WO2008135065A1

WO2008135065A1 - PHAs PRODUCING MICROORGANISM AND PHA OBTAINABLE THEREWITH

Info

Publication number: WO2008135065A1
Application number: PCT/EP2007/004007
Authority: WO
Inventors: Jean Guezennec; Sébastien COLIN; Christelle Simon-Colin; Gérard RAGUENES; Gloria Vendrell
Original assignee: Total Petrochemicals Research Feluy; Institut Francais De Recherche Pour L'exploitationde La Mer
Priority date: 2007-05-07
Filing date: 2007-05-07
Publication date: 2008-11-13

Abstract

The present invention relates to poly-3-hydroxyalkanoate produced by a Pseudomonas sp. RA26 strain (CNCM 1-3358), wherein said poly-3-hydroxyalkanoate comprises as repeating units, formulae (I, II, III, IV, V, VI, VII, VIII, IX), 0.05 to 1 wt% of 3-hydroxy butyrate units having the formula I, 0.5 to 5 wt% of 3-hydroxy hexanoate units having the formula (II), 15 to 45 wt% of 3-hydroxy octanoate units having the formula (III), 25 to 70 wt% of 3-hydroxy decanoate units having the formula (IV), 2 to 20 wt% of 3-hydroxy dodecanoate units having the formula (V), 0 to 10 wt% of 3-hydroxy-10- dodecenoate units having the formula Vl, 0 to 5 wt% of 3-hydroxy tetradecanoate units having the formula (VII), 0 to 30 wt% of 3-hydroxy-12-tetradecenoate units having the formula (VIII), and 0 to 5 wt% of 3-hydroxy-10,12-tetradecadienoate units having the formula (IX), or a stereoisomer, tautomer, racemate, salt, hydrate, or solvate thereof.

Description

PHAs producing microorganism and PHA obtainable therewith Field of the Invention

The present invention relates to poly-3-hydroxyalkanoates (PHAs) synthesizing microorganism and a process of producing poly-3-hydroxyalkanoate of medium chain length (PHAmcl) using the same. The invention also relates to said poly-3- hydroxyalkanoate and to DNA and protein sequences coding for proteins useful in cell synthesis of said PHAs. The invention also relates to microbial production of said poly-3- hydroxyalkanoates, using recombinant bacteria capable of producing such polymers.

Background of the invention Placed under certain conditions of nutritional and/or energetic imbalances, a certain number of micro-organisms have the ability to synthesize intracellular storage molecules. Some of these storage molecules are polymers of hydroxyalkanoic acids, known as polyhydroxyalkanoates (PHAs).

Due to their physical and chemical properties, this class of polymers has attracted much attention as a potential alternative of conventional petrochemical-derived plastics, with the advantage of renew ability of the sources and biodegradability on disposal.

Interest has focused on PHAs because these biopolymers are thermoplastics and the physical properties of some PHAs resemble the properties of petrochemically-based polymers such as polyethylene and polypropylene. Numerous bacteria and fungi can hydrolyze PHAs to monomers and oligomers, which are metabolized as a carbon source. PHAs thus have attracted attention as a potential source of renewable and biodegradable plastics and elastomers.

The nature of these polyesters is linked to several parameters such as physicochemical parameters, the limiting source, and the type of carbon source. The most commonly found compound of this class is poly-3-hydroxybutyrate. However, some microbial species accumulate copolymers, which in addition to hydroxybutyrate, may contain longer chain hydroxyalkanoates. Polymers containing monomers of C6 units and above are classified as medium chain length PHAs (PHAmcl).

While PHAs have been of general interest because of their biodegradable nature, their actual use as a plastic material has been hampered by their mechanical properties, thermal instability and by their high price. Thus, only some PHAs have found few industrial application, the most representatives being PHB (poly-3-hydroxybutyrate), PHB-V (poly- hydroxybutyrate-co-hydroxyvalerate), P4HB (poly-4-hydroxybutyrate), P3HB4HB (poly (3- hydroxybutyrate-co-4-hydroxybutyrate)) and some PHAmcl, the typical representative of this last family being PHHx (polyhydroxyhexanoate). PHB is a highly crystalline polymer with rather poor physical properties, being relatively stiff and brittle. PHBΛ/ is a thermoplastic having a high degree of crystallinity and a high melting temperature. As a result, PHB/V becomes unstable and degrades at elevated temperatures near its melting temperature. In addition, PHB/V has mechanical problems such as poor flexibility and poor impact resistance. Both copolymers suffer the drawbacks of high crystallinity and fragility/brittleness. In contrast, PHA copolymers containing monomer units ranging from three to five carbons for short-chain-length PHA or 6-14 carbons for medium-chain-length PHA (MCL-PHA) are less crystalline and more flexible polymers. However, medium to long side-chain PHAs, such as isotactic polyhydroxyoctanoates (PHOs), are amorphous owing to the recurring pentyl and higher alkyl side-chains.

Further poly (3-hydroxyalkanoate) copolymer compositions have been disclosed by Kaneka (U.S. Pat No. 5,292,860) and Procter & Gamble (U.S. Pat Nos. 5,498,692; 5,536,564; 5,990,271 ; 6,160,199). All describe various approaches of tailoring the crystallinity and melting point of PHAs to any desirable lower value than in the high- crystallinity PHB or PHBV by randomly incorporating controlled amounts of "defects" along the backbone that partially impede the crystallization process. Yet, whereas the mechanical properties and melt handling conditions of such copolymers are generally improved over that of PHB or PHBV, their rate of crystallization is characteristically slow, often slower than PHB and PHBV.

There exists therefore a need for novel polyhydroxyalkanoate polymers suitable for commercial applications. In particular, there is a need for polyhydroxyalkanoates with improved physico-chemical and mechanical properties.

Summary of the invention The inventors have found a new strain, which is capable of synthesizing novel poly-3- hydroxyalkanoate copolymers composed of different monomers comprising but not limited to 3-hydroxybutyric acid (C4), 3-hydroxyhexanoic acid (C6), 3-hydroxyoctanoic acid (C8), 3-hydroxydecanoic acid (C10), 3-hydroxydodecanoic acid (C12) monomers, 3- hydroxydodecadienoic acid (C12:2); 3-hydroxydodecanoic acid (C12:1 ); 3- hydroxytetradecenoic acid (C14:1 ); 3-hydroxytetradecadienoic acid (C14:2); 3- hydroxytetradecanoic acid (C14:0), and mixtures thereof.

The new strain is Pseudomonas sp. RA26 strain (RA26) deposited on January 27, 2005 at the Collection Nationale de Cultures de Microorganismes, lnstitut Pasteur, under the n° CNCM I-3358, abbreviated hereunder "RA26 strain". The present invention therefore concerns said new RA26 strain, biologically pure culture thereof, descendants, variants and mutants thereof.

The invention also relates to poly-3-hydroxyalkanoate produced by said Pseudomonas sp. RA26 strain (CNCM 1-3358), wherein said poly-3-hydroxyalkanoate comprises as repeating units,

O -0-CH-CH₂- ⁰C 0-CH-CH₂- ffC 0-CH-CH₂- 9C C-CH-CH₂- flC-

-0-CH-CH₂-C- (CH₂)J (CH₂U (CH₂)_β (CH₂J₈

CH3 CH₃ CH3 CH3 CH3

I Il III IV V

-0-CH-CH₂- ⁰C C-CH-CH₂-C ° 0-CH-CH₂-C ° 0-CH-CH₂-C °-

(CH₂J₆ (CH₂)I₀ (CH₂J₈ (CH₂J₆

CH=CH-CH₃ CH₃ CH=CH-CH₃ CH=CH-CH=CH-CH₃

Vl VII VIII IX 0.05 to 1 wt% of 3-hydroxy butyrate units having the formula I, 0.5 to 5 wt% of 3-hydroxy hexanoate units having the formula II, 15 to 45 wt% of 3-hydroxy octanoate units having the formula III, 25 to 70 wt% of 3-hydroxy decanoate units having the formula IV, 2 to 20 wt% of 3-hydroxy dodecanoate units having the formula V, 0 to 10 wt% of 3-hydroxy-10-dodecenoate units having the formula Vl, 0 to 5 wt% of 3-hydroxy tetradecanoate units having the formula VII, 0 to 30 wt% of 3-hydroxy-12-tetradecenoate units having the formula VIII, and 0 to 5 wt% of 3-hydroxy-10,12-tetradecadienoate units having the formula IX, or stereoisomer, tautomer, racemate, salt, hydrate, or solvate thereof. The present invention also relates to method of producing a poly-3-hydroxyalkanoate according to the invention, comprising a step of allowing the RA26 strain according to the invention to synthesize said poly-3-hydroxyalkanoate.

The present invention further relates to at least one nucleic acid encoding an enzyme selected from the group comprising polyhydroxyalkanoate synthase PhaC1 , or polyhydroxyalkanoate synthase PhaC2, wherein the PhaC1 amino acid sequence is at least 97% identical to SEQ ID NO: 1 , wherein the PhaC2 amino acid sequence is at least 86% identical to SEQ ID NO: 3.

The present invention also encompasses a recombinant host having stably incorporated into the genome a nucleic acid according to the present invention, and the use of said recombinant host for the production of poly-3-hydroxyalkanoate according to the invention. The recombinant host can be a yeast cell, a bacterial cell or a plant cell. Preferably, the recombinant host is a bacterial cell, such as for example E. coli.

Applicants have surprisingly discovered that the PHAs according to the invention provide, in addition to biodegradability, the following properties, particularly as compared to prior art PHA polymers a lower melt temperature, a lower degree of crystallinity, and an improved melt rheology.

The present invention relates to biodegradable PHAs which are surprisingly easy to process into films as compared to prior art PHAs. The PHAs according to the invention can be used in the preparation of films, sheets, molded articles, fibers, elastomerics, laminates and coated articles, nonwoven fabrics, synthetic paper products, foams, and the like

Those skilled in the art will immediate recognize the many other effects and advantages of the present method and the numerous possibilities for end uses of the present invention from the detailed description and examples provided below.

Brief description of the Figures

Figure 1 represents a phylogenetic tree showing the phylogenetic position of the RA26 strain according to the invention within the genus Pseudomonas.

Figure 2 represents a graph plotting the DSC curve of a PHA according to an embodiment of the present invention.

Figure 3 represents schematically the organization of the PHA locus in Pseudomonas and cloning strategy of the whole locus in three overlapping fragments by PCR. Fi and Rj indicates the forward and reverse primers which were used for the amplification of the fragments by PCR (F: forward ; R: reverse, i and j being the numbers indicated next to F or R).

Figure 4 represents the amino acid sequence of PhaC1 (SEQ ID NO: 1 ). Figure 5 represents one example of nucleic acid sequence of PhaC1 (SEQ ID NO: 2). Figure 6 represents the amino acid sequence of PhaC2 (SEQ ID NO: 3) Figure 7 represents one example of nucleic acid sequence of PhaC2 (SEQ ID NO: 4). Detailed description

The present invention will now be further described. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.

As used in the specification and the appended claims, the singular forms "a", "an," and "the" include plural referents unless the context clearly dictates otherwise. By way of example, "a monomer" means one monomer or more than one monomer.

The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within that range (e.g. 1 to 5 includes 1 , 1.5, 2, 2.75, 3, 3.80, 4, and 5).

The strain RA26 according to the present invention produces complex PHAs. Without being bound by any theory, the metabolism of the produced PHAs derives either from the fatty acids biosynthesis cycle or from their degradation (/?-oxidation) cycle, depending on the type of carbon source used, respectively, a carbohydrate or fatty acids. The two cycles feed in a single enzymatic step the PHA synthase in substrate, namely the (R)-3- hydroxyacyl-CoA. (R)-3-hydroxyacyl-CoA is produced by the PhaG protein from (R)-3- hydroyacyl-ACP through fatty acids anabolism, and/or is produced by the PhaJ protein from enoyl-CoA through fatty acids catabolism.

In an embodiment of the present invention, the PHAs of the present invention are isotactic and have the R absolute configuration at the stereocenters in the polymer backbone.

The present invention also concerns a method of producing a poly-3-hydroxyalkanoate according to the invention. This method comprises the step of growing a RA26 strain in a culture medium, preferably under certain conditions, to synthesize said poly-3- hydroxyalkanoate.

In an embodiment, the RA26 strain is grown in a culture medium comprising at least one carbon source selected from glycerol; at least one fatty acid, an ester, or an oil thereof; at least one light cycle oil; at least one carbohydrate; or mixtures thereof. Preferably, said carbon source is selected from glycerol, acetate, propionate, pyruvate, valerate, caprylate, hexanoate, heptanoate, oleic acid, lauric acid, myristic acid, olive oil, glucose, light cycle oil, or a mixture thereof. More preferably said carbon source is selected from glycerol, glucose, olive oil, oleic acid, and mixture thereof, such as mixture comprising glycerol and oleic acid, mixture comprising glycerol and olive oil, mixture comprising glucose, glycerol and oleic acid and the like.

Preferably said RA26 strain is grown in medium comprising sea water or suitable amount of salts to mimic (reproduce) sea water composition.

The strain RA26 according to the present invention comprises two PHA synthases PhaC1 and PhaC2 which can be either used each alone or used together to produce the PHAs according to the invention. The terms "polyhydroxyalkanoate", "poly-3-hydroxyalkanoate" and "PHA" are synonyms and are used interchangeably.

The terms "PHA synthase" and "polyhydroxyalkanoate synthase" are used interchangeably and refer to an enzyme that is capable of catalyzing the polymerization of constituent monomers to yield PHA, and is also referred to in scientific literature as a PHA polymerase or a PHA synthetase.

The present invention encompasses an isolated nucleic acid encoding a polypeptide having a synthase activity, said polypeptide comprising a sequence selected from the group consisting of SEQ ID NO: 1 and sequences having at least about 97% identity to SEQ ID NO: 1. The present invention also encompasses an isolated nucleic acid encoding a polypeptide having a polyhydroxyalkanoate synthase activity, said polypeptide comprising a sequence selected from the group consisting of SEQ ID NO: 3 and sequences having at least about 86% identity to SEQ ID NO: 3.

In particular, the invention encompasses an isolated nucleic acid encoding an enzyme selected from the group comprising polyhydroxyalkanoate synthase PhaC1 , or polyhydroxyalkanoate synthase PhaC2, wherein the PhaC1 amino acid sequence is at least 97% identical to SEQ ID NO: 1 , wherein the PhaC2 amino acid sequence is at least 86% identical to SEQ ID NO: 3.

Preferably, the PhaC1 has an amino acid sequence that has at least 97%, 97.5%, 98%, 98.5%, 99% or 99.5% identity with the amino acid sequence of SEQ ID NO: 1.

Preferably, the PhaC2 has an amino acid sequence that has at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 98%, 98.5%, 99% or 99.5% identity with the amino acid sequence of SEQ ID NO: 3.

The invention also encompasses a purified polypeptide comprising an amino acid sequence with at least about 97%, 97.5%, 98%, 98.5%, 99% or 99.5% identity to the amino acid sequence set forth in SEQ ID NO : 1. The invention also encompasses a purified polypeptide comprising an amino acid sequence with at least about 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 98%, 98.5%, 99% or 99.5% identity to the amino acid sequence set forth in SEQ ID NO : 3. The terms "amino acid" or "amino acid sequence" as used herein refer to an oligopeptide, peptide, polypeptide, or protein sequence, or to a fragment, portion, or subunit of any of these, and to naturally occurring or synthetic molecules. The standard three letter codes for amino acids are used throughout this text. Unless specified otherwise, these represent the natural L-amino acids: alanine - Ala; arginine - Arg ; asparagine - Asn; aspartic acid - Asp; cysteine - Cys; glutamine - GIn; glutamic acid - GIu; glycine - GIy; histidine - His; isoleucine - lie; leucine - Leu; lysine - Lys; methionine - Met; phenylalanine - Phe; proline - Pro; serine - Ser; threonine - Thr; tryptophan - Trp; tyrosine - Tyr; valine - VaI.

The term "polypeptide" as used herein, refers to amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain modified amino acids other than the 20 gene-encoded amino acids.

The terms "nucleic acid" or "nucleic acid sequence" as used herein refer to an oligonucleotide, nucleotide, polynucleotide, or to a fragment of any of these, to DNA or RNA of genomic or synthetic origin which may be single-stranded or double-stranded and may represent a sense or antisense strand, to peptide nucleic acid (PNA), or to any DNA- like or RNA-like material, natural or synthetic in origin.

The term "gene" as used herein refers to chromosomal DNA, plasmid DNA, cDNA, synthetic DNA, or other DNA that encodes a peptide, polypeptide, protein, or RNA molecule, and regions flanking the coding sequence involved in the regulation of expression. The term "oligonucleotide" as used herein is defined as a molecule comprising two or more deoxyribonucleotides or ribonucleotides, preferably at least 5 nucleotides, more preferably at least about 10-15 nucleotides and more preferably at least about 15 to 50, preferably about 15 to 35 nucleotides. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, PCR, or a combination thereof.

The term "primer" as used herein refers to an oligonucleotide that is capable of acting as a point of initiation of synthesis when placed under conditions in which primer extension is initiated. An oligonucleotide "primer" may occur naturally as in a purified restriction digest or may be produced synthetically. A primer is selected to be "substantially" complementary to a strand of specific sequence of the template. A primer must be sufficiently complementary to hybridize with a template strand for primer elongation to occur. A primer sequence need not reflect the exact sequence of the template.

The term "isolated" as used herein, refers to a material that has been removed from its original environment (e. g., the natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.

By a polypeptide or an amino acid sequence with, for example, 95% "identity to a reference amino acid sequence, it is intended that the amino acid sequence is identical to the reference sequence except that the amino acid sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid sequence. In other words, to obtain a polypeptide having an amino acid sequence of at least 95% identity with a reference amino acid sequence, up to 5% of the amino acids in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acids in the reference sequence may be inserted into the reference sequence. As a practical matter, whether any particular amino acid sequence has at least 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 98%, 98.5%, 99% or 99.5% identity to an amino acid sequence of the present invention can be determined using known algorithms. For example, an alignment of the two sequences is performed by a suitable computer program and the number of matching bases or amino acids is divided by the total number of bases or amino acids, and multiplied by 100 to obtain a percent identity. For example, if two 580 base pair sequences had 145 matched bases, they would be 25 percent identical. If the two compared sequences are of different lengths, the number of matches is divided by the shorter of the two lengths. For example, if there were 100 matched amino acids between 200 and a 400 amino acid protein, they are 50 percent identical with respect to the shorter sequence.

In an embodiment, one example of a nucleic acid sequence encoding polyhydroxyalkanoate synthase PhaC1 is given at SEQ ID NO:2. The present invention also concerns a nucleic acid sequence at least 94%, 95%, 96%, 97%, 97.5%, 98%, 98.5%, 99% or 99.5% identical with the nucleic acid sequence of SEQ ID NO:2.

One example of a nucleic acid sequence encoding polyhydroxyalkanoate synthase PhaC2 is given at SEQ ID NO:4. The present invention also concerns a nucleic acid sequence at least 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 98%, 98.5%, 99% or 99.5% identical with the nucleic acid sequence of SEQ ID NO:4. The invention encompasses isolated or substantially purified protein compositions. In particular the invention encompasses an isolated protein selected from the group comprising polyhydroxyalkanoate synthase PhaC1 , or polyhydroxyalkanoate synthase PhaC2, wherein the PhaC1 amino acid sequence is at least 97% identical to SEQ ID NO: 1 , wherein the PhaC2 amino acid sequence is at least 86% identical to SEQ ID NO: 3. The present invention also encompasses proteins deriving from the above mentioned sequences, obtained by truncation, fusion or mutagenesis thereof.

The proteins of the invention may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants of PHA synthase proteins can be prepared by mutations in the DNA.

Methods for mutagenesis and nucleotide sequence alterations are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82: 488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York). Guidance as to appropriate amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D. C), herein incorporated by reference. Conservative substitutions, such as exchanging one amino acid with another having similar properties, may be preferred.

Thus, the genes and nucleotide sequences of the invention include both the naturally occurring sequences as well as mutant forms. Likewise, the proteins of the invention encompass both naturally occurring proteins as well as variations and modified forms thereof. Such variants will continue to possess the desired activity. The present invention also encompasses a recombinant host having stably incorporated into the genome a nucleic acid encoding an enzyme selected from the group comprising polyhydroxyalkanoate synthase PhaC1 , or polyhydroxyalkanoate synthase PhaC2, wherein the PhaC1 amino acid sequence is at least 97%, 97,5%, 98%, 98,5%, 99% or 99,5% identical to SEQ ID NO: 1 , wherein the PhaC2 amino acid sequence is at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97,5%, 98%, 98,5%, 99% or 99,5% identical to SEQ ID NO: 3.

Integration or incorporation into the host cell genome leads to stable transformation (as opposed to transient transformation commonly associated with episomal vector maintenance) of the host cell and may be referred to as "stable incorporation". "Integration", "incorporation" "stable incorporation" or "stable integration", refers to the integration of at least part of the nucleic acid sequences into the genome of the host cell or its maintenance in an artificial chromosomal body such as a plasmid.

In an embodiment, the recombinant host is produced by a transformation method comprises introducing into a host cell a nucleic acid according to the invention. For instance the method comprises, introducing into a host cell according to the invention a molecule comprising a nucleic acid sequence encoding said polyhydroxyalkanoate synthase PhaC1 operably linked to a promoter functional in the host cell, wherein the PhaC1 amino acid sequence shares at least 97%, 97,5%, 98%, 98,5%, 99% or 99,5% identity with SEQ ID NO: 1. The DNA encoding the polyhydroxyalkanoate synthase PhaC1 is then expressed in the host cell so as to generate a polyhydroxyalkanoate polymer.

In another embodiment, the method comprises introducing into a host cell a DNA molecule comprising a nucleic acid sequence encoding said polyhydroxyalkanoate synthase PhaC2 operably linked to a promoter functional in the host cell, wherein the PhaC2 amino acid sequence shares at least 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 97,5%, 98%, 98,5%, 99% or 99,5% identity with SEQ ID NO: 3. The DNA encoding the polyhydroxyalkanoate synthase PhaC2 is then expressed in the host cell so as to generate a polyhydroxyalkanoate polymer. In a third embodiment, the method comprises introducing into a host cell two nucleic acid sequences encoding said two polyhydroxyalkanoate synthases PhaC1 and PhaC2 according to the invention. The two DNA molecules are expressed in the host cell so as to generate a polyhydroxyalkanoate polymer. The recombinant host having stably incorporated into its genome both said polyhydroxyalkanoate synthase PhaC1 and polyhydroxyalkanoate synthase PhaC2 is also encompassed herein.

The recombinant host can be used for producing PHA according to the invention. Preferably, the recombinant host in which the PHA is synthesized is a yeast cell, a plant cell or a bacterial cell. Preferred yeast or fungi cells include cells of the genera Saccharomyces, Pichia, Schizosaccharomyces, Fusarium, Aspergillus, and Kluyveromyces, more preferably from Saccharomyces cerevisiae. Preferred bacterial cells include cells from the genera Escherichia, Streptomyces, Bacillus, Pseudomonas, Aeromonas, Vibrio, Allochromatium, Agrobacterium, Alcaligenes, Ralstonia, Rhodospirillum, Caulobacter, Paracoccus, Rhodococcus, Synechocystis, Alcanivorax, Zoogloea and Lactobacillus, more preferably from E. coli. Preferred plant cell include cells from the genera alfalfa, banana, barley, bean, cabbage, canola/oilseed rape, carrot, castorbean, celery, clover, coconut, corn, cotton, cucumber, linseed, melon, olive, palm, parsnip, pea, peanut, pepper, potato, radish, rapeseed, rice, soybean, spinach, sunflower, tobacco, tomato, or wheat cell. The recombinant host can be cultured under aerobic or anaerobic conditions. The present invention also relates to a method for production of PHA according to the invention in a recombinant host comprising stably incorporating into the genome of the host a nucleic acid according to the invention, growing said host under PHA producing conditions, and optionally recovering the PHA produced. In an embodiment, the method comprises culturing said host in a medium comprising glycerol, or at least one fatty acid; an ester, or an oil thereof; or at least one light cycle oil; or at least one carbohydrate; or mixtures thereof.

In a preferred embodiment, the method comprises culturing said host in a medium comprising at least one compound selected from acetate, propionate, pyruvate, valerate, caprylate, hexanoate, heptanoate, oleic acid, lauric acid, myristic acid, glucose, light cycle oil, or mixtures thereof.

The recombinant host can be cultured in any convenient matter, for example in a suspension or on a solid matrix. Microbial cultures are typically grown in a nutrient-rich culture medium. The recombinant cells of the invention can be grown under either aerobic or anaerobic conditions, or in cultures with one or more aerobic or anaerobic phases. Cells are cultured under anaerobic conditions when they are cultured in an environment where there is no detectable oxygen, or where the dissolved oxygen levels are so low that they fail to induce an aerobic cellular metabolism. What constitutes "anaerobic conditions" can vary from organism to organism and also can depend on parameters like growth rate, media composition, and other culturing conditions. Anaerobic conditions are typically present when, for example, the dissolved oxygen level in the culture medium is at most about ten percent of air saturation.

Recombinant host of the invention are transformed with a nucleic acid fragment comprising a nucleic acid sequence according to the invention and, preferably, but not necessarily, regulatory sequences operably linked thereto. The nucleic acid fragment can be circular or linear, single-stranded or double stranded, and can be DNA, RNA, or any modification or combination thereof. Typically a vector comprising the nucleic acid sequence is used for transformation.

The invention also encompasses a vector comprising an isolated nucleic acid according to the invention, preferably under the control of a promoter for enhancing expression after integration into the genome of a host. Preferably, said vector comprises a nucleic acid sequence coding for an amino acid sequence selected from the group comprising the sequence of SEQ ID NO:1 , the sequence of SEQ ID NO:3, a sequence at least 97% identical to SEQ ID NO: 1 , and a sequence at least 86% identical to SEQ ID NO: 3. Preferably, said vector comprises a nucleic acid sequence selected from the group comprising the sequence of SEQ ID NO: 2, the sequence of SEQ ID NO: 4, a sequence at least 94% identical to SEQ ID NO: 2, and a sequence at least 86% identical to SEQ ID NO: 4.

The vector can be a plasmid (integrative or autonomous), a viral vector or a cosmid. Selection of a vector backbone depends upon a variety of desired characteristics in the resulting construct, such as a selection marker, plasmid reproduction rate, and the like.

Recombinant hosts of the invention are transformed with a nucleic acid sequence that encodes at least one functional PHA synthase and may, in some embodiments of the invention, optionally be transformed with one or more additional nucleic acid sequences that encode at least one other functional enzyme utilized in the biosynthesis of PHA such as transacylase (for example PhaG) and/or depolymerase (for example PhaZ) and/or enoyl-CoA hydratase (PhaJ) and/or β- ketothiolase and/or acetoacetyl-CoA reductase.

One or more nucleic acid fragments can be used to transform a host cell; for example, the host can be transformed with one vector comprising a nucleic acid that encodes at least one PHA synthase according to the invention, and a second vector comprising a nucleic acid that encodes a transacylase. Alternatively, two or more nucleic acids, for example one coding for at least one PHA synthase and one coding for a transacylase, can be present on the same nucleic acid fragment used to transform the host cell, as is the case, for example, when a divergent promoter is used. The nucleic acid used to transform the host according to the invention can optionally include a promoter sequence operably linked to the nucleic acid sequence encoding the enzyme to be expressed in the host. A promoter is a DNA fragment that can cause transcription of genetic material. Transcription is the formation of an RNA chain in accordance with the genetic information contained in the DNA. The invention is not limited by the use of any particular promoter, and a wide variety is known. Promoters act as regulatory signals that bind RNA polymerase in a cell to initiate transcription of a downstream (3'direction) coding sequence. A promoter is "operably linked" to a nucleic acid sequence if it is does, or can be used to, control or regulate transcription of that nucleic acid sequence. The promoter used in the invention can be a constitutive or an inducible promoter. It can be, but need not be, heterologous with respect to the host.

A divergent promoter can also be used to introduce and regulate multiple genes. These promoters permit the co-regulation of two separate genes from a single, centrally located sequence.

The nucleic acid used to transform a host according to the invention may optionally include one or more marker sequences, which typically encode a gene product, usually an enzyme, which inactivates or otherwise detects or is detected by a compound in the growth medium. For example, the inclusion of a marker sequence can render the transgenic cell resistant to an antibiotic, or it can confer compound-specific metabolism on the transgenic cell. Examples are marker sequences that confer kanamycin, ampicillin or paromomycin sulfate resistance; the URA3 selection marker and HIS3 selection markers described in the following examples, or, for yeast, various other genes that complement auxotrophic mutations such as G418.

A recombinant host according to the invention can include at least one nucleic acid encoding PhaC1 according to the invention, and, optionally, either or both of a second nucleic acid encoding PhaC2 according to the invention.

Biologically synthesized PHA typically accumulates in the recombinant host and can be isolated using any convenient method.

The PHAs according to the invention, produced by the recombinant host cells of the invention are useful as biopolymers, e. g., in packaging or biomedical applications. In a further aspect, the invention also relates to a poly-3-hydroxyalkanoate or a stereoisomer, tautomer, racemate, salt, hydrate, or solvate thereof, comprising as repeating units the units of formula I, II, III, IV, V, Vl, VII, VIII and IX.

In an embodiment, the poly-3-hydroxyalkanoate further comprises 0 to 5 wt% of 3-hydroxy heptanoate units having the formula X, and/or 0 to 10 wt% of 3-hydroxy-8,10- dodecadienoate units having the formula Xl.

X Xl

In a particular embodiment, said poly-3-hydroxyalkanoate comprises 0.1 to 1 wt% of 3- hydroxy butyrate units having the formula I, 0.5 to 5 wt% of 3-hydroxy hexanoate units having the formula II, 15 to 30 wt% of 3-hydroxy octanoate units having the formula III, 50 to 70 wt% of 3-hydroxy decanoate units having the formula IV, 2 to 5 wt% of 3-hydroxy dodecanoate units having the formula V, and 2 to 10 wt% of 3-hydroxy-10-dodecenoate units having the formula Vl. This poly-3-hydroxyalkanoate can be produced for example by the RA26 strain of the invention, or a recombinant host according to the invention, when grown on glucose for example.

In another particular embodiment, said poly-3-hydroxyalkanoate comprises 0.1 to 1 wt% of 3-hydroxy butyrate units having the formula I, 1 to 5 wt% of 3-hydroxy hexanoate units having the formula II, 30 to 45 wt% of 3-hydroxy octanoate units having the formula III, 25 to 40 wt% of 3-hydroxy decanoate units having the formula IV, 10 to 15 wt% of 3-hydroxy dodecanoate units having the formula V, 1 to 5 wt% of 3-hydroxy-10-dodecenoate units having the formula Vl, 0 to 10 wt% of 3-hydroxy-8,10-dodecadienoate units having the formula Xl, 1 to 5 wt% of 3-hydroxy tetradecanoate units having the formula VII, 10 to 15 wt% of 3-hydroxy-12-tetradecenoate units having the formula VIII, and 0 to 4 wt% of 3- hydroxy-10,12-tetradecadienoate units having the formula IX. This poly-3- hydroxyalkanoate can be produced for example by the RA26 strain of the invention, or a recombinant host according to the invention, when grown on olive oil.

In another particular embodiment, said poly-3-hydroxyalkanoate comprises 0.1 to 1 wt% of 3-hydroxy butyrate units having the formula I, 1 to 5 wt% of 3-hydroxy hexanoate units having the formula II, 0 to 2 wt% of 3-hydroxy heptanoate units having the formula X, 30 to

45 wt% of 3-hydroxy octanoate units having the formula III, 30 to 45 wt% of 3-hydroxy decanoate units having the formula IV, 5 to 15 wt% of 3-hydroxy dodecanoate units having the formula V, 0.1 to 5 wt% of 3-hydroxy-10-dodecenoate units having the formula Vl, and 5 to 20 wt% of 3-hydroxy-12-tetradecenoate units having the formula VIII. This poly-3-hydroxyalkanoate can be produced for example by the RA26 strain of the invention, or a recombinant host according to the invention, when grown on oleic acid.

In another particular embodiment, said poly-3-hydroxyalkanoate comprises 0.05 to 1 wt% of 3-hydroxy butyrate units having the formula I, 1 to 5 wt% of 3-hydroxy hexanoate units having the formula II, 25 to 40 wt% of 3-hydroxy octanoate units having the formula III, 25 to 40 wt% of 3-hydroxy decanoate units having the formula IV, 10 to 20 wt% of 3-hydroxy dodecanoate units having the formula V, 0 to 2 wt% of 3-hydroxy tetradecanoate units having the formula VII, and 15 to 25 wt% of 3-hydroxy-12-tetradecenoate units having the formula VIII. This poly-3-hydroxyalkanoate can be produced for example by the RA26 strain of the invention, or a recombinant host according to the invention, when grown on glycerol with oleic acid.

The PHAs of the present invention can be biologically produced as described above or can be synthesized by synthetic chemical methods. A chemical approach involves the ring-opening polymerization of /Mactone monomers. The catalysts or initiators used can be a variety of materials such as aluminoxanes, distannoxanes, or alkoxy-zinc and alkoxy- aluminum compounds. The production of isotactic polymer can be accomplished by polymerization of an enantiomerically pure monomer and a non-racemizing initiator, with either retention or inversion of configuration of the stereocenter, or by polymerization of racemic monomer with an initiator which preferentially polymerizes one enantiomer. The PHAs of the present invention can be purified, using techniques known per se, such as evaporation of the solvent, washing, trituration, recrystallisation from a suitable solvent or solvent mixture, and chromatographic techniques.

In an embodiment, the biologically produced PHAs of the present invention are isotactic and have the R absolute configuration at the stereocenters in the polymer backbone. Alternatively, isotactic polymers may be made where the configuration of the stereocenters is predominantly S. Atactic polymers, polymers with random incorporation of R and S stereocenters, can be produced from racemic monomers and polymerization initiators or catalysts that show no preference for either enantiomer while such initiators or catalysts often polymerize monomers of high optical purity to isotactic polymer. Alternatively, isotactic polymer can be produced from racemic monomers if the polymerization catalyst has an enhanced reactivity for one enantiomer over the other. The Cahn-lngold-Prelog system was used to attribute the absolute configuration of chiral center, in which the four groups on an asymmetric carbon are ranked to a set of sequences rules. Reference is made to Cahn; Ingold; Prelog Angew. Chem. Int. Ed. Engl. 1966, 5, 385-415.

The PHAs according to the invention exhibit a lower Tm (melt temperature) compared to prior art PHAs, allowing for better processing of the polymer without having degradation problems during the processing. They high melt viscosity allows for extrusion blowing of the polymer. The PHAs according to the invention also have lower crystallinity, compared to prior art PHAs, giving a flexible, tough and ductible polymer and a lower Tg (glass transition temperature) compared to prior art PHAs, giving a soft and drapable polymer.

The PHAs according to the invention are thermally processable. They have good polyethylene elastomer-like mechanical properties. They can be compatible with various additives and fillers and can be blended with many other polymers The PHAs of the present invention can be used in the preparation of a variety of plastic articles, including but not limited to, films, sheets, fibers, foams, molded articles, nonwoven fabrics, elastomers, and adhesives, etc. The present invention therefore also relates to films, sheets, molded articles, fibers, elastics, laminates and coated articles, nonwoven fabrics, synthetic paper products, or foams comprising the PHAs according to the invention. Said PHAs can be processed into films, sheets and the like either alone or preferably in combination with other polymers. The film of the present invention can be employed in a variety of disposable products including, but not limited to, disposable diapers, shrink-wrapping (e. g. , food wraps, consumer product wraps, pallet and/or crate wraps, and the like), or bags (grocery bags, food storage bags, sandwich bags, resealable bags, garbage bags, and the like). The invention will now be illustrated by means of the following synthetic and biological examples, which do not limited the scope of the invention in any way.

Examples

Example 1: Bacterial strain: Strain isolation:

In November 2001 , several samples of « kopara » were collected from the different microbial mats located on the atoll of Rangiroa (French Polynesia) (Raguenes G. et al. (2004). Curr. Microbiol. 49:145-151) Enrichment cultures were purified on Marine Agar 2216E (MA, Difco Laboratories, Detroit, USA). Included in a screening for searching PHA producing bacteria, strain RA26 was selected because of its capacity to exhibit a different phenotype on Minimum Marine Agar medium (Sea Salts 27 g I^"1 + agar 15 g I^"1 + pH 7.6) supplemented with 20 g I^'1 of glucose.

Pseudomonas sp. RA26 strain (RA26) was deposited on January 27, 2005 at the Collection Nationale de Cultures de Microorganismes, lnstitut Pasteur, under the n° CNCM I-3358.

Morphology:

Strain RA26 was a motile, strictly aerobic, non fermentative, gram-negative rod, 0.6 by 2.2 μm size.

Culture conditions: The optimal temperature for growth was between 33 and 37°C, the optimal pH was between 6.4 and 7.1 and the optimal ionic strength was between 15 and 20 g I^"1 of NaCI.

Metabolic properties:

Tests were performed using API20NE, APIZYM, ATB VET strips and Biolog GN microplates. The results of these tests are shown under tables 1 , 2, 3 and 4. Table 1 : API 20NE results

Table 2: APIZYM results

Table 3. antimicrobial susceptibility ATB VET results

(R = resistant; S = sensible)

Table 4. Biolog GN : carbon source utilization

DNA base composition:

The G+C content of strain RA26 was 63.2 mol%.

Phylogenetic analyses: The sequence of the 16S rRNA-encoding gene of strain RA26 was determined (1379 bp) and deposited in the EMBL sequence database under accession number AJ876736. Phylogenetic analyses using the ARB program showed that strain RA26 belonged to the gamma subdivision of the phylum Proteobacteria and that it was closely related to Pseudomonas aeruginosa. More analyses were performed using the sequences of the type strain of the genus Pseudomonas. Results are shown in Fig. 1 (17 species, mean length: 1376 (pairwise gap removal) Jukes and Cantor distance is shown at 0.020). Neighbor joining tree based on 16S rRNA gene sequence analysis showed the relationships between isolate RA26 and other species from the genus Pseudomonas. Percentage bootstrap values (>50%, 1000 resamplings) are given at branch points. Bar corresponds to 20 substitutions per 1000 nucleotide positions. P. denitrificans (ABO21419) was used as an outgroup. All three methods used (neighbor joining, maximum parsimony, maximum likelihood) placed RA26 in a monophyletic group with Pseudomonas aeruginosa. The percentage sequence similarity between RA26 and P. aeruginosa was 99%, clearly above the limit of intraspecies variability (97%) as proposed by Stackebrandt and Goebel (Stackebrandt E, Goebel BM (1994) lnt J Syst Bacterid 44:846-849). Nevertheless, quantitative DNA/DNA hybridization was conducted to confirm RA26 as a new species of Pseudomonas.

DNA reassociation:

The measurement of DNA-DNA homology between strain RA26 and the most closely related Pseudomonas as deduced from the phylogenetic analysis showed a homology value of 28.4 % with P. aeruginosa. Taking in consideration the criteria recommended by Wayne et a/, (lnt J Syst Bacteriol (1987) 37:463-464), this result confirmed strain RA26 as a new species of Pseudomonas.

Example 2: PHA production and characterization PHA production and Extraction

PHA production was performed in two steps. First, cellular biomass was ground in Zobell medium comprising sea water 42%, peptone 5g/L, yeast extract 1g/L, inoculated at 10% with a suspension of cells in exponential phase. The temperature was set at 34°C and pH at 7. After bacterial phase growth the cells were collected by centrifugation (15 min, 8500 G) and transferred in a PHA producing medium comprising sea water 42% yeast extract 0.4 g/L, pH 7, and an excess of carbon source. Unless otherwise stated the concentration of the carbon source was around 10g/L The carbon sources tested were: glucose; olive oil; oleic acid; glycerol 2g/L + oleic acid 8g/L; glycerol 4g/L + oleic acid 6g/L; and glycerol 8g/L + oleic acid 2g/L.

The cultures were cultivated in an incubator under agitation during 3 or 5 days (the duration varying depending on the assimilation rate of certain substrates). At the end of the PHA production phase, the cells were harvested by centrifugation (15 min, 8500 G), washed three times with sea water 50%, and the bacterial pellet was lyophilized.

For the analysis of the produced PHA, 100 mg of freeze-dried cells were extracted in chloroform (2.5 ml) during 4h under magnetic stirring at 5O⁰C. After addition of distilled water, the phases were separated by centrifugation for 15 min at 10000G. The organic phase was collected and evaporated under nitrogen flow to yield the PHA. Analytical and preparative techniques:

All reagents used either were obtained commercially or were prepared in a manner known per se.

Unless indicated otherwise, the composition of the polymers was confirmed by FTIR, NMR and gas chromatography/mass spectrometry (GC/MS), as follows: For FTIR, the samples were analyzed as pellets obtained by crushing and compressing of few milligrams of dry PHA with 200 mg of KBr. The spectra were recorded on a spectrometer BRUKER Vector 22, with a 4cm^"1 resolution along the region 4000-400 cm^"1.

¹H, 13C as well as COSY, TOCSY, HMQC and HMBC NMR spectra were determined. The samples were dissolved in CDCI₃. Sodium 3-(trimethylsilyl) propionate-2, 2, 3, 3-d4 was added for internal referencing of ¹H chemical shifts. The ¹H NMR spectra were recorded at 298K on a BRUKER DRX 400 and BRUKER DRX Avance 500. NMR spectra of the PHAs could also be acquired on live bacteria, by placing few milligrams of bacterial pellets in D₂O and introducing the sample in a HR-MAS rotor (High Resolution Magic angle Spinning).¹H NMR spectra were recorded on a BRUKER ARX 500. For the analysis in GC-MS, approximately 7 mg of PHA obtained after chloroform extraction and evaporation were redissolved in chloroform (1 ml) , then hydrolyzed using 1 ml of a mixture methanol/HCI (17/2, v/V) during 4hours at 100⁰C. Addition of distilled water followed by a centrifugation (10 min, 4000G) induced a separation of phases. The methyl esters were recovered in the organic phase, which was then concentrated under reduced pressure under nitrogen flow. A trimethylsylilation by 100 μl_ of BSTFA (N.O-bistrymethylsilyltrifluoroacetamide) - TMCS 1 % (trimethylchlorosylane) in the presence of 100 pyridine μl_ was performed during 30 minutes at 70⁰C. The excess solvent was evaporated under nitrogen, the sample was then dissolved in dichloromethane and analyzed by GCMS.

For GCMS analysis, 1 μl of sample was injected on a column Agilent HP-5MS (30 m X 250 μm), using helium at a flow rate of 1 mL/min-1 , Split ratio: 50: 1. The programmed temperature ramping was 1 minute at 60⁰C, then 4°C.min^"1 until 140°C, then 15°C.min^"1 until 280⁰C and then 5 minutes at 280⁰C.

PHA compositions

The composition of the PHAs produced by the RA26 strain cultivated using different carbon sources are shown hereunder in Tables 5 to 8. The following abbreviations were used: 3HB (3-hydroxybutyrate); 3HP (3-hydroxypentanoate); 3HHx (3-hydroxyhexanoate); 3HHp (3-hydroxyheptanoate); 3HO (3-hydroxyoctanoate); 3HD (3-hydroxydecanoate); 3HDDe (3-hydroxydodecenoate); 3HDDee (3-hydroxydodecadienoate); 3HDD (3- hydroxydodecanoate); 3HTDe (3-hydroxytetradecenoate); 3HTDee (3- hydroxytetradecadienoate); 3HTD (3-hydroxytetradecanoate).

Table 5 shows the composition of the PHA produced by the RA26 strain when using glucose as a carbon source. Table 5 summarizes the mean and standard deviation of the PHA analysis by GCMS of 7 different extracts of PHA produced by RA26 on glucose during 7 different fermentations.

Table 5

Traces of 3HP were detected in 2 samples

Table 6 shows the composition of the PHA produced by the RA26 strain when using olive oil as a carbon source. Table 6 summarizes the mean and standard deviation of the PHA analysis by GCMS of 3 different extracts of PHA produced by RA26 on olive oil during 3 different fermentations.

Table 6

Table 7 shows the composition of the PHA produced by the RA26 strain when using oleic acid as a carbon source. Table 7 summarizes the mean and standard deviation of the PHA analysis by GCMS of 4 different extracts of PHA produced by RA26 on oleic acid during 4 different fermentations.

Table 7

Table 8 shows the composition of the PHA produced by the RA26 strain when using glycerol + oleic as carbon source. Table 8 summarizes the mean and standard deviation of the PHA analysis by GCMS of 2 different extracts from 2 different fermentations of PHA produced by RA26 on Glycerol 2g/L + Oleic 8g/L; GIy 4g/L + Oleic 6g/L and GIy 8g/L + Oleic 2g/L.

Table 8

Properties of the PHA

The Tg (Glass Transition Temperature) and the melting points were determined by differential scanning calorimetry (DSC) for PHAs obtained with glucose as substrate. Figure 2 represents the DSC curve of a PHA formed on glucose. Measured Tg for said PHA was between -15 with -25°C. This is an advantage compared to the PHB homopolymers which have a Tg around O⁰C.

This results shows that the present polymers will be particularly suitable for the production of polymers particularly useful for applications as films.

The graph shows also various melting points for the PHA related to different chain length of the monomers. The PHA has a lower melting point than that met in the literature for PHAmcl such as for example Nodax™ This is another advantage of the polymers according to the invention which have increased processability compared to prior art polymers.

Example 3: PHAC1 and PHAC2 from RA26 strain Genomic DNA of the RA26 strain was extracted using standard PCI (phenol-chloroform- isoamylalcohol) protocol (Current protocols in Molecular Biology). The organization of Pseudomonas PHA locus is shown in Figure 3. The locus comprises phaC1 a gene coding for a first PHA synthase, the gene phaZ coding for a depolymerase, the gene phaC2 coding for a second PHA synthase, the gene phaD coding for a transcriptional regulator and the genes phaF and phal which code for globule's structural proteins. In order to clone the whole locus, three overlapping fragments were selected and amplified by PCR.

The following primers were used: RA26-F01 5" CCAYGACAGCGGCCTGTTCACCTGGGA 3" (SEQ ID NO: 5) RA26-R04 5' AGGTTGGCRCCkATGCCGTTGAAGATCAGCA 3' (SEQ ID NO: 6) RA26-F05 5' CTCGGCTGGACCAGCATCCACTGGCTGCA 3' (SEQ ID NO: 7) RA26-R12 5' TCGACGATCAGGTGCAGGAACAGCCAGTA 3' (SEQ ID NO: 8) RA26-F11 5' GGCAAYCTCTACTACCACTTCCATGGCAAGGA 3' (SEQ ID NO: 9) RA26-R17 5' AAGGCGCTGGACAARGCSCTGGCCTGA 3' (SEQ ID NO: 10) The PCR mix was prepared according to the furnished recommendations (Pfx, Invitrogen).

PCR cycling conditions: Initial denaturation step: 3 min at 94°C, then 35 cycles: of denaturation step.15 sec at 94°C and extending step: 2 min at 68°C and then the final extending step: 10 min at 68°C.

The cloning of the three PCR products was carried out via the kit ZeroBlunt® TOPO® PCR cloning (Invitrogen™). The PCR products of were purified on agarose gel, inserted in the vector pCR4blunt-TOPO, and then incorporated by transformation in E. coli TOP10. The positive clones were selected on LB agar with Kanamycin. The plasmidic preparation of each clones showed after digestion by EcoRI an insert of the expected size.

RA26 PhaC1 and phaC2 were sequenced. SEQ ID NO: 1 is the amino acid sequence of PhaC1 (Figure 4). SEQ ID NO: 3 is the amino acid sequence of PhaC2 (Figure 6). SEQ ID NO: 2 is one example of a nucleic acid sequence coding for PhaC1 (Figure 5). SEQ ID NO: 4 is one example of a nucleic acid sequence coding for PhaC2 (Figure 7).

Claims

1. A poly-3-hydroxyalkanoate produced by a Pseudomonas sp. RA26 strain deposited on January 27, 2005 at the Collection Nationale de Cultures de Microorganismes, lnstitut Pasteur, under the n⁰ CNCM I-3358, wherein said poly-3-hydroxyalkanoate comprises as repeating units

O O O O

O -0-CH-CH₂-C 0-CH-CH₂-C C-CH-CH₂-C 0-CH-CH₂-C-

-0-CH-CH₂-C- (CH₂J₂ (CH₂), (CH₂J₆ (CH₂J₈

CH₃ CH₃ CH₃ CH₃ CH₃

I Il III IV V o o o o

-0-CH-CH₂-C 0-CH-CH₂-C 0-CH-CH₂-C C-CH-CH₂-C-

(CH₂J₆ (CH₂J₁₀ (CH₂J₈ (CH₂J₆

CH=CH-CH₃ CH₃ CH=CH-CH₃ CH=CH-CH=CH-CH₃

Vl VII VIII IX 0.05 to 1 wt% of 3-hydroxy butyrate units having the formula I,

0.5 to 5 wt% of 3-hydroxy hexanoate units having the formula II, 15 to 45 wt% of 3-hydroxy octanoate units having the formula III, 25 to 70 wt% of 3-hydroxy decanoate units having the formula IV, 2 to 20 wt% of 3-hydroxy dodecanoate units having the formula V, 0 to 10 wt% of 3-hydroxy-10-dodecenoate units having the formula Vl,

0 to 5 wt% of 3-hydroxy tetradecanoate units having the formula VII, 0 to 30 wt% of 3-hydroxy-12-tetradecenoate units having the formula VIII, and 0 to 5 wt% of 3-hydroxy-10,12-tetradecadienoate units having the formula IX, or a stereoisomer, tautomer, racemate, salt, hydrate, or solvate thereof.

2. A method of producing a poly-3-hydroxyalkanoate according to claim 1 , comprising a step of allowing a Pseudomonas sp. RA26 strain (CNCM I-3358) to synthesize said poly-3-hydroxyalkanoate.

3. The method according to claim 2, wherein said Pseudomonas sp. RA26 strain is grown in a culture medium comprising at least one carbon source selected from glycerol; at least one fatty acid, an ester, or an oil thereof; at least one light cycle oil; at least one carbohydrate; or mixtures thereof.

4. The method according to claim 3, wherein the culture medium comprises at least one carbon source selected from glycerol, acetate, propionate, pyruvate, valerate, caprylate, hexanoate, heptanoate, oleic acid, lauric acid, myristic acid, olive oil, glucose, light cycle oil, or a mixture thereof.

5. An isolated protein selected from the group comprising polyhydroxyalkanoate synthase PhaC1 , or polyhydroxyalkanoate synthase PhaC2, wherein the PhaC1

5 amino acid sequence is at least 97% identical to SEQ ID NO: 1 , wherein the PhaC2 amino acid sequence is at least 86% identical to SEQ ID NO: 3.

6. An isolated nucleic acid encoding an enzyme selected from the group comprising polyhydroxyalkanoate synthase PhaC1 , or polyhydroxyalkanoate synthase PhaC2, wherein the PhaC1 amino acid sequence is at least 97% identical to SEQ ID NO: 1 ,

10 wherein the PhaC2 amino acid sequence is at least 86% identical to SEQ ID NO: 3.

7. A recombinant host having stably incorporated into the genome an isolated nucleic acid according to claim 6.

8. The recombinant host according to claim 7 having stably incorporated into its genome isolated nucleic acids coding for both a polyhydroxyalkanoate synthase PhaC1 and

15 polyhydroxyalkanoate synthase PhaC2.

9. The recombinant host according to claim 7 or 8 wherein the host is E. coli.

10. A method for production of poly-3-hydroxyalkanoate (PHA) in a host according to any of claims 7 to 9 comprising growing said host under PHA producing conditions, and optionally recovering the PHA produced.

20 11. The method according to claim 10, wherein the host has stably incorporated into its genome isolated nucleic acids coding for both a polyhydroxyalkanoate synthase PhaC1 and polyhydroxyalkanoate synthase PhaC2.

12. The method according to any of claims 10 or 11 , wherein the poly-3-hydroxyalkanoate comprises as repeating units

O O O O

O -0-CH-CH₂-C 0-CH-CH₂-C C-CH-CH₂-C 0-CH-CH₂-C-

-0-CH-CH₂-C- (CH₂J₂ (CH₂J₄ (CH₂J₆ (CH₂J₈

O_C CH₃ CH₃ CH₃ CH₃ CH₃

I Il III IV V

^{0 0 0 0}

-0-CH-CH₂-C C-CH-CH₂-C C-CH-CH₂-C 0-CH-CH₂-C-

(CH₂J₆ (CH₂J₁₀ (CH₂J₈ (CH₂J₆

CH=CH-CH₃ CH₃ CH=CH-CH₃ CH=CH-CH=CH-CH₃

Vl VII VIII IX

0.05 to 1 wt% of 3-hydroxy butyrate units having the formula I, 30 0.5 to 5 wt% of 3-hydroxy hexanoate units having the formula II, 15 to 45 wt% of 3-hydroxy octanoate units having the formula III, 25 to 70 wt% of 3-hydroxy decanoate units having the formula IV, 2 to 20 wt% of 3-hydroxy dodecanoate units having the formula V, 0 to 10 wt% of 3-hydroxy-IO-dodecenoate units having the formula Vl, 0 to 5 wt% of 3-hydroxy tetradecanoate units having the formula VII,

0 to 30 wt% of 3-hydroxy-12-tetradecenoate units having the formula VIM, and 0 to 5 wt% of 3-hydroxy-10,12-tetradecadienoate units having the formula IX.

13. The method according to any of claims 10 to 12, wherein the host is cultured in a medium comprising glycerol, or at least one fatty acid; an ester, or an oil thereof; or at least one light cycle oil; or at least one carbohydrate; or mixtures thereof.

14. The method according to claim 13, wherein the host is cultured in a medium comprising at least one compound selected from acetate, propionate, pyruvate, valerate, caprylate, hexanoate, heptanoate, oleic acid, lauric acid, myristic acid, glucose, light cycle oil, or mixtures thereof.

15. The method according to any of claims 10 to 14, wherein the host is a bacterial cell.

16. The method according to any of claims 10 to 15, wherein the host is E. coli.

17. A poly-3-hydroxyalkanoate produced by a recombinant host according to any of claims 7 to 9, wherein said poly-3-hydroxyalkanoate comprises as repeating units

O O O O

O -0-CH-CH₂-C 0-CH-CH₂-C 0-CH-CH₂-C C-CH-CH₂-C-

-0-CH-CH₂-C- (CH₂J₂ (CH₂J₄ (CH₂J₆ (CH₂J₈

CH3 CH3 CH3 CH3 CH3 I Il III IV V

0 0 0 0

-0-CH-CH₂-C 0-CH-CH₂-C C-CH-CH₂-C 0-CH-CH₂-C-

(CH₂J₆ (CH₂J₁₀ (CH₂J₈ (CH₂J₆

CH=CH-CH₃ CH₃ CH=CH-CH₃ CH=CH-CH=CH-CH₃

Vl VII VIII IX.

0.05 to 1 wt% of 3-hydroxy butyrate units having the formula I, 0.5 to 5 wt% of 3-hydroxy hexanoate units having the formula II, 15 to 45 wt% of 3-hydroxy octanoate units having the formula III,

25 to 70 wt% of 3-hydroxy decanoate units having the formula IV, 2 to 20 wt% of 3-hydroxy dodecanoate units having the formula V, 0 to 10 wt% of 3-hydroxy-10-dodecenoate units having the formula Vl, 0 to 5 wt% of 3-hydroxy tetradecanoate units having the formula VII, 0 to 30 wt% of 3-hydroxy-12-tetradecenoate units having the formula VIII, and 0 to 5 wt% of 3-hydroxy-10,12-tetradecadienoate units having the formula IX.

18. A vector comprising an isolated nucleic acid encoding polyhydroxyalkanoate synthase PhaC1 and/or polyhydroxyalkanoate synthase PhaC2, under the control of a promoter

5 for enhancing expression after integration into the genome of a host, wherein the

PhaC1 amino acid sequence is at least 97% identical to SEQ ID NO: 1 , wherein the PhaC2 amino acid sequence is at least 86% identical to SEQ ID NO: 3.

19. A poly-3-hydroxyalkanoate or a stereoisomer, tautomer, racemate, salt, hydrate, or solvate thereof, comprising as repeating units

O O O O

O -0-CH-CH₂-C 0-CH-CH₂-C 0-CH-CH₂-C 0-CH-CH₂-C-

-0-CH-CH₂-C- (CH₂J₂ (CH₂J₄ (CH₂J₆ (CH₂J₈

A r\ CH3 CH₃ CH3 CH₃ CH3

I Il III IV V

0 0 0 0 -0-CH-CH₂-C 0-CH-CH₂-C 0-CH-CH₂-C 0-CH-CH₂-C-

(CH₂J₆ (CH₂J₁₀ (CH₂J₈ (CH₂J₆

CH=CH-CH₃ CH₃ CH=CH-CH₃ CH=CH-CH=CH-CH₃

Vl VII VIII IX

0.05 to 1 wt% of 3-hydroxy butyrate units having the formula I,

15 0.5 to 5 wt% of 3-hydroxy hexanoate units having the formula II,

15 to 45 wt% of 3-hydroxy octanoate units having the formula III, 25 to 70 wt% of 3-hydroxy decanoate units having the formula IV, 2 to 20 wt% of 3-hydroxy dodecanoate units having the formula V, 0 to 10 wt% of 3-hydroxy-10-dodecenoate units having the formula Vl, 0 0 to 5 wt% of 3-hydroxy tetradecanoate units having the formula VII,

0 to 30 wt% of 3-hydroxy-12-tetradecenoate units having the formula VIII, and 0 to 5 wt% of 3-hydroxy-10,12-tetradecadienoate units having the formula IX.

20. The poly-3-hydroxyalkanoate according to claim 19, 17 or 1 , also comprising 0 to 5 wt% of 3-hydroxy heptanoate units having the formula X, and/or 5 0 to 10 wt% of 3-hydroxy-8,10-dodecadienoate units having the formula Xl.

0 0

-0-CH-CH₂-C 0-CH-CH₂-C-

(CH₂J₃ (CH₂J₄

CH₃ CH=CH-CH=CH-CH₃

X Xl

21. The poly-3-hydroxyalkanoate according to any of claims 19, 20, 17, or 1 , comprising 0.1 to 1 wt% of 3-hydroxy butyrate units having the formula I,

0.5 to 5 wt% of 3-hydroxy hexanoate units having the formula II, 15 to 30 wt% of 3-hydroxy octanoate units having the formula III, 50 to 70 wt% of 3-hydroxy decanoate units having the formula IV,

2 to 5 wt% of 3-hydroxy dodecanoate units having the formula V, and 2 to 10 wt% of 3-hydroxy-10-dodecenoate units having the formula Vl.

22. The poly-3-hydroxyalkanoate according to any of claims 19, 20, 17, or 1 , comprising 0.1 to 1 wt% of 3-hydroxy butyrate units having the formula I, 1 to 5 wt% of 3-hydroxy hexanoate units having the formula II,

30 to 45 wt% of 3-hydroxy octanoate units having the formula III, 25 to 40 wt% of 3-hydroxy decanoate units having the formula IV, 10 to 15 wt% of 3-hydroxy dodecanoate units having the formula V, 1 to 5 wt% of 3-hydroxy-10-dodecenoate units having the formula Vl, 0 to 10 wt% of 3-hydroxy-8,10-dodecadienoate units having the formula Xl,

1 to 5 wt% of 3-hydroxy tetradecanoate units having the formula VII, 10 to 15 wt% of 3-hydroxy-12-tetradecenoate units having the formula VIII, and

0 to 4 wt% of 3-hydroxy-10,12-tetradecadienoate units having the formula IX.

23. The poly-3-hydroxyalkanoate according to any of claims 19, 20, 17, or 1 , comprising 0.1 to 1 wt% of 3-hydroxy butyrate units having the formula I,

1 to 5 wt% of 3-hydroxy hexanoate units having the formula II, 0 to 2 wt% of 3-hydroxy heptanoate units having the formula X, 30 to 45 wt% of 3-hydroxy octanoate units having the formula III, 30 to 45 wt% of 3-hydroxy decanoate units having the formula IV, 5 to 15 wt% of 3-hydroxy dodecanoate units having the formula V,

0.1 to 5 wt% of 3-hydroxy-IO-dodecenoate units having the formula Vl, and 5 to 20 wt% of 3-hydroxy-12-tetradecenoate units having the formula VIII.

24. The poly-3-hydroxyalkanoate according to any of claims 19, 20, 17, or 1 , comprising 0.05 to 1 wt% of 3-hydroxy butyrate units having the formula I, 1 to 5 wt% of 3-hydroxy hexanoate units having the formula II,

25 to 40 wt% of 3-hydroxy octanoate units having the formula III, 25 to 40 wt% of 3-hydroxy decanoate units having the formula IV, 10 to 20 wt% of 3-hydroxy dodecanoate units having the formula V, 0 to 2 wt% of 3-hydroxy tetradecanoate units having the formula VII, and 15 to 25 wt% of 3-hydroxy-12-tetradecenoate units having the formula VIII. 5