CN101845414A - Method for preparing hydroxyalkanoate homopolymer and special bacteria thereof - Google Patents

Method for preparing hydroxyalkanoate homopolymer and special bacteria thereof Download PDF

Info

Publication number
CN101845414A
CN101845414A CN 201010161314 CN201010161314A CN101845414A CN 101845414 A CN101845414 A CN 101845414A CN 201010161314 CN201010161314 CN 201010161314 CN 201010161314 A CN201010161314 A CN 201010161314A CN 101845414 A CN101845414 A CN 101845414A
Authority
CN
China
Prior art keywords
pseudomonas putida
sequence
recombinant
recombinant pseudomonas
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN 201010161314
Other languages
Chinese (zh)
Other versions
CN101845414B (en
Inventor
陈国强
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tsinghua University
Original Assignee
Tsinghua University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tsinghua University filed Critical Tsinghua University
Priority to CN2010101613141A priority Critical patent/CN101845414B/en
Publication of CN101845414A publication Critical patent/CN101845414A/en
Application granted granted Critical
Publication of CN101845414B publication Critical patent/CN101845414B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses a method for preparing hydroxyalkanoate homopolymer and special bacteria thereof. Recombinant pseudomonas putida is prepared by the method comprising the following steps of: depriving coding functions of 3-hydroxyfatty acyl-coenzyme A dehydrogenase coding gene and 3-ketoacyl coenzyme A thiolase coding gene in pseudomonas putida to obtain recombinant pseudomonas putida, and recording the recombinant pseudomonas putida as recombinant pseudomonas putida I. Experiments prove that the hydroxyalkanoate homopolymer, particularly medium and long-chain hydroxyalkanoate homopolymer (C4-C14), can be obtained by using the recombinant bacteria organism to synthesize polyhydroxyalkanoate. The obtained hydroxyalkanoate homopolymer has high purity and high yield. The method of the invention can synthesize the medium and long-chain hydroxyalkanoate homopolymer with random length, and overcomes the defect that only one 3-hydroxybutyrate (HB) homopolymer can be obtained by biosynthesis in the prior art. Therefore, the method of the invention has broad application prospect in the biosynthesis field of the hydroxyalkanoate homopolymer.

Description

A kind of method and special bacterium thereof for preparing hydroxyalkanoate homopolymer
Technical field
The present invention relates to a kind of method and special bacterium thereof for preparing hydroxyalkanoate homopolymer.
Background technology
Polyhydroxyalkanoate (Polyhydroxyalkanoates is called for short PHA) is a kind of can the existence with granular inclusion form in extracellular microbial by polyester in many microorganism synthetic born of the same parents, is the interior a kind of carbon source of bacterium born of the same parents and the reserve of the energy.Because its physical material performance close with plastics and biodegradable performance are called as biodegradable plastic.Polyhydroxyalkanoate has following structure: wherein, and m=1,2,3 or 4, common m=1; N represents the polymerization degree; R is the alterable height side chain, can be saturated or unsaturated, straight or branched, aliphatics or aromatic group.When the R=ethyl or when following, be short chain PHA; When the R=heptyl or when above, be long-chain PHA; When being situated between, be medium chain PHA.
Figure GSA00000104571300011
The result of study of field of tissue engineering technology shows that PHA also has excellent biological compatibility in recent years, is very potential bio-medical material.PHA can be divided three classes according to the difference of monomer whose structure: short chain PHA, the carbonatoms of monomer whose be less than 6, as poly 3-hydroxy butyrate PHB, and 3-hydroxybutyric acid valeric acid copolyesters PHBV; Long-chain copolymerization PHA in the short chain had both contained short chain PHA monomer, and long-chain PHA monomer in containing again is as poly-3-hydroxybutyric acid capronate; Middle long-chain PHA contains carbonatoms and is not less than 6 monomer.The PHA that different monomers is formed has different physical propertiess, for example intensity, ductility, crystallization rate etc.Along with the rising of long-chain 3-hydroxy fatty acid monomer content, the variation of matter has taken place in middle long-chain PHA performance, become from softness even viscosity have elasticity, degree of crystallinity and rigidity.In general, microorganism can only be synthesized the homopolymer of poly 3-hydroxy butyrate PHB, and the monomer of other PHA can only exist with the form of multipolymer.Also find no at present the microorganism wild strain that can synthesize non-PHB homopolymer.Because the more distinctive performances of homopolymer, add from homopolymer to obtain the chiral hydroxyl group fatty acid mono easily, so carry out that the microorganism of homopolymer is synthetic to seem very necessary.
Pseudomonas putida (Pseudomonas putida) can be a carbon source with lipid acid or its salt, and biosynthesizing obtains polyhydroxyalkanoate.Pseudomonas putida Pseudomonas putida KT2442 is a long-chain PHA synthetic type culture in the strain research.
Summary of the invention
An object of the present invention is to provide a kind of recombinant pseudomonas putida.
Recombinant pseudomonas putida provided by the present invention is as following 1), 2), 3), 4) or 5) shown in:
1) described recombinant pseudomonas putida is according to the preparation of the method that comprises the steps: use the 3-hydroxyl fatty acyl-CoA dehydrogenase encoding gene in the pseudomonas that stinks of and the encoding function forfeiture of 3-keto acyl coenzyme A thiolase encoding gene, obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida I;
2) described recombinant pseudomonas putida is to prepare according to the method that comprises the steps: make the encoding function forfeiture of the 3-hydroxyl acyl lipophorin thiophorase encoding gene among the described recombinant pseudomonas putida I, obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida II;
3) described recombinant pseudomonas putida is to prepare according to the method that comprises the steps: import Poly-synthetase-coding gene and 4-maloyl group thiophorase encoding gene in described recombinant pseudomonas putida II, obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida III;
4) described recombinant pseudomonas putida is to prepare according to the method that comprises the steps: the encoding gene and the pha synthesizing enzyme encoding gene that import the protein-bonded encoding gene of PHA particle, enoyl coenzyme A hydratase in described recombinant pseudomonas putida II, obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida IV;
5) described recombinant pseudomonas putida is according to the preparation of the method that comprises the steps: make the encoding function forfeiture of the encoding gene of the encoding gene of the 3-hydroxyl fatty acyl-CoA dehydrogenase among the described recombinant pseudomonas putida II and fatty acyl-CoA dehydrogenase, obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida V.
Above-mentioned 1) shown in the recombinant pseudomonas putida, describedly uses 3-hydroxyl fatty acyl-CoA dehydrogenase encoding gene in the pseudomonas that stinks of and the encoding function forfeiture of 3-keto acyl coenzyme A thiolase encoding gene realizes by homologous recombination; The method of described homologous recombination comprises the steps: in the described pseudomonas putida that sets out to import in the sequence table DNA shown in the sequence 2 among the DNA shown in the sequence 1 and sequence table, the encoding gene generation homologous recombination of the 3-hydroxyl fatty acyl-CoA dehydrogenase in the described sequence table in DNA shown in the sequence 1 and the described pseudomonas putida that sets out, the encoding gene generation homologous recombination of the 3-keto acyl coenzyme A thiolase in the described sequence table in DNA shown in the sequence 2 and the described pseudomonas putida that sets out obtains described recombinant pseudomonas putida I;
Above-mentioned 2) shown in the recombinant pseudomonas putida, described the encoding function forfeiture of the 3-hydroxyl acyl lipophorin thiophorase encoding gene among the described recombinant pseudomonas putida I is realized by homologous recombination; The method of described homologous recombination comprises the steps: to import DNA shown in the sequence 3 in the sequence table in described recombinant pseudomonas putida I, the encoding gene generation homologous recombination of the 3-hydroxyl acyl lipophorin thiophorase in the described sequence table among DNA shown in the sequence 3 and the described recombinant pseudomonas putida I obtains described recombinant pseudomonas putida II;
Above-mentioned 3) in the recombinant pseudomonas putida, described Poly-synthetase-coding gene and 4-maloyl group thiophorase encoding gene import by recombinant vectors shown in;
Described recombinant vectors is prepared as follows and obtains: plasmid pKSSE5.3 is carried out enzyme with restriction enzyme BamHI and EcoRI cut, reclaim big fragment, note is made big fragment I; Carrier pBBR1-MCS2 is carried out enzyme with restriction enzyme BamHI and EcoRI cut, reclaim the big fragment of carrier, note is made big fragment II; Described big fragment I is connected with described big fragment II, obtains described recombinant vectors;
Above-mentioned 4) in the recombinant pseudomonas putida, the encoding gene and the pha synthesizing enzyme encoding gene of the protein-bonded encoding gene of described PHA particle, enoyl coenzyme A hydratase import by recombinant vectors shown in; Described recombinant vectors is that KpnI and EcoRI site that the fusion gene that the encoding gene of the protein-bonded encoding gene of described PHA particle, pha synthesizing enzyme encoding gene and enoyl coenzyme A hydratase constitutes inserts carrier pBBR1-MCS2 are obtained; The protein-bonded encoding gene of described PHA particle is positioned at the upstream of described fusion gene, and described pha synthesizing enzyme encoding gene is positioned at the middle reaches of described fusion gene, and the encoding gene of described enoyl coenzyme A hydratase is positioned at the downstream of described fusion gene;
Above-mentioned 5) shown in the recombinant pseudomonas putida, the encoding function forfeiture of the encoding gene of described encoding gene that makes the 3-hydroxyl fatty acyl-CoA dehydrogenase among the described recombinant pseudomonas putida II and fatty acyl-CoA dehydrogenase realizes by homologous recombination; The method of described homologous recombination comprises the steps: in described recombinant pseudomonas putida II to import in the sequence table DNA shown in the sequence 10 among the DNA shown in the sequence 9 and sequence table, the encoding gene generation homologous recombination of the 3-hydroxyl fatty acyl-CoA dehydrogenase in the described sequence table among DNA shown in the sequence 9 and the described recombinant pseudomonas putida II, the encoding gene generation homologous recombination of the fatty acyl-CoA dehydrogenase in the described sequence table among DNA shown in the sequence 10 and the described recombinant pseudomonas putida II obtains described recombinant pseudomonas putida V.
Above-mentioned 1) shown in the recombinant pseudomonas putida, in the described sequence table in DNA shown in the sequence 1 and the sequence table DNA shown in the sequence 2 import by recombinant vectors; Described recombinant vectors is that XbaI and HindIII site that the fusion gene that DNA shown in the sequence 2 in DNA shown in the sequence 1 in the described sequence table and the table constitutes inserts the carrier pK18mobSacB that sets out are obtained; DNA shown in the sequence 1 is positioned at the upstream of fusion gene in the described sequence table, and DNA shown in the sequence 2 is positioned at the downstream of fusion gene in the described table;
Above-mentioned 2) in the recombinant pseudomonas putida, DNA shown in the sequence 3 imports by recombinant vectors in the described sequence table shown in; Described recombinant vectors is that HindIII and XmaI site that DNA shown in the sequence 3 in the described sequence table inserts the carrier pK18mobSacB that sets out are obtained;
Above-mentioned 3) in the recombinant pseudomonas putida, the nucleotide sequence of described Poly-synthetase-coding gene is shown in sequence in the sequence table 4 shown in, and the nucleotide sequence of described 4-maloyl group thiophorase encoding gene is shown in sequence in the sequence table 5; Described Poly-synthetase-coding gene is positioned at the upstream of described fusion gene, and described 4-maloyl group thiophorase encoding gene is positioned at the downstream of described fusion gene;
Above-mentioned 4) in the recombinant pseudomonas putida, the nucleotide sequence of the protein-bonded encoding gene of described PHA particle is shown in sequence in the sequence table 6 shown in, and the nucleotide sequence of the encoding gene of described enoyl coenzyme A hydratase is shown in sequence in the sequence table 7; The nucleotide sequence of described pha synthesizing enzyme encoding gene is shown in sequence in the sequence table 8;
Described recombinant vectors obtains as follows: the genomic dna with Aeromonas hydrophila 4AK4 is a template, to carrying out pcr amplification, obtains the PCR product with following primer; With restriction enzyme KpnI and EcoRI described pcr amplification product is carried out double digestion, reclaim gene fragment; With restriction enzyme KpnI and EcoRI carrier pBBR1-MCS2 is carried out double digestion, reclaim enzyme and cut big fragment; Described gene fragment and described enzyme are cut big fragment be connected, obtain described recombinant vectors;
Above-mentioned 5) shown in the recombinant pseudomonas putida, in the described sequence table in DNA shown in the sequence 9 and the sequence table DNA shown in the sequence 10 import by recombinant vectors; Described recombinant vectors is that HindIII and BamHI site that the fusion gene that DNA shown in the sequence 10 in DNA shown in the sequence 9 and the sequence table in the described sequence table constitutes inserts the carrier pK18mobSacB that sets out are obtained; DNA shown in the sequence 9 is positioned at the upstream of described fusion gene in the described sequence table, and DNA shown in the sequence 10 is positioned at the downstream of described fusion gene in the described sequence table.
In above-mentioned arbitrary described recombinant pseudomonas putida, the described carrier that sets out is pK18mobSacB or pBBR1-MCS2; The described pseudomonas putida that sets out is strain Pseudomonas putida KTOY06.
The application of above-mentioned arbitrary described recombinant pseudomonas putida in the preparation polyhydroxyalkanoate also belongs to protection scope of the present invention.
Last purpose of the present invention provides a kind of method for preparing polyhydroxyalkanoate.
The method for preparing polyhydroxyalkanoate provided by the present invention comprises the steps: that with lipid acid, solubility soap or gamma-butyrolactone be carbon source, carries out biosynthesizing with above-mentioned arbitrary described recombinant pseudomonas putida, obtains polyhydroxyalkanoate.
In the aforesaid method, the described biosynthetic method above-mentioned arbitrary described recombinant pseudomonas putida that comprises the steps: to ferment obtains containing the fermented liquid of described recombinant pseudomonas putida; Adding described lipid acid or described solubility soap or described gamma-butyrolactone in the described fermented liquid that contains recombinant pseudomonas putida, is to continue to cultivate 39h under 30 ℃ the condition in temperature, obtains polyhydroxyalkanoate.
In the aforesaid method, described lipid acid is valeric acid, caproic acid, enanthic acid, sad, n-nonanoic acid, capric acid, lauric acid or myristic acid, and described solubility soap is natrium valericum, Sodium n-caproate, enanthic acid sodium, Sodium octoate, n-nonanoic acid sodium or Sodium decanoic acid.
In the aforesaid method, described polyhydroxyalkanoate is hydroxyalkanoate homopolymer or hydroxy fatty acid ester copolymer;
Described biosynthetic method is following 1), 2), 3), 4) or 5) shown in:
1) described recombinant pseudomonas putida is recombinant pseudomonas putida I, and described solubility soap is enanthic acid sodium, and the chemical formula of described polyhydroxyalkanoate is suc as formula shown in the I, and the number-average molecular weight of described polyhydroxyalkanoate is 252 * 10 3Da, the weight-average molecular weight of described polyhydroxyalkanoate is 455 * 10 3Da; The concentration of described enanthic acid sodium in the described fermented liquid that contains pseudomonas putida is 5g/L;
Figure GSA00000104571300041
2) described recombinant pseudomonas putida is recombinant pseudomonas putida II, and described solubility soap is Sodium n-caproate, and the chemical formula of described polyhydroxyalkanoate is suc as formula shown in the II-1, and the number-average molecular weight of described polyhydroxyalkanoate is 206 * 10 3Da, the weight-average molecular weight of described polyhydroxyalkanoate is 272 * 10 3Da; The concentration of described Sodium n-caproate in the described fermented liquid that contains pseudomonas putida is 10g/L;
Figure GSA00000104571300042
Described recombinant pseudomonas putida is recombinant pseudomonas putida II, and described solubility soap is Sodium octoate, and the chemical formula of described polyhydroxyalkanoate is suc as formula shown in the II-2, and the number-average molecular weight of described polyhydroxyalkanoate is 148 * 10 3Da, the weight-average molecular weight of described polyhydroxyalkanoate is 180 * 10 3Da; The concentration of described Sodium n-caproate in the described fermented liquid that contains pseudomonas putida is 10g/L;
Figure GSA00000104571300043
3) described recombinant pseudomonas putida is recombinant pseudomonas putida III, and described carbon source is a gamma-butyrolactone, and the chemical formula of described polyhydroxyalkanoate is shown in formula III, and the number-average molecular weight of described polyhydroxyalkanoate is 487 * 10 3Da, the weight-average molecular weight of described polyhydroxyalkanoate is 854 * 10 3Da; The concentration of described gamma-butyrolactone in the described fermented liquid that contains pseudomonas putida is 5g/L;
Figure GSA00000104571300051
4) described recombinant pseudomonas putida is recombinant pseudomonas putida IV: described solubility soap is natrium valericum, and the chemical formula of described polyhydroxyalkanoate is suc as formula shown in the IV, and the number-average molecular weight of described polyhydroxyalkanoate is 815 * 10 3Da, the weight-average molecular weight of described polyhydroxyalkanoate is 1056 * 10 3Da; The concentration of described natrium valericum in the described fermented liquid that contains pseudomonas putida is 5g/L;
Figure GSA00000104571300052
5) described recombinant pseudomonas putida is recombinant pseudomonas putida V: described solubility soap is Sodium decanoic acid, and the chemical formula of described polyhydroxyalkanoate is suc as formula shown in the V-1, and the number-average molecular weight of described polyhydroxyalkanoate is 248.6 * 10 3Da, the weight-average molecular weight of described polyhydroxyalkanoate is 361.4 * 10 3Da; The concentration of described Sodium decanoic acid in the described fermented liquid that contains pseudomonas putida is 2g/L;
Figure GSA00000104571300053
Described recombinant pseudomonas putida is recombinant pseudomonas putida V: described lipid acid is lauric acid, and the chemical formula of described polyhydroxyalkanoate is suc as formula shown in the V-2, and the number-average molecular weight of described polyhydroxyalkanoate is 119.4 * 10 3Da, the weight-average molecular weight of described polyhydroxyalkanoate is 155.5 * 10 3Da; The concentration of described lauric acid in the described fermented liquid that contains pseudomonas putida is 6g/L;
Figure GSA00000104571300061
Described recombinant pseudomonas putida is recombinant pseudomonas putida V: described lipid acid is myristic acid, and the chemical formula of described polyhydroxyalkanoate is suc as formula shown in the V-3; The concentration of described myristic acid in the described fermented liquid that contains pseudomonas putida is 4g/L;
Figure GSA00000104571300062
In the aforesaid method, the described fermented liquid that contains recombinant pseudomonas putida is to obtain according to the method that comprises the steps: described recombinant pseudomonas putida is inoculated in the LB-Km liquid nutrient medium, be to cultivate under 30 ℃ the condition in temperature, obtain described fermented liquid; Described LB-Km liquid nutrient medium is made up of yeast extract, peptone, NaCl, sulphuric acid kanamycin and water, the concentration of yeast extract in the LB-Km liquid nutrient medium is 5g/L, the concentration of peptone in the LB-Km liquid nutrient medium is 10g/L, the concentration of NaCl in the LB-Km liquid nutrient medium is 10g/L, and the concentration of sulphuric acid kanamycin in the LB-Km liquid nutrient medium is 50 μ g/mL.
In the recombinant pseudomonas putida of the present invention, passing through of having knocks out some gene (as PP2047) in the beta-oxidation approach of lipid acid, makes its forfeiture encoding function, thereby the beta-oxidation approach of the lipid acid in this bacterium is contained; Have plenty of on the basis that the beta-oxidation approach of lipid acid is contained, further some gene (as phaG) in the de novo synthesis of lipid acid is knocked out, thereby the de novo synthesis of the lipid acid in this bacterium is contained, realized that the de novo synthesis of lipid acid and the beta-oxidation approach of lipid acid are contained simultaneously; Have plenty of on the basis that the de novo synthesis of the beta-oxidation approach of lipid acid and lipid acid is contained simultaneously, further in bacterium, import polyhydroxyalkanoate synthetic genes involved (as orfZ).
Because the de novo synthesis of the beta-oxidation approach of lipid acid and lipid acid is all weakened in the recombinant pseudomonas putida of the present invention, make lipid acid or solubility soap substrate neither enter the de novo synthesis that the beta-oxidation approach does not enter lipid acid yet, be not increased thereby the carbochain that makes substrate is neither cut yet, guarantee the homogeneity of substrate carbon chain lengths, make the substrate of carbon chain lengths homogeneous enter the polyhydroxyalkanoate route of synthesis, the synthetic hydroxyalkanoate homopolymer that obtains.
No matter experiment showed, all can to obtain hydroxyalkanoate homopolymer with above-mentioned any reorganization bacterium biosynthesizing polyhydroxyalkanoate, especially in long-chain hydroxyalkanoate homopolymer (C 4-C 14).The polyhydroxyalkanoate homopolymer purity height, the output height that obtain.The inventive method can synthesize the middle long-chain polyhydroxyalkanoate homopolymer of random length, overcome the defective that biosynthesizing in the prior art can only obtain the homopolymer of 3-butyric ester (HB).Therefore, the inventive method will have broad application prospects in the biosynthesizing field of the homopolymer of hydroxy fatty acid.
Description of drawings
Fig. 1 is the collection of illustrative plates of plasmid pK18mobSacB.
Fig. 2 is poly-4 butyric ester nuclear magnetic resonance maps.
Fig. 3 is poly-hydroxyl valerate nuclear magnetic resonance map.
Fig. 4 is poly-hydroxycaproic ester nuclear magnetic resonance map.
Fig. 5 is poly-hydroxyl heptanoate nuclear magnetic resonance map.
Fig. 6 is poly-hydroxydecanoic acid ester nuclear magnetic resonance map.
Embodiment
Employed experimental technique is ordinary method if no special instructions among the following embodiment.
Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.
Yeast extract is available from Britain OXOID company, and catalog number is LP-0042; Peptone is available from Britain OXOID company, and catalog number is LP-0021;
The LB liquid nutrient medium: every liter of substratum contains the 5g/L yeast extract, the 10g/L peptone, and 10g/L NaCl, all the other are water.
LB-Km liquid nutrient medium: form by yeast extract, peptone, NaCl, sulphuric acid kanamycin and water, the concentration of yeast extract in the LB-Km liquid nutrient medium is 5g/L, the concentration of peptone in the LB-Km liquid nutrient medium is 10g/L, the concentration of NaCl in the LB-Km liquid nutrient medium is 10g/L, and the concentration of sulphuric acid kanamycin in the LB-Km liquid nutrient medium is 50 μ g/mL.
The LB-Km solid medium: every liter of substratum contains 15g/L agar, the 5g/L yeast extract, and the 10g/L peptone, 10g/L NaCl and 50 μ g/mL sulphuric acid kanamycins, all the other are water.
The LBS-Amp solid medium: every liter of substratum contains 15g/L agar, the 5g/L yeast extract, and the 10g/L peptone, 10g/L NaCl and 100 μ g/mL penbritins, all the other are water.
The LB-Km-Amp solid medium: every liter of substratum contains 15g/L agar, the 5g/L yeast extract, and the 10g/L peptone, 10g/L NaCl, 50 μ g/mL sulphuric acid kanamycins and 100 μ g/mL penbritins, all the other are water.
Strain Pseudomonas putida strain KT2442 (van der Meer, J R, van Neerven, A R, deVries, E J, et al.Cloning and characterization of plasmid-encoded genes for thedegradation of 1,2-dichloro-, 1,4-dichloro-, and 1,2,4-trichlorobenzene ofPseudomonas sp.strain P51.J Bacteriol 173 (1): 6-15 Jan 1991) (provide) by Tsing-Hua University.
Plasmid pK18mobSacB (
Figure GSA00000104571300081
A, Tauch A,
Figure GSA00000104571300082
W, et al.Small mobilizblemulti-purpose cloning vectors derived from the Escherichia coli plasmids pK18 andpK19:selection of defined deletions in the chromosome of Corynebacterium glutamicum.Gene 1994 145:69-73) (is provided by Tsing-Hua University).The collection of illustrative plates of plasmid pK18mobSacB as shown in Figure 1.
Intestinal bacteria E.coli S17-1 ATCC No.47055 is available from ATCC.
Strain Pseudomonas putida KTOY06 (SP Ouyang, RC Luo, Q Liu, et al.Production ofpolyhydroxyalkanoates with high 3-hydroxydodecanoate monomer content by fadB andfadA knockout mutant of Pseudomonas putida KT2442.Biomacromolecules 2007 8:2504-2511) (is provided by Tsing-Hua University).
The construction step of strain Pseudomonas putida KTOY06: Pseudomonas putida KT2442 3-hydroxyl fatty acyl-CoA dehydrogenase gene (3-hydroxyacyl-CoA dehydrogenase, fadB) and 3-keto acyl coenzyme A thiolase gene (3-ketoacyl-CoA thiolase, fadA) structure of deletion mutantion strain:
1, the structure that is used for the escherichia coli cloning carrier of deletion mutantion Pseudomonas putida KT2442 fadB and fadA gene
1) genomic dna with Pseudomonas putida strain KT2442 is a template, under the guiding of primer P1:ATTTCTAGAGCAGATGATGGCCTTC and P2:CTGAAGCTTTGTAATGCCGGTATAC, two genes that pcr amplification links to each other, comprise 3-keto acyl coenzyme A thiolase gene fadA fragment (sequence 11 is from 5 ' terminal 1498-2674 position Nucleotide in the sequence table) and 3-hydroxyl fatty acyl-CoA dehydrogenase gene fadB fragment (sequence 11 is from 5 ' terminal 1-1467 position Nucleotide in the sequence table), with restriction enzyme XbaI and HindIII pcr amplification product is carried out double digestion, reclaim the endonuclease bamhi that size is about 2.8kb;
2) with restriction enzyme XbaI and HindIII plasmid pK18mobSacB is carried out double digestion, reclaim endonuclease bamhi;
3) with step 1) and step 2) the recovery fragment be connected with the T4DNA ligase enzyme, after ligation is finished, the method that connects product electricity consumption conversion is imported to E.coli S17-1 (ATCC numbering: 47055), transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h;
4) mono-clonal that on LB-Km solid culture flat board, grows of picking, it is inoculated in the LB-Km liquid nutrient medium, shaking table is cultivated 12h under 37 ℃, 200rpm, extract plasmid, and with restriction enzyme XbaI and HindIII plasmid is carried out enzyme and cut evaluation, the result obtains the dna fragmentation of size for 5.699kb and 2.783kb, further plasmid is carried out sequence verification, the sequence that the result obtains is correct, the plasmid that shows structure is correct, will make up correct fadA and the segmental escherichia coli cloning carrier of the fadBPCR called after pSPK10 of containing.
5) with restriction enzyme SalI plasmid pSPK10 is carried out enzyme and cut, reclaim the endonuclease bamhi of 6.648kb;
6) the recovery fragment of step 5) is carried out from connecting with the T4DNA ligase enzyme, after ligation is finished, the method that connects product electricity consumption conversion is imported to E.coli S17-1 (ATCC numbering: 47055), transformant is coated on the LB-Km solid culture flat board, cultivated 12h in 37 ℃ of incubators;
7) mono-clonal that on LB-Km solid culture flat board, grows of picking, it is inoculated in the LB-Km liquid nutrient medium, shaking table is cultivated 12h under 37 ℃, 200rpm, extract plasmid, and with restriction enzyme XbaI and HindIII plasmid is carried out enzyme and cut evaluation, the result produces the dna fragmentation of size for 5.699kb and 0.949kb, further sequence verification, the sequence that records shows that the plasmid of structure is correct shown in sequence in the sequence table 11, will make up correct suicide plasmid called after pSPK11.
2, knock out fadB and fadA gene among the Pseudomonas putida KT2442 by the suicide plasmid pSPK11 that builds, obtain mutant strain Pseudomonas putida KTOY06 engineering strain
1) the reorganization bacterium E.coli S17-1 (pSPK11) that contains plasmid pSPK11 that obtains in the picking step 1, it is inoculated in the LB-Km liquid nutrient medium, at 37 ℃, shaking table is cultivated 12h under the 200rpm, simultaneously with Pseudomonas putidaKT2442 inoculation in the LB liquid nutrient medium, at 30 ℃, shaking table is cultivated 12h under the 200rpm, the nutrient solution of respectively getting the above-mentioned two kinds of bacterial strains of 0.5mL then is mixed in the same aseptic tubule, centrifugal 2 minutes of 8000rpm, abandoning supernatant, add the aseptic LB liquid nutrient medium of 1mL again, behind the resuspended bacterium, placed 30 ℃ of incubators 1 hour, one ring mixed bacteria liquid is coated on the LB-Km-Amp solid culture flat board by method of scoring with the aseptic inoculation ring, in 30 ℃ of incubators, cultivated 24h;
2) mono-clonal that grows on LB-Km-Amp solid culture flat board of picking is seeded to it in LB-Amp liquid nutrient medium, and shaking table is cultivated 24h under 30 ℃, 200rpm;
3) with the aseptic inoculation ring by method of scoring with one the ring 2) in the bacterium liquid that obtains coat on the LBS-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h;
4) 3) in LBS-Amp solid culture flat board on 20 single bacterium colonies of picking, numbering, and in order each single bacterium colony being seeded in respectively on the dull and stereotyped and LB-Km solid culture flat board of LBS-Amp solid culture is cultivated 24h in 30 ℃ of incubators.
5) the picking previous step can only grow on LBS-Amp solid culture flat board in rapid and the single bacterium colony that can not grow on LB-Km solid culture flat board simultaneously, is seeded in the LB-Amp liquid nutrient medium shaking table cultivation 24h under 30 ℃, 200rpm respectively;
6) with 5) in the nutrient solution that obtains respectively get 1ml, centrifugal, remove supernatant, resuspended with 200 μ l sterilized waters.Resuspended bacterium liquid was placed boiling water bath 10 minutes.After the cooling, be template, under the guiding of primer P1:ATTTCTAGAGCAGATGATGGCCTTC and P2:CTGAAGCTTTGTAATGCCGGTATAC, carry out pcr amplification and identify, again plasmid is checked order with this bacterium liquid.Pcr amplification obtains 949bp size fragment as a result, and it is also correct to record sequence, proves that the plasmid structure that makes up is correct, and also proof reorganization bacterium is correct, with this mutant strain called after Pseudomonas putida KTOY06.
Structure and the biosynthesizing of embodiment 1, mutant strain Pseudomonas putida KTOY08
One, the structure of mutant strain Pseudomonas putida KTOY08
(1) structure of suicide plasmid pSPK09
1) genomic dna with Pseudomonas putida strain KT2442 is a template, under the guiding of primer P1:ATTTCTAGAGCTGAACCCGGATGGC and P2:AATAAGCTTGCCGAAGCGCAGGATC, two genes that pcr amplification links to each other, 3-keto acyl coenzyme A thiolase gene (fadAx) and 3-hydroxyl fatty acyl-CoA dehydrogenase gene (fadB2x), with restriction enzyme XbaI and HindIII pcr amplification product is carried out double digestion, reclaim the endonuclease bamhi that size is about 2.7kb.
2) with restriction enzyme XbaI and HindIII plasmid pK18mobSacB is carried out double digestion, reclaim the endonuclease bamhi that size is about 5.699kb;
3) with step 1) and step 2) the recovery fragment be connected with the T4DNA ligase enzyme, after ligation is finished, the method that connects product electricity consumption conversion is imported to E.coli S17-1 (ATCC numbering: 47055), transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h;
4) mono-clonal that on LB-Km solid culture flat board, grows of picking, it is inoculated in the LB-Km liquid nutrient medium, shaking table is cultivated 12h under 37 ℃, 200rpm, extract plasmid, and with restriction enzyme XbaI and HindIII plasmid is carried out enzyme and cut evaluation, the result produces the dna fragmentation of size for 5.699kb and 2.692kb, will make up the correct escherichia coli cloning carrier called after pSPK08 that contains fadAx and fadB2x complete genome.
5) with restriction enzyme SalI plasmid pSPK08 is carried out enzyme and cut, reclaim the endonuclease bamhi of 6.775kb; Part fragment in this step in fadAx complete genome and the fadB2x complete genome is cut, and the non-complete fragment of remaining fadAx is shown in sequence in the sequence table 2, and the non-complete fragment of remaining fadB2x is shown in sequence in the sequence table 1.
6) the recovery fragment of step 5) is carried out from connecting with the T4 dna ligase, after ligation is finished, the method that connects product electricity consumption conversion is imported to E.coli S17-1 (ATCC numbering: 47055), transformant is coated on the LB-Km solid culture flat board, cultivated 12h in 37 ℃ of incubators; The mono-clonal that picking grows on LB-Km solid culture flat board.
7) checking: the mono-clonal that step 6) is obtained is inoculated in the LB-Km liquid nutrient medium, shaking table is cultivated 12h under 37 ℃, 200rpm, extract plasmid, and with restriction enzyme XbaI and HindIII plasmid is carried out enzyme and cut evaluation, the result obtains the dna fragmentation of size for 5.699kb and 1.066kb, illustrates that plasmid construction is correct; Again plasmid is checked order, the result shows, the segmental fusion fragment sequence of fadB2x upstream fragment and fadAx downstream that inserts is the fusion sequence that sequence 1 and sequence 2 constitute, merge fragment and be positioned between the XbaI and HindIII site of the carrier pK18mobSacB that sets out, further the plasmid structure of proof structure is correct; Correct plasmid called after pSPK09 will be made up.
The E.coli S17-1 note that will contain plasmid pSPK09 is made reorganization bacterium E.coli S17-1 (pSPK09).
(2) plasmid pSPK09 transforms strain Pseudomonas putida KTOY06, obtains mutant strain Pseudomonasputida KTOY08
Contain the Amp resistant gene among the strain Pseudomonas putida KTOY06; Contain the Km resistant gene among the plasmid pSPK09;
1) the reorganization bacterium E.coli S17-1 (pSPK09) that contains plasmid pSPK09 that obtains in the picking step () is inoculated into it in LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm; Simultaneously with Pseudomonas putidaKTOY06 inoculation in the LB-Amp liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm; The nutrient solution of respectively getting the above-mentioned two kinds of bacterial strains of 0.5mL then is mixed in the same aseptic tubule, centrifugal 2 minutes of 8000rpm, abandoning supernatant, add the aseptic LB liquid nutrient medium of 1mL again, behind the resuspended bacterium, placed 30 ℃ of incubators 1 hour, and by method of scoring one ring mixed bacteria liquid was coated on the LB-Km-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h with the aseptic inoculation ring;
2) mono-clonal that grows on LB-Km-Amp solid culture flat board of picking is seeded to it in LB-Amp liquid nutrient medium, and shaking table is cultivated 24h under 30 ℃, 200rpm;
3) with the aseptic inoculation ring by method of scoring with one the ring 2) in the bacterium liquid that obtains coat on the LBS-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h;
4) 3) in LBS-Amp solid culture flat board on 20 single bacterium colonies of picking, numbering, and in order each single bacterium colony being seeded in respectively on the dull and stereotyped and LB-Km solid culture flat board of LBS-Amp solid culture is cultivated 24h in 30 ℃ of incubators.
5) can only on LBS-Amp solid culture flat board, grow in the picking step 4) and the single bacterium colony that can not on LB-Km solid culture flat board, grow simultaneously.
6) checking: single bacterium colony that step (5) is obtained is seeded to respectively in the LB-Amp liquid nutrient medium, and shaking table is cultivated 24h under 30 ℃, 200rpm; The nutrient solution that obtains is respectively got 1ml, and is centrifugal, removes supernatant, resuspended with 200 μ l sterilized waters.Resuspended bacterium liquid was placed boiling water bath 10 minutes.After the cooling, be template, under the guiding of primer P1:ATTTCTAGAGCTGAACCCGGATGGC and P2:AATAAGCTTGCCGAAGC GCAGGATC, carry out pcr amplification with this bacterium liquid.Pcr amplification product is checked order.DNA (being the downstream fragment of fadAx) shown in DNA (being the upstream fragment of fadB2x) shown in the sequence that records and the sequence 1 and the sequence 2 is compared, comparison result mates fully, illustrate that homologous recombination has taken place the fadB2x gene in DNA shown in the sequence 1 and the Pseudomonas putida KTOY06 genome, homologous recombination has taken place in the fadAx gene in DNA shown in the sequence 2 and the Pseudomonas putida KTOY06 genome, and the fadB2x gene in the Pseudomonas putida KTOY06 genome and most of fragment of fadAx gene are knocked out.With the most of fragment of fadB2x gene and fadAx gene by the Pseudomonas putida KTOY06 called after Pseudomonas putida KTOY08 after knocking out.
Two, obtain PHA with mutant strain Pseudomonas putida KTOY08 biosynthesizing
Enanthic acid sodium is available from Shanghai traditional Chinese medicines group;
Transform the shake flat experiment of long-chain PHA in the lipid acid production with Pseudomonas putida KTOY08.
(1) biosynthesizing
1) Pseudomonas putida KTOY08 is inoculated in the LB-Km liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm, ratio in 5% (V/V) is inoculated into bacterium liquid in the LB-Km liquid nutrient medium again, shaking table is cultivated 9h under 30 ℃, 200rpm, obtains containing the fermented liquid of Pseudomonas putida KTOY08;
2) enanthic acid sodium is joined in the fermented liquid that contains Pseudomonas putida KTOY08 in the step 1), the concentration that makes enanthic acid sodium in the fermented liquid is 5g/L, continues shaking table then and cultivate 39h under 30 ℃, 200rpm, obtains the fermented liquid after the biosynthesizing;
3) the biosynthesizing fermented liquid that obtains centrifugal 5 minutes at 8000rpm is collected thalline.
4) thalline of collecting is resuspended with deionized water, and 8000rpm is centrifugal 5 minutes then, collects thalline.
5) thalline of collecting is resuspended with 70% aqueous ethanolic solution, 8000rpm is centrifugal 5 minutes then, collects thalline.
6) collect the thalline obtain and under freezing conditions carry out vacuum and drain and spend the night, obtain dry mycelium, be used for gas chromatographic analysis.
7) dry mycelium is weighed put into reactor, add chloroform, 100 ℃ of reactions 4 hours down with 1: 10 ratio (volume ratio).
8) will be dissolved with the chloroform filter paper filtering of PHA in the reactor, obtain mother liquor and ice ethanol sedimentation according to 1: 10 ratio (volume ratio) adding.
9) collecting precipitation carries out the normal temperature vacuum and drains, and the product that obtains is last PHA homopolymer, is used for NMR (Nuclear Magnetic Resonance) analysis.
(2) product checking
Somatic cells dry weight in the fermented liquid after detection of biological is synthetic (CDW, g/L) and PHA content (wt%), form.
Cultivate and finish the back according to document (Ouyang, S.P.; Liu, Q.; Fang, L.; Chen, G.Q.Constructionof pha-Operon-Defined Knockout Mutants of Pseudomonas putida KT2442 and theirApplications in Poly (hydroxyalkanoate) Production.Macromol.Biosci.2007,7,227-233) described method:
1) get the about 30mg of dry mycelium in exsiccant esterification pipe, add the 2ml chloroform, 2ml esterifying liquid (methanol solution of 3% vitriol oil) is in 100 ℃ of reaction 4h;
2) add 1ml deionized water, mixing, standing over night;
3) take off layer liquid 0.5 μ l and carry out the chromatography of gases analysis.
1, homopolymer structure verification
The detection method that PHA forms: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis;
The molecular structural formula of homopolymer:
Figure GSA00000104571300121
Number-average molecular weight is 252 * 10 3(or weight-average molecular weight is 455 * 10 to Da 3Da); The nuclear magnetic resonance map of homopolymer PHHp is (a: poly-hydroxycaproic ester proton nmr spectra as shown in Figure 5; B: poly-hydroxycaproic ester carbon-13 nmr spectra).
2, PHA content detecting method: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis; The calculation formula of PHA content
PHA content=each monomer content sum
Figure GSA00000104571300122
Monomer content=slope of standard curve * monomer peak area/interior mark peak area;
The result: mutant strain KTOY08 is being under the culture condition of single carbon source with enanthic acid sodium, can form the homopolymer (table 1) that only contains 3-hydroxyl enanthic acid (3Hp) by synthon.
Table 1, P.putida KTOY08 transform the synthetic PHA of fatty acid biological
Figure GSA00000104571300123
The structure of embodiment 2, strain Pseudomonas putida KTOY08-G and biosynthesizing
One, the structure of engineering strain Pseudomonas putida KTOY08-G
(1) structure of recombinant vectors pKQQ01
1) genomic dna with Pseudomonas putida KT2442 is a template, carry out pcr amplification with primer phaG-up-1 and phaG-up-2, obtain the upstream fragment (sequence 3 is from shown in the Nucleotide of 5 ' terminal 1-448 position in the sequence table) of 3-hydroxyl acyl lipophorin thiophorase encoding gene (3-hydroxyacyl-acylcarrier protein-coenzyme A transferase or be PhaG); With restriction enzyme XbaI and HindIII pcr amplification product is carried out double digestion, reclaim the endonuclease bamhi that size is about 400bp;
Genomic dna with Pseudomonas putida KT2442 is a template, carry out pcr amplification with primer phaG-down-1 and phaG-down-2, obtain the downstream fragment (sequence 3 is from shown in the Nucleotide of 5 ' terminal 449-913 position in the sequence table) of 3-hydroxyl acyl lipophorin thiophorase encoding gene (3-hydroxyacyl-acylcarrier protein-coenzyme A transferase or be PhaG); With restriction enzyme XbaI and XmaI pcr amplification product is carried out double digestion, reclaim the endonuclease bamhi that size is about 400bp;
phaG-up-1：ATAGAT? AAGCTT?TATCGTGAACTGACGGCCAATGAGA
phaG-up-2：GC? TCTAGA?GCGATAGAACTCCGTGTAAACCCGA
phaG-down-1：GC? TCTAGA?GCAAGCATGTGGGCAGAAGCCAGTTCA
phaG-down-2：AT? CCCGGG?CATGGGCCAGGTCAAGGCAGGA
2) with restriction enzyme XbaI and HindIII plasmid pK18mobSacB is carried out double digestion, reclaim enzyme and cut big fragment;
3) the phaG upstream fragment enzyme of step 1) is cut product and step 2) the big fragment of recovery be connected with the T4 dna ligase, after ligation is finished, import to intestinal bacteria E.coli S17-1 (ATCC numbering: 47055) with connecting the method for product with chemical conversion, transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h;
4) mono-clonal that on LB-Km solid culture flat board, grows of picking, it is inoculated in the LB-Km liquid nutrient medium, shaking table is cultivated 12h under 37 ℃, 200rpm, extract plasmid, and with restriction enzyme XbaI and HindIII plasmid is carried out enzyme and cut evaluation, positive plasmid can produce the dna fragmentation of size for 448bp and 5696bp after enzyme is cut, will make up the correct segmental escherichia coli cloning carrier of the phaG upstream PCR called after pKQQ01-1 that contains.
5) with restriction enzyme XbaI and XmaI plasmid pKQQ01-1 is carried out enzyme and cut, reclaim the endonuclease bamhi of 6145bp;
6) the phaG downstream fragment of step 1) and the recovery fragment of step 5) are connected with the T4 dna ligase, after ligation is finished, import to E.coli S17-1 (ATCC numbering: 47055) with connecting the method for product with chemical conversion, transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h; The mono-clonal that picking grows on LB-Km solid culture flat board.
7) checking: the mono-clonal that step 6) is obtained is inoculated in the LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm, extracts plasmid, and with restriction enzyme XbaI and XmaI plasmid is carried out enzyme and cut evaluation.The result obtains the dna fragmentation of size for 467bp and 6145bp; Again plasmid is checked order, the result shows, the sequence that records is shown in sequence in the sequence table 3, and the gene shown in the sequence 3 in the sequence table (is the segmental fusion gene of upstream fragment and downstream of PhaG gene, but be not complete PhaG gene) be positioned between the HindIII and XmaI site of the carrier pK18mobSacB that sets out, the plasmid structure that confirm to make up is correct, will make up correct two sections segmental escherichia coli cloning carriers of PCR of phaG upstream and downstream called after pKQQ01 that contains.
The E.coli S17-1 called after reorganization bacterium E.coli S17-1 (pKQQ01) that will contain plasmid pKQQ01.
(2) structure of engineering strain Pseudomonas putida KTOY08-G
1) the reorganization bacterium E.coli S17-1 (pKQQ01) that contains plasmid pKQQ01 that obtains in the picking step () is inoculated into it in LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm; Simultaneously with Pseudomonas putidaKTOY08 inoculation in the LB liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm; The nutrient solution of respectively getting the above-mentioned two kinds of bacterial strains of 0.5mL then is mixed in the same aseptic tubule, centrifugal 2 minutes of 8000rpm, abandoning supernatant, add the aseptic LB liquid nutrient medium of 1mL again, behind the resuspended bacterium, placed 30 ℃ of incubators 1 hour, and by method of scoring one ring mixed bacteria liquid was coated on the LB-Km-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h with the aseptic inoculation ring;
2) mono-clonal that grows on LB-Km-Amp solid culture flat board of picking is seeded to it in LB-Amp liquid nutrient medium, and shaking table is cultivated 24h under 30 ℃, 200rpm;
3) with the aseptic inoculation ring by method of scoring with one the ring 2) in the bacterium liquid that obtains coat on the LBS-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h;
4) 3) in LBS-Amp solid culture flat board on 20 single bacterium colonies of picking, numbering, and in order each single bacterium colony being seeded in respectively on the dull and stereotyped and LB-Km solid culture flat board of LBS-Amp solid culture is cultivated 24h in 30 ℃ of incubators.
5) the picking previous step can only grow on LBS-Amp solid culture flat board in rapid and the single bacterium colony that can not grow on LB-Km solid culture flat board the while.
6) checking: single bacterium colony that step 5) is obtained is seeded to respectively in the LB-Amp liquid nutrient medium, and shaking table is cultivated 24h under 30 ℃, 200rpm; The nutrient solution that obtains is respectively got 1ml, and is centrifugal, removes supernatant, resuspended with 200 μ l sterilized waters.Resuspended bacterium liquid was placed boiling water bath 10 minutes.After the cooling, be template, under the guiding of primer P1:ATTTCTAGAGCAGATGATGGCCTTC and P4:ATACCCGGGCCGGAGTAGATGC GGAACGACAACG, carry out pcr amplification with this bacterium liquid.The pcr amplification product that the amplified fragments size is about 800bp checks order.With DNA shown in the sequence that records and the sequence 3 (is the segmental fusion fragment of upstream fragment and downstream of PhaG gene, but be not complete PhaG gene) compare, comparison result mates fully, illustrate that homologous recombination has taken place the phaG gene in DNA shown in the sequence 3 and the Pseudomonas putida KTOY08 genome, most of fragment of the phaG gene in the Pseudomonas putida KTOY08 genome is knocked out.With most of fragment of phaG gene by the Pseudomonas putida KTOY08 called after Pseudomonas putida KTOY08-G after knocking out.Principle of homologous recombination judge to take place: at first Kuo Zeng sequence size will be about 913bp, then Ce Xu result will with the segmental fusion gene of upstream fragment and downstream of above-mentioned phaG gene, but be not that complete phaG gene is complementary.If under situation about not knocking out, be that template is carried out PCR with the genome in other words with phaG-up-1 and these two primers of phaG-down-2, the sequence that obtains so will be 1552bp, this 1552bp comprises the segmental fusion gene of upstream fragment and downstream of above-mentioned phaG gene, but the most of fragment that also comprises the phaG gene simultaneously, recombinate then most of fragment of phaG gene has been recombinated successfully only stayed the segmental fusion gene of upstream fragment and downstream of phaG gene.
Two, with engineering strain Pseudomonas putida KTOY08-G biosynthesizing, obtain PHA
Transform the shake flat experiment of long-chain PHA in the lipid acid production with Pseudomonas putida KTOY08-G.
(1) biosynthesizing
Sodium n-caproate is available from Shanghai traditional Chinese medicines group; Sodium octoate is available from Shanghai traditional Chinese medicines group;
1) Pseudomonas putida KTOY08-G is inoculated in the LB-Km liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm, ratio in 5% (V/V) is inoculated into bacterium liquid in the LB-Km liquid nutrient medium again, shaking table is cultivated 9h under 30 ℃, 200rpm, obtains containing the fermented liquid of Pseudomonas putida KTOY08-G;
2) respectively Sodium n-caproate and Sodium octoate are joined in the fermented liquid that contains Pseudomonas putida KTOY08-G in the step 1), make the concentration of Sodium n-caproate in the fermented liquid, Sodium octoate be 10g/L, under 30 ℃, 200rpm, continue shaking table then and cultivate 39h, obtain the fermented liquid after the biosynthesizing.
3) method of acquisition thalline: with consistent described in the embodiment 1.
(2) product checking
Somatic cells dry weight in the fermented liquid after detection of biological is synthetic (CDW, g/L) and PHA content (wt%), form.
Cultivate and finish the back according to document (Ouyang, S.P.; Liu, Q.; Fang, L.; Chen, G.Q.Constructionof pha-Operon-Defined Knockout Mutants of Pseudomonas putida KT2442 and theirApplications in Poly (hydroxyalkanoate) Production.Macromol.Biosci.2007,7,227-233) described method: the pre-treating process of thalline is with consistent described in the embodiment 1.
Product checking when 1, being substrate with the Sodium n-caproate
(1) detection method of PHA composition: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis;
Result: the molecular structural formula of homopolymer:
Figure GSA00000104571300151
Number-average molecular weight is 206 * 10 3(or weight-average molecular weight is 272 * 10 to Da 3Da); The nuclear magnetic resonance map of homopolymer HHx is (a: poly-hydroxycaproic ester proton nmr spectra as shown in Figure 4; B: poly-hydroxycaproic ester carbon-13 nmr spectra).
(2) PHA content detecting method: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis; The calculation formula of PHA content is with consistent described in the embodiment 1.
The result: mutant strain KTOY08 is being under the culture condition of single carbon source with Sodium n-caproate, can form the homopolymer that only contains 3-hydroxycaproic acid (3HHx), (table 2) by synthon.
Product checking when 2, being substrate with the Sodium octoate
(1) detection method of PHA composition: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis;
Result: the molecular structural formula of multipolymer:
Figure GSA00000104571300152
The number-average molecular weight of multipolymer is 148 * 10 3(or weight-average molecular weight is 180 * 10 to Da 3Da);
(2) PHA content detecting method: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis; The calculation formula of PHA content
PHA content=each monomer content sum
Figure GSA00000104571300153
Monomer content=slope of standard curve * monomer peak area/interior mark peak area;
The result: mutant strain KTOY08 is being under the culture condition of single carbon source with Sodium octoate, can form the multipolymer that contains 3-hydroxycaproic acid (3HHx) and 3-Hydroxyoctanoic acid (3HO), (table 2) by synthon.
Table 2.P.putida KTOY08-G transforms the synthetic PHA of fatty acid biological.
Figure GSA00000104571300161
The structure of embodiment 3, strain Pseudomonas putida KTHH06 and biosynthesizing PHA
Carrier pKSSE5.3 (Hein S,
Figure GSA00000104571300162
B, Gottschalk G, Steinb ü chel A.Biosynthesis ofpoly (4-hydroxybutyric acid) by recombinant strains of Escherichia coli.FEMSMicrobiol.Lett.1997; 153:411-418.) (providing by Tsing-Hua University);
Contain among the carrier pKSSE5.3 and come from the genomic Poly-synthetase-coding gene of the true bacteria of Luo Shi (Ralstonia eutropha) (phbC gene); The nucleotide sequence that comes from the genomic Poly-synthetase-coding gene of the true bacteria of Luo Shi (Ralstonia eutropha) (phbC gene) is 1767bp shown in sequence in the sequence table 4.
Carrier pBBR1-MCS2 (Michael E.Kovach, Philip H.Elzer, D.Steven Hill et al.Fournew derivatives of the broad-host-range cloning vector pBBR1MCS, carrying differentantibiotic-resistance cassettes.Gene.1995; 166:175-176.) (providing by Tsing-Hua University);
Contain among the carrier pBBR1-MCS2 and come from Ke Shi clostridium (Clostridium kluyveri) genomic 4-maloyl group thiophorase encoding gene (orfZ gene); The nucleotide sequence that comes from Ke Shi clostridium (Clostridium kluyveri) genomic 4-maloyl group thiophorase encoding gene (orfZ gene) is 1290bp shown in sequence in the sequence table 5.
One, the structure of strain Pseudomonas putida KTHH06
(1) structure of carrier pBHH01
1) plasmid pKSSE5.3 is carried out enzyme with restriction enzyme BamHI and EcoRI and cut, obtain 2 dna fragmentations of 4520bp and 2943bp, reclaiming size is the 5420bp dna fragmentation.
Carrier pBBR1-MCS2 is carried out enzyme with restriction enzyme BamHI and EcoRI cut, obtain 2 dna fragmentations of 18bp and 5126bp, reclaiming size is the 5126bp dna fragmentation.
2) two dna fragmentations of 5420bp bp and 5126bp with step 1) are connected with the T4 dna ligase, after ligation is finished, import to E.coli S17-1 (ATCC numbering: 47055) with connecting the method for product with chemical conversion, transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h;
3) mono-clonal that grows on LB-Km solid culture flat board of picking is inoculated into it in LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm, extracts plasmid, and with restriction enzyme BamHI and EcoRI plasmid is carried out enzyme and cut evaluation.The result obtains enzyme and cuts the plasmid that the back produces big or small 5420bp and two dna fragmentations of 5126bp, and positive plasmid is with the correct escherichia coli cloning carrier called after pBHH01 that contains phbC and orfZ (Ralstonia eutropha) gene that obtains.
With the further sequence verification of pBHH01, the result shows, gene shown in the sequence 4 (phbC gene) constitutes fusion gene (the fusion gene sequence is the sequence after sequence 4 and sequence 5 merge) with gene (orfZ gene) shown in the sequence 5, the phbC gene is positioned at the upstream of fusion gene, and the orfZ gene is positioned at the downstream of fusion gene.
The E.coli S17-1 note that will contain pBHH01 is made reorganization bacterium E.coli S17-1 (pBHH01).
(2) plasmid pBHH01 transforms Pseudomonas putida KTOY08-G
1) the reorganization bacterium E.coli S17-1 (pBHH01) that contains plasmid pBHH01 that obtains in the picking step () is inoculated into it in LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm; Simultaneously with Pseudomonas putidaKTOY08-G inoculation in the LB liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm; The nutrient solution of respectively getting the above-mentioned two kinds of bacterial strains of 0.5mL then is mixed in the same aseptic tubule, centrifugal 2 minutes of 8000rpm, abandoning supernatant, add the aseptic LB liquid nutrient medium of 1mL again, behind the resuspended bacterium, placed 30 ℃ of incubators 1 hour, and by method of scoring one ring mixed bacteria liquid was coated on the LB-Km-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h with the aseptic inoculation ring;
2) mono-clonal that on LB-Km-Amp solid culture flat board, grows of picking.
3) checking: from the mono-clonal that step (2) obtains, extract plasmid, with restriction enzyme BamHI and EcoRI plasmid is carried out enzyme and cut evaluation, the result, obtaining size is 5420bp and two dna fragmentations of 5126bp, confirms that the plasmid that imports in the mono-clonal is pBHH01.The mutant strain KTOY08-G called after Pseudomonas putida KTHH06 that will contain plasmid pBHH01.
Two, with the synthetic PHA of strain Pseudomonas putida KTHH06
Transform the shake flat experiment that lipid acid is produced PHA with Pseudomonas putida KTHH06.
Gamma-butyrolactone is available from Shanghai traditional Chinese medicines group.
(1) biosynthesizing
1) Pseudomonas putida KTHH06 is inoculated in the LB-Km liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm, ratio in 5% (V/V) is inoculated into bacterium liquid in the LB-Km liquid nutrient medium again, shaking table is cultivated 9h under 30 ℃, 200rpm, obtains containing the fermented liquid of Pseudomonas putida KTHH06;
2) gamma-butyrolactone is joined in the fermented liquid that contains Pseudomonas putida KTHH06 in the step 1), make that the concentration of gamma-butyrolactone is 5g/L in the fermented liquid, under 30 ℃, 200rpm, continue shaking table then and cultivate 39h, obtain the fermented liquid after the biosynthesizing.
3) method of acquisition thalline: with consistent described in the embodiment 1.
(2) product checking
Somatic cells dry weight in the fermented liquid after detection of biological is synthetic (CDW, g/L) and PHA content (wt%), form.
Cultivate and finish the back according to document (Ouyang, S.P.; Liu, Q.; Fang, L.; Chen, G.Q.Constructionof pha-Operon-Defined Knockout Mutants of Pseudomonas putida KT2442 and theirApplications in Poly (hydroxyalkanoate) Production.Macromol.Biosci.2007,7,227-233) described method: the pre-treating process of thalline is with consistent described in the embodiment 1.
1, homopolymer structure verification
The detection method that P4HB forms: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis;
The molecular structural formula of homopolymer:
Number-average molecular weight is 487 * 10 3(or weight-average molecular weight is 854 * 10 to Da 3Da);
The nuclear magnetic resonance map of homopolymer P4HB is (a: poly butyric ester proton nmr spectra as shown in Figure 2; B: the poly butyric ester carbon-13 nmr spectra).
2, PHA content detecting method: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis; The calculation formula of PHA content is with identical described in the embodiment 1.
The result: mutant strain KTOY08 is being under the culture condition of single carbon source with gamma-butyrolactone, can form the homopolymer that only contains 4 hydroxybutyric acid (4HB), (table 3) by synthon.
The above results shows, in the presence of gamma-butyrolactone, and the formation (table 3) of 4 hydroxybutyric acid (HD) homopolymer P4HB.
Table 3.P.putida KTHH06 transforms the synthetic PHA of fatty acid biological.
Figure GSA00000104571300181
The structure of embodiment 4, strain Pseudomonas putida KTHH08 and biosynthesizing
One, the structure of strain Pseudomonas putida KTHH08
Bacterial strain has a liking for that the segmental nucleotide sequence of the protein-bonded encoding gene of PHA particle (phaP) is shown in sequence in the sequence table 6 in aqueous vapor sporangium (Aeromonas hydrophila) the 4AK4 genome, and bacterial strain is had a liking for the segmental nucleotide sequence of encoding gene (phaJ) of enoyl coenzyme A hydratase in aqueous vapor sporangium (Aeromonashydrophila) the 4AK4 genome shown in sequence in the sequence table 7; Bacterial strain is had a liking for the nucleotide sequence of polyhydroxyalkanoate (PHA) synthetase-coding gene (claiming pha synthesizing enzyme encoding gene, PHBHHx synthase gene or phaC gene again) in aqueous vapor sporangium (Aeromonas hydrophila) the 4AK4 genome shown in sequence in the sequence table 8.
Bacterial strain is had a liking for aqueous vapor sporangium (Aeromonas hydrophila) 4AK4 (van der Meer, J R, van Neerven, A R, de Vries, E J, et al.Cloning and characterization of plasmid-encoded genes forthe degradation of 1,2-dichloro-, 1,4-dichloro-, and 1,2,4-trichlorobenzene ofPseudomonas sp.strain P51.J Bacteriol 173 (1): 6-15 Jan 1991) (provide) by Tsing-Hua University.
(1) structure of plasmid pZWJ4-31
1) genomic dna with Aeromonas hydrophila 4AK4 is a template, under the guiding of primer P1:TTTGGTACCTGGAGACCGATGATGAATATGG and P2:ATGAATTCTTAAGGCAGCTTGACCACGG, 3 genes that pcr amplification links to each other comprise PHA particle binding-protein gene (phaP) fragment, PHBHHx synthase gene (phaC) fragment and enoyl coenzyme A hydratase gene (phaJ) fragment; With restriction enzyme KpnI and EcoRI pcr amplification product is carried out double digestion, reclaim the endonuclease bamhi that size is about 2.6kb; Contain following fusion fragment in the pcr amplification product: the fusion fragment that phaP fragment, phaC fragment and phaJ fragment connect and compose successively, merging segmental gene order is the sequence that sequence nucleotide sequence 6, sequence 8 and sequence 7 connect and compose successively; Described PHA particle binding-protein gene (phaP) is positioned at the upstream of described fusion gene, and described PHA synthase gene (phaC) is positioned at the middle reaches of described fusion gene, and described enoyl coenzyme A hydratase gene (phaJ) is positioned at the downstream of described fusion gene.
2) with restriction enzyme KpnI and EcoRI plasmid pBBR1-MCS2 is carried out double digestion, reclaim enzyme and cut big fragment;
3) with step 1) and step 2) the recovery fragment be connected with the T4DNA ligase enzyme, after ligation is finished, the method that connects product electricity consumption conversion is imported to E.coli S17-1 (ATCC numbering: 47055), transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h;
4) mono-clonal that on LB-Km solid culture flat board, grows of picking, it is inoculated in the LB-Km liquid nutrient medium, at 37 ℃, shaking table is cultivated 12h under the 200rpm, extract plasmid, and with restriction enzyme KpnI and EcoRI plasmid is carried out enzyme and cut evaluation, the result produces the dna fragmentation of size for 5.100kb and 2.643kb, the preliminary identification plasmid construction is correct, further carry out sequence verification, the fusion fragments sequence that the result records is correct, and fusion sequence is positioned between the KpnI and EcoRI of pBBR1-MCS2, the plasmid that shows structure is correct, merges make up correct containing with fragment (phaP fragment, phaC fragment and phaJ fragment) escherichia coli cloning carrier called after pZWJ4-31.
The E.coli S17-1 note that will contain plasmid pZWJ4-31 is made reorganization bacterium E.coli S17-1 (pZWJ4-31).
(2) structure of strain Pseudomonas putida KTHH08
1) the reorganization bacterium E.coli S17-1 (pZWJ4-31) that contains plasmid pZWJ4-31 that obtains in the picking step () is inoculated into it in LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm; Simultaneously with Pseudomonasputida KTOY08-G inoculation in the LB liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm; The nutrient solution of respectively getting the above-mentioned two kinds of bacterial strains of 0.5mL then is mixed in the same aseptic tubule, centrifugal 2 minutes of 8000rpm, abandoning supernatant, add the aseptic LB liquid nutrient medium of 1mL again, behind the resuspended bacterium, placed 30 ℃ of incubators 1 hour, and by method of scoring one ring mixed bacteria liquid was coated on the LB-Km-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h with the aseptic inoculation ring;
2) mono-clonal that on LB-Km-Amp solid culture flat board, grows of picking.
3) checking: from the mono-clonal that step (2) obtains, extract plasmid, and with restriction enzyme PstI plasmid is carried out enzyme and cut; The result obtains the dna fragmentation of size for 1754bp, 2087bp and 3902bp, and the plasmid that shows importing is pZWJ4-31.The mutant strain KTOY08-G called after Pseudomonas putida KTHH08 that will contain plasmid pZWJ4-31.
Two, transform the shake flat experiment that lipid acid is produced PHA with Pseudomonas putida KTHH08
Natrium valericum is available from Shanghai traditional Chinese medicines group.
(1) biosynthesizing
1) Pseudomonas putida KTHH08 is inoculated in the LB-Km liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm, ratio in 5% (V/V) is inoculated into bacterium liquid in the LB-Km liquid nutrient medium again, shaking table is cultivated 9h under 30 ℃, 200rpm, obtains containing the fermented liquid of Pseudomonas putida KTHH08;
2) natrium valericum is joined in the fermented liquid that contains Pseudomonas putida KTHH08 in the step 1), make that the concentration of natrium valericum is 5g/L in the fermented liquid, under 30 ℃, 200rpm, continue shaking table then and cultivate 39h, obtain the fermented liquid after the biosynthesizing.
3) method of acquisition thalline: with consistent described in the embodiment 1.
(2) product checking
Somatic cells dry weight in the fermented liquid after detection of biological is synthetic (CDW, g/L) and PHA content (wt%), form.
Cultivate and finish the back according to document (Ouyang, S.P.; Liu, Q.; Fang, L.; Chen, G.Q.Constructionof pha-Operon-Defined Knockout Mutants of Pseudomonas putida KT2442 and theirApplications in Poly (hydroxyalkanoate) Production.Macromol.Biosci.2007,7,227-233) described method: the pre-treating process of thalline is with consistent described in the embodiment 1.
1, homopolymer structure verification
The detection method that PHA forms: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis;
The molecular structural formula of homopolymer:
Figure GSA00000104571300191
Number-average molecular weight is 815 * 10 3(or weight-average molecular weight is 1056 * 10 to Da 3Da);
The nuclear magnetic resonance map of homopolymer HV is (a: poly-hydroxyl valerate proton nmr spectra as shown in Figure 3; B: poly-hydroxyl valerate carbon-13 nmr spectra).
2, PHA content detecting method: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis; The calculation formula of PHA content is with identical described in the embodiment 1.
The result: mutant strain KTOY08 is being under the culture condition of single carbon source with natrium valericum, can form the homopolymer that only contains 3-hydroxypentanoic acid (3HV), (table 4) by synthon.
The above results shows, in the presence of natrium valericum, and the formation (table 4) of 3-hydroxypentanoic acid (HV) homopolymer PHV.。
Table 4.P.putida KTHH08 transforms the synthetic PHA of fatty acid biological.
The structure of embodiment 5, strain Pseudomonas putida KTQQ20 and biosynthesizing
One, the structure of strain Pseudomonas putida KTQQ20
(1) structure of escherichia coli cloning carrier pKQQ12:
1) genomic dna with Pseudomonas putida KT2442 is a template, carry out pcr amplification with primer P1 and P2, obtain the upstream fragment (the upstream fragments sequence of PP2047 is shown in sequence in the sequence table 9) of 3-hydroxyl fatty acyl-CoA dehydrogenase gene PP2047; With restriction enzyme HindIII and PstI pcr amplification product is carried out double digestion, reclaim the endonuclease bamhi that size is about 430bp;
Genomic dna with Pseudomonas putida KT2442 is a template, carries out pcr amplification with primer P3 and P4, obtains the downstream fragment (the downstream fragment of PP2048 is shown in sequence in the sequence table 10) of fatty acyl-CoA dehydrogenase gene PP2048; With restriction enzyme PstI and BamHI pcr amplification product is carried out double digestion, reclaim the endonuclease bamhi that size is about 488bp;
P1：AAT AAGCTTGCGATGGCTGCGCTGA
P2：CAT CTGCAGGATTGATCGGGAAGGGA
P3：AAT CTGCAGCTAGCGCACGGCAAAC
P4：TGAT GGATCCTCCGAACCGGTACCTG
2) with restriction enzyme HindIII and PstI plasmid pK18mobSacB is carried out double digestion, reclaim enzyme and cut big fragment;
3) with the upstream fragment and step 2 of step 1)) the recovery fragment be connected with the T4DNA ligase enzyme, after ligation is finished, import to E.coli S17-1 (ATCC numbering: 47055) with connecting the method for product with chemical conversion, transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h;
4) mono-clonal that on LB-Km solid culture flat board, grows of picking, it is inoculated in the LB-Km liquid nutrient medium, shaking table is cultivated 12h under 37 ℃, 200rpm, extract plasmid, and with restriction enzyme PstI and HindIII plasmid is carried out enzyme and cut evaluation, positive plasmid can produce size and be the dna fragmentation of 430bp after enzyme is cut, with structure correct contain the segmental escherichia coli cloning carrier of PP2047 upstream PCR called after pKQQ12-1.
5) with restriction enzyme PstI ﹠amp; BamHI carries out enzyme to plasmid pKQQ12-1 and cuts, and reclaims the endonuclease bamhi of 6576bp;
6) the downstream fragment of step 1) and the recovery fragment of step 5) are connected with the T4DNA ligase enzyme, after ligation is finished, import to E.coli S17-1 (ATCC numbering: 47055) with connecting the method for product with chemical conversion, transformant is coated on the LB-Km solid culture flat board, in 37 ℃ of incubators, cultivated 12h; The mono-clonal that picking grows on LB-Km solid culture flat board.
7) checking: the mono-clonal that step 6) is obtained is inoculated in the LB-Km liquid nutrient medium, shaking table is cultivated 12h under 37 ℃, 200rpm, extract plasmid, and with restriction enzyme PstI and NcoI plasmid is carried out enzyme and cut evaluation, the result obtains the dna fragmentation of size for 1598bp and 5022bp; Plasmid is checked order, the result shows, DNA (being the downstream fragment of PP2048) shown in DNA shown in the sequence 9 (being the upstream fragment of PP2047) and the sequence 10 constitutes the fusion fragment, merging fragment (merging fragments sequence is that sequence 9 and sequence 10 merge the sequence that constitutes) is positioned between the HindIII and BamHI site of the carrier pK18mobSacB that sets out, proof plasmid structure is correct, will make up the correct two sections segmental escherichia coli cloning carrier of PCR called after pKQQ12 that contain PP2047 upstream and PP2048 downstream.DNA shown in the sequence 9 in the described sequence table (PP2047 upstream fragment) is positioned at the upstream of described fusion gene, and DNA shown in the sequence 10 in the described sequence table (PP2048 downstream fragment) is positioned at the downstream of described fusion gene.
(2) knock out PP2047 and PP2048 gene among the Pseudomonas putida KTOY08-G by suicide plasmid pKQQ12
1) the reorganization bacterium E.coli S17-1 (pKQQ12) that contains plasmid pKQQ12 that obtains in the picking step () is inoculated into it in LB-Km liquid nutrient medium, and shaking table is cultivated 12h under 37 ℃, 200rpm; Simultaneously with Pseudomonas putidaKTOY08-G inoculation in the LB liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm; The nutrient solution of respectively getting the above-mentioned two kinds of bacterial strains of 0.5mL then is mixed in the same aseptic tubule, centrifugal 2 minutes of 8000rpm, abandoning supernatant, add the aseptic LB liquid nutrient medium of 1mL again, behind the resuspended bacterium, placed 30 ℃ of incubators 1 hour, and by method of scoring one ring mixed bacteria liquid was coated on the LB-Km-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h with the aseptic inoculation ring;
2) mono-clonal that grows on LB-Km-Amp solid culture flat board of picking is seeded to it in LB-Amp liquid nutrient medium, and shaking table is cultivated 24h under 30 ℃, 200rpm;
3) with the aseptic inoculation ring by method of scoring with one the ring 2) in the bacterium liquid that obtains coat on the LBS-Amp solid culture flat board, in 30 ℃ of incubators, cultivate 24h;
4) 3) in LBS-Amp solid culture flat board on 20 single bacterium colonies of picking, numbering, and in order each single bacterium colony being seeded in respectively on the dull and stereotyped and LB-Km solid culture flat board of LBS-Amp solid culture is cultivated 24h in 30 ℃ of incubators.
5) the picking previous step can only grow on LBS-Amp solid culture flat board in rapid and the single bacterium colony that can not grow on LB-Km solid culture flat board the while.
6) checking: single bacterium colony that step 5) is obtained is seeded to respectively in the LB-Amp liquid nutrient medium, and shaking table is cultivated 24h under 30 ℃, 200rpm; The nutrient solution that obtains is respectively got 1ml, and is centrifugal, removes supernatant, resuspended with the 200ul sterilized water.Resuspended bacterium liquid was placed boiling water bath 10 minutes.After the cooling, be template, under the guiding of primer P1:AATAAGCTTGCGATGGCTGCGCTGA and P4:TGATGGATCCTCCGAACCGGTA CCTG, carry out pcr amplification with this bacterium liquid.Pcr amplification product is checked order.The fusion fragment of DNA (being the downstream fragment of PP2048) shown in DNA (being the upstream fragment of PP2047) shown in the sequence that records and the sequence 9 and the sequence 10 is compared, the result is mated fully, illustrate that homologous recombination has taken place the PP2047 gene in DNA shown in the sequence 9 and the Pseudomonas putidaKTOY08-G genome, homologous recombination has taken place in the PP2048 gene in DNA shown in the sequence 10 and the Pseudomonas putidaKTOY08-G genome, and most of fragment of the PP2047 gene in the Pseudomonas putida KTOY08-G genome and most of fragment of PP2048 gene are knocked out.With most of fragment of most of fragment of PP2047 gene and PP2048 gene by the Pseudomonas putida KTOY08-G called after Pseudomonasputida KTQQ20 after knocking out.
Two, transform the shake flat experiment that lipid acid is produced PHA with Pseudomonas putida KTQQ20
Sodium decanoic acid is available from Shanghai traditional Chinese medicines group; Lauric acid (dodecylic acid) is available from Shantou brilliance chemical reagent work; And myristic acid (tetradecanoic acid) is available from Shanghai traditional Chinese medicines group;
(1) biosynthesizing
1) Pseudomonas putida KTQQ20 is inoculated in the LB-Km liquid nutrient medium, shaking table is cultivated 12h under 30 ℃, 200rpm, ratio in 5% (V/V) is inoculated into bacterium liquid in the LB-Km liquid nutrient medium again, shaking table is cultivated 9h under 30 ℃, 200rpm, obtains containing the fermented liquid of Pseudomonas putida KTQQ20;
2) respectively Sodium decanoic acid, lauric acid (dodecylic acid) and myristic acid (tetradecanoic acid) are joined in the fermented liquid that contains Pseudomonas putida KTQQ20 in the step 1), make that the concentration of Sodium decanoic acid in the fermented liquid is that the concentration of 2g/L, lauric acid (dodecylic acid) is that the concentration of 6g/L, myristic acid (tetradecanoic acid) is 4g/L, under 30 ℃, 200rpm, continue shaking table then and cultivate 39h, obtain the fermented liquid after the biosynthesizing.
The adding mode of lauric acid and myristic acid: behind yeast culture 12h in the disposable adding substratum;
The adding mode of Sodium decanoic acid: being divided equally into twice adding, is behind yeast culture 12h for the first time, is for the second time after adding 12h for the first time.；
3) method of acquisition thalline: with consistent described in the embodiment 1.
(2) product checking
Somatic cells dry weight in the fermented liquid after detection of biological is synthetic (CDW, g/L) and PHA content (wt%), form.
Cultivate and finish the back according to document (Ouyang, S.P.; Liu, Q.; Fang, L.; Chen, G.Q.Constructionof pha-Operon-Defined Knockout Mutants of Pseudomonas putida KT2442 and theirApplications in Poly (hydroxyalkanoate) Production.Macromol.Biosci.2007,7,227-233) described method: the pre-treating process of thalline is with consistent described in the embodiment 1.
1, with the Sodium decanoic acid carbon source, the checking of the product that obtains
(1) homopolymer structure verification
The detection method that PHA forms: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis;
The molecular structural formula of homopolymer:
Figure GSA00000104571300221
Number-average molecular weight is 248.6 * 10 3(or weight-average molecular weight is 361.4 * 10 to Da 3Da); The nuclear magnetic resonance map of homopolymer PHD is (a: poly-hydroxydecanoic acid ester proton nmr spectra as shown in Figure 6; B: poly-hydroxydecanoic acid ester carbon-13 nmr spectra).
(2) PHA content detecting method: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis; The calculation formula of PHA content is with consistent described in the embodiment 1.
The result: mutant strain KTOY08 is being under the culture condition of single carbon source with Sodium decanoic acid, can form the homopolymer that only contains 3-hydroxydecanoic acid (3HD), (table 5) by synthon.
2, with the lauric acid carbon source, the checking of the product that obtains
(1) copolymer structure checking
The detection method that PHA forms: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis;
The molecular structural formula of multipolymer:
Figure GSA00000104571300231
Number-average molecular weight is 119.4 * 10 3(or weight-average molecular weight is 155.5 * 10 to Da 3Da);
(2) PHA content detecting method: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis; The calculation formula of PHA content is with consistent described in the embodiment 2.
The result: mutant strain KTOY08 is being under the culture condition of single carbon source with lauric acid, can form the multipolymer that contains 3-hydroxydecanoic acid (3HD) and 3-hydroxyl dodecanoic acid (3HDD), (table 5) by synthon.
3, with the myristic acid carbon source, the checking of the product that obtains
(1) homopolymer structure verification
The detection method that PHA forms: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis;
The molecular structural formula of homopolymer:
Weight-average molecular weight is＞50 * 10 3Da;
(2) PHA content detecting method: gas chromatographic analysis and NMR (Nuclear Magnetic Resonance) analysis;
The calculation formula of PHA content is with consistent described in the embodiment 2.
The result: mutant strain KTOY08 is being under the culture condition of single carbon source with myristic acid, can form the multipolymer that contains 3-hydroxyl dodecanoic acid (3HDD) and 3-hydroxy tetradecanoic acid (3HTD), (table 5) by synthon.
The above results shows that in the presence of capric acid, laurostearic acid and TETRADECONIC ACID, 3-hydroxydecanoic acid (HD) homopolymer PHD and 3-hydroxy tetradecanoic acid (HTD) homopolymer PHTD form (table 5) respectively.
Table 5.P.putida KTQQ20 transforms the synthetic PHA of fatty acid biological.
Figure GSA00000104571300241
" ND " expression does not detect numerical value.
Sequence table
＜110〉Tsing-Hua University
＜120〉a kind of method and special bacterium thereof for preparing hydroxyalkanoate homopolymer
<160>11
<210>1
<211>509
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>1
gctgaacccg?gatggcagca?tcagcttcgt?tggccgtagc?gacgacgtga?tcaccacctc 60
cggttaccgt?gtggggccat?tcgatgtgga?aagcgcgttg?atcgagcacc?cggcggtgat 120
cgaggcagcg?gtgatcggca?agcccgaccc?ggagcgtacc?gagctgatca?aggcgttcgt 180
ggtattggcc?agcggctacg?ccggcagcgt?cgagctggaa?gaaaccttgc?gccagcatgt 240
gcgccagcgc?ctctacgcgc?atgcctaccc?cagggaaatc?gaattcgtca?gcgagctgcc 300
caagaccccg?agcggcaagc?tgcaacgctt?catcctgcgc?aaccaggaag?tcgccaaaca 360
acaagcgcaa?caggccaccc?ctgccagcgt?ctgaaaggaa?agtactcatg?cacatagcca 420
ataaacattt?catcgtcagc?ggcgccgctt?ccgggctggg?tgccgcgact?gcacagatgc 480
tggtcgaggc?tggcgccaag?gtcatgctg 509
 
<210>2
<211>557
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>2
ctgttcgaga?tcaacgaggc?cttcgccgtg?gtcaccctgg?cggccatgaa?acacctcgac 60
ctgccacacg?acaaggtcaa?tatccacggc?ggcgcctgcg?ccctcggtca?cccgatcggc 120
gcttctggcg?cacgtattct?ggtcaccctg?ttgtcggcct?tgcgccagaa?caatctgcgt 180
cggggtgtgg?cggccatctg?catcggcggt?ggcgaggcca?cggccatggc?tgttgaatgc 240
ctgtactgag?gtgaaccatg?ctggtaaatg?acgagcaaca?acagatcgcc?gacgcggtac 300
gtgcgttcgc?ccaggaacgc?ctgaagccgt?ttgccgagca?atgggacaag?gaccatcgct 360
tcccgaaaga?ggccatcgac?gagatggccg?aactgggcct?gttcggcatg?ctggtgccgg 420
agcagtgggg?cggtagcgac?accggttatg?tggcctatgc?catggccttg?gaggaaatcg 480
ctgcgggcga?tggcgcctgc?tcgaccatca?tgagcgtgca?caactcggtg?ggttgcgtgc 540
cgatcctgcg?cttcggc 557
 
<210>3
<211>921
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>3
tatcgtgaac?tgacggccaa?tgagatagcc?actgtctagg?ccgtgacaga?cagcccgtgt?60
cgtcatacga?ccgctcagcg?acaaaagtca?cattacttac?cgaacggcac?ttgcgcgatc?120
cccaacccac?tgcttgaatc?caaatcgtca?gtctgcatgt?gactaccaag?tcacacctgc?180
agccgatgac?actttttgcc?ggccacccaa?agcctagatg?ccttggggca?cggcaaattg?240
cccgccaaaa?acaataccgt?cgacgcaagt?gccaaggatc?gacacagggc?ccccggatta?300
tcttcaggca?aatgcctacc?tgtcataaag?aacgtgcacc?ctaggtgacg?cgaataccct?360
ttttgcgcca?ggagtcgatg?acatgaggcc?agaaatcgct?gtacttgata?tccaaggtca?420
gtatcgggtt?tacacggagt?tctatcgcgc?aagcatgtgg?gcagaagcca?gttcagcgtg?480
atccgcgatg?cgggccactt?cctggacatg?gagaacaaga?ccgcctgcga?gaacacccgc?540
aatgtcatgc?tggcttcctc?aagccaaccg?tgcgtgaacc?ccgccaacgt?taccaacccg?600
tgcagcaggg?gcagcatgca?tttgccatct?gagcggctcg?cgccttgtag?ccaatacccg?660
caggccacgg?ggcgccgaca?agctttttta?taacttgggc?ttctaattcg?ctgaaggttc?720
tggtaaaaag?tcgagctcag?atgcgggtat?agtttagtgg?caaaacgaaa?gcttcccaag?780
ctttagttga?gggttcgatt?ccctctaccc?gctccacatc?gcagtcccgc?atggcgttcc?840
agcaacgtca?tcgcagtcaa?aaggagcctt?ggctcctttt?ttcgtttttc?atcctgcctt?900
gacctggccc?atg 913
<210>4
<211>1767
<212>DNA
＜213〉the true bacteria of Luo Shi (Ralstonia eutropha)
<400>4
atggcgaccg?gcaaaggcgc?ggcagcttcc?acgcaggaag?gcaagtccca?accattcaag 60
gtcacgccgg?ggccattcga?tccagccaca?tggctggaat?ggtcccgcca?gtggcagggc 120
actgaaggca?acggccacgc?ggccgcgtcc?ggcattccgg?gcctggatgc?gctggcaggc 180
gtcaagatcg?cgccggcgca?gctgggtgat?atccagcagc?gctacatgaa?ggacttctca 240
gcgctgtggc?aggccatggc?cgagggcaag?gccgaggcca?ccggtccgct?gcacgaccgg 300
cgcttcgccg?gcgacgcatg?gcgcaccaac?ctcccatatc?gcttcgctgc?cgcgttctac 360
ctgctcaatg?cgcgcgcctt?gaccgagctg?gccgatgccg?tcgaggccga?tgccaagacc 420
cgccagcgca?tccgcttcgc?gatctcgcaa?tgggtcgatg?cgatgtcgcc?cgccaacttc 480
cttgccacca?atcccgaggc?gcagcgcctg?ctgatcgagt?cgggcggcga?atcgctgcgt 540
gccggcgtgc?gcaacatgat?ggaagacctg?acacgcggca?agatctcgca?gaccgacgag 600
agcgcgtttg?aggtcggccg?caatgtcgcg?gtgaccgaag?gcgccgtggt?cttcgagaac 660
gagtacttcc?agctgttgca?gtacaagccg?ctgaccgaca?aggtgcacgc?gcgcccgctg 720
ctgatggtgc?cgccgtgcat?caacaagtac?tacatcctgg?acctgcagcc?ggagagctcg 780
ctggtgcgcc?atgtggtgga?gcagggacat?acggtgtttc?tggtgtcgtg?gcgcaatccg 840
gacgccagca?tggccggcag?cacctgggac?gactacatcg?agcacgcggc?catccgcgcc 900
atcgaagtcg?cgcgcgacat?cagcggccag?gacaagatca?acgtgctcgg?cttctgcgtg 960
ggcggcacca?ttgtctcgac?cgcgctggcg?gtgctggccg?cgcgcggcga?gcacccggcc 1020
gccagcgtca?cgctgctgac?cacgctgctg?gactttgccg?acacgggcat?cctcgacgtc 1080
tttgtcgacg?agggccatgt?gcagttgcgc?gaggccacgc?tgggcggcgg?cgccggcgcg 1140
ccgtgcgcgc?tgctgcgcgg?ccttgagctg?gccaatacct?tctcgttctt?gcgcccgaac 1200
gacctggtgt?ggaactacgt?ggtcgacaac?tacctgaagg?gcaacacgcc?ggtgccgttc 1260
gacctgctgt?tctggaacgg?cgacgccacc?aacctgccgg?ggccgtggta?ctgctggtac 1320
ctgcgccaca?cctacctgca?gaacgagctc?aaggtaccgg?gcaagctgac?cgtgtgcggc 1380
gtgccggtgg?acctggccag?catcgacgtg?ccgacctata?tctacggctc?gcgcgaagac 1440
catatcgtgc?cgtggaccgc?ggcctatgcc?tcgaccgcgc?tgctggcgaa?caagctgcgc 1500
ttcgtgctgg?gtgcgtcggg?ccatatcgcc?ggtgtgatca?acccgccggc?caagaacaag 1560
cgcagccact?ggactaacga?tgcgctgccg?gagtcgccgc?agcaatggct?ggccggcgcc 1620
atcgagcatc?acggcagctg?gtggccggac?tggaccgcat?ggctggccgg?gcaggccggc 1680
gcgaaacgcg?ccgcgcccgc?caactatggc?aatgcgcgct?atcgcgcaat?cgaacccgcg 1740
cctgggcgat?acgtcaaagc?caaggca 1767
 
<210>5
<211>1290
<212>DNA
＜213〉Ke Shi clostridium (Clostridium kluyveri)
<400>5
atggagtggg?aagagatata?taaagagaaa?ctggtaactg?cagaaaaagc?tgtttcaaaa 60
atagaaaacc?atagcagggt?agtttttgca?catgcagtag?gagaacccgt?agatttagta 120
aatgcactag?ttaaaaataa?ggataattat?ataggactag?aaatagttca?catggtagct 180
atgggcaaag?gtgaatatac?aaaagagggt?atgcaaagac?attttagaca?taatgcttta 240
tttgtaggcg?gatgtactag?agatgcagta?aattcaggaa?gagcagatta?tacaccttgt 300
tttttctatg?aagtgccaag?tttgtttaaa?gaaaaacgtt?tgcctgtaga?tgtagcactt 360
attcaggtaa?gtgagccaga?taaatatggc?tactgcagtt?ttggagtttc?caatgactat 420
accaagccag?cagcagaaag?tgctaagctt?gtaattgcag?aagtgaataa?aaacatgcca 480
agaactcttg?gagattcttt?tatacatgta?tcagatattg?attatatagt?ggaagcttca 540
cacccattgt?tagaattgca?gcctcctaaa?ttgggagatg?tagaaaaagc?cataggagaa 600
aactgtgcat?ctttaattga?agatggagct?actcttcagc?ttggaatagg?tgctatacca 660
gatgcggtac?ttttattctt?aaagaacaaa?aagaatttag?gaatacattc?tgagatgata 720
tcagatggtg?tgatggaact?ggtgaaggca?ggggttatca?ataacaagaa?aaagaccctc 780
catccaggca?aaatagttgt?aacattttta?atgggaacaa?aaaaattata?tgattttgta 840
aacaataatc?caatggtaga?aacttattct?gtagattatg?taaataatcc?actggtaatt 900
atgaaaaatg?acaatatggt?ttcaataaat?tcttgtgttc?aagtagactt?aatgggacaa 960
gtatgttctg?aaagtatagg?attgaaacag?ataagtggag?tgggaggcca?ggtagatttt 1020
attagaggag?ctaatctatc?aaagggtgga?aaggctatta?tagctatacc?ttccacagct 1080
ggaaaaggaa?aagtttcaag?aataactcca?cttctagata?ctggtgctgc?agttacaact 1140
tctagaaatg?aagtagatta?tgtagttact?gaatatggtg?ttgctcatct?taagggcaaa 1200
actttaagaa?atagggcaag?agctctaata?aatatcgctc?atccaaaatt?cagagaatca 1260
ttaatgaatg?aatttaaaaa?gagattttag 1290
 
<210>6
<211>348
<212>DNA
＜213〉have a liking for aqueous vapor sporangium (Aeromonas hydrophila)
<400>6
atgaatatgg?acgtgatcaa?gagctttacc?gagcagatgc?aaggcttcgc?cgcccccctc 60
acccgctaca?accaactgct?ggccagcaac?atcgagcagc?tgacccggtt?gcagctggcc 120
tccgccaacg?cctacgccga?actgggcctc?aaccagttgc?aggccgtgag?caaggtgcag 180
gacacccaga?gtctggctgc?cctcggcaca?gtgcagctgg?agaccgccag?ccagctctcc 240
cgccagatgc?tggacgacat?ccagaagctg?agcgccctcg?gccagcagtt?caaggaagag 300
ctggatgtcc?tgaccgcgga?cggcatcaag?aagagcacgg?gcaaggcc 348
<210>7
<211>405
<212>DNA
＜213〉have a liking for aqueous vapor sporangium (Aeromonas hydrophi la)
<400>7
atgagcgcac?aaccccttga?agtgggccag?aaggcccgtc?tcagcaagcg?gttcggggcg 60
gcagaggtgg?ccgccttcgc?cgcgctctcg?gaggatttca?accctctgca?ccttgatccg 120
gccttcgccg?ccaccacggc?gttcgagcga?cccatcgtcc?acggcatgct?gctggccagc 180
ctcttctccg?ggctgctggg?ccagcagttg?ccgggcaagg?ggagcatcta?tctgggccag 240
agcctcagct?tcaagctgcc?ggtctttgtc?ggggatgagg?tgacggccga?ggtggaggtg 300
accgcccttc?gcagcgacaa?gcccatcgcc?accctgacca?cccgcatctt?cacttcaaac 360
ggcgccctcg?ccgtgacggg?ggaagccgtg?gtcaagctgc?cttaa 405
 
<210>8
<211>1782
<212>DNA
＜213〉have a liking for aqueous vapor sporangium (Aeromonas hydrophila)
<400>8
atgagccaac?catcttatgg?cccgctgttc?gaggccctgg?cccactacaa?tgacaagctg 60
ctggccatgg?ccaaggccca?gacagagcgc?accgcccagg?cgctgctgca?gaccaatctg 120
gacgatctgg?gccaggtgct?ggagcagggc?agccagcagc?cctggcagct?gatccaggcc 180
cagatgaact?ggtggcagga?tcagctcaag?ctgatgcagc?acaccctgct?gaaaagcgca 240
ggccagcaga?gcgagccggt?gatcaccccg?gagcgcagcg?atcgccgctt?caaggccgag 300
gcctggagcg?aacaacccat?ctatgactac?ctcaagcagt?cctacctgct?caccgccagg 360
cacctgctgg?cctcggtgga?tgccctggac?ggcgtccccc?agaagagccg?ggagcggctg 420
cgtttcttca?cccgtcagta?cgtcaacgcc?atggcaccca?gcaacttcct?ggccaccaac 480
ccggagctgc?tcaagctcac?cctggagtcc?gacggccaga?acctggtgcg?cgggctggcc 540
ctcttggccg?aggatctgga?gcgcagcgcc?gatcagctca?acatccgcct?gaccgacgaa 600
tccgccttcg?agctcggccg?ggatctggcg?accaccccgg?gccgggtggt?gcagcgcacc 660
gagctctatg?agctgatcca?gtacagcccc?accacggaaa?ccgtgggcaa?gacgcctgtg 720
ctgatcgtgc?cccccttcat?caacaagtac?tacatcatgg?acatgcggcc?ccagaactcc 780
ctggtcgcct?ggctggtcgc?ccagggccag?acggtgttca?tgatctcctg?gcgcaacccg 840
agcgtagccc?aggcccaaat?cgatctcgac?gactacgtgg?tggatggcgt?catcgccgcc 900
ctggacggcg?tggaagcggc?caccggcgag?cgggaggtgc?acggcatcgg?ctactgcatc 960
ggcggcaccg?ccctgtcgct?cgccatgggc?tggctggcgg?cgcggcgcca?gaagcagcgg 1020
gtgcgcactg?ccaccctgtt?caccaccctg?ctggacttct?cccagccagg?ggagcttggc 1080
atcttcattc?acgagcccat?catagcggcg?ctcgaggcgc?aaaatgaggc?caagggcatc 1140
atggacgggc?gccagctggc?tgtctctttc?agcctgctgc?gggagaacag?cctctactgg 1200
aactactaca?tcgacagcta?cctcaagggt?cagagcccgg?tggccttcga?tctgctgcac 1260
tggaacagcg?acagcaccaa?tgtggcgggc?aagacccaca?acagcctggt?gcgccgtctc 1320
tatctggaga?accagctggt?gaagggggag?ctcaagatcc?gcaacacccg?catcgatctt 1380
ggcaaggtga?agacccctgt?gctgctggtg?tcggcggtgg?acgatcacat?cgccctctgg 1440
cagggcacct?ggcagggcat?gaagctgttt?ggcggggagc?agcgcttcct?cctggcagag 1500
tccggccaca?tcgccggcat?catcaacccg?ccggtcgcca?acaagtacgg?cttctggcac 1560
aacggggccg?aggccgatag?cccggagagc?tggctggcag?gggcgacgca?tcagagcggc 1620
tcctggtggc?ccgagatgat?gggctttatc?cagagccgtg?acgaagggtc?agagcccgtc 1680
cccgcacggg?tgcccgagga?ggggctggcc?cccgcccccg?gccactatgt?caaggtgcgg 1740
ctcaaccccg?tgtttgccag?cgccacagag?gaggacgccg?ca 1782
 
<210>9
<211>430
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>9
cagctggcga?tggctgcgct?gaggctcgaa?accatcgccg?gtgcccagcg?tctgctcgat 60
ctgctgtaac?gccgcacgta?tcggcccctc?cagtgccaag?gcccgtggcg?tcgggcgcat 120
gcgccggccc?acgcggacca?gcagcgggtc?acccagctgg?tcacgcaggc?gcgccagggc 180
attgctcacg?gtcggctggg?tcagggccag?acgctcggct?gcccgggata?cattctgttc 240
acgcagcaac?atgtcgaaga?cgcgcagcag?gttcaggtcg?aagttcgaaa?tattcatgct 300
gaaaatatat?ggcatacgaa?atggaaattt?caaaaatacc?ttcggcctgc?ttagggtgat 360
cacagtcctc?atacctacaa?gaaagcagga?gcgttgcgcg?tgaatactcc?cttcccgatc 420
aatcaggtgg 430
 
<210>10
<211>488
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>10
cgcgttctag?cgcacggcaa?accacacgaa?caaggagagt?gcgatgcagc?ctttcagctt 60
tgccaccact?gcgcagatcc?tctgcgaacc?cggcgcggtg?cagcgccttg?caggtctgtg 120
ccgtgagcgc?ggtgccaagc?gtgttttgat?tatcagtgac?ccgggtatcg?cccgccttgg 180
catgctcgat?gacctgctgc?cggggttcac?ggcagccaag?gtcggtgtgg?cgatcttcag 240
tgaggttacg?gccgacccca?gcgaggcatg?cgtgctggcg?gccgcccagc?gcgcccggca 300
tatcggcgcc?gacctggtgg?tggggttcgg?cggcggcagc?tcgatggatg?tggccaagct 360
ggttgcgctg?ctggcccacc?gcgattgttc?gcagcccatc?gccgagctgt?acggcatcga 420
cagggccaag?ggccgccggc?tgccgttgat?ccaggtgccc?accacggcag?gtaccggttc 480
ggaggtga 488
<210>11
<211>2784
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>11
ctagagcaga?tgatggcctt?cgagactgcc?aagggcttcg?tcgctggcca?ggccggcccg 60
aactacccgg?ccccggtcga?agcgatcaag?agcatccaga?aagccgccaa?cttcggtcgc 120
gacaaggccc?tggaagtcga?agccgcaggc?tttgccaagc?tggccaagac?ctctgtcgcc 180
gagagcctga?tcggcttgtt?cctcaacgat?caggaactca?agcgcaaggc?caaggcgcat 240
gacgagatcg?cccacgacgt?gaagcaggcc?gccgtgctcg?gcgccggcat?catgggcggc 300
ggtatcgcct?accagtcggc?ggtcaaaggt?acgccgatcc?tgatgaagga?catccgcgag 360
gaagccattc?agctgggtct?gaacgaggcc?tccaagttgc?ttggcaaccg?cgtcgagaag 420
ggccgcctga?ccccggccaa?gatggccgag?gccctcaacg?ccattcgccc?gaccctgtcc 480
tatggcgatt?tcgccaatgt?cgacatcgtc?gtcgaggctg?tggtcgagaa?cccgaaggtc 540
aagcaagcgg?tactggcgga?agtggaaggc?caggtgaagg?acgatgcgat?cctcgcttcc 600
aacacctcta?ccatctccat?caacctgctg?gccaaggcgc?tcaagcgccc?ggaaaacttc 660
gtcggcatgc?acttcttcaa?cccggtgcac?atgatgccgc?tggttgaagt?gatccgtggc 720
gagaagtcca?gtgacgtggc?ggtcgccacc?accgtggcct?acgccaagaa?aatgggcaag 780
aacccgatcg?tggtcaacga?ctgcccgggc?tttttggtca?accgcgtgct?gttcccgtac 840
tttggcggtt?ttgccaagct?ggtcagcgcc?ggtgtcgact?tcgtgcgcat?cgacaaggtc 900
atggagaagt?tcggctggcc?gatgggccca?gcctacttga?tggacgtggt?cggcatcgac 960
accggccacc?acggccgtga?cgtcatggcc?gaaggcttcc?cggatcgcat?gaaggacgag 1020
cgccgctcgg?cagtcgacgc?gttgtacgag?gccaaccgcc?tgggccagaa?gaacggtaag 1080
ggcttctacg?cctacgaaac?cgacaagcgc?ggcaagccga?agaaggtctt?cgatgccacc 1140
gtgctcgacg?tgctcaaacc?gatcgtgttc?gagcagcgtg?aagtcactga?cgaagacatc 1200
atcaactgga?tgatggtccc?gctgtgcctt?gagaccgtgc?gttgcctgga?agacggcatc 1260
gtcgaaaccg?ctgccgaagc?cgacatgggc?ctggtctacg?gcattggttt?ccctcccttc 1320
cgcggtggtg?cgctgcgtta?catcgactcg?atcggtgtgg?ccgaattcgt?cgccctggcc 1380
gatcagtatg?ccgacctggg?gccgctgtac?cacccgaccg?ccaagctgcg?tgaaatggcc 1440
aagaacggcc?agcgcttctt?caactgagcg?gtcaacgagc?tagagcgaga?gatttgatat 1500
gagcctgaat?ccaagagacg?tggtgattgt?cgacttcggt?cgcacgccaa?tgggccgctc 1560
caagggtggc?atgcaccgca?acacccgcgc?cgaagacatg?tcggcgcacc?tgatcagcaa 1620
gctgctggaa?cgcaacggca?aggtcgaccc?gaaagaagtc?gaggacgtga?tctggggctg 1680
cgtcaaccag?accctggagc?agggctggaa?catcgcccgc?atggcttcgc?tgatgacccc 1740
gatcccgcac?acctctgcgg?cgcagaccgt?cagccgcctg?tgcggctcgt?ccatgagcgc 1800
gctgcacacg?gccgcccagg?cgatcatgac?cggtaacggt?gatgtgttcg?tggtcggtgg 1860
cgtggagcac?atgggccacg?tcagcatgat?gcatggcgta?gaccccaacc?cgcacctgtc 1920
cttgcatgcc?gccaaggctt?ccgggatgat?gggcctgact?gcagaaatgc?tcggcaagat 1980
gcacggcatc?acccgtgagc?agcaggacct?gttcggcttg?cgttcgcacc?agctggccca 2040
caaggccacg?gtcgaaggca?agttcaagga?cgagatcatc?ccgatgcagg?gctacgacga 2100
gaacggcttc?ctgaaggtgt?tcgatttcga?cgaaaccatt?cgcccggaaa?ccaccctcga 2160
aggcctggca?tcgctcaagc?ctgcgttcaa?cccgaaaggc?ggtacggtca?cggccggtac 2220
ctcgtcgcag?atcaccgacg?gcgcctcgtg?catgatcgtc?atgtccggtc?agcgtgccat 2280
ggacctcggt?atccagccat?tggcggtgat?ccgttcgatg?gcagtggccg?gtgtcgaccc 2340
ggcaatcatg?ggctacggcc?cggtgccatc?gacccagaaa?gccctcaagc?gtgcgggctt 2400
gaccatggcc?gatatcgact?tcatcgagct?caacgaagcc?ttcgctgcgc?aggccctgcc 2460
cgtgctgaaa?gacttgaaag?tgctcgacaa?gatggatgag?aaggttaacc?tgcacggcgg 2520
cgccattgct?ttgggccacc?cgttcggttg?ctccggggcg?cggatttccg?gcaccctgct 2580
caacgtcatg?aagcaaaatg?gcggtacgct?gggtgttgcg?accatgtgcg?tcggcctggg 2640
ccaaggtatc?accactgtct?tcgaacgcgt?ctgatcgcgt?agcgggacag?cagccggggc 2700
ctagtgcccc?ggttttgttt?tttcaggttt?ttttcaggag?gtgtgcaaca?tgcagataca 2760
accaggcgta?taccggcatt?acaa 2784

Claims (10)

1. recombinant pseudomonas putida is as following 1), 2), 3), 4) or 5) shown in:
1) described recombinant pseudomonas putida is according to the preparation of the method that comprises the steps: use the 3-hydroxyl fatty acyl-CoA dehydrogenase encoding gene in the pseudomonas that stinks of and the encoding function forfeiture of 3-keto acyl coenzyme A thiolase encoding gene, obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida I;
2) described recombinant pseudomonas putida is to prepare according to the method that comprises the steps: make the encoding function forfeiture of the 3-hydroxyl acyl lipophorin thiophorase encoding gene among the described recombinant pseudomonas putida I, obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida II;
3) described recombinant pseudomonas putida is to prepare according to the method that comprises the steps: import Poly-synthetase-coding gene and 4-maloyl group thiophorase encoding gene in described recombinant pseudomonas putida II, obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida III;
4) described recombinant pseudomonas putida is to prepare according to the method that comprises the steps: the encoding gene and the pha synthesizing enzyme encoding gene that import the protein-bonded encoding gene of PHA particle, enoyl coenzyme A hydratase in described recombinant pseudomonas putida II, obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida IV;
5) described recombinant pseudomonas putida is according to the preparation of the method that comprises the steps: make the encoding function forfeiture of the encoding gene of the encoding gene of the 3-hydroxyl fatty acyl-CoA dehydrogenase among the described recombinant pseudomonas putida II and fatty acyl-CoA dehydrogenase, obtain recombinant pseudomonas putida, note is made recombinant pseudomonas putida V.
2. recombinant pseudomonas putida according to claim 1 is characterized in that:
Described 1) shown in the recombinant pseudomonas putida, describedly uses 3-hydroxyl fatty acyl-CoA dehydrogenase encoding gene in the pseudomonas that stinks of and the encoding function forfeiture of 3-keto acyl coenzyme A thiolase encoding gene realizes by homologous recombination; The method of described homologous recombination comprises the steps: in the described pseudomonas putida that sets out to import in the sequence table DNA shown in the sequence 2 among the DNA shown in the sequence 1 and sequence table, the encoding gene generation homologous recombination of the 3-hydroxyl fatty acyl-CoA dehydrogenase in the described sequence table in DNA shown in the sequence 1 and the described pseudomonas putida that sets out, the encoding gene generation homologous recombination of the 3-keto acyl coenzyme A thiolase in the described sequence table in DNA shown in the sequence 2 and the described pseudomonas putida that sets out obtains described recombinant pseudomonas putida I;
Described 2) shown in the recombinant pseudomonas putida, described the encoding function forfeiture of the 3-hydroxyl acyl lipophorin thiophorase encoding gene among the described recombinant pseudomonas putida I is realized by homologous recombination; The method of described homologous recombination comprises the steps: to import DNA shown in the sequence 3 in the sequence table in described recombinant pseudomonas putida I, the encoding gene generation homologous recombination of the 3-hydroxyl acyl lipophorin thiophorase in the described sequence table among DNA shown in the sequence 3 and the described recombinant pseudomonas putida I obtains described recombinant pseudomonas putida II;
Described 3) in the recombinant pseudomonas putida, described Poly-synthetase-coding gene and 4-maloyl group thiophorase encoding gene import by recombinant vectors shown in;
Described recombinant vectors is prepared as follows and obtains: plasmid pKSSE5.3 is carried out enzyme with restriction enzyme BamHI and EcoRI cut, reclaim big fragment, note is made big fragment I; Carrier pBBR1-MCS2 is carried out enzyme with restriction enzyme BamHI and EcoRI cut, reclaim the big fragment of carrier, note is made big fragment II; Described big fragment I is connected with described big fragment II, obtains described recombinant vectors;
Described 4) in the recombinant pseudomonas putida, the encoding gene and the pha synthesizing enzyme encoding gene of the protein-bonded encoding gene of described PHA particle, enoyl coenzyme A hydratase import by recombinant vectors shown in; Described recombinant vectors is that KpnI and EcoRI site that the fusion gene that the encoding gene of the protein-bonded encoding gene of described PHA particle, pha synthesizing enzyme encoding gene and enoyl coenzyme A hydratase constitutes inserts carrier pBBR1-MCS2 are obtained; The protein-bonded encoding gene of described PHA particle is positioned at the upstream of described fusion gene, and described pha synthesizing enzyme encoding gene is positioned at the middle reaches of described fusion gene, and the encoding gene of described enoyl coenzyme A hydratase is positioned at the downstream of described fusion gene;
Described 5) shown in the recombinant pseudomonas putida, the encoding function forfeiture of the encoding gene of described encoding gene that makes the 3-hydroxyl fatty acyl-CoA dehydrogenase among the described recombinant pseudomonas putida II and fatty acyl-CoA dehydrogenase realizes by homologous recombination; The method of described homologous recombination comprises the steps: in described recombinant pseudomonas putida II to import in the sequence table DNA shown in the sequence 10 among the DNA shown in the sequence 9 and sequence table, the encoding gene generation homologous recombination of the 3-hydroxyl fatty acyl-CoA dehydrogenase in the described sequence table among DNA shown in the sequence 9 and the described recombinant pseudomonas putida II, the encoding gene generation homologous recombination of the fatty acyl-CoA dehydrogenase in the described sequence table among DNA shown in the sequence 10 and the described recombinant pseudomonas putida II obtains described recombinant pseudomonas putida V.
3. recombinant pseudomonas putida according to claim 1 and 2 is characterized in that:
Described 1) shown in the recombinant pseudomonas putida, in the described sequence table in DNA shown in the sequence 1 and the sequence table DNA shown in the sequence 2 import by recombinant vectors; Described recombinant vectors is that XbaI and HindIII site that the fusion gene that DNA shown in the sequence 2 in DNA shown in the sequence 1 in the described sequence table and the table constitutes inserts the carrier pK18mobSacB that sets out are obtained; DNA shown in the sequence 1 is positioned at the upstream of fusion gene in the described sequence table, and DNA shown in the sequence 2 is positioned at the downstream of fusion gene in the described table;
Described 2) in the recombinant pseudomonas putida, DNA shown in the sequence 3 imports by recombinant vectors in the described sequence table shown in; Described recombinant vectors is that HindIII and XmaI site that DNA shown in the sequence 3 in the described sequence table inserts the carrier pK18mobSacB that sets out are obtained;
Described 3) in the recombinant pseudomonas putida, the nucleotide sequence of described Poly-synthetase-coding gene is shown in sequence in the sequence table 4 shown in, and the nucleotide sequence of described 4-maloyl group thiophorase encoding gene is shown in sequence in the sequence table 5; Described Poly-synthetase-coding gene is positioned at the upstream of described fusion gene, and described 4-maloyl group thiophorase encoding gene is positioned at the downstream of described fusion gene;
Described 4) in the recombinant pseudomonas putida, the nucleotide sequence of the protein-bonded encoding gene of described PHA particle is shown in sequence in the sequence table 6 shown in, and the nucleotide sequence of the encoding gene of described enoyl coenzyme A hydratase is shown in sequence in the sequence table 7; The nucleotide sequence of described pha synthesizing enzyme encoding gene is shown in sequence in the sequence table 8;
Described recombinant vectors obtains as follows: the genomic dna with Aeromonas hydrophila 4AK4 is a template, to carrying out pcr amplification, obtains the PCR product with following primer; With restriction enzyme KpnI and EcoRI described pcr amplification product is carried out double digestion, reclaim gene fragment; With restriction enzyme KpnI and EcoRI carrier pBBR1-MCS2 is carried out double digestion, reclaim enzyme and cut big fragment; Described gene fragment and described enzyme are cut big fragment be connected, obtain described recombinant vectors;
Described 5) shown in the recombinant pseudomonas putida, in the described sequence table in DNA shown in the sequence 9 and the sequence table DNA shown in the sequence 10 import by recombinant vectors; Described recombinant vectors is that HindIII and BamHI site that the fusion gene that DNA shown in the sequence 10 in DNA shown in the sequence 9 and the sequence table in the described sequence table constitutes inserts the carrier pK18mobSacB that sets out are obtained; DNA shown in the sequence 9 is positioned at the upstream of described fusion gene in the described sequence table, and DNA shown in the sequence 10 is positioned at the downstream of described fusion gene in the described sequence table.
4. according to arbitrary described recombinant pseudomonas putida among the claim 1-3, it is characterized in that: the described pseudomonas putida that sets out is strain Pseudomonas putida KTOY06.
5. the application of arbitrary described recombinant pseudomonas putida in the preparation polyhydroxyalkanoate among the claim 1-4.
6. a method for preparing polyhydroxyalkanoate comprises the steps: that with lipid acid, solubility soap or gamma-butyrolactone be carbon source, carries out biosynthesizing with arbitrary described recombinant pseudomonas putida among the claim 1-4, obtains polyhydroxyalkanoate.
7. method according to claim 6 is characterized in that: the described biosynthetic method arbitrary described recombinant pseudomonas putida among the claim 1-4 that comprises the steps: to ferment obtains containing the fermented liquid of described recombinant pseudomonas putida; Adding described lipid acid or described solubility soap or described gamma-butyrolactone in the described fermented liquid that contains recombinant pseudomonas putida, is to continue to cultivate 39h under 30 ℃ the condition in temperature, obtains polyhydroxyalkanoate.
8. according to claim 6 or 7 described methods, it is characterized in that: described lipid acid is valeric acid, caproic acid, enanthic acid, sad, n-nonanoic acid, capric acid, lauric acid or myristic acid, and described solubility soap is natrium valericum, Sodium n-caproate, enanthic acid sodium, Sodium octoate, n-nonanoic acid sodium or Sodium decanoic acid.
9. according to arbitrary described method among the claim 6-8, it is characterized in that: described polyhydroxyalkanoate is hydroxyalkanoate homopolymer or hydroxy fatty acid ester copolymer;
Described biosynthetic method is following 1), 2), 3), 4) or 5) shown in:
1) described recombinant pseudomonas putida is recombinant pseudomonas putida I, and described solubility soap is enanthic acid sodium, and the chemical formula of described polyhydroxyalkanoate is suc as formula shown in the I, and the number-average molecular weight of described polyhydroxyalkanoate is 252 * 10 3Da, the weight-average molecular weight of described polyhydroxyalkanoate is 455 * 10 3Da; The concentration of described enanthic acid sodium in the described fermented liquid that contains pseudomonas putida is 5g/L;
Figure FSA00000104571200031
2) described recombinant pseudomonas putida is recombinant pseudomonas putida II, and described solubility soap is Sodium n-caproate, and the chemical formula of described polyhydroxyalkanoate is suc as formula shown in the II-1, and the number-average molecular weight of described polyhydroxyalkanoate is 206 * 10 3Da, the weight-average molecular weight of described polyhydroxyalkanoate is 272 * 10 3Da; The concentration of described Sodium n-caproate in the described fermented liquid that contains pseudomonas putida is 10g/L;
Figure FSA00000104571200032
Described recombinant pseudomonas putida is recombinant pseudomonas putida II, and described solubility soap is Sodium octoate, and the chemical formula of described polyhydroxyalkanoate is suc as formula shown in the II-2, and the number-average molecular weight of described polyhydroxyalkanoate is 148 * 10 3Da, the weight-average molecular weight of described polyhydroxyalkanoate is 180 * 10 3Da; The concentration of described Sodium n-caproate in the described fermented liquid that contains pseudomonas putida is 10g/L;
Figure FSA00000104571200041
3) described recombinant pseudomonas putida is recombinant pseudomonas putida III, and described carbon source is a gamma-butyrolactone, and the chemical formula of described polyhydroxyalkanoate is shown in formula III, and the number-average molecular weight of described polyhydroxyalkanoate is 487 * 10 3Da, the weight-average molecular weight of described polyhydroxyalkanoate is 854 * 10 3Da; The concentration of described gamma-butyrolactone in the described fermented liquid that contains pseudomonas putida is 5g/L;
Figure FSA00000104571200042
4) described recombinant pseudomonas putida is recombinant pseudomonas putida IV: described solubility soap is natrium valericum, and the chemical formula of described polyhydroxyalkanoate is suc as formula shown in the IV, and the number-average molecular weight of described polyhydroxyalkanoate is 815 * 10 3Da, the weight-average molecular weight of described polyhydroxyalkanoate is 1056 * 10 3Da; The concentration of described natrium valericum in the described fermented liquid that contains pseudomonas putida is 5g/L;
Figure FSA00000104571200043
5) described recombinant pseudomonas putida is recombinant pseudomonas putida V: described solubility soap is Sodium decanoic acid, and the chemical formula of described polyhydroxyalkanoate is suc as formula shown in the V-1, and the number-average molecular weight of described polyhydroxyalkanoate is 248.6 * 10 3Da, the weight-average molecular weight of described polyhydroxyalkanoate is 361.4 * 10 3Da; The concentration of described Sodium decanoic acid in the described fermented liquid that contains pseudomonas putida is 2g/L;
Figure FSA00000104571200051
Described recombinant pseudomonas putida is recombinant pseudomonas putida V: described lipid acid is lauric acid, and the chemical formula of described polyhydroxyalkanoate is suc as formula shown in the V-2, and the number-average molecular weight of described polyhydroxyalkanoate is 119.4 * 10 3Da, the weight-average molecular weight of described polyhydroxyalkanoate is 155.5 * 10 3Da; The concentration of described lauric acid in the described fermented liquid that contains pseudomonas putida is 6g/L;
Described recombinant pseudomonas putida is recombinant pseudomonas putida V: described lipid acid is myristic acid, and the chemical formula of described polyhydroxyalkanoate is suc as formula shown in the V-3; The concentration of described myristic acid in the described fermented liquid that contains pseudomonas putida is 4g/L;
10. according to arbitrary described method among the claim 6-9, it is characterized in that: the described fermented liquid that contains recombinant pseudomonas putida is to obtain according to the method that comprises the steps: described recombinant pseudomonas putida is inoculated in the LB-Km liquid nutrient medium, be to cultivate under 30 ℃ the condition in temperature, obtain described fermented liquid; Described LB-Km liquid nutrient medium is made up of yeast extract, peptone, NaCl, sulphuric acid kanamycin and water, the concentration of yeast extract in the LB-Km liquid nutrient medium is 5g/L, the concentration of peptone in the LB-Km liquid nutrient medium is 10g/L, the concentration of NaCl in the LB-Km liquid nutrient medium is 10g/L, and the concentration of sulphuric acid kanamycin in the LB-Km liquid nutrient medium is 50 μ g/mL.
CN2010101613141A 2010-04-28 2010-04-28 Method for preparing hydroxyalkanoate homopolymer and special bacteria thereof Active CN101845414B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2010101613141A CN101845414B (en) 2010-04-28 2010-04-28 Method for preparing hydroxyalkanoate homopolymer and special bacteria thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2010101613141A CN101845414B (en) 2010-04-28 2010-04-28 Method for preparing hydroxyalkanoate homopolymer and special bacteria thereof

Publications (2)

Publication Number Publication Date
CN101845414A true CN101845414A (en) 2010-09-29
CN101845414B CN101845414B (en) 2012-07-18

Family

ID=42770233

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2010101613141A Active CN101845414B (en) 2010-04-28 2010-04-28 Method for preparing hydroxyalkanoate homopolymer and special bacteria thereof

Country Status (1)

Country Link
CN (1) CN101845414B (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102133511A (en) * 2011-01-14 2011-07-27 清华大学 Novel application of amphiphilic protein-polyhydroxyalkanoate granule associated protein (PhaP)
CN102226206A (en) * 2011-05-11 2011-10-26 北京联合大学生物化学工程学院 Method for preparing polyhydroxybutyrate (PHB)
CN102952774A (en) * 2012-10-30 2013-03-06 清华大学 Engineering strain and application thereof to production of long-chain 3-hydroxy fatty acid
CN103230385A (en) * 2013-05-02 2013-08-07 王志雄 Preparation method of transdermal drug delivery system (TDDS)
CN105039376A (en) * 2014-08-14 2015-11-11 清华大学 Recombinant bacterium for producing 3-hydroxypropionic acid homopolymer/copolymer as well as construction method and application of recombinant bacterium
CN106047741A (en) * 2016-03-04 2016-10-26 李涛 Bacterial strain and synthetic method for synthesizing PHA from chitin, and application of PHA
CN106754471A (en) * 2016-11-21 2017-05-31 天津大学 A kind of method for producing PHA pseudomonad Primary Studies in activated sludge
CN109266597A (en) * 2018-09-30 2019-01-25 清华大学 A kind of method of micro-organisms brachymedial long-chain poly-hydroxy fatty acid copolymer
CN110760460A (en) * 2019-09-30 2020-02-07 浙江工业大学 Compound microbial inoculum capable of efficiently degrading kitchen waste oil components and application thereof
CN116445440A (en) * 2022-10-26 2023-07-18 华南理工大学 Viscous polyhydroxyalkanoate and preparation and application thereof
CN116970659A (en) * 2023-09-18 2023-10-31 清华大学 Method for producing polyhydroxyalkanoate

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104140522B (en) * 2014-06-27 2016-02-10 江南大学 A kind of degradable polyhydroxyalkanoate

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1532278A (en) * 2003-03-19 2004-09-29 清华大学 Recombined strain for producing polyhydroxy fatty ester and its construction and use
CN101008011A (en) * 2006-01-25 2007-08-01 天津国韵生物科技有限公司 Recombinant strain for producing polyhydroxyalkanoate and its construction method and uses
CN101096651A (en) * 2007-06-05 2008-01-02 清华大学 Engineering bacterium for expressing poly hydroxy fatty acid ester and its construction method and application
CN101137744A (en) * 2005-03-24 2008-03-05 株式会社钟化 Microorganism capable of accumulating ultra high molecular weight polyester

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1532278A (en) * 2003-03-19 2004-09-29 清华大学 Recombined strain for producing polyhydroxy fatty ester and its construction and use
CN101137744A (en) * 2005-03-24 2008-03-05 株式会社钟化 Microorganism capable of accumulating ultra high molecular weight polyester
CN101008011A (en) * 2006-01-25 2007-08-01 天津国韵生物科技有限公司 Recombinant strain for producing polyhydroxyalkanoate and its construction method and uses
CN101096651A (en) * 2007-06-05 2008-01-02 清华大学 Engineering bacterium for expressing poly hydroxy fatty acid ester and its construction method and application

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102133511A (en) * 2011-01-14 2011-07-27 清华大学 Novel application of amphiphilic protein-polyhydroxyalkanoate granule associated protein (PhaP)
CN102226206A (en) * 2011-05-11 2011-10-26 北京联合大学生物化学工程学院 Method for preparing polyhydroxybutyrate (PHB)
CN102226206B (en) * 2011-05-11 2013-08-14 北京联合大学生物化学工程学院 Method for preparing polyhydroxybutyrate (PHB)
CN102952774A (en) * 2012-10-30 2013-03-06 清华大学 Engineering strain and application thereof to production of long-chain 3-hydroxy fatty acid
CN102952774B (en) * 2012-10-30 2015-09-30 清华大学 Application in a kind of engineering bacteria and aborning long-chain 3-hydroxy fatty acid
CN103230385A (en) * 2013-05-02 2013-08-07 王志雄 Preparation method of transdermal drug delivery system (TDDS)
CN105039376A (en) * 2014-08-14 2015-11-11 清华大学 Recombinant bacterium for producing 3-hydroxypropionic acid homopolymer/copolymer as well as construction method and application of recombinant bacterium
CN105039376B (en) * 2014-08-14 2018-08-03 清华大学 The recombinant bacterium and construction method of production 3- hydracrylic acids homopolymer/copolymer and application
CN106047741B (en) * 2016-03-04 2019-09-27 李涛 It is a kind of to utilize the bacterial strain and synthetic method of chitin synthesis PHA and its application
CN106047741A (en) * 2016-03-04 2016-10-26 李涛 Bacterial strain and synthetic method for synthesizing PHA from chitin, and application of PHA
CN106754471A (en) * 2016-11-21 2017-05-31 天津大学 A kind of method for producing PHA pseudomonad Primary Studies in activated sludge
CN109266597A (en) * 2018-09-30 2019-01-25 清华大学 A kind of method of micro-organisms brachymedial long-chain poly-hydroxy fatty acid copolymer
CN110760460A (en) * 2019-09-30 2020-02-07 浙江工业大学 Compound microbial inoculum capable of efficiently degrading kitchen waste oil components and application thereof
CN116445440A (en) * 2022-10-26 2023-07-18 华南理工大学 Viscous polyhydroxyalkanoate and preparation and application thereof
CN116445440B (en) * 2022-10-26 2024-01-02 华南理工大学 Viscous polyhydroxyalkanoate and preparation and application thereof
CN116970659A (en) * 2023-09-18 2023-10-31 清华大学 Method for producing polyhydroxyalkanoate
CN116970659B (en) * 2023-09-18 2024-02-09 清华大学 Method for producing polyhydroxyalkanoate

Also Published As

Publication number Publication date
CN101845414B (en) 2012-07-18

Similar Documents

Publication Publication Date Title
CN101845414B (en) Method for preparing hydroxyalkanoate homopolymer and special bacteria thereof
US10829793B2 (en) Transformant that produces copolymerized PHA containing 3HH unit, and method for producing said PHA
Liu et al. Biosynthesis of poly (3-hydroxydecanoate) and 3-hydroxydodecanoate dominating polyhydroxyalkanoates by β-oxidation pathway inhibited Pseudomonas putida
Moorkoth et al. Production and characterization of poly (3-hydroxy butyrate-co-3 hydroxyvalerate)(PHBV) by a novel halotolerant mangrove isolate
JP5670728B2 (en) Improved polyhydroxyalkanoate-producing microorganism and method for producing polyhydroxyalkanoate using the same
Zakaria et al. Biosynthesis and characterization of poly (3-hydroxybutyrate-co-3-hydroxyvalerate) copolymer from wild-type Comamonas sp. EB172
US8049065B2 (en) Transgenic systems for the manufacture of poly(2-hydroxy-butyrate-co-3-hydroxyhexanoate)
CN114134096B (en) 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid terpolymer P (3HB-4HB-3HV) and microbial production thereof
CN113583922B (en) Method for producing PHA (polyhydroxyalkanoate) by culturing halophilic bacteria in low-salt culture medium
CN101058799B (en) Method of producing polyhydroxyalkanoates and special-purpose engineering bacterium for the same
CN102066560B (en) Method for production of polyester copolymer using genetically modified microorganism
Song et al. Production of poly (4-hydroxybutyric acid) by fed-batch cultures of recombinant strains of Escherichia coli
Ashby et al. Poly (ethylene glycol)-mediated molar mass control of short-chain-and medium-chain-length poly (hydroxyalkanoates) from Pseudomonas oleovorans
CN102154387B (en) Method for producing succinic acid and polyhydroxyalkanoate (PHA) by using biodiesel byproducts
US8334129B2 (en) Microorganism capable of producing polyhydroxyalkanoate, polyhydroxyalkanoate synthase, and gene encoding the same
EP2935599B1 (en) Preparation of long-chain length poly(hydroxyfatty acids)
CN101616954B (en) Copolymer containing 3-hydroxyalkanoate unit and lactate unit, and its manufacturing method
CN102171356A (en) Method for polymerising glycolic acid with microorganisms
JP5839854B2 (en) Microbial culture method
Wang et al. The effect of co-substrate feeding on polyhydroxyalkanoate (PHA) homopolymer and copolymer production in recombinant Escherichia coli LS5218
CN111363713A (en) Construction method and application of genetic engineering escherichia coli for improving content of lactic acid component in polyhydroxybutyrate lactate
Shetye et al. Poly (3-hydroxybutyrate-co-3-hydroxyvalerate) synthesis in Nostoc muscorum from biodiesel industry waste: a sustainable model of bioplastic production
Nishikawa et al. Cloning and molecular analysis of poly (3-hydroxyalkanoate) biosynthesis genes in Pseudomonas aureofaciens
US20110118434A1 (en) Method for polymerising glycolic acid with microorganisms
Öksüz et al. Polyhydroxyalkanoate accumulation in Streptomyces coelicolor affected by SCO7613 gene region

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant