bacterial strain is had a liking for the nucleotide sequence of polyhydroxyalkanoate (PHA) synthetase-coding gene (claiming pha synthesizing enzyme encoding sox, PHBHHx synthase gene or phaC gene again) in aqueous vapor sporangium (Aeromonas hydrophila) the 4AK4 genome shown in sequence in the sequence table 8.

Bacterial strain is had a liking for aqueous vapor sporangium (Aeromonas hydrophila) 4AK4 (van der Meer, J R, van Neerven; A R, de Vries, E J; Et al.Cloning and characterization of plasmid-encoded genes forthe degradation of 1,2-dichloro-, 1; 4-dichloro-; And 1,2,4-trichlorobenzene ofPseudomonas sp.strain P51.J Bacteriol 173 (1): 6-15 Jan 1991) (provided by Tsing-Hua University).

(1) structure of plasmid pZWJ4-31

1) genomic dna with Aeromonas hydrophila 4AK4 is a template; Under the guiding of primer P1:TTTGGTACCTGGAGACCGATGATGAATATGG and P2:ATGAATTCTTAAGGCAGCTTGACCACGG; 3 genes that pcr amplification links to each other comprise PHA particle binding-protein gene (phaP) fragment, PHBHHx synthase gene (phaC) fragment and enoyl coenzyme A hydratase gene (phaJ) fragment; With restriction enzyme KpnI and EcoRI pcr amplification product is carried out double digestion, reclaim the endonuclease bamhi that size is about 2.6kb; Contain following fusion fragment in the pcr amplification product: the fusion fragment that phaP fragment, phaC fragment and phaJ fragment connect and compose successively, merging segmental gene order is the sequence that sequence nucleotide sequence 6, sequence 8 and sequence 7 connect and compose successively; Said PHA particle binding-protein gene (phaP) is positioned at the upper reaches of said fusion gene, and said PHA synthase gene (phaC) is positioned at the middle reaches of said fusion gene, and said enoyl coenzyme A hydratase gene (phaJ) is positioned at the downstream of said fusion gene.

2) with restriction enzyme KpnI and EcoRI plasmid pBBR1-MCS2 is carried out double digestion, reclaim enzyme and cut big fragment;

4) mono-clonal that on LB-Km solid culture flat board, grows of picking; It is inoculated in the LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm, extracts plasmid; And with restriction enzyme KpnI and EcoRI plasmid is carried out enzyme and cut evaluation; The result produces the dna fragmentation of size for 5.100kb and 2.643kb, and the preliminary identification plasmid construction is correct, further carries out sequence verification; The fusion fragments sequence that the result records is correct; And fusion sequence is positioned between the KpnI and EcoRI of pBBR1-MCS2, shows that the plasmid of structure is correct, with making up the correct escherichia coli cloning carrier called after pZWJ4-31 that merges fragment (phaP fragment, phaC fragment and phaJ fragment) that contains.

The E.coli S17-1 note that will contain plasmid pZWJ4-31 is made reorganization bacterium E.coli S17-1 (pZWJ4-31).

(2) structure of strain Pseudomonas putida KTHH08

1) the reorganization bacterium E.coli S17-1 (pZWJ4-31) that contains plasmid pZWJ4-31 that obtains in the picking step () is inoculated into it in LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm; Simultaneously with Pseudomonasputida KTOY08-G inoculation in the LB liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm; The nutrient solution of respectively getting the above-mentioned two kinds of bacterial strains of 0.5mL then is mixed in the same aseptic tubule; Centrifugal 2 minutes of 8000rpm, abandoning supernatant adds the aseptic LB liquid nutrient medium of 1mL again; Behind the resuspended bacterium; Placed 30 ℃ of incubators 1 hour, and through strok method one ring mixed bacteria liquid was coated on the LB-Km-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h with the aseptic inoculation ring;

2) mono-clonal that on LB-Km-Amp solid culture flat board, grows of picking.

3) checking: from the mono-clonal that step (2) obtains, extract plasmid, and with restriction enzyme PstI plasmid is carried out enzyme and cut; The result obtains size and is the dna fragmentation of 1754bp, 2087bp and 3902bp, and the plasmid that shows importing is pZWJ4-31.The mutant strain KTOY08-G called after Pseudomonas putida KTHH08 that will contain plasmid pZWJ4-31.

Two, transform the shake flat experiment that lipid acid is produced PHA with Pseudomonas putida KTHH08

Natrium valericum is available from Shanghai traditional Chinese medicines group.

(1) biosynthesizing

1) Pseudomonas putida KTHH08 is inoculated in the LB-Km liquid nutrient medium; Shaking table is cultivated 12h under 30 ℃, 200rpm; Ratio in 5% (V/V) is inoculated into bacterium liquid in the LB-Km liquid nutrient medium again; Shaking table is cultivated 9h under 30 ℃, 200rpm, obtains containing the fermented liquid of Pseudomonas putida KTHH08;

2) natrium valericum is joined in the fermented liquid that contains Pseudomonas putida KTHH08 in the step 1), make that the concentration of natrium valericum is 5g/L in the fermented liquid, the continuation shaking table is cultivated 39h under 30 ℃, 200rpm then, obtains the fermented liquid after the biosynthesizing.

(2) product checking

1, homopolymer structure verification

The molecular structural formula of homopolymer:

Number-average molecular weight is 815 * 10 ³(or weight-average molecular weight is 1056 * 10 to Da ³Da);

The nuclear magnetic resonance map of homopolymer HV (a: gather the hydroxyl valerate proton nmr spectra as shown in Figure 3; B: gather the hydroxyl valerate carbon-13 nmr spectra).

The result: mutant strain KTOY08 is being under the culture condition of single carbon source with natrium valericum, can form the homopolymer that only contains 3-hydroxypentanoic acid (3HV), (table 4) by synthon.

The above results shows, in the presence of natrium valericum, and the formation (table 4) of 3-hydroxypentanoic acid (HV) homopolymer PHV.。

Table 4.P.putida KTHH08 transforms the synthetic PHA of fatty acid biological.

The structure of embodiment 5, strain Pseudomonas putida KTQQ20 and biosynthesizing

One, the structure of strain Pseudomonas putida KTQQ20

(1) structure of escherichia coli cloning carrier pKQQ12:

1) genomic dna with Pseudomonas putida KT2442 is a template; Carry out pcr amplification with primer P1 and P2, obtain the upper reaches fragment (upper reaches fragments sequence of PP2047 is shown in sequence in the sequence table 9) of 3-hydroxyl fatty acyl-CoA dehydrogenase gene PP2047; With restriction enzyme HindIII and PstI pcr amplification product is carried out double digestion, reclaim the endonuclease bamhi that size is about 430bp;

Genomic dna with Pseudomonas putida KT2442 is a template, carries out pcr amplification with primer P3 and P4, obtains the downstream fragment (the downstream fragment of PP2048 is shown in sequence in the sequence table 10) of fatty acyl-CoA dehydrogenase gene PP2048; With restriction enzyme PstI and BamHI pcr amplification product is carried out double digestion, reclaim the endonuclease bamhi that size is about 488bp;

P1：AAT AAGCTTGCGATGGCTGCGCTGA

P2：CAT CTGCAGGATTGATCGGGAAGGGA

P3：AAT CTGCAGCTAGCGCACGGCAAAC

P4：TGAT GGATCCTCCGAACCGGTACCTG

2) with restriction enzyme HindIII and PstI plasmid pK18mobSacB is carried out double digestion, reclaim enzyme and cut big fragment;

3) with the upper reaches fragment and step 2 of step 1)) the recovery fragment be connected with the T4DNA ligase enzyme; After ligation is accomplished; Import to E.coli S17-1 (ATCC numbering: 47055) with connecting the method for product with chemical conversion; Transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h;

4) mono-clonal that on LB-Km solid culture flat board, grows of picking; It is inoculated in the LB-Km liquid nutrient medium; Shaking table is cultivated 12h under 37 ℃, 200rpm, extracts plasmid, and with restriction enzyme PstI and HindIII plasmid is carried out enzyme and cut evaluation; Positive plasmid can produce size and be the dna fragmentation of 430bp after enzyme is cut, with structure correct contain the segmental escherichia coli cloning carrier of PP2047 upper reaches PCR called after pKQQ12-1.

5) with restriction enzyme PstI BamHI plasmid pKQQ12-1 is carried out enzyme and cut, reclaim the endonuclease bamhi of 6576bp;

6) the downstream fragment of step 1) and the recovery fragment of step 5) are connected with the T4DNA ligase enzyme; After ligation is accomplished; Import to E.coli S17-1 (ATCC numbering: 47055) with connecting the method for product with chemical conversion; Transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h; The mono-clonal that picking grows on LB-Km solid culture flat board.

7) checking: the mono-clonal that step 6) is obtained is inoculated in the LB-Km liquid nutrient medium; Shaking table is cultivated 12h under 37 ℃, 200rpm; Extract plasmid, and with restriction enzyme PstI and NcoI plasmid is carried out enzyme and cut evaluation, the result obtains the dna fragmentation of size for 1598bp and 5022bp; Plasmid is checked order; The result shows; DNA (being the downstream fragment of PP2048) shown in DNA shown in the sequence 9 (being the upper reaches fragment of PP2047) and the sequence 10 constitutes the fusion fragment; Merging fragment (merging fragments sequence is that sequence 9 and sequence 10 merge the sequence that constitutes) is positioned between the HindIII and BamHI site of the carrier pK18mobSacB that sets out; Proof plasmid structure is correct, with making up the correct two sections segmental escherichia coli cloning carrier of PCR called after pKQQ12 that contain the PP2047 upper reaches and PP2048 downstream.DNA shown in the sequence 9 in the said sequence table (PP2047 upper reaches fragment) is positioned at the upper reaches of said fusion gene, and DNA shown in the sequence 10 in the said sequence table (PP2048 downstream fragment) is positioned at the downstream of said fusion gene.

(2) knock out PP2047 and PP2048 gene among the Pseudomonas putida KTOY08-G through suicide plasmid pKQQ12

1) the reorganization bacterium E.coli S17-1 (pKQQ12) that contains plasmid pKQQ12 that obtains in the picking step () is inoculated into it in LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm; Simultaneously with Pseudomonas putidaKTOY08-G inoculation in the LB liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm; The nutrient solution of respectively getting the above-mentioned two kinds of bacterial strains of 0.5mL then is mixed in the same aseptic tubule; Centrifugal 2 minutes of 8000rpm, abandoning supernatant adds the aseptic LB liquid nutrient medium of 1mL again; Behind the resuspended bacterium; Placed 30 ℃ of incubators 1 hour, and through strok method one ring mixed bacteria liquid was coated on the LB-Km-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h with the aseptic inoculation ring;

6) checking: single bacterium colony that step 5) is obtained is seeded to respectively in the LB-Amp liquid nutrient medium, and shaking table is cultivated 24h under 30 ℃, 200rpm; The nutrient solution that obtains is respectively got 1ml, and is centrifugal, removes supernatant, resuspended with the 200ul sterilized water.Resuspended bacterium liquid was placed boiling water bath 10 minutes.After the cooling, be template, under the guiding of primer P1:AATAAGCTTGCGATGGCTGCGCTGA and P4:TGATGGATCCTCCGAACCGGTA CCTG, carry out pcr amplification with this bacterium liquid.Pcr amplification product is checked order.The fusion fragment of DNA (being the downstream fragment of PP2048) shown in DNA shown in sequence that records and the sequence 9 (being the upper reaches fragment of PP2047) and the sequence 10 is compared; The result is mated fully; Explain that homologous recombination has taken place the PP2047 gene in DNA shown in the sequence 9 and the Pseudomonas putidaKTOY08-G genome; Homologous recombination has taken place in the PP2048 gene in DNA shown in the sequence 10 and the Pseudomonas putidaKTOY08-G genome, and most of fragment of the PP2047 gene in the Pseudomonas putida KTOY08-G genome and most of fragment of PP2048 gene are knocked out.With most of fragment of most of fragment of PP2047 gene and PP2048 gene by the Pseudomonas putida KTOY08-G called after Pseudomonasputida KTQQ20 after knocking out.

Two, transform the shake flat experiment that lipid acid is produced PHA with Pseudomonas putida KTQQ20

Sodium decanoic acid is available from Shanghai traditional Chinese medicines group; LAURIC ACID 99 MIN (dodecylic acid) is available from Shantou brilliance chemical reagent work; And myristic acid (tetradecanoic acid) is available from Shanghai traditional Chinese medicines group;

(1) biosynthesizing

1) Pseudomonas putida KTQQ20 is inoculated in the LB-Km liquid nutrient medium; Shaking table is cultivated 12h under 30 ℃, 200rpm; Ratio in 5% (V/V) is inoculated into bacterium liquid in the LB-Km liquid nutrient medium again; Shaking table is cultivated 9h under 30 ℃, 200rpm, obtains containing the fermented liquid of Pseudomonas putida KTQQ20;

2) respectively Sodium decanoic acid, LAURIC ACID 99 MIN (dodecylic acid) and myristic acid (tetradecanoic acid) are joined in the fermented liquid that contains Pseudomonas putida KTQQ20 in the step 1); Make that the concentration of Sodium decanoic acid in the fermented liquid is that the concentration of 2g/L, LAURIC ACID 99 MIN (dodecylic acid) is that the concentration of 6g/L, myristic acid (tetradecanoic acid) is 4g/L; The continuation shaking table is cultivated 39h under 30 ℃, 200rpm then, obtains the fermented liquid after the biosynthesizing.

The adding mode of LAURIC ACID 99 MIN and myristic acid: behind yeast culture 12h in the disposable adding substratum;

The adding mode of Sodium decanoic acid: being divided equally into twice adding, is behind yeast culture 12h for the first time, is for the second time after adding 12h for the first time.；

(2) product checking

1, with the Sodium decanoic acid carbon source, the checking of the product that obtains

(1) homopolymer structure verification

The molecular structural formula of homopolymer:

Number-average molecular weight is 248.6 * 10 ³(or weight-average molecular weight is 361.4 * 10 to Da ³Da); The nuclear magnetic resonance map of homopolymer PHD (a: gather hydroxydecanoic acid ester proton nmr spectra as shown in Figure 6; B: gather hydroxydecanoic acid ester carbon-13 nmr spectra).

The result: mutant strain KTOY08 is being under the culture condition of single carbon source with Sodium decanoic acid, can form the homopolymer that only contains 3-hydroxydecanoic acid (3HD), (table 5) by synthon.

2, with the LAURIC ACID 99 MIN carbon source, the checking of the product that obtains

(1) copolymer structure checking

The molecular structural formula of multipolymer:

Number-average molecular weight is 119.4 * 10 ³(or weight-average molecular weight is 155.5 * 10 to Da ³Da);

(2) PHA content detecting method: gas chromatographic analysis and NMR analysis; The calculation formula of PHA content is with consistent described in the embodiment 2.

The result: mutant strain KTOY08 is being under the culture condition of single carbon source with LAURIC ACID 99 MIN, can form the multipolymer that contains 3-hydroxydecanoic acid (3HD) and 3-hydroxyl dodecanoic acid (3HDD), (table 5) by synthon.

3, with the myristic acid carbon source, the checking of the product that obtains

(1) homopolymer structure verification

The molecular structural formula of homopolymer:

Weight-average molecular weight is＞50 * 10 ³Da;

(2) PHA content detecting method: gas chromatographic analysis and NMR analysis;

The calculation formula of PHA content is with consistent described in the embodiment 2.

The result: mutant strain KTOY08 is being under the culture condition of single carbon source with myristic acid, can form the multipolymer that contains 3-hydroxyl dodecanoic acid (3HDD) and 3-hydroxy tetradecanoic acid (3HTD), (table 5) by synthon.

The above results shows that in the presence of capric acid, laurostearic acid and TETRADECONIC ACID, 3-hydroxydecanoic acid (HD) homopolymer PHD and 3-hydroxy tetradecanoic acid (HTD) homopolymer PHTD form (table 5) respectively.

Table 5.P.putida KTQQ20 transforms the synthetic PHA of fatty acid biological.

" ND " expression does not detect numerical value.

Sequence table

< 110>Tsing-Hua University

< 120>a kind of method and special bacterium thereof for preparing hydroxyalkanoate homopolymer

<160>11

<210>1

<211>509

<212>DNA

< 213>artificial sequence

<220>

<223>

<400>1

gctgaacccg?gatggcagca?tcagcttcgt?tggccgtagc?gacgacgtga?tcaccacctc 60

cggttaccgt?gtggggccat?tcgatgtgga?aagcgcgttg?atcgagcacc?cggcggtgat 120

cgaggcagcg?gtgatcggca?agcccgaccc?ggagcgtacc?gagctgatca?aggcgttcgt 180

ggtattggcc?agcggctacg?ccggcagcgt?cgagctggaa?gaaaccttgc?gccagcatgt 240

gcgccagcgc?ctctacgcgc?atgcctaccc?cagggaaatc?gaattcgtca?gcgagctgcc 300

caagaccccg?agcggcaagc?tgcaacgctt?catcctgcgc?aaccaggaag?tcgccaaaca 360

acaagcgcaa?caggccaccc?ctgccagcgt?ctgaaaggaa?agtactcatg?cacatagcca 420

ataaacattt?catcgtcagc?ggcgccgctt?ccgggctggg?tgccgcgact?gcacagatgc 480

tggtcgaggc?tggcgccaag?gtcatgctg 509

<210>2

<211>557

<212>DNA

< 213>artificial sequence

<220>

<223>

<400>2

ctgttcgaga?tcaacgaggc?cttcgccgtg?gtcaccctgg?cggccatgaa?acacctcgac 60

ctgccacacg?acaaggtcaa?tatccacggc?ggcgcctgcg?ccctcggtca?cccgatcggc 120

gcttctggcg?cacgtattct?ggtcaccctg?ttgtcggcct?tgcgccagaa?caatctgcgt 180

cggggtgtgg?cggccatctg?catcggcggt?ggcgaggcca?cggccatggc?tgttgaatgc 240

ctgtactgag?gtgaaccatg?ctggtaaatg?acgagcaaca?acagatcgcc?gacgcggtac 300

gtgcgttcgc?ccaggaacgc?ctgaagccgt?ttgccgagca?atgggacaag?gaccatcgct 360

tcccgaaaga?ggccatcgac?gagatggccg?aactgggcct?gttcggcatg?ctggtgccgg 420

agcagtgggg?cggtagcgac?accggttatg?tggcctatgc?catggccttg?gaggaaatcg 480

ctgcgggcga?tggcgcctgc?tcgaccatca?tgagcgtgca?caactcggtg?ggttgcgtgc 540

cgatcctgcg?cttcggc 557

<210>3

<211>921

<212>DNA

< 213>artificial sequence

<220>

<223>

<400>3

tatcgtgaac?tgacggccaa?tgagatagcc?actgtctagg?ccgtgacaga?cagcccgtgt?60

cgtcatacga?ccgctcagcg?acaaaagtca?cattacttac?cgaacggcac?ttgcgcgatc?120

cccaacccac?tgcttgaatc?caaatcgtca?gtctgcatgt?gactaccaag?tcacacctgc?180

agccgatgac?actttttgcc?ggccacccaa?agcctagatg?ccttggggca?cggcaaattg?240

cccgccaaaa?acaataccgt?cgacgcaagt?gccaaggatc?gacacagggc?ccccggatta?300

tcttcaggca?aatgcctacc?tgtcataaag?aacgtgcacc?ctaggtgacg?cgaataccct?360

ttttgcgcca?ggagtcgatg?acatgaggcc?agaaatcgct?gtacttgata?tccaaggtca?420

gtatcgggtt?tacacggagt?tctatcgcgc?aagcatgtgg?gcagaagcca?gttcagcgtg?480

atccgcgatg?cgggccactt?cctggacatg?gagaacaaga?ccgcctgcga?gaacacccgc?540

aatgtcatgc?tggcttcctc?aagccaaccg?tgcgtgaacc?ccgccaacgt?taccaacccg?600

tgcagcaggg?gcagcatgca?tttgccatct?gagcggctcg?cgccttgtag?ccaatacccg?660

caggccacgg?ggcgccgaca?agctttttta?taacttgggc?ttctaattcg?ctgaaggttc?720

tggtaaaaag?tcgagctcag?atgcgggtat?agtttagtgg?caaaacgaaa?gcttcccaag?780

ctttagttga?gggttcgatt?ccctctaccc?gctccacatc?gcagtcccgc?atggcgttcc?840

agcaacgtca?tcgcagtcaa?aaggagcctt?ggctcctttt?ttcgtttttc?atcctgcctt?900

gacctggccc?atg 913

<210>4

<211>1767

<212>DNA

< 213>the true bacteria of Luo Shi (Ralstonia eutropha)

<400>4

atggcgaccg?gcaaaggcgc?ggcagcttcc?acgcaggaag?gcaagtccca?accattcaag 60

gtcacgccgg?ggccattcga?tccagccaca?tggctggaat?ggtcccgcca?gtggcagggc 120

actgaaggca?acggccacgc?ggccgcgtcc?ggcattccgg?gcctggatgc?gctggcaggc 180

gtcaagatcg?cgccggcgca?gctgggtgat?atccagcagc?gctacatgaa?ggacttctca 240

gcgctgtggc?aggccatggc?cgagggcaag?gccgaggcca?ccggtccgct?gcacgaccgg 300

cgcttcgccg?gcgacgcatg?gcgcaccaac?ctcccatatc?gcttcgctgc?cgcgttctac 360

ctgctcaatg?cgcgcgcctt?gaccgagctg?gccgatgccg?tcgaggccga?tgccaagacc 420

cgccagcgca?tccgcttcgc?gatctcgcaa?tgggtcgatg?cgatgtcgcc?cgccaacttc 480

cttgccacca?atcccgaggc?gcagcgcctg?ctgatcgagt?cgggcggcga?atcgctgcgt 540

gccggcgtgc?gcaacatgat?ggaagacctg?acacgcggca?agatctcgca?gaccgacgag 600

agcgcgtttg?aggtcggccg?caatgtcgcg?gtgaccgaag?gcgccgtggt?cttcgagaac 660

gagtacttcc?agctgttgca?gtacaagccg?ctgaccgaca?aggtgcacgc?gcgcccgctg 720

ctgatggtgc?cgccgtgcat?caacaagtac?tacatcctgg?acctgcagcc?ggagagctcg 780

ctggtgcgcc?atgtggtgga?gcagggacat?acggtgtttc?tggtgtcgtg?gcgcaatccg 840

gacgccagca?tggccggcag?cacctgggac?gactacatcg?agcacgcggc?catccgcgcc 900

atcgaagtcg?cgcgcgacat?cagcggccag?gacaagatca?acgtgctcgg?cttctgcgtg 960

ggcggcacca?ttgtctcgac?cgcgctggcg?gtgctggccg?cgcgcggcga?gcacccggcc 1020

gccagcgtca?cgctgctgac?cacgctgctg?gactttgccg?acacgggcat?cctcgacgtc 1080

tttgtcgacg?agggccatgt?gcagttgcgc?gaggccacgc?tgggcggcgg?cgccggcgcg 1140

ccgtgcgcgc?tgctgcgcgg?ccttgagctg?gccaatacct?tctcgttctt?gcgcccgaac 1200

gacctggtgt?ggaactacgt?ggtcgacaac?tacctgaagg?gcaacacgcc?ggtgccgttc 1260

gacctgctgt?tctggaacgg?cgacgccacc?aacctgccgg?ggccgtggta?ctgctggtac 1320

ctgcgccaca?cctacctgca?gaacgagctc?aaggtaccgg?gcaagctgac?cgtgtgcggc 1380

gtgccggtgg?acctggccag?catcgacgtg?ccgacctata?tctacggctc?gcgcgaagac 1440

catatcgtgc?cgtggaccgc?ggcctatgcc?tcgaccgcgc?tgctggcgaa?caagctgcgc 1500

ttcgtgctgg?gtgcgtcggg?ccatatcgcc?ggtgtgatca?acccgccggc?caagaacaag 1560

cgcagccact?ggactaacga?tgcgctgccg?gagtcgccgc?agcaatggct?ggccggcgcc 1620

atcgagcatc?acggcagctg?gtggccggac?tggaccgcat?ggctggccgg?gcaggccggc 1680

gcgaaacgcg?ccgcgcccgc?caactatggc?aatgcgcgct?atcgcgcaat?cgaacccgcg 1740

cctgggcgat?acgtcaaagc?caaggca 1767

<210>5

<211>1290

<212>DNA

< 213>Ke Shi clostridium (Clostridium kluyveri)

<400>5

atggagtggg?aagagatata?taaagagaaa?ctggtaactg?cagaaaaagc?tgtttcaaaa 60

atagaaaacc?atagcagggt?agtttttgca?catgcagtag?gagaacccgt?agatttagta 120

aatgcactag?ttaaaaataa?ggataattat?ataggactag?aaatagttca?catggtagct 180

atgggcaaag?gtgaatatac?aaaagagggt?atgcaaagac?attttagaca?taatgcttta 240

tttgtaggcg?gatgtactag?agatgcagta?aattcaggaa?gagcagatta?tacaccttgt 300

tttttctatg?aagtgccaag?tttgtttaaa?gaaaaacgtt?tgcctgtaga?tgtagcactt 360

attcaggtaa?gtgagccaga?taaatatggc?tactgcagtt?ttggagtttc?caatgactat 420

accaagccag?cagcagaaag?tgctaagctt?gtaattgcag?aagtgaataa?aaacatgcca 480

agaactcttg?gagattcttt?tatacatgta?tcagatattg?attatatagt?ggaagcttca 540

cacccattgt?tagaattgca?gcctcctaaa?ttgggagatg?tagaaaaagc?cataggagaa 600

aactgtgcat?ctttaattga?agatggagct?actcttcagc?ttggaatagg?tgctatacca 660

gatgcggtac?ttttattctt?aaagaacaaa?aagaatttag?gaatacattc?tgagatgata 720

tcagatggtg?tgatggaact?ggtgaaggca?ggggttatca?ataacaagaa?aaagaccctc 780

catccaggca?aaatagttgt?aacattttta?atgggaacaa?aaaaattata?tgattttgta 840

aacaataatc?caatggtaga?aacttattct?gtagattatg?taaataatcc?actggtaatt 900

atgaaaaatg?acaatatggt?ttcaataaat?tcttgtgttc?aagtagactt?aatgggacaa 960

gtatgttctg?aaagtatagg?attgaaacag?ataagtggag?tgggaggcca?ggtagatttt 1020

attagaggag?ctaatctatc?aaagggtgga?aaggctatta?tagctatacc?ttccacagct 1080

ggaaaaggaa?aagtttcaag?aataactcca?cttctagata?ctggtgctgc?agttacaact 1140

tctagaaatg?aagtagatta?tgtagttact?gaatatggtg?ttgctcatct?taagggcaaa 1200

actttaagaa?atagggcaag?agctctaata?aatatcgctc?atccaaaatt?cagagaatca 1260

ttaatgaatg?aatttaaaaa?gagattttag 1290

<210>6

<211>348

<212>DNA

< 213>have a liking for aqueous vapor sporangium (Aeromonas hydrophila)

<400>6

atgaatatgg?acgtgatcaa?gagctttacc?gagcagatgc?aaggcttcgc?cgcccccctc 60

acccgctaca?accaactgct?ggccagcaac?atcgagcagc?tgacccggtt?gcagctggcc 120

tccgccaacg?cctacgccga?actgggcctc?aaccagttgc?aggccgtgag?caaggtgcag 180

gacacccaga?gtctggctgc?cctcggcaca?gtgcagctgg?agaccgccag?ccagctctcc 240

cgccagatgc?tggacgacat?ccagaagctg?agcgccctcg?gccagcagtt?caaggaagag 300

ctggatgtcc?tgaccgcgga?cggcatcaag?aagagcacgg?gcaaggcc 348

<210>7

<211>405

<212>DNA

< 213>have a liking for aqueous vapor sporangium (Aeromonas hydrophi la)

<400>7

atgagcgcac?aaccccttga?agtgggccag?aaggcccgtc?tcagcaagcg?gttcggggcg 60

gcagaggtgg?ccgccttcgc?cgcgctctcg?gaggatttca?accctctgca?ccttgatccg 120

gccttcgccg?ccaccacggc?gttcgagcga?cccatcgtcc?acggcatgct?gctggccagc 180

ctcttctccg?ggctgctggg?ccagcagttg?ccgggcaagg?ggagcatcta?tctgggccag 240

agcctcagct?tcaagctgcc?ggtctttgtc?ggggatgagg?tgacggccga?ggtggaggtg 300

accgcccttc?gcagcgacaa?gcccatcgcc?accctgacca?cccgcatctt?cacttcaaac 360

ggcgccctcg?ccgtgacggg?ggaagccgtg?gtcaagctgc?cttaa 405

<210>8

<211>1782

<212>DNA

< 213>have a liking for aqueous vapor sporangium (Aeromonas hydrophila)

<400>8

atgagccaac?catcttatgg?cccgctgttc?gaggccctgg?cccactacaa?tgacaagctg 60

ctggccatgg?ccaaggccca?gacagagcgc?accgcccagg?cgctgctgca?gaccaatctg 120

gacgatctgg?gccaggtgct?ggagcagggc?agccagcagc?cctggcagct?gatccaggcc 180

cagatgaact?ggtggcagga?tcagctcaag?ctgatgcagc?acaccctgct?gaaaagcgca 240

ggccagcaga?gcgagccggt?gatcaccccg?gagcgcagcg?atcgccgctt?caaggccgag 300

gcctggagcg?aacaacccat?ctatgactac?ctcaagcagt?cctacctgct?caccgccagg 360

cacctgctgg?cctcggtgga?tgccctggac?ggcgtccccc?agaagagccg?ggagcggctg 420

cgtttcttca?cccgtcagta?cgtcaacgcc?atggcaccca?gcaacttcct?ggccaccaac 480

ccggagctgc?tcaagctcac?cctggagtcc?gacggccaga?acctggtgcg?cgggctggcc 540

ctcttggccg?aggatctgga?gcgcagcgcc?gatcagctca?acatccgcct?gaccgacgaa 600

tccgccttcg?agctcggccg?ggatctggcg?accaccccgg?gccgggtggt?gcagcgcacc 660

gagctctatg?agctgatcca?gtacagcccc?accacggaaa?ccgtgggcaa?gacgcctgtg 720

ctgatcgtgc?cccccttcat?caacaagtac?tacatcatgg?acatgcggcc?ccagaactcc 780

ctggtcgcct?ggctggtcgc?ccagggccag?acggtgttca?tgatctcctg?gcgcaacccg 840

agcgtagccc?aggcccaaat?cgatctcgac?gactacgtgg?tggatggcgt?catcgccgcc 900

ctggacggcg?tggaagcggc?caccggcgag?cgggaggtgc?acggcatcgg?ctactgcatc 960

ggcggcaccg?ccctgtcgct?cgccatgggc?tggctggcgg?cgcggcgcca?gaagcagcgg 1020

gtgcgcactg?ccaccctgtt?caccaccctg?ctggacttct?cccagccagg?ggagcttggc 1080

atcttcattc?acgagcccat?catagcggcg?ctcgaggcgc?aaaatgaggc?caagggcatc 1140

atggacgggc?gccagctggc?tgtctctttc?agcctgctgc?gggagaacag?cctctactgg 1200

aactactaca?tcgacagcta?cctcaagggt?cagagcccgg?tggccttcga?tctgctgcac 1260

tggaacagcg?acagcaccaa?tgtggcgggc?aagacccaca?acagcctggt?gcgccgtctc 1320

tatctggaga?accagctggt?gaagggggag?ctcaagatcc?gcaacacccg?catcgatctt 1380

ggcaaggtga?agacccctgt?gctgctggtg?tcggcggtgg?acgatcacat?cgccctctgg 1440

cagggcacct?ggcagggcat?gaagctgttt?ggcggggagc?agcgcttcct?cctggcagag 1500

tccggccaca?tcgccggcat?catcaacccg?ccggtcgcca?acaagtacgg?cttctggcac 1560

aacggggccg?aggccgatag?cccggagagc?tggctggcag?gggcgacgca?tcagagcggc 1620

tcctggtggc?ccgagatgat?gggctttatc?cagagccgtg?acgaagggtc?agagcccgtc 1680

cccgcacggg?tgcccgagga?ggggctggcc?cccgcccccg?gccactatgt?caaggtgcgg 1740

ctcaaccccg?tgtttgccag?cgccacagag?gaggacgccg?ca 1782

<210>9

<211>430

<212>DNA

< 213>artificial sequence

<220>

<223>

<400>9

cagctggcga?tggctgcgct?gaggctcgaa?accatcgccg?gtgcccagcg?tctgctcgat 60

ctgctgtaac?gccgcacgta?tcggcccctc?cagtgccaag?gcccgtggcg?tcgggcgcat 120

gcgccggccc?acgcggacca?gcagcgggtc?acccagctgg?tcacgcaggc?gcgccagggc 180

attgctcacg?gtcggctggg?tcagggccag?acgctcggct?gcccgggata?cattctgttc 240

acgcagcaac?atgtcgaaga?cgcgcagcag?gttcaggtcg?aagttcgaaa?tattcatgct 300

gaaaatatat?ggcatacgaa?atggaaattt?caaaaatacc?ttcggcctgc?ttagggtgat 360

cacagtcctc?atacctacaa?gaaagcagga?gcgttgcgcg?tgaatactcc?cttcccgatc 420

aatcaggtgg 430

<210>10

<211>488

<212>DNA

< 213>artificial sequence

<220>

<223>

<400>10

cgcgttctag?cgcacggcaa?accacacgaa?caaggagagt?gcgatgcagc?ctttcagctt 60

tgccaccact?gcgcagatcc?tctgcgaacc?cggcgcggtg?cagcgccttg?caggtctgtg 120

ccgtgagcgc?ggtgccaagc?gtgttttgat?tatcagtgac?ccgggtatcg?cccgccttgg 180

catgctcgat?gacctgctgc?cggggttcac?ggcagccaag?gtcggtgtgg?cgatcttcag 240

tgaggttacg?gccgacccca?gcgaggcatg?cgtgctggcg?gccgcccagc?gcgcccggca 300

tatcggcgcc?gacctggtgg?tggggttcgg?cggcggcagc?tcgatggatg?tggccaagct 360

ggttgcgctg?ctggcccacc?gcgattgttc?gcagcccatc?gccgagctgt?acggcatcga 420

cagggccaag?ggccgccggc?tgccgttgat?ccaggtgccc?accacggcag?gtaccggttc 480

ggaggtga 488

<210>11

<211>2784

<212>DNA

< 213>artificial sequence

<220>

<223>

<400>11

ctagagcaga?tgatggcctt?cgagactgcc?aagggcttcg?tcgctggcca?ggccggcccg 60

aactacccgg?ccccggtcga?agcgatcaag?agcatccaga?aagccgccaa?cttcggtcgc 120

gacaaggccc?tggaagtcga?agccgcaggc?tttgccaagc?tggccaagac?ctctgtcgcc 180

gagagcctga?tcggcttgtt?cctcaacgat?caggaactca?agcgcaaggc?caaggcgcat 240

gacgagatcg?cccacgacgt?gaagcaggcc?gccgtgctcg?gcgccggcat?catgggcggc 300

ggtatcgcct?accagtcggc?ggtcaaaggt?acgccgatcc?tgatgaagga?catccgcgag 360

gaagccattc?agctgggtct?gaacgaggcc?tccaagttgc?ttggcaaccg?cgtcgagaag 420

ggccgcctga?ccccggccaa?gatggccgag?gccctcaacg?ccattcgccc?gaccctgtcc 480

tatggcgatt?tcgccaatgt?cgacatcgtc?gtcgaggctg?tggtcgagaa?cccgaaggtc 540

aagcaagcgg?tactggcgga?agtggaaggc?caggtgaagg?acgatgcgat?cctcgcttcc 600

aacacctcta?ccatctccat?caacctgctg?gccaaggcgc?tcaagcgccc?ggaaaacttc 660

gtcggcatgc?acttcttcaa?cccggtgcac?atgatgccgc?tggttgaagt?gatccgtggc 720

gagaagtcca?gtgacgtggc?ggtcgccacc?accgtggcct?acgccaagaa?aatgggcaag 780

aacccgatcg?tggtcaacga?ctgcccgggc?tttttggtca?accgcgtgct?gttcccgtac 840

tttggcggtt?ttgccaagct?ggtcagcgcc?ggtgtcgact?tcgtgcgcat?cgacaaggtc 900

atggagaagt?tcggctggcc?gatgggccca?gcctacttga?tggacgtggt?cggcatcgac 960

accggccacc?acggccgtga?cgtcatggcc?gaaggcttcc?cggatcgcat?gaaggacgag 1020

cgccgctcgg?cagtcgacgc?gttgtacgag?gccaaccgcc?tgggccagaa?gaacggtaag 1080

ggcttctacg?cctacgaaac?cgacaagcgc?ggcaagccga?agaaggtctt?cgatgccacc 1140

gtgctcgacg?tgctcaaacc?gatcgtgttc?gagcagcgtg?aagtcactga?cgaagacatc 1200

atcaactgga?tgatggtccc?gctgtgcctt?gagaccgtgc?gttgcctgga?agacggcatc 1260

gtcgaaaccg?ctgccgaagc?cgacatgggc?ctggtctacg?gcattggttt?ccctcccttc 1320

cgcggtggtg?cgctgcgtta?catcgactcg?atcggtgtgg?ccgaattcgt?cgccctggcc 1380

gatcagtatg?ccgacctggg?gccgctgtac?cacccgaccg?ccaagctgcg?tgaaatggcc 1440

aagaacggcc?agcgcttctt?caactgagcg?gtcaacgagc?tagagcgaga?gatttgatat 1500

gagcctgaat?ccaagagacg?tggtgattgt?cgacttcggt?cgcacgccaa?tgggccgctc 1560

caagggtggc?atgcaccgca?acacccgcgc?cgaagacatg?tcggcgcacc?tgatcagcaa 1620

gctgctggaa?cgcaacggca?aggtcgaccc?gaaagaagtc?gaggacgtga?tctggggctg 1680

cgtcaaccag?accctggagc?agggctggaa?catcgcccgc?atggcttcgc?tgatgacccc 1740

gatcccgcac?acctctgcgg?cgcagaccgt?cagccgcctg?tgcggctcgt?ccatgagcgc 1800

gctgcacacg?gccgcccagg?cgatcatgac?cggtaacggt?gatgtgttcg?tggtcggtgg 1860

cgtggagcac?atgggccacg?tcagcatgat?gcatggcgta?gaccccaacc?cgcacctgtc 1920

cttgcatgcc?gccaaggctt?ccgggatgat?gggcctgact?gcagaaatgc?tcggcaagat 1980

gcacggcatc?acccgtgagc?agcaggacct?gttcggcttg?cgttcgcacc?agctggccca 2040

caaggccacg?gtcgaaggca?agttcaagga?cgagatcatc?ccgatgcagg?gctacgacga 2100

gaacggcttc?ctgaaggtgt?tcgatttcga?cgaaaccatt?cgcccggaaa?ccaccctcga 2160

aggcctggca?tcgctcaagc?ctgcgttcaa?cccgaaaggc?ggtacggtca?cggccggtac 2220

ctcgtcgcag?atcaccgacg?gcgcctcgtg?catgatcgtc?atgtccggtc?agcgtgccat 2280

ggacctcggt?atccagccat?tggcggtgat?ccgttcgatg?gcagtggccg?gtgtcgaccc 2340

ggcaatcatg?ggctacggcc?cggtgccatc?gacccagaaa?gccctcaagc?gtgcgggctt 2400

gaccatggcc?gatatcgact?tcatcgagct?caacgaagcc?ttcgctgcgc?aggccctgcc 2460

cgtgctgaaa?gacttgaaag?tgctcgacaa?gatggatgag?aaggttaacc?tgcacggcgg 2520

cgccattgct?ttgggccacc?cgttcggttg?ctccggggcg?cggatttccg?gcaccctgct 2580

caacgtcatg?aagcaaaatg?gcggtacgct?gggtgttgcg?accatgtgcg?tcggcctggg 2640

ccaaggtatc?accactgtct?tcgaacgcgt?ctgatcgcgt?agcgggacag?cagccggggc 2700

ctagtgcccc?ggttttgttt?tttcaggttt?ttttcaggag?gtgtgcaaca?tgcagataca 2760

accaggcgta?taccggcatt?acaa 2784

Claims

1. recombinant pseudomonas putida is as following 1), 2) or 3) shown in:

1) said recombinant pseudomonas putida is to prepare according to the method that comprises the steps: make the encoding function forfeiture of the 3-hydroxyl acyl lipophorin thiophorase encoding sox among the recombinant pseudomonas putida I; Obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida II; Said recombinant pseudomonas putida I is according to the preparation of the method that comprises the steps: 3-hydroxyl fatty acyl-CoA dehydrogenase encoding sox and the encoding function of 3-keto acyl coenzyme A thiolase encoding sox of using in the pseudomonas that stinks of (Pseudomonas putida) are lost, and obtain recombinant pseudomonas putida I;

2) said recombinant pseudomonas putida is according to the preparation of the method that comprises the steps: to 1) import Poly-synthetase-coding gene and 4-maloyl group thiophorase encoding sox among the said recombinant pseudomonas putida II; Obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida III;

3) said recombinant pseudomonas putida is according to the preparation of the method that comprises the steps: to 1) import the encoding sox and the pha synthesizing enzyme encoding sox of the protein-bonded encoding sox of PHA particle, enoyl coenzyme A hydratase among the said recombinant pseudomonas putida II; Obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida IV.

2. recombinant pseudomonas putida according to claim 1 is characterized in that:

Said encoding function forfeiture of using 3-hydroxyl fatty acyl-CoA dehydrogenase encoding sox and 3-keto acyl coenzyme A thiolase encoding sox in the pseudomonas that stinks of realizes through homologous recombination; The method of said homologous recombination comprises the steps: in the said pseudomonas putida that sets out to import in the sequence table DNA shown in the sequence 2 among the DNA shown in the sequence 1 and sequence table; The encoding sox generation homologous recombination of the 3-hydroxyl fatty acyl-CoA dehydrogenase in the said sequence table in DNA shown in the sequence 1 and the said pseudomonas putida that sets out; The encoding sox generation homologous recombination of the 3-keto acyl coenzyme A thiolase in the said sequence table in DNA shown in the sequence 2 and the said pseudomonas putida that sets out obtains said recombinant pseudomonas putida I;

Said 1) shown in the recombinant pseudomonas putida, said the encoding function forfeiture of the 3-hydroxyl acyl lipophorin thiophorase encoding sox among the said recombinant pseudomonas putida I is realized through homologous recombination; The method of said homologous recombination comprises the steps: in said recombinant pseudomonas putida I, to import DNA shown in the sequence 3 in the sequence table; The encoding sox generation homologous recombination of the 3-hydroxyl acyl lipophorin thiophorase in the said sequence table among DNA shown in the sequence 3 and the said recombinant pseudomonas putida I obtains said recombinant pseudomonas putida II;

Said 2) in the recombinant pseudomonas putida, said Poly-synthetase-coding gene and 4-maloyl group thiophorase encoding sox import through recombinant vectors shown in;

Said 3) in the recombinant pseudomonas putida, the encoding sox and the pha synthesizing enzyme encoding sox of the protein-bonded encoding sox of said PHA particle, enoyl coenzyme A hydratase import through recombinant vectors shown in; Said recombinant vectors is that KpnI and EcoRI site that the fusion gene that the encoding sox of the protein-bonded encoding sox of said PHA particle, pha synthesizing enzyme encoding sox and enoyl coenzyme A hydratase constitutes inserts carrier pBBR1-MCS2 are obtained; The protein-bonded encoding sox of said PHA particle is positioned at the upper reaches of said fusion gene, and said pha synthesizing enzyme encoding sox is positioned at the middle reaches of said fusion gene, and the encoding sox of said enoyl coenzyme A hydratase is positioned at the downstream of said fusion gene.

3. recombinant pseudomonas putida according to claim 2 is characterized in that:

In the said sequence table in DNA shown in the sequence 1 and the sequence table DNA shown in the sequence 2 import through recombinant vectors; Said recombinant vectors is that XbaI and HindIII site that the fusion gene that DNA shown in the sequence 2 in DNA shown in the sequence 1 in the said sequence table and the table constitutes inserts the carrier pK18mobSacB that sets out are obtained; DNA shown in the sequence 1 is positioned at the upper reaches of fusion gene in the said sequence table, and DNA shown in the sequence 2 is positioned at the downstream of fusion gene in the said table;

Said 1) in the recombinant pseudomonas putida, DNA shown in the sequence 3 imports through recombinant vectors in the said sequence table shown in; Said recombinant vectors is that HindIII and XmaI site that DNA shown in the sequence 3 in the said sequence table inserts the carrier pK18mobSacB that sets out are obtained;

Said 2) in the recombinant pseudomonas putida, the nucleotide sequence of said Poly-synthetase-coding gene is shown in sequence in the sequence table 4 shown in, and the nucleotide sequence of said 4-maloyl group thiophorase encoding sox is shown in sequence in the sequence table 5; Said Poly-synthetase-coding gene is positioned at the upper reaches of said fusion gene, and said 4-maloyl group thiophorase encoding sox is positioned at the downstream of said fusion gene;

Said 3) in the recombinant pseudomonas putida, the nucleotide sequence of the protein-bonded encoding sox of said PHA particle is shown in sequence in the sequence table 6 shown in, and the nucleotide sequence of the encoding sox of said enoyl coenzyme A hydratase is shown in sequence in the sequence table 7; The nucleotide sequence of said pha synthesizing enzyme encoding sox is shown in sequence in the sequence table 8; Said recombinant vectors obtains according to following method: the genomic dna with Aeromonas hydrophila (Aeromonas hydrophila) 4AK4 is a template, to carrying out pcr amplification, obtains the PCR product with following primer: primer P1 and P2; The nucleotide sequence of said P1 is TTTGGTACCTGGAGACCGATGATGAATATGG, and the nucleotide sequence of said P2 is ATGAATTCTTAAGGCAGCTTGACCACGG; With restriction enzyme KpnI and EcoRI said pcr amplification product is carried out double digestion, reclaim gene fragment; With restriction enzyme KpnI and EcoRI carrier pBBR1-MCS2 is carried out double digestion, reclaim enzyme and cut big fragment; Said gene fragment and said enzyme are cut big fragment be connected, obtain said recombinant vectors.

4. according to claim 1,2 or 3 described recombinant pseudomonas putidas, it is characterized in that: the said pseudomonas putida that sets out is strain Pseudomonas putida KTOY06.

5. the application of arbitrary described recombinant pseudomonas putida in the preparation polyhydroxyalkanoate among the claim 1-4.

6. a method for preparing polyhydroxyalkanoate comprises the steps: that with lipid acid, solubility soap or gamma-butyrolactone be carbon source, carries out biosynthesizing with arbitrary said recombinant pseudomonas putida among the claim 1-4, obtains polyhydroxyalkanoate.

7. method according to claim 6 is characterized in that: the said biosynthetic method arbitrary said recombinant pseudomonas putida among the claim 1-4 that comprises the steps: to ferment obtains containing the fermented liquid of said recombinant pseudomonas putida; In the said fermented liquid that contains recombinant pseudomonas putida, adding said lipid acid or said solubility soap or said gamma-butyrolactone, is to continue to cultivate 39h under 30 ℃ the condition in temperature, obtains polyhydroxyalkanoate.

8. according to claim 6 or 7 described methods; It is characterized in that: said lipid acid is valeric acid, caproic acid, enanthic acid, sad, n-nonanoic acid, capric acid, LAURIC ACID 99 MIN or myristic acid, and said solubility soap is natrium valericum, Sodium n-caproate, enanthic acid sodium, Sodium octoate, n-nonanoic acid sodium or Sodium decanoic acid.

9. according to claim 6 or 7 described methods, it is characterized in that: said polyhydroxyalkanoate is hydroxyalkanoate homopolymer or hydroxy fatty acid ester copolymer;

Said biosynthetic method is following 1), 2), 3) or 4) shown in:

1) said recombinant pseudomonas putida is recombinant pseudomonas putida II, and said solubility soap is Sodium n-caproate, and the chemical formula of said polyhydroxyalkanoate is suc as formula shown in the II-1, and the number-average molecular weight of said polyhydroxyalkanoate is 206 * 10 ³Da, the weight-average molecular weight of said polyhydroxyalkanoate is 272 * 10 ³Da; The concentration of said Sodium n-caproate in the said fermented liquid that contains pseudomonas putida is 10g/L;

(formula II-1)

2) said recombinant pseudomonas putida is recombinant pseudomonas putida II, and said solubility soap is Sodium octoate, and the chemical formula of said polyhydroxyalkanoate is suc as formula shown in the II-2, and the number-average molecular weight of said polyhydroxyalkanoate is 148 * 10 ³Da, the weight-average molecular weight of said polyhydroxyalkanoate is 180 * 10 ³Da; The concentration of said Sodium octoate in the said fermented liquid that contains pseudomonas putida is 10g/L;

(formula II-2)

(formula III)

(formula IV)

10. method according to claim 8 is characterized in that: said polyhydroxyalkanoate is hydroxyalkanoate homopolymer or hydroxy fatty acid ester copolymer;

Said biosynthetic method is following 1), 2), 3) or 4) shown in:

(formula II-1)

(formula II-2)

(formula III)

(formula IV).

11. according to claim 6 or 7 described methods; It is characterized in that: the said fermented liquid that contains recombinant pseudomonas putida is to obtain according to the method that comprises the steps: said recombinant pseudomonas putida is inoculated in the LB-Km liquid nutrient medium; Be to cultivate under 30 ℃ the condition in temperature, obtain said fermented liquid; Said LB-Km liquid nutrient medium is made up of yeast extract, peptone, NaCl, sulphuric acid kanamycin and water; The concentration of yeast extract in the LB-Km liquid nutrient medium is 5g/L; The concentration of peptone in the LB-Km liquid nutrient medium is 10g/L; The concentration of NaCl in the LB-Km liquid nutrient medium is 10g/L, and the concentration of sulphuric acid kanamycin in the LB-Km liquid nutrient medium is 50 μ g/mL.

12. method according to claim 8; It is characterized in that: the said fermented liquid that contains recombinant pseudomonas putida is to obtain according to the method that comprises the steps: said recombinant pseudomonas putida is inoculated in the LB-Km liquid nutrient medium; Be to cultivate under 30 ℃ the condition in temperature, obtain said fermented liquid; Said LB-Km liquid nutrient medium is made up of yeast extract, peptone, NaCl, sulphuric acid kanamycin and water; The concentration of yeast extract in the LB-Km liquid nutrient medium is 5g/L; The concentration of peptone in the LB-Km liquid nutrient medium is 10g/L; The concentration of NaCl in the LB-Km liquid nutrient medium is 10g/L, and the concentration of sulphuric acid kanamycin in the LB-Km liquid nutrient medium is 50 μ g/mL.

13. method according to claim 9; It is characterized in that: the said fermented liquid that contains recombinant pseudomonas putida is to obtain according to the method that comprises the steps: said recombinant pseudomonas putida is inoculated in the LB-Km liquid nutrient medium; Be to cultivate under 30 ℃ the condition in temperature, obtain said fermented liquid; Said LB-Km liquid nutrient medium is made up of yeast extract, peptone, NaCl, sulphuric acid kanamycin and water; The concentration of yeast extract in the LB-Km liquid nutrient medium is 5g/L; The concentration of peptone in the LB-Km liquid nutrient medium is 10g/L; The concentration of NaCl in the LB-Km liquid nutrient medium is 10g/L, and the concentration of sulphuric acid kanamycin in the LB-Km liquid nutrient medium is 50 μ g/mL.

14. method according to claim 10; It is characterized in that: the said fermented liquid that contains recombinant pseudomonas putida is to obtain according to the method that comprises the steps: said recombinant pseudomonas putida is inoculated in the LB-Km liquid nutrient medium; Be to cultivate under 30 ℃ the condition in temperature, obtain said fermented liquid; Said LB-Km liquid nutrient medium is made up of yeast extract, peptone, NaCl, sulphuric acid kanamycin and water; The concentration of yeast extract in the LB-Km liquid nutrient medium is 5g/L; The concentration of peptone in the LB-Km liquid nutrient medium is 10g/L; The concentration of NaCl in the LB-Km liquid nutrient medium is 10g/L, and the concentration of sulphuric acid kanamycin in the LB-Km liquid nutrient medium is 50 μ g/mL.