CN114134096B - 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid terpolymer P (3HB-4HB-3HV) and microbial production thereof - Google Patents

3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid terpolymer P (3HB-4HB-3HV) and microbial production thereof Download PDF

Info

Publication number
CN114134096B
CN114134096B CN202210115391.6A CN202210115391A CN114134096B CN 114134096 B CN114134096 B CN 114134096B CN 202210115391 A CN202210115391 A CN 202210115391A CN 114134096 B CN114134096 B CN 114134096B
Authority
CN
China
Prior art keywords
recombinant bacterium
halomonas
acid
recombinant
bluephagenesis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210115391.6A
Other languages
Chinese (zh)
Other versions
CN114134096A (en
Inventor
陈国强
黄悟哲
何宏韬
吴赴清
兰宇轩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Micro Structure Factory Biotechnology Co ltd
Tsinghua University
Original Assignee
Beijing Micro Structure Factory Biotechnology Co ltd
Tsinghua University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Micro Structure Factory Biotechnology Co ltd, Tsinghua University filed Critical Beijing Micro Structure Factory Biotechnology Co ltd
Priority to CN202210115391.6A priority Critical patent/CN114134096B/en
Publication of CN114134096A publication Critical patent/CN114134096A/en
Application granted granted Critical
Publication of CN114134096B publication Critical patent/CN114134096B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/13—Transferases (2.) transferring sulfur containing groups (2.8)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/62—Carboxylic acid esters
    • C12P7/625—Polyesters of hydroxy carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01061—4-Hydroxybutyrate dehydrogenase (1.1.1.61)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01202—1,3-Propanediol dehydrogenase (1.1.1.202)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/0101—Acetaldehyde dehydrogenase (acetylating) (1.2.1.10)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01016—Succinate-semialdehyde dehydrogenase [NAD(P)+] (1.2.1.16)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01024—Succinate-semialdehyde dehydrogenase (NAD+) (1.2.1.24)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01076—Succinate-semialdehyde dehydrogenase (acetylating) (1.2.1.76)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01079—Succinate-semialdehyde dehydrogenase (NADP+) (1.2.1.79)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/99—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with other acceptors (1.2.99)
    • C12Y102/99003—Aldehyde dehydrogenase (pyrroloquinoline-quinone) (1.2.99.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/99—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with other acceptors (1.2.99)
    • C12Y102/99007—Aldehyde dehydrogenase (FAD-independent) (1.2.99.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y103/00—Oxidoreductases acting on the CH-CH group of donors (1.3)
    • C12Y103/99—Oxidoreductases acting on the CH-CH group of donors (1.3) with other acceptors (1.3.99)
    • C12Y103/99001—Succinate dehydrogenase (1.3.99.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/03—Acyl groups converted into alkyl on transfer (2.3.3)
    • C12Y203/03005—2-Methylcitrate synthase (2.3.3.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y208/00—Transferases transferring sulfur-containing groups (2.8)
    • C12Y208/03—CoA-transferases (2.8.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01041—Methylmalonyl-CoA decarboxylase (4.1.1.41)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01071—2-Oxoglutarate decarboxylase (4.1.1.71)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y504/00—Intramolecular transferases (5.4)
    • C12Y504/99—Intramolecular transferases (5.4) transferring other groups (5.4.99)
    • C12Y504/99002—Methylmalonyl-CoA mutase (5.4.99.2)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a recombinant bacterium, a method for producing P (3HB-4HB-3HV) by adopting the recombinant bacterium through fermentation, and a method for adjusting the monomer proportion in P (3HB-4HB-3 HV). According to the invention, a recombinant bacterium capable of producing P (3HB-4HB-3HV) is constructed by modifying a microorganism which cannot originally produce P (3HB-4HB-3HV), and meanwhile, the content of 4HB and 3HV in the produced P (3HB-4HB-3HV) can be well increased by culturing the recombinant bacterium, so that a P (3HB-4HB-3HV) material with excellent performance is obtained.

Description

3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid terpolymer P (3HB-4HB-3HV) and microbial production thereof
Technical Field
The invention relates to the fields of biotechnology and biomaterials, in particular to a copolymer P (3HB-4HB-3HV) of 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid and microbial production thereof.
Background
The degradable plastics PHA produced by microbial fermentation mainly comprises homopolymer P (3HB) and copolymer P (3HB-co-4HB)、P(3HB-co-3HV) and P (3HB-co-3 HHx). Except that 3HB monomer can be synthesized to a production level by using a non-related carbon source such as glucose in a part of microorganisms (e.g., halophiles) (reference: Tan D., et al. nozzle and connecting production of polyhydroxybutyrate byHalomonasTD01 Bioresource technology 2011.102: 8130-: li M.Y., et alng Pseudomonas entomophilafor synthesis of polymers with defined fractions of 3-hydroxybutation and medium-chain-length 3-hydroxyalkanoates. Metabolic engineering 2019, 52: 253-262), it is urgently needed to find a method for increasing the monomer level except 3HB, but the currently reported engineering bacteria are only strains which utilize non-related carbon sources to synthesize PHA with one or two monomers copolymerized. The copolymers of 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid and the production strains described in this application are not disclosed.
Polyhydroxyalkanoates (PHAs) are a generic name for a class of polymers having hundreds of monomers. PHA, such as P (3HB), obtained by polymerizing a monomer has problems of low elongation at break, brittle material properties, poor toughness and unstable molten state. PHA obtained by copolymerization of two monomers, such as P (3HB-co-4HB)、P(3HB-co-3HV)、P(3HB-co-3HHx), which is problematic in that recrystallization causes brittleness, low transparency, poor thermal stability, and the like. The P (3HB-4HB-3HV) material obtained by copolymerizing the three monomers has three monomers with different structures, so that the phenomenon of post-crystallization is well weakened, and the material has good transparency and material toughness.
Disclosure of Invention
In order to solve the above problems, the present application provides a method for producing P (3HB-4HB-3HV) and a production strain, and the ratio of monomer 4HB and/or 3HV is effectively increased, so that the prepared P (3HB-4HB-3HV) has higher glass transition temperature, lower Young's modulus and larger elongation at break.
Specifically, in the first aspect of the present application, a recombinant bacterium is provided, wherein the recombinant bacterium comprisesscpA、scpB、sucD、ogdA、4hbD、orfZ、dhaTAndaldDover-expression, and, in the recombinant bacteriumsdhE、gabD、sadAndprpCand (4) weakening expression.
Preferably, the recombinant bacterium isphaA、phaBAndphaCand (4) overexpression.
Preferably, the overexpression is to introduce the target gene into the recombinant bacterium by using a plasmid containing the target gene. The introduction may be into the chromosomal genome of the recombinant bacterium, or the plasmid may be released into the recombinant bacterium.
Preferably, the overexpression is an activated transcription factor that upregulates a gene of interest.
Preferably, said overexpression is on a plasmid or chromosome.
Preferably, the recombinant bacterium issdhAAnd (4) weakening expression.
Preferably, the promoter used for overexpression is constitutive or inducible.
In one embodiment of the present invention, the constitutive promoter may be a constitutive porin gene, porin promoter. The constitutive promoter can be a low-strength promoter, a medium-strength promoter or a high-strength promoter. Such as Pporin203, Pporin 221, Pporin 194, Pporin 278, Pporin 68, Pporin42 or Pporin 58.
In one embodiment of the present invention, the inducible promoter may be an IPTG-inducible T7 promoter.
Preferably, the recombinant bacterium isphaGAndphaJand (4) weakening expression.
Further preferably, the attenuated expression may be a knock-out of all or part of the nucleotide sequence of the gene of interest. So that the target gene is not expressed in the recombinant bacteria or the expressed protein has no function.
Preferably, the recombinant bacterium is halophilomonasHalomonas bluephagenesisPseudomonas spPseudomonas putidaEscherichia coliEscherishia coliEutrophobacterium rolfsiiRalstonia eutropha(also calledAlcaligenes eutrophus、Cupriavidus necator) Aeromonas genusAeromonas hydrophilaBacillus genusBacilllus subtilisOr Alcaligenes megateriumAlcaligenes latus。
Further preferably, the genus HalomonasHalomonas bluephagenesisIs composed ofHalomonas bluephagenesisTD01 CGMCC. No. 4353、Halomonas campaniensisLS21 CGMCC No.6593 orHalomonas aydingkolgenesis M1 CGMCC NO.19880。
In a second aspect of the invention, a method for preparing a recombinant bacterium is provided, the method for preparing the recombinant bacterium comprises overexpressionscpA、scpB、sucD、ogdA、4hbD、orfZ、dhaTAndaldDand, attenuating the expressionsdhE、gabD、sadAndprpC。
preferably, it is overexpressedphaA、phaBAndphaC。
preferably, the overexpression is to introduce the target gene into the recombinant bacterium by using a plasmid containing the target gene. The introduction may be into the genome of the recombinant bacterium, or the plasmid may be released into the recombinant bacterium.
Preferably, the overexpression is an activated transcription factor that upregulates a gene of interest.
Preferably, said overexpression is on a plasmid or chromosome.
Preferably, the promoter used for overexpression is constitutive or inducible.
Preferably, the expression is attenuatedsdhA。
Preferably, the expression is attenuatedphaGAndphaJ。
further preferably, the attenuated expression may be a knock-out of all or part of the nucleotide sequence of the gene of interest. So that the target gene is not expressed in the recombinant bacteria or the expressed protein has no function.
Preferably, the recombinant bacterium is halophilomonasHalomonas bluephagenesisPseudomonas spPseudomonas putidaEscherichia coliEscherishia coliEutrophobacterium rolfsiiRalstonia eutropha(also calledAlcaligenes eutrophus、Cupriavidus necator) Aeromonas genusAeromonas hydrophilaBacillus genusBacilllus subtilisOr Alcaligenes megateriumAlcaligenes latus。
Further preferably, the genus HalomonasHalomonas bluephagenesisIs composed ofHalomonas bluephagenesis TD01 CGMCC. No. 4353、Halomonas campaniensis LS21 CGMCC No.6593 orHalomonas aydingkolgenesis M1 CGMCC NO.19880。
In a third aspect of the present invention, there is provided a method for producing P (3HB-4HB-3HV), which comprises fermentatively culturing the above-described recombinant bacterium.
Preferably, the fermentation medium may be a natural medium, a synthetic medium and/or a semi-synthetic medium.
Preferably, the medium contains a carbon source, a nitrogen source, inorganic salts, and the like. The nitrogen source comprises an inorganic nitrogen source and/or an organic nitrogen source. Further preferably, the fermentation medium further comprises vitamins and/or growth factors.
Preferably, the culture medium for the fermentation can adopt a culture medium which is conventional in the prior art, and can also adopt other substances containing nutrient components. The conventional medium contains MMG, LB, and the like.
Preferably, the fermentation medium can be liquid, solid or semisolid.
Preferably, the fermentation medium comprises a source of a related carbon and/or a source of a non-related carbon. The related carbon source is selected from one or the combination of more than two of gamma-butyrolactone, 4-hydroxybutyric acid, 1, 2-butanediol, 1, 3-butanediol, 1, 4-butanediol, 1, 6-hexanediol, 1, 8-octanediol, 1, 10-decanediol, 1, 12-dodecanediol, propionic acid, valeric acid or heptanoic acid or other medium-long chain fatty acids. The non-related carbon source is one or the combination of more than two of glucose, sodium gluconate, glycerol, acetic acid, caproic acid, xylose, cellulose, lactose and fructose.
The relevant carbon source and the non-relevant carbon source can be used singly or in a mixture to better regulate the ratio of each monomer in P (3HB-4HB-3 HV).
Preferably, the feeding time in the fermentation process is adjusted to suitably prolong the cell growth time.
In one embodiment of the present invention, the feeding time is 16 to 28 hours of the fermentation culture.
In a fourth aspect of the invention, P (3HB-4HB-3HV) prepared by the method is provided.
In a fifth aspect of the invention, the application of the P (3HB-4HB-3HV) in the preparation of novel biodegradable materials is provided. Preferably in the development of medical devices, medical microspheres, surgical sutures, patches, disposable packaging materials or textile fibres.
In a sixth aspect of the invention, a method for regulating the monomer ratio in P (3HB-4HB-3HV) is provided, and the method comprises the fermentation culture of the recombinant bacterium.
Preferably, the monomer is 3HB, 4HB and/or 3 HV.
In one embodiment of the invention, the monomer is 4HB and/or 3 HV.
Preferably, the adjustment is an increase or decrease.
In one embodiment of the present invention, the monomer ratio in P (3HB-4HB-3HV) is adjusted to increase the monomer ratio. Preferably, the ratio of 4HB and/or 3HV is increased.
Preferably, the method employs modulating the expression intensity of an overexpressed gene.
In one embodiment of the invention, different promoters are used for gene expression.
The promoter may be constitutive or inducible.
In one embodiment of the present invention, the constitutive promoter may be a constitutive porin gene, porin promoter. The constitutive promoter can be a low-strength promoter, a medium-strength promoter or a high-strength promoter. Such as Pporin203, Pporin 221, Pporin 194, Pporin 278, Pporin 68, Pporin42 or Pporin 58.
In one embodiment of the present invention, the inducible promoter may be an IPTG-inducible T7 promoter.
Preferably, the method comprises adjusting the composition of the fermentation medium.
In one embodiment of the invention, the monomer ratio in P (3HB-4HB-3HV) is adjusted using related carbon sources and/or non-related carbon sources.
Preferably, the method comprises adjusting the feeding time during the fermentation process to suitably prolong the cell growth time.
In one embodiment of the present invention, the feeding time is 16-28 hours of the fermentation culture
In a seventh aspect of the present invention, there is provided a method for increasing the ratio of 4HB to 3HV in P (3HB-4HB-3HV), which comprises the step of fermentatively culturing the recombinant bacterium described above.
Preferably, the method comprises adjusting the expression intensity of the overexpressed gene.
In one embodiment of the present invention, the regulation of the expression intensity of the overexpressed gene is performed by using different promoters for gene expression.
Preferably, the method comprises the use of related carbon sources alone or in combination with non-related carbon sources.
Preferably, the time for switching the carbon-nitrogen ratio, i.e., the addition amount of the feed in the bacterial growth phase and the PHA accumulation phase, is controlled. In one embodiment of the invention, the feeding time during fermentation is adjusted to suitably prolong the cell growth time.
In one embodiment of the present invention, the feeding time is 16 to 28 hours of the fermentation culture.
The invention realizes the independent or combined production of P (3HB-4HB-3HV) by related carbon sources or non-related carbon sources through the combination of different promoters and genes, and the proportion of 4HB ranges from 0 to 27 percent, and the proportion of 3HV ranges from 0 to 25 percent. In addition, in the batch fed-batch fermentation, the 4HB and 3HV monomer ratios in terpolymer P (3HB-4HB-3HV) were adjusted by adjusting the time for switching from cell growth feed to product production feed.
The 'overexpression' of the invention is the up-regulated expression of genes, which is higher than the original natural expression amount.
The attenuation expression is that the gene is down-regulated and expressed, and is lower than the original natural expression quantity.
Comparison of polymer abbreviations with the Chinese names in this application:
3 HB: 3-hydroxybutyric acid;
4 HB: 4-hydroxybutyric acid;
3HV represents 3-hydroxyvaleric acid;
p (3HB-4HB-3 HV): 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid copolymers;
P(3HB-co-3HV) or PHBV: 3-hydroxybutyric acid, 3-hydroxyvaleric acid copolymers;
P(3HB-co-4HB) or P34 HB: 3-hydroxybutyric acid and 4-hydroxybutyric acid copolymers.
PHB: a homopolymer of 3-hydroxybutyric acid.
The present application relates to a Chinese name comparison of gene abbreviations and encoded enzymes:
scpA: methylmalonyl-coa mutase;
scpB: methylmalonyl-coa decarboxylase;
sucD: succinic semialdehyde dehydrogenase;
ogdA: 2-ketoglutarate decarboxylase;
4hbD: 4-hydroxybutyrate dehydrogenase;
orfZ: 4-hydroxybutyryl-coa transferase;
sdhA: succinate dehydrogenase A;
sdhE: succinate dehydrogenase E;
gabD: NADP-dependent succinic hemiacetal dehydrogenase;
sad: NAD/NADP dependent succinic hemiacetal dehydrogenase;
dhaT: 1, 3-propanediol dehydrogenase;
aldD: acetaldehyde dehydrogenase;
prpC: 2-methyl citrate synthase;
phaA: a beta-ketothiolase;
phaB: acetoacetyl-coa;
phaC: a PHA synthase;
phaG: 3-hydroxyacyl-coa acyltransferase;
phaJ: enoyl-coa hydratase.
The "proportion of monomers" described herein represents the molar amount of the monomers based on the total polymer, and for example, the "proportion of monomers in P (3HB-4HB-3 HV)" represents the molar amount of monomers 3HB, 4HB, or 3HV based on P (3HB-4HB-3 HV).
Drawings
Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:
FIG. 1: p (3HB-4HB-3HV) synthesis-related metabolic pathway map.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only some embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Media formulations used in the examples:
60 LB: 5g/L of yeast extract, 10g/L of peptone, 60g/L of NaCl and the balance of distilled water; adjusting the pH value to 7.0-7.2; then autoclaved.
10 MMG: preparing NaCl solution of yeast extract, wherein the concentration of the yeast extract is 1g/L, and the concentration of NaCl is 10 g/L; after dissolution, autoclaving; after cooling, 1mL of component I (to 10g (NH) was added per 50mL of solution4)2SO4And 2g MgSO4Adding distilled water to a volume of 200mL, followed by autoclaving) and 1mL of component II (to 96.5g Na)2HPO4·12H2O and 15g KH2PO4Adding distilled water to a constant volume of 200mL, and then sterilizing by high-pressure steam); finally, the pH of the system was adjusted to about 7.0 with 5M aqueous NaOH.
20 MMG: preparing NaCl solution of yeast extract with yeast extract concentration of 1g/L and NaCl concentrationIs 20 g/L; after dissolution, autoclaving; after cooling, 1mL of component I was added per 50mL of solution (to 10g (NH4)2SO4And 2g MgSO4Adding distilled water to a volume of 200mL, followed by autoclaving) and 1mL of component II (to 96.5g Na)2HPO4·12H2O and 15g KH2PO4Adding distilled water to a constant volume of 200mL, and then sterilizing by high-pressure steam); finally, the pH of the system was adjusted to about 7.0 with 5M aqueous NaOH.
40 MMG: preparing NaCl solution of yeast extract, wherein the concentration of the yeast extract is 1g/L, and the concentration of NaCl is 40 g/L; after dissolution, autoclaving; after cooling, 1mL of component I (to 10g (NH) was added per 50mL of solution4)2SO4And 2g MgSO4Adding distilled water to a volume of 200mL, followed by autoclaving) and 1mL of component II (to 96.5g Na)2HPO4·12H2O and 15g KH2PO4Adding distilled water to a constant volume of 200mL, and then sterilizing by high-pressure steam); finally, the pH of the system was adjusted to about 7.0 with 5M aqueous NaOH.
60 MMG: preparing NaCl solution of yeast extract, wherein the concentration of the yeast extract is 1g/L, and the concentration of NaCl is 60 g/L; after dissolution, autoclaving; after cooling, 1mL of component I was added per 50mL of solution (to 10g (NH4)2SO4And 2g MgSO4Adding distilled water to a volume of 200mL, followed by autoclaving) and 1mL of component II (to 96.5g Na)2HPO4·12H2O and 15g KH2PO4Adding distilled water to a constant volume of 200mL, and then sterilizing by high-pressure steam); finally, the pH of the system was adjusted to about 9.0 with 5M aqueous NaOH.
Method for calculating dry cell weight in examples:
measured as dry cell weight per liter of post-fermentation system. The unit of cell dry weight is g/L. And (3) filling 30mL of a bacterial liquid sample in a centrifugal tube, centrifuging to remove a supernatant, and freeze-drying. Dry cell weight (CDW) = (weight of centrifugal tube after freeze-drying-weight of original empty centrifugal tube) ÷ 0.03; the weight of the centrifugal tube after freeze drying and the weight of the original hollow centrifugal tube are both g; 0.03 represents 0.03L.
In the examples, the method for detecting the PHA content of the bacterial cells and the content of each monomer is as follows:
the product of freeze drying was subjected to esterification reaction, and then the monomer content was measured by Gas Chromatography (GC);
esterification reaction: putting 30-40mg of freeze-dried product into an esterification tube, adding 2mL of chloroform and 2mL of esterification solution (methanol solution containing 1g/L of benzoic acid and 3% of concentrated sulfuric acid), mixing uniformly, covering and sealing, and esterifying for 4h in a metal bath at 100 ℃; cooling to room temperature, adding 1mL of distilled water, fully oscillating, uniformly mixing, standing and layering; after the chloroform phase is completely separated from the water, the chloroform phase is taken for gas chromatography analysis;
taking 20-25mg of poly 3-hydroxybutyrate (P3HB), gamma-butyrolactone or delta-valerolactone for esterification reaction to be used as a standard sample;
gas Chromatography (GC) analysis parameters: separating the measured substance with HP-5 type gas chromatograph of Shimadzu GC-2014 type; setting a GC analysis heating program, wherein the injection port temperature (240 ℃), the detector temperature (250 ℃), the initial temperature and the maintaining time (80 ℃, 1.5 min), the first-stage heating (the heating rate is 30 ℃/min), the second-stage heating (the heating rate is 40 ℃/min, the temperature is maintained for 2min after the temperature is increased to 240 ℃), and the total program time is 8 min;
and calculating the corresponding PHA monomer ratio by reading the peak area of the internal standard, the peak area of the PHA monomer methyl ester of the standard sample, the area of the internal standard and the peak area of the PHA monomer methyl ester of the sample.
Content of PHA (%) = (mass of 3HB + mass of 4HB + mass of 3HV) ÷ mass of freeze-dried product × 100%;
the content of 3HB (% by mol) = mole of 3HB ÷ (mole of 3HB + mole of 4HB + mole of 3HV) × 100%;
the calculation methods of the 4HB content and the 3HV content refer to the 3HB content.
Reference or extension articles in the examples relating to the site of halophiles, e.g. G49, G4, G7 etc.: low-cost industrial production of poly (3-hydroxybutyrate-4-hydroxybutyrate) (doctor's academic paper, leaf health, strong Chen university, Qinghua university), or article: stimulus response-based fine-tuning of polyhydroxyakanoate pathway inHalomonas(Jianwen Ye, et cl, Metabolic Engineering, 2020).
Example 1: knock-out in halophilic bacteriaprpCGene, increasing P (3HB-co3HV proportion in-3 HV)
The invention utilizes CRISPR/Cas9 technology to construct a plasmid which takes pSEVA321 as a framework and has gRNA with a sequence cgcaccgtcatcatcaggt (SEQ ID NO: 1). By using halophilic bacteriaHalomonas bluephagenesis The genome of TD01 is knocked out 2-methyl citrate synthetase (PrpC) to promote the conversion of Propionyl coenzyme A (Propionyl-CoA) to 3-ketoamyl coenzyme A (3-ketoamyl-CoA) more, and under the action of acetoacetyl coenzyme A (PhaB), 3-hydroxypentyl coenzyme A (3-hydroxyvalyl-CoA) as more 3HV precursor is synthesized, and finally under the action of PHA synthase (PhaC)Halomonas bluephagenesis Copolymerization of 3-hydroxybutyryl-CoA (3-hydroxybutyryl-CoA) produced by TD01 self-metabolism into P (3HB-co-3 HV). And whether the gene operation is successful can be judged by adding a 3HV related carbon source, namely propionic acid and judging whether the conversion rate of the propionic acid to the 3HV is increased. The related principle is shown in figure 1. The strain constructed by this operation was named TD 01-D1.
The gene knock-out bacterium and the starting bacteriumHalomonas bluephagenesisTD01 was cultured in 60LB medium at 200rpm at 37 ℃ for 12 hours, and then inoculated at 1% to 50mL of 60MMG medium supplemented with propionic acid at 200rmp at 37 ℃ for 48 hours. After 48 hours, the cells were collected, and the dry cell weight and PHA content were measured, and the results are shown in Table 1 below.
Table 1: knock-outHalomonas bluephagenesisInprpCGene-enhanced conversion rate of propionic acid to 3HV
Figure 203243DEST_PATH_IMAGE001
Growth promoting bacteriaHalomonas bluephagenesis TD01 and knockout bacteriumHalomonas bluephagenesis TD01-D1 did not contain a 3HV fraction in accumulated PHA when no related carbon source (propionic acid) was added as substrate. When the related carbon source (propionic acid) is added as a substrate, the two strains are culturedThe accumulated PHA contains 3HV component, and has knockdown bacteriaHalomonas bluephagenesis The 3HV component of PHA accumulated by TD01-D1 is a starting bacteriumHalomonas bluephagenesis 20-fold higher TD01, indicating knock-outprpCThe gene can improve the conversion rate of halomonas for synthesizing 3HV by propionic acid and improve the synthesized P (3HB-co-3HV) of the total of the components.
Example 2: introduction into halophilic bacteriascpA、scpBTo increase the ratio of 3HV synthesized from non-related carbon sources
The invention is realized by using halophilic bacteriaHalomonas bluephagenesis In TD01-D1, methylmalonyl-CoA mutase (ScpA) and methylmalonyl-CoA decarboxylase (ScpB) were introduced into the G49 site by homologous recombination. In the copolymer, the high proportion of 3HB is easy to cause the material performance to lack flexibility and ductility, and a plurality of promoters with different strengths are designed for expressionscpAAndscpBa gene which is capable of converting Succinyl-CoA, a product of the tricarboxylic acid cycle (TCA cycle), into Propionyl-CoA and synthesizing P (3HB-co-3 HV). The tricarboxylic acid cycle is the major pathway for glucose metabolism. The related principle is shown in figure 1.
The promoter of the porin promoter (Pporin) library used includes Pporin203, Pporin 221, Pporin 194, Pporin 278, Pporin 68, Pporin42 and Pporin58, and the corresponding recombinant bacteria are named as Pporin42 and Pporin58Halomonas bluephagenesis TDV1, TDV2, TDV3, TDV4, TDV5, TDV6, TDV7 and the like.
The recombinant bacterium and the starting bacteriumHalomonas bluephagenesisTD01 was cultured in 60LB medium at 37 ℃ and 200rpm for 12 hours, and then inoculated at 1% into 50mL of 60MMG medium supplemented with glucose alone as a carbon source at 37 ℃ and 200rmp for 48 hours. After 48 hours, the cells were collected, and the dry cell weight and PHA content were measured, and the results are shown in Table 2 below.
Table 2: various kinds ofHalomonas bluephagenesisThe recombinant bacterium synthesizes PHA and monomer 3HV thereof
Figure DEST_PATH_IMAGE002
Growth promoting bacteriaHalomonas bluephagenesisTD01 when non-related carbon source (glucose) is used as substrate, accumulated PHA contains no 3HV component, and recombinant bacteriaHalomonas bluephagenesi3HV component is detected in PHA accumulated by TDV1-TDV7, which indicates that 2 genes contained in the plasmid vector can realize the synthesis of P (3HB-co-3HV)。
Example 3: introduction into halophilic bacteriaogdA、sucD、4hbD、orfZTo increase the ratio of 4HB synthesized by non-related carbon sources
The invention is realized by using halophilic bacteriaHalomonas bluephagenesis TD01, introducing 4-hydroxybutyryl-CoA transferase (OrfZ) at the G4 site by homologous recombination, introducing promoter tandem combinations of 2-ketoglutarate decarboxylase (OgdA), succinate semialdehyde dehydrogenase (SucD) and 4-hydroxybutyrate dehydrogenase (4 hbd) with different intensities at the G7 site to convert alpha-ketoglutarate (alpha-ketoglutarate) as a tricarboxylic acid cycle (TCA cycle) product into 4-hydroxybutyryl-CoA, and copolymerizing the 4-hydroxybutyryl-CoA with 3-hydroxybutyryl-CoA produced by self-metabolism under the action of PHA synthase (PhaC) of the bacteria to form P (3 HB-)co-4 HB). The tricarboxylic acid cycle is the major pathway for glucose metabolism. The related principle is shown in figure 1.
The promoter of the porin promoter (Pporin) library used includes Pporin203, Pporin 221, Pporin 194, Pporin 278, Pporin 68, Pporin42 and Pporin58, and the corresponding recombinant bacteria are named as Pporin42 and Pporin58HalomonasbluephagenesisTDB1, TDB2, TDB3, TDB4, TDB5, TDB6, TDB7 and the like.
The recombinant bacterium and the starting bacteriumHalomonas bluephagenesisTD01 was cultured in 60LB medium at 37 ℃ and 200rpm for 12 hours, and then inoculated at 1% into 50mL of 60MMG medium supplemented with glucose alone as a carbon source at 37 ℃ and 200rmp for 48 hours. After 48 hours, the cells were collected, and the dry cell weight and PHA content were measured, and the results are shown in Table 3 below.
Table 3: various kinds ofHalomonas bluephagenesisThe recombinant bacterium synthesizes PHA and monomer 4HB thereof
Figure 215324DEST_PATH_IMAGE003
Growth promoting bacteriaHalomonas bluephagenesisTD01 when non-related carbon source (glucose) is used as substrate, accumulated PHA does not contain 4HB component, and recombinant bacteriaHalomonas bluephagenesis4HB components are detected in PHA accumulated by TDB1-TDB7, which indicates that 4 genes contained in the plasmid vector can realize the synthesis of P (3HB-co-4HB)。
Example 4: construction of P (3HB-4HB-3HV) Synthesis halophilic bacteria
Recombinant bacteria with different combinations of gene expression intensities were obtained by introducing the knockout bacteria TD01-D1 of example 1 into the six genes of examples 2 and 3, wherein the promoters used include Pporin203, Pporin 221, Pporin 194, Pporin 278, Pporin 68, Pporin42 and Pporin58, and the corresponding recombinant bacteria are named as PporinHalomonas bluephagenesis TDB1-V1, TDB1-V3, TDB1-V6, TDB3-V1, TDB3-V3, TDB3-V6, TDB5-V1, TDB5-V3 and TDB 5-V6. Wherein V represents expressionscpA、scpBB represents expressionogdA、sucD、4hbD、orfZ1-7 represent promoters respectively Pporin203, Pporin 221, Pporin 194, Pporin 278, Pporin 68, Pporin42, Pporin 58; for example, TDB1-V1 represents a knockoutprpCGenes, expressionscpA、scpBThe promoter of (1) is Pporin203, expressionogdA、sucD、4hbD、orfZThe promoter of (1) is Pporin 203. TDB3-V6 represents a knockoutprpCGenes, expressionscpA、scpBThe promoter of (A) is Pporin42, expressionogdA、sucD、4hbD、orfZThe promoter of (1) is Pporin 194. Combining the recombinant bacteria and the starting bacteriaHalomonas bluephagenesisTD01 was cultured in 60LB medium at 200rpm at 37 ℃ for 12 hours, and then inoculated at 1% to 50mL of 60MMG medium at 200rmp at 37 ℃ for 48 hours. After 48 hours, the cells were collected and the dry cell weight and PHA content were measured, the results of which are shown in Table 4 belowShown in the figure.
Table 4: various kinds ofHalomonas bluephagenesisRecombinant bacteria synthesized PHA and its monomer 4HB and 3HV
Figure DEST_PATH_IMAGE004
Recombinant bacteriumHalomonas bluephagenesis TDB1-V1, TDB1-V3, TDB1-V6, TDB3-V1, TDB3-V3, TDB3-V6, TDB5-V1, TDB5-V3 and TDB5-V6 can produce P (3HB-4HB-3HV) when a non-relevant carbon source (glucose) is used as a substrate. Recombinant bacteriumHalomonas bluephagenesis The 4HB proportion of P (3HB-4HB-3HV) produced by TDB1-V1, TDB1-V3 and TDB1-V6 is about 5%; recombinant bacteriumHalomonas bluephagenesis The 4HB proportion of P (3HB-4HB-3HV) produced by TDB3-V1, TDB3-V3 and TDB3-V6 is about 8%; recombinant bacteriumHalomonas bluephagenesis The 4HB ratio of P (3HB-4HB-3HV) produced by TDB5-V1, TDB5-V3 and TDB5-V6 is about 11%, which indicates that the 4HB ratio of P (3HB-4HB-3HV) produced by recombinant bacteria is related to 4HB metabolismogdA、sucD、4hbD、orfZThe expression intensity of the gene is positively correlated. Likewise, recombinant bacteriaHalomonas bluephagenesis The 3HV proportion of P (3HB-4HB-3HV) produced by TDB1-V1, TDB3-V1 and TDB5-V1 is about 4 percent; recombinant bacteriumHalomonas bluephagenesis The 3HV proportion of P (3HB-4HB-3HV) produced by TDB1-V3, TDB3-V3 and TDB5-V3 is about 11%; recombinant bacteriumHalomonas bluephagenesis The 3HV proportion of P (3HB-4HB-3HV) produced by TDB1-V6, TDB3-V6 and TDB5-V6 is about 15%, which indicates that the 3HV proportion of P (3HB-4HB-3HV) produced by recombinant bacteria is related to 3HV metabolismscpA、scpBThe expression intensity of the genes is positively correlated. By adjusting the expression intensity of the two groups of genes, the recombinant bacteria can produce P (3HB-4HB-3HV) products with different 4HB ratios and 3HV ratios.
Example 5: continuing to introduce into halophilic bacteriadhaT、aldDGene to increase the 4HB ratio
The invention is through in the recombinant bacteriumHalomonas bluephagenesis TDB3-V3 design 1, 3-propanediol dehydrogenase (Dhat) and acetaldehyde dehydrogenase using pSEVA321 plasmid backbone with Pporin58 promoter(AldD) introducing strain. The plasmid was transferred into the strain in a conjugative transformation manner to assist in the synthesis of 4-Hydroxybutyrate (4-Hydroxybutyrate), which is a 4HB precursor, and the 4HB ratio of the product P (3HB-4HB-3HV) was increased by the action of 4-hydroxybutyryl CoA transferase (OrfZ) and PHA synthase (PhaC) as described in example 3. The related principle is shown in figure 1. The strain constructed by this operation was named TDB 40.
The recombinant bacterium and the starting bacteriumHalomonas bluephagenesisTD01 was cultured in 60LB medium at 200rpm at 37 ℃ for 12 hours, and then inoculated at 1% to 50mL of 60MMG medium at 200rmp at 37 ℃ for 48 hours. After 48 hours, the cells were collected, and the dry cell weight and PHA content were measured, and the results are shown in Table 5 below.
Table 5: expression ofdhaTAndaldDto increase the ratio of 4HB in P (3HB-4HB-3HV)
Figure 791799DEST_PATH_IMAGE005
Starting bacteria by adding related carbon source gamma-butyrolactoneHalomonas bluephagenesis TD01 still contains no 4HB and 3HV components in the accumulated PHA due to the lack of related genes; and the recombinant bacteriumHalomonas bluephagenesis TDB3-V3 and recombinant bacteriumHalomonas bluephagenesis In PHA accumulated by TDB40, the proportion of 4HB components is increased by 10% compared with that of gamma-butyrolactone which is not added with a related carbon source, which indicates that the recombinant bacteria can utilize the related carbon source gamma-butyrolactone to synthesize 4HB, thereby increasing the proportion of 4HB in a product P (3HB-4HB-3 HV).
Starting bacteria by adding related carbon source 1, 4-butanediolHalomonas bluephagenesis TD01 still contains no 4HB and 3HV components in the accumulated PHA due to the lack of related genes; recombinant bacteriumHalomonas bluephagenesis The proportion of 4HB in PHA accumulated by TDB3-V3 is not obviously increased compared with that of 1, 4-butanediol without adding related carbon source; and the recombinant bacteriumHalomonas bluephagenesis In PHA accumulated by TDB40, the proportion of 4HB component is improved by 7 percent compared with that of 1, 4-butanediol component without related carbon source, which indicates that 2 genes contained in the plasmid vector can realize the benefit in halomonas4HB is synthesized by using related carbon source 1, 4-butanediol, so that the proportion of 4HB in the product P (3HB-4HB-3HV) is increased.
Example 6: knock-out in halophilic bacteriagabD、sadGene, increasing the ratio of 4HB in P (3HB-4HB-3HV)
The invention is realized by using halophilic bacteriaHalomonas bluephagenesis In TDB40, homologous genes encoding Succinic hemiacetal dehydrogenase in halomonas are determined through genome sequencing analysis and gene annotation of halomonas, and by utilizing a homologous recombination technology, homologous arms are designed at 500bp around a target gene to knock out NADP-dependent Succinic hemiacetal dehydrogenase (GabD) and NAD/NADP-dependent Succinic hemiacetal dehydrogenase (Sad) respectively to promote conversion of Succinic semialdehyde (Succinic-semialdehyde) to 4HB metabolic pathways more, so that the 4HB proportion of a product P (3HB-4 HB-HV 3HV) is increased. The related principle is shown in figure 1. The corresponding knockdown bacteria are named TDB40D, TDB40d, TDB40Dd, etc.
The knock-out bacterium and the starter bacteriumHalomonas bluephagenesisTDB40 was cultured in 60LB medium at 200rpm and 37 ℃ for 12 hours, and then inoculated at 1% to 50mL of 60MMG medium at 200rmp and 37 ℃ for 48 hours. After 48 hours, the cells were collected, and the dry cell weight and PHA content were measured, and the results are shown in Table 6 below.
Table 6: knock-outgabD、sadGene, increasing the ratio of 4HB in P (3HB-4HB-3HV)
Figure DEST_PATH_IMAGE006
Knock-out bacteriaHalomonas bluephagenesis TDB40D, TDB40d and TDB40Dd all have higher 4HB ratio than that of the starting bacteria under the same culture conditionsHalomonas bluephagenesisThe improvement of TDB40 indicates that the knockout of the 2 genes can improve the 4HB conversion rate of halomonas in the synthesis of P (3HB-4HB-3HV) by using a non-related carbon source (glucose) as a substrate.
Example 7: knock-out in halophilic bacteriasdhA、sdhEGene, increasing the 3HV ratio in P (3HB-4HB-3HV)
The invention is realized by using halophilic bacteriaHalomonas bluephagenesis In TDB40Dd, by using CRISPR/Cas9 technology, the plasmid with gRNAs with sequences acgcaccagtcatcatcagt (SEQ ID NO: 2) and ctgacgcgttaaaacattgtc (SEQ ID NO: 3) is constructed by taking pSEVA321 as a framework, and succinate dehydrogenase A (SdhA) and succinate dehydrogenase E (SdhE) are respectively knocked out to promote more conversion of Succinyl-coenzyme A (succininyl-CoA) to a 3HV metabolic pathway, so that the 3HV proportion of a product P (3HB-4HB-3HV) is increased. The related principle is shown in figure 1. The corresponding knockout bacteria are named as TDB40A, TDB40E and the like.
The knock-out bacterium and the starter bacteriumHalomonas bluephagenesis TDB40Dd was cultured in 60LB medium at 200rpm and 37 ℃ for 12 hours, and then inoculated at 1% to 50mL of 60MMG medium at 200rmp and 37 ℃ for 48 hours. After 48 hours, the cells were collected, and the dry cell weight and PHA content were measured, and the results are shown in Table 7 below.
Table 7: knock-outsdhA、sdhEGene, increasing the 3HV ratio in P (3HB-4HB-3HV)
Figure 997128DEST_PATH_IMAGE007
Knock-out bacteriaHalomonas bluephagenesis TDB40A and TDB40E have higher 3HV ratio of PHA than that of original bacteria under the same culture conditionsHalomonas bluephagenesisThe improvement of TDB40Dd shows that the knockout of the 2 genes can improve the 3HV conversion rate of halomonas in the synthesis of P (3HB-4HB-3HV) by using a non-related carbon source as a substrate. However, knocking out the sdhA gene has a large influence on the growth of bacteria.
Example 8: introduction into halophilic bacteriaphaA、phaB、phaCGene, increase the overall PHA content
The invention is realized by using halophilic bacteriaHalomonas bluephagenesis TDB40E containing Pporin58 promoter andRalstonia eutrophathe promoter of (1) has been introduced with exogenous beta-ketothiolase (PhaA), acetoacetyl-CoA (PhaB) and PHA synthase (PhaC) at the G51 site on the genome to promote the synthesis and copolymerization of 3HB, 4HB, and 3HV components, thereby increasing the yield of P (3HB-4HB-3 HV). The related principle is shown in figure 1. The operation ofThe constructed strain was named TDB 40H.
The recombinant bacterium and the starting bacteriumHalomonas bluephagenesisTDB40E was cultured in 60LB medium at 200rpm and 37 ℃ for 12 hours, and then inoculated at 1% to 50mL of 60MMG medium at 200rmp and 37 ℃ for 48 hours. After 48 hours, the cells were collected, and the dry cell weight and PHA content were measured, and the results are shown in Table 8 below.
Table 8: expression ofphaA、phaBAndphaCincreasing P (3HB-4HB-3HV) yield
Figure DEST_PATH_IMAGE008
Recombinant bacteriumHalomonas bluephagenesis TDB40H has cell dry weight and PHA content higher than those of original strain under the same culture conditionsHalomonas bluephagenesisThe improvement of TDB40E shows that the introduction of the 3 genes can improve the P (3HB-4HB-3HV) yield of halomonas.
Example 9: recombinant bacteria in batch fed-batch fermentation for producing P (3HB-4HB-3HV)
The recombinant bacterium obtained in example 4 was repeatedly subjected to the operations of examples 5 to 8Halomonas bluephagenesis TDB1-V1 and TDB5-V6, and finally constructed strains are named as TDB41H and TDB 42H.
By recombinant bacteriaHalomonas bluephagenesis The batch-wise fed-batch fermentation of TDB40H, TDB41H and TDB42H in 7L fermentors for producing P (3HB-4HB-3HV), wherein each strain is fed into 2 7L fermentors in each batch, each batch is fed into 2 batches, and the parallel data of each strain are summed up by the following specific method:
the frozen bacteria are cultured in a 60LB plate culture medium at 37 ℃ for 24h and activated for 3 times. A single colony is selected and inoculated in a 60LB culture medium at 37 ℃, cultured at 200rpm for 12 hours and then inoculated in a fermentation culture medium, and the inoculation amount is 10 percent. The fermentation medium was 60 MMG. The temperature was controlled at 37 ℃. The pH was controlled at pH 8.5. The bacteria themselves metabolise to produce acids, so the pH is adjusted only by 5M NaOH. If the pH value exceeds 9, the fermentation is abnormal, and the fermentation is stopped. The dissolved oxygen was controlled to be 30% or more under the permission of the equipment conditions, the initial stirring speed was 200rpm and the maximum was 800rpm, and the air aeration was 3L/min. The feed is divided into cellsGrowth supplement and product production supplement: the cell growth feed solution is prepared by dissolving 800g/L glucose, 20g/L yeast extract and 15g/L urea in tap water, and continuously feeding for 6-20 h; product production feed solution 800g/L glucose was dissolved in tap water and fed continuously after 20 h. The glucose concentration is detected off-line, a certain regulation delay exists, the glucose concentration is controlled to fluctuate between 0 and 20g/L after fermentation for 6 hours and is controlled to be 10g/L as much as possible. Fermenting to OD600The fermentation was terminated without further growth, and this test was conducted by terminating the fermentation process at 48 hours and examining the dry cell weight CDW, PHA content, 4HB ratio and 3HV ratio in the fermentation broth, and the results are shown in Table 9 below.
Table 9: fermentation level of recombinant bacteria TDB40H, TDB41H and TDB42H for producing P (3HB-4HB-3HV)
Figure 139396DEST_PATH_IMAGE009
Recombinant bacteriumHalomonas bluephagenesis The 4HB proportion of P (3HB-4HB-3HV) produced by TDB40H is about 11%, the 3HV proportion is about 7%, and the yield is about 66 g/L; recombinant bacteriumHalomonas bluephagenesis The 4HB proportion of P (3HB-4HB-3HV) produced by TDB41H is about 5%, the 3HV proportion is about 4%, and the yield is about 72 g/L; recombinant bacteriumHalomonas bluephagenesis The 4HB proportion of P (3HB-4HB-3HV) produced by TDB42H is about 16%, the 3HV proportion is about 22%, and the yield is about 36 g/L, which indicates that the recombinant bacteriumHalomonas bluephagenesis TDB40H, TDB41H and TDB42H have stable fermentation level in batch fed-batch fermentation for producing P (3HB-4HB-3 HV).
Example 10: adjusting 4HB ratio and 3HV ratio of P (3HB-4HB-3HV) by adjusting feeding strategy in batch feeding fermentation process
Halophilic bacteriaHalomonas bluephagenesisThe fermentation process of (a) can be divided into a cell growth phase and a product production phase, which can be controlled to switch over by the feeding strategy described in example 9. In the cell growth stage, halophilic bacteria can grow and proliferate cells, and express and synthesize a large amount of protein. By extending the growth phase of the cells, canSo as to obtain more expression of the synthetic proteins of 4HB and 3HV, thereby improving the 4HB proportion and the 3HV proportion of the product P (3HB-4HB-3 HV).
By recombinant bacteriaHalomonas bluephagenesis TDB40H was fed batch fermentation in a 7L fermentor to produce P (3HB-4HB-3HV), feeding was switched among 16h, 20h, 24h and 28h, and the results of measurement of the dry cell weight CDW, PHA content, 4HB ratio and 3HV ratio in the fermentation broth after completion of fermentation were as shown in Table 10 below, except for the other fermentation conditions.
Table 10: effect of feed switching time on the 4HB to 3HV ratio of P (3HB-4HB-3HV) produced by TDB40H
Figure DEST_PATH_IMAGE010
Along with the delay of the switching time of the feeding, the recombinant bacteriaHalomonas bluephagenesis The 4HB ratio and the 3HV ratio of P (3HB-4HB-3HV) produced by TDB40H are gradually increased, which shows that the proper extension of cell growth time can improve the synthesis of more 4HB and 3HV synthetic proteins by bacteria, thereby improving the 4HB ratio and the 3HV ratio of the product P (3HB-4HB-3 HV).
Example 11: adding related carbon source to increase the 4HB ratio and 3HV ratio of P (3HB-4HB-3HV) in batch fed-batch fermentation process
The invention improves the recombinant bacteria by additionally adding related carbon source gamma-butyrolactone in the batch feed fermentation processHalomonas bluephagenesis 4HB proportion of P (3HB-4HB-3HV) produced by TDB40H, and improvement of recombinant bacteria by additional addition of related carbon source propionic acidHalomonas bluephagenesis 3HV proportion of P (3HB-4HB-3HV) produced by TDB 40H.
By recombinant bacteriaHalomonas bluephagenesis TDB40H was fed batch fermentation in a 7L fermentor to produce P (3HB-4HB-3HV), the fermentation conditions were the same as those described in example 9, the relevant carbon source was fed slowly after 20 hours of switched feeding, and the dry cell weight CDW, PHA content, 4HB ratio and 3HV ratio in the fermentation broth after the end of fermentation were measured, and the results are shown in Table 11 below.
Table 11: effect of the relevant carbon sources on the 4HB to 3HV ratio of P (3HB-4HB-3HV) produced by recombinant TDB40H
Figure 774908DEST_PATH_IMAGE011
Recombinant bacteria after adding 4HB related carbon source (gamma-butyrolactone)Halomonas bluephagenesis The 4HB proportion of P (3HB-4HB-3HV) produced by TDB40H is greatly improved; after the 3 HV-related carbon source (propionic acid) is added, the recombinant bacteriaHalomonas bluephagenesis The 3HV proportion of P (3HB-4HB-3HV) produced by TDB40H is also greatly improved, which shows that the addition of related carbon sources can improve the 4HB proportion and the 3HV proportion of the product P (3HB-4HB-3HV) to a certain extent. The simultaneous addition of two related carbon sources will increase slightly less and will have an impact on yield.
Example 12: performance characterization of P (3HB-4HB-3HV) material produced by recombinant bacteria
In this experiment, the P (3HB-4HB-3HV) material obtained in examples 9 to 11 was extracted and purified by organic extraction, specifically as follows:
and (4) centrifuging the bacterial liquid at 5000rpm for 30min to collect bacterial precipitates. The cells were washed once with a re-suspended tap water, centrifuged again at 5000rpm for 30min and the supernatant discarded. Freezing the thallus at-80 deg.C for 1 hr, and vacuum freeze drying for more than 24 hr to completely remove water.
The dried cells were soaked in 15mL of chloroform solvent per gram for 24 hours. The suspension was centrifuged at 8000rpm for 10min, and the insoluble material was removed. Mixing ethanol at the ratio of supernatant to ethanol =1:5, centrifuging at 5000rpm for 30min, and discarding the supernatant. Air-drying in a fume hood, centrifuging, and precipitating to obtain high-purity P (3HB-4HB-3HV) product.
This experiment analyzed the PHA content, 4HB ratio and 3HV ratio of the P (3HB-4HB-3HV) material obtained in examples 9-11 by Gas Chromatography (GC). The specific method comprises the following steps:
preparing an esterification solution: 485mL of anhydrous methanol is taken, 1g/L of benzoic acid is added, and 15mL of concentrated sulfuric acid is slowly dropped to prepare about 500mL of esterification solution.
Sample preparation: 30 to 40mg of the freeze-dried cells or 20 to 30mg of the purified P (3HB-4HB-3HV) product were weighed out, and placed in an esterification tube. Approximately 10 to 30mg of PHB sample was weighed and treated in the same manner as a standard sample of 3 HB. A sample of about 10 to 20mg of gamma-butyrolactone was weighed and treated in the same manner as a standard sample of 4 HB. Samples of PHBV ranging from about 20 to 30mg were weighed out and treated in the same manner as a 3HV standard. 2mL of the esterified solution and 2mL of chloroform were added to all the samples. The esterification tube was capped and sealed, and then reacted at 100 ℃ for 4 hours. After the reaction is finished, cooling the esterification pipe to room temperature, adding 1mL of deionized water, performing vortex oscillation until the mixture is fully mixed, and standing for layering. After complete separation of the aqueous and organic phases, the lower organic phase was removed for Gas Chromatography (GC) analysis.
Analysis by GC of PHA composition and content: a gas chromatograph model GC-2014 from shimadzu was used. The chromatograph is configured to: an HP-5 type capillary chromatographic column, a hydrogen flame ionization detector FID and an SPL shunt sample inlet; high-purity nitrogen is used as carrier gas, hydrogen is fuel gas, and air is combustion-supporting gas; an AOC-20S autosampler was used, acetone being the wash liquid. The settings of the GC analysis program were: the sample inlet temperature is 240 ℃, the detector temperature is 250 ℃, the initial column temperature is 80 ℃, and the temperature is maintained for 1.5 minutes; ramping up to 140 degrees at a rate of 30 degrees/minute and maintaining for 0 minute; ramping up to 240 degrees at a rate of 40 degrees/minute and maintaining for 2 minutes; the total time was 8 minutes. And quantitatively calculating the PHA composition and content according to peak areas by adopting an internal standard normalization method according to the GC result.
This experiment P (3HB-4HB-3HV) materials obtained in examples 9-11 were analyzed for glass transition temperature (T) by Differential Scanning Calorimeter (DSC)g) Melting Point (T)m) The results of the iso-thermal mechanical properties are shown in Table 12. The specific method comprises the following steps:
sample preparation: 5.00 to 10.00mg of purified P (3HB-4HB-3HV) product was weighed, accurately weighed, charged into a crucible and capped.
DSC analysis PHA thermodynamic performance: a DSC model Q2000 from TA was used. High-purity nitrogen is taken as an environment, and the nitrogen flow rate is 50 mL/min. Settings for DSC analysis program: the sample was first warmed to 200 ℃ at a rate of 40 ℃/min and held at 200 ℃ for 2 minutes to eliminate the previous thermal history, then ramped to-50 ℃ at a rate of 10 ℃/min, and finally ramped to 200 ℃ at a rate of 10 ℃/min.
This experiment was conducted by analyzing the material properties such as Young's modulus, tensile strength, elongation at break and the like of the P (3HB-4HB-3HV) materials obtained in examples 9 to 11 by means of a tensile machine. The specific method comprises the following steps:
sample preparation: 0.5 to 1.0g of the purified P (3HB-4HB-3HV) product was weighed, dissolved well in20 mL of chloroform, and then placed on a glass plate and allowed to stand for membrane development. And after the PHA membrane is completely dried, taking out the PHA membrane, and knocking out the PHA membrane by using a mold to test the required shape of the sample. The thickness, length, width, etc. of each sample were measured with a vernier caliper.
Analyzing the material performance by a tensile machine: a tensile machine of type AI-7000S from GOTECH was used. The sample was clamped into the mold and fine-tuned to straighten the sample. The settings of the analysis program were: the test speed of 10mm/min stretches the sample with a break sensitivity of 50Max.%, a force limit of 18kgf and a deformation limit of 500 mm. The system can automatically calculate the material properties such as Young modulus, tensile strength, elongation at break and the like.
Table 12: material thermodynamic properties of different materials PHA
Figure DEST_PATH_IMAGE012
Note: no melting point was determined at a temperature of 200 ℃ or lower
P (3HB-4HB-3HV) material produced by recombinant bacteria, PHB and P (3HB-co-4HB)、P(3HB-co-3HV) material comparison, higher glass transition temperature, lower young's modulus and greater elongation at break. Due to the limitation of hardware equipment, the program temperature cannot exceed 200 ℃, so that the melting point peak of the P (3HB-4HB-3HV) material produced by the recombinant bacteria is not detected, and the P (3HB-4HB-3HV) material cannot be judged to have a melting point higher than 200 ℃ or have no melting point. However, the test result is not influenced, which shows that the performance of the P (3HB-4HB-3HV) material is better than that of PHB and P (3HB-co-4HB)、P(3HB-co-3HV) material.
Example 13: recombinant bacteriumHalomonas campaniensis LS21 production P (3HB-4HB-3HV)
The invention is through in the recombinant bacteriumHalomonas campaniensis LS21 CGMCC No.6593 uses CRISPR/Cas9 technology on genome to construct plasmid with pSEVA321 as skeleton and gRNA with corresponding sequence, and knockouts 2-methyl citrate synthetase (PrpC), NADP dependent succinic acid hemiacetal dehydrogenase (GabD), NAD/NADP dependent succinic acid hemiacetal dehydrogenase (Sad), succinate dehydrogenase E (SdhE). Methylmalonyl-coa mutase (ScpA) and methylmalonyl-coa decarboxylase (ScpB) are introduced into the G49 site; 2-ketoglutarate decarboxylase (OgdA), succinate semialdehyde dehydrogenase (SucD), 4-hydroxybutyrate dehydrogenase (4 hbd) and 4-hydroxybutyryl coenzyme A transferase (OrfZ) are introduced into the G4 site; the introduction of 1, 3-propanediol dehydrogenase (Dhat) and acetaldehyde dehydrogenase (AldD) at the G7 site allowed the recombinant strain LSBV to synthesize P (3HB-4HB-3 HV).
The recombinant strain LSBV is cultured in 40LB culture medium at 200rpm and 37 ℃ for 12 hours, and then is inoculated to 50mL of 40MMG culture medium at 200rmp and 37 ℃ according to 1 percent for 48 hours. 40MMG culture medium is respectively added with carbon sources: 30g/L glucose, sodium gluconate, glycerol, acetic acid, caproic acid, xylose, cellulose, lactose and fructose. After 48 hours, the cells were collected, and the dry cell weight and PHA content were measured, the results of which are shown in Table 13 below.
Table 13: the recombinant strain LSBV is synthesized into a P (3HB-4HB-3HV) material in MMG culture media with different carbon sources
Figure 104258DEST_PATH_IMAGE013
Example 14: recombinant bacteriumHalomonas aydingkolgenesisM1 production P (3HB-4HB-3HV)
The invention is through in the recombinant bacteriumHalomonas aydingkolgenesisM1 CGMCC NO.19880, on the genome, a plasmid with pSEVA321 as the framework and a gRNA with a corresponding sequence was constructed by using CRISPR/Cas9 technology, and 2-methyl citrate synthetase (PrpC), NADP-dependent succinic hemiacetal dehydrogenase (GabD), NAD/NADP-dependent succinic hemiacetal dehydrogenase (Sad), succinate dehydrogenase E (SdhE) were knocked out. At the G49 site, methylmalonyl-CoA mutase (ScpA) and formazan were introducedAn alkylmalonyl-coenzyme A decarboxylase (ScpB); 2-ketoglutarate decarboxylase (OgdA), succinate semialdehyde dehydrogenase (SucD), 4-hydroxybutyrate dehydrogenase (4 hbd) and 4-hydroxybutyryl coenzyme A transferase (OrfZ) are introduced into the G4 site; the recombinant bacteria MBV can synthesize P (3HB-4HB-3HV) by introducing 1, 3-propanediol dehydrogenase (Dhat) and acetaldehyde dehydrogenase (AldD) at the G7 site.
The recombinant strain MBV is cultured in 60LB culture medium at 200rpm and 37 ℃ for 12 hours, and then inoculated to 50mL of 60MMG culture medium at 200rmp and 37 ℃ for 48 hours according to 1 percent. Respectively adding carbon sources into an MMG culture medium: 30g/L glucose, caproic acid, xylose, cellulose, lactose and fructose. After 48 hours, the cells were collected, and the dry cell weight and PHA content were measured, the results of which are shown in Table 14 below.
Table 14: recombinant bacteria MBV synthesizes P (3HB-4HB-3HV) material in MMG culture medium with different carbon sources
Figure DEST_PATH_IMAGE014
Example 15: recombinant bacteriumPseudomonas putidaProduction P (3HB-4HB-3HV)
The invention is through in the recombinant bacteriumPseudomonas putidaIn the method, plasmids of gRNA having pSEVA321 as a backbone and corresponding sequences were constructed on the genome by using CRISPR/Cas9 technology, and 2-methyl citrate synthase (PrpC), NADP-dependent succinic hemiacetal dehydrogenase (GabD), NAD/NADP-dependent succinic hemiacetal dehydrogenase (Sad), succinate dehydrogenase E (SdhE), 3-hydroxyacyl-CoA acylase (PhaG), and enoyl-CoA hydratase (PhaJ) were deleted. The ccaccgccagggtaatgacc (SEQ ID NO: 4) site of the genome is inserted with beta-ketothiolase (PhaA); insertion of acetoacetyl-CoA (PhaB) at position caacggcaccgtgttcggcg (SEQ ID NO: 5); insertion of methylmalonyl-CoA mutase (ScpA) and methylmalonyl-CoA decarboxylase (ScpB) at position ggcaccgtgttcggcgacaa (SEQ ID NO: 6); the insertion of 2-ketoglutarate decarboxylase (OgdA), succinate semialdehyde dehydrogenase (SucD), 4-hydroxybutyrate dehydrogenase (ABA) at the cttgcaggcgctgtgggtgc (SEQ ID NO: 7) siteCatalase (4 hbd), 4-hydroxybutyryl-CoA transferase (OrfZ), 1, 3-propanediol dehydrogenase (Dhat) and acetaldehyde dehydrogenase (AldD) at position cttcgagccagccatcccgg (SEQ ID NO: 8) to allow P (3HB-4HB-3HV) synthesis by recombinant bacteria PPBV.
Culturing the recombinant strain PPBV in LB culture medium at 200rpm and 37 ℃ for 12 hours, then inoculating the recombinant strain PPBV to a new 50mLLB culture medium at 200rpm and 37 ℃ for 48 hours according to 1 percent. Adding carbon sources into LB culture medium respectively: 25g/L glucose, 4.5g/L decanoic acid, 5g/L dodecanoic acid and 5 g/L9-decenol. After 48 hours, the cells were collected, and the dry cell weight and PHA content were measured, the results of which are shown in Table 15 below.
Table 15: recombinant bacterium PPBV synthesizes P (3HB-4HB-3HV) material in MMG culture medium with different carbon sources
Figure 116208DEST_PATH_IMAGE015
Example 16: recombinant bacteriumEscherishia coliProduction P (3HB-4HB-3HV)
The invention is realized by using Escherichia coliEscherishia coli2-methyl citrate synthetase (PrpC) is removed from a plasmid which is constructed by using CRISPR/Cas9 technology on a genome and takes pSEVA321 as a framework and has a ctcgaccctacaaatgataac (SEQ ID NO: 9) sequence; constructing plasmid with ctttgaaaacaggatgtagc (SEQ ID NO: 10) sequence as gRNA to knock out NADP dependent succinic hemiacetal dehydrogenase (GabD); constructing plasmid knock-out NAD/NADP dependent succinic hemiacetal dehydrogenase (Sad) by taking ctcctttatgagtcatggtat (SEQ ID NO: 11) sequence as gRNA; a plasmid knockout succinate dehydrogenase E (SdhE) was constructed with the cttcctgtctcacgaaaatc (SEQ ID NO: 12) sequence as the gRNA. A methylmalonyl-CoA mutase (ScpA) and a methylmalonyl-CoA decarboxylase (ScpB) are inserted into the non-functional region gtttctgcgttgtccatacc (SEQ ID NO: 13); the insertion of 2-ketoglutarate decarboxylase (OgdA), succinate semialdehyde dehydrogenase (SucD), 4-hydroxybutyrate dehydrogenase (4 hbd), 4-hydroxybutyryl coenzyme A transferase (OrfZ) at position gttcctttcattcaatcctc (SEQ ID NO: 14); at position gtatctcattgttagataatg (SEQ ID NO: 15)The recombinant bacterium ECBV can synthesize P (3HB-4HB-3HV) by inserting 1, 3-propanediol dehydrogenase (dhaT) and acetaldehyde dehydrogenase (AldD).
The recombinant bacterium ECBV is cultured in LB culture medium at 200rpm and 37 ℃ for 12 hours, and then inoculated to 50mL of MMG culture medium at 200rmp and 37 ℃ for 48 hours according to 1 percent. Respectively adding carbon sources into an MMG culture medium: 20g/L glucose, glycerol and 5g/L acetic acid. After 48 hours, the cells were collected, and the dry cell weight and PHA content were measured, the results of which are shown in Table 16 below.
Table 16: recombinant bacterium PPBV synthesizes P (3HB-4HB-3HV) material in MMG culture medium with different carbon sources
Figure DEST_PATH_IMAGE016
Example 17: recombinant bacteriumRalstonia eutrophaProduction P (3HB-4HB-3HV)
The invention is realized by culturing the bacillus eutrophicus roseiRalstonia eutrophaIn (2), 2-methyl citrate synthase (PrpC), NADP-dependent succinic hemiacetal dehydrogenase (GabD), NAD/NADP-dependent succinic hemiacetal dehydrogenase (Sad), succinate dehydrogenase E (SdhE) were deleted from the genome by homologous recombination. The genome was introduced with methylmalonyl-CoA mutase (ScpA) and methylmalonyl-CoA decarboxylase (ScpB) at position gaaaatggccactgataaggc (SEQ ID NO: 16); the insertion of 2-ketoglutarate decarboxylase (OgdA), succinate semialdehyde dehydrogenase (SucD), 4-hydroxybutyrate dehydrogenase (4 hbd), 4-hydroxybutyryl coenzyme A transferase (OrfZ) at position cttgataaacggaggcatgg (SEQ ID NO: 17); the recombinant bacterium REBV can synthesize P (3HB-4HB-3HV) by inserting 1, 3-propanediol dehydrogenase (Dhat) and acetaldehyde dehydrogenase (AldD) at the position cacagacatttcggcgccgc (SEQ ID NO: 18).
The recombinant strain REBV is cultured in LB culture medium at 200rpm and 37 ℃ for 12 hours, and then inoculated into 50mL of 20MMG culture medium at 200rmp and 37 ℃ for 48 hours according to 1 percent. 20, respectively adding carbon sources into MMG culture medium: 20g/L fructose, 17g/L palm oil. After 48 hours, the cells were collected, and the dry cell weight and PHA content were measured, the results of which are shown in Table 17 below.
Table 17: the recombinant bacteria REBV can synthesize P (3HB-4HB-3HV) material in MMG culture medium with different carbon sources
Figure 847403DEST_PATH_IMAGE017
Example 18: recombinant bacteriumAeromonas hydrophilaProduction P (3HB-4HB-3HV)
The invention is realized by culturing the bacillus eutrophicus roseiAeromonas hydrophilaIn (2), 2-methyl citrate synthase (PrpC), NADP-dependent succinic hemiacetal dehydrogenase (GabD), NAD/NADP-dependent succinic hemiacetal dehydrogenase (Sad), succinate dehydrogenase E (SdhE) were knocked out on the genome by homologous recombination. At the gcgagaccaatatgaagaaat (SEQ ID NO: 19) site of the genome, methylmalonyl-CoA mutase (ScpA) and methylmalonyl-CoA decarboxylase (ScpB) were introduced; the insertion of 2-ketoglutarate decarboxylase (OgdA), succinate semialdehyde dehydrogenase (SucD), 4-hydroxybutyrate dehydrogenase (4 hbd), 4-hydroxybutyryl coenzyme A transferase (OrfZ) at position gcttatgggtggttatgggt (SEQ ID NO: 20); p (3HB-4HB-3HV) can be synthesized by recombinant AHBV by inserting 1, 3-propanediol dehydrogenase (Dhat) and acetaldehyde dehydrogenase (AldD) at position gttgatgtcttcagtgttcg (SEQ ID NO: 21).
After culturing the recombinant bacterium AHBV in LB culture medium at 200rpm and 30 ℃ for 12 hours, inoculating the cultured bacterium to 50mL MS culture medium added with 8g/L of lauric acid according to 1%, culturing at 200rmp and 30 ℃ for 72 hours, collecting the bacterium, and detecting the dry cell weight and PHA content, wherein the results are shown in the following table 18.
Table 18: recombinant bacteria AHBV synthesizes P (3HB-4HB-3HV) material in MMG culture medium with different carbon sources
Figure DEST_PATH_IMAGE018
Example 19: recombinant bacteriumAlcaligenes latusProduction P (3HB-4HB-3HV)
The invention produces the alkali rod by the Eubacterium rolfsii giantBacteriaAlcaligenes latusIn (2), 2-methyl citrate synthase (PrpC), NADP-dependent succinic hemiacetal dehydrogenase (GabD), NAD/NADP-dependent succinic hemiacetal dehydrogenase (Sad), succinate dehydrogenase E (SdhE) were knocked out on the genome by homologous recombination. At the gcgcatagcagaccgcgata (SEQ ID NO: 22) site of the genome, methylmalonyl-CoA mutase (ScpA) and methylmalonyl-CoA decarboxylase (ScpB) were introduced; the insertion of 2-ketoglutarate decarboxylase (OgdA), succinate semialdehyde dehydrogenase (SucD), 4-hydroxybutyrate dehydrogenase (4 hbd), 4-hydroxybutyryl coenzyme A transferase (OrfZ) at position gctattctaccgtgctgcgc (SEQ ID NO: 23); the recombinant bacterium ALBV can synthesize P (3HB-4HB-3HV) by inserting 1, 3-propanediol dehydrogenase (Dhat) and acetaldehyde dehydrogenase (AldD) at the position gcagtcagccggcggcgctg (SEQ ID NO: 24).
After culturing the recombinant bacterium ALBV in LB culture medium at 200rpm and 37 ℃ for 12 hours, inoculating the strain to 50mL of 10MMG culture medium at 200rmp and 37 ℃ for 36 hours according to 1 percent. Then transferring the thalli to a new 10MMG culture medium and respectively adding carbon sources: 10g/L of sucrose, sodium gluconate, glycerol and acetic acid. After 48 hours, the cells were collected, and the dry cell weight and PHA content were measured, the results of which are shown in Table 19 below.
Table 19: recombinant bacterium ALBV synthesizes P (3HB-4HB-3HV) material in MMG culture medium with different carbon sources
Figure 857079DEST_PATH_IMAGE019
The preferred embodiments of the present invention have been described in detail, however, the present invention is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solution of the present invention within the technical idea of the present invention, and these simple modifications are within the protective scope of the present invention.
It should be noted that the various technical features described in the above embodiments can be combined in any suitable manner without contradiction, and the invention is not described in any way for the possible combinations in order to avoid unnecessary repetition.
SEQUENCE LISTING
<110> Qinghua university, Beijing micro-structured workshop Biotechnology Ltd
<120> 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid terpolymer P (3HB-4HB-3HV) and its microorganisms
Production of articles
<130> P0102021100744W
<160> 24
<170> PatentIn version 3.5
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cgcaccgtca tcatcaggt 19
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
acgcaccagt catcatcagt 20
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ctgacgcgtt aaaacattgt c 21
<210> 4
<211> 20
<212> DNA
<213> Pseudomonas putida
<400> 4
ccaccgccag ggtaatgacc 20
<210> 5
<211> 20
<212> DNA
<213> Pseudomonas putida
<400> 5
caacggcacc gtgttcggcg 20
<210> 6
<211> 20
<212> DNA
<213> Pseudomonas putida
<400> 6
ggcaccgtgt tcggcgacaa 20
<210> 7
<211> 20
<212> DNA
<213> Pseudomonas putida
<400> 7
cttgcaggcg ctgtgggtgc 20
<210> 8
<211> 20
<212> DNA
<213> Pseudomonas putida
<400> 8
cttcgagcca gccatcccgg 20
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ctcgacccta caaatgataa c 21
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ctttgaaaac aggatgtagc 20
<210> 11
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ctcctttatg agtcatggta t 21
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
cttcctgtct cacgaaaatc 20
<210> 13
<211> 20
<212> DNA
<213> Escherishia coli
<400> 13
gtttctgcgt tgtccatacc 20
<210> 14
<211> 20
<212> DNA
<213> Escherishia coli
<400> 14
gttcctttca ttcaatcctc 20
<210> 15
<211> 21
<212> DNA
<213> Escherishia coli
<400> 15
gtatctcatt gttagataat g 21
<210> 16
<211> 21
<212> DNA
<213> Ralstonia eutropha
<400> 16
gaaaatggcc actgataagg c 21
<210> 17
<211> 20
<212> DNA
<213> Ralstonia eutropha
<400> 17
cttgataaac ggaggcatgg 20
<210> 18
<211> 20
<212> DNA
<213> Ralstonia eutropha
<400> 18
cacagacatt tcggcgccgc 20
<210> 19
<211> 21
<212> DNA
<213> Aeromonas hydrophila
<400> 19
gcgagaccaa tatgaagaaa t 21
<210> 20
<211> 20
<212> DNA
<213> Aeromonas hydrophila
<400> 20
gcttatgggt ggttatgggt 20
<210> 21
<211> 20
<212> DNA
<213> Aeromonas hydrophila
<400> 21
gttgatgtct tcagtgttcg 20
<210> 22
<211> 20
<212> DNA
<213> Alcaligenes latus
<400> 22
gcgcatagca gaccgcgata 20
<210> 23
<211> 20
<212> DNA
<213> Alcaligenes latus
<400> 23
gctattctac cgtgctgcgc 20
<210> 24
<211> 20
<212> DNA
<213> Alcaligenes latus
<400> 24
gcagtcagcc ggcggcgctg 20

Claims (8)

1. A recombinant bacterium, wherein scpA, scpB, sucD, ogdA, 4hbD, orfZ, dhaT and aldD are overexpressed in the recombinant bacterium, and sdhE, gabD, sad and prpC are attenuated to expressThe recombinant bacterium is halophiles bacterium (A), (B), (C)Halomonas) Pseudomonas (a)Pseudomonas) Escherichia coli (E. coli)Escherishia) Eubacterium reuteri (F.), (IIRalstonia eutropha) Aeromonas (A) and (B)Aeromonas) Bacillus (B) and (C)Bacilllus) Or Alcaligenes megaterium: (Alcaligenes latus）。
2. The recombinant bacterium of claim 1, wherein phaA, phaB and phaC are overexpressed in the recombinant bacterium.
3. The recombinant bacterium of claim 1 or 2, wherein phaG and phaJ are attenuated in expression in the recombinant bacterium.
4. The preparation method of the recombinant bacterium is characterized by comprising the steps of over-expressing scpA, scpB, sucD, ogdA, 4hbD, orfZ, dhaT and aldD and weakening the expression of sdhE, gabD, sad and prpC, wherein the recombinant bacterium is halophiles (halophiles) ((sab: (sab)), (dhaT)), (ndd)Halomonas) Pseudomonas (a)Pseudomonas) Escherichia coli (E. coli)Escherishia) Eubacterium reuteri (F.), (IIRalstonia eutropha) Aeromonas (A) and (B)Aeromonas) Bacillus (B) and (C)Bacilllus) Or Alcaligenes megaterium: (Alcaligenes latus）。
5. A method for producing P (3HB-4HB-3HV), which comprises the step of fermentatively culturing the recombinant bacterium according to any one of claims 1 to 3.
6. The method of claim 5, wherein the fermentation medium comprises a source of a related carbon and/or a source of a non-related carbon;
the related carbon source is selected from one or the combination of more than two of gamma-butyrolactone, 4-hydroxybutyric acid, 1, 2-butanediol, 1, 3-butanediol, 1, 4-butanediol, 1, 6-hexanediol, 1, 8-octanediol, 1, 10-decanediol, 1, 12-dodecanediol, propionic acid, valeric acid or heptanoic acid;
the non-related carbon source is one or the combination of more than two of glucose, sodium gluconate, glycerol, acetic acid, caproic acid, xylose, cellulose, lactose and fructose.
7. The method of claim 5 or 6, wherein the feeding is performed at 16-28 hours of the fermentation culture.
8. A method for regulating the monomer ratio of P (3HB-4HB-3HV), which comprises the step of fermentatively culturing the recombinant bacterium according to any one of claims 1 to 3.
CN202210115391.6A 2022-02-07 2022-02-07 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid terpolymer P (3HB-4HB-3HV) and microbial production thereof Active CN114134096B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210115391.6A CN114134096B (en) 2022-02-07 2022-02-07 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid terpolymer P (3HB-4HB-3HV) and microbial production thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210115391.6A CN114134096B (en) 2022-02-07 2022-02-07 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid terpolymer P (3HB-4HB-3HV) and microbial production thereof

Publications (2)

Publication Number Publication Date
CN114134096A CN114134096A (en) 2022-03-04
CN114134096B true CN114134096B (en) 2022-05-13

Family

ID=80381876

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210115391.6A Active CN114134096B (en) 2022-02-07 2022-02-07 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid terpolymer P (3HB-4HB-3HV) and microbial production thereof

Country Status (1)

Country Link
CN (1) CN114134096B (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114807206B (en) * 2022-03-28 2023-03-21 珠海麦得发生物科技股份有限公司 Bacterial strain for synthesizing poly (3-hydroxybutyrate-co-4-hydroxybutyrate) and construction method and application thereof
CN116121218B (en) * 2022-04-06 2023-11-24 深圳蓝晶生物科技有限公司 Engineered microorganisms expressing acetoacetyl-CoA reductase variants and methods of increasing PHA production
CN116042685B (en) * 2022-07-26 2023-09-15 珠海麦得发生物科技股份有限公司 Strain for producing P34HB by utilizing xylose as well as construction method and application thereof
CN115678816A (en) * 2022-12-16 2023-02-03 北京华熙荣熙生物技术研究有限公司 Nitrogen hydrogen single cell bacterium T1 for producing 3-hydroxybutyric acid and application thereof
CN116240155A (en) * 2023-02-13 2023-06-09 清华大学 Recombinant bacterium for producing poly (hydroxy fatty acid-co-lactic acid) and application thereof
CN116904384B (en) * 2023-09-12 2024-08-27 清华大学 Recombinant microorganism and application thereof in production of polyhydroxyalkanoate
CN116970659B (en) * 2023-09-18 2024-02-09 清华大学 Method for producing polyhydroxyalkanoate

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2702138A2 (en) * 2011-04-29 2014-03-05 Metabolix, Inc. Green process for producing polyhydroxyalkanoates and chemicals using a renewable feedstock

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010068953A2 (en) * 2008-12-12 2010-06-17 Metabolix Inc. Green process and compositions for producing poly(5hv) and 5 carbon chemicals
CN102120973B (en) * 2010-12-08 2012-10-10 清华大学 Halomonas strain and application thereof
AU2013203169A1 (en) * 2011-06-22 2013-05-02 Genomatica, Inc. Microorganisms for producing butadiene and methods related thereto
ITTO20120155A1 (en) * 2012-02-21 2013-08-22 So F Ter S P A COMPOSITION OF DURABLE POLYDROSSIALCANOATES
CN111705029B (en) * 2020-07-06 2022-10-21 清华大学 Method for efficiently producing 3-hydroxypropionic acid (3 HP) and derivatives thereof based on halophilic bacteria
CN113583922B (en) * 2021-09-28 2022-03-08 清华大学 Method for producing PHA (polyhydroxyalkanoate) by culturing halophilic bacteria in low-salt culture medium
CN113999869A (en) * 2021-12-31 2022-02-01 清华大学 Promoter with expression intensity regulated by synthesis of bacterial intracellular Polyhydroxyalkanoate (PHA) and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2702138A2 (en) * 2011-04-29 2014-03-05 Metabolix, Inc. Green process for producing polyhydroxyalkanoates and chemicals using a renewable feedstock

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
生产聚羟基脂肪酸酯的微生物细胞工厂;李正军等;《生物工程学报》;20101025(第10期);全文 *

Also Published As

Publication number Publication date
CN114134096A (en) 2022-03-04

Similar Documents

Publication Publication Date Title
CN114134096B (en) 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid terpolymer P (3HB-4HB-3HV) and microbial production thereof
US10829793B2 (en) Transformant that produces copolymerized PHA containing 3HH unit, and method for producing said PHA
Li et al. Production of poly (3-hydroxybutyrate-co-4-hydroxybutyrate) from unrelated carbon sources by metabolically engineered Escherichia coli
Liu et al. Biosynthesis of poly (3-hydroxydecanoate) and 3-hydroxydodecanoate dominating polyhydroxyalkanoates by β-oxidation pathway inhibited Pseudomonas putida
JP5670728B2 (en) Improved polyhydroxyalkanoate-producing microorganism and method for producing polyhydroxyalkanoate using the same
Zhou et al. Production of 3-hydroxypropionate homopolymer and poly (3-hydroxypropionate-co-4-hydroxybutyrate) copolymer by recombinant Escherichia coli
US8956835B2 (en) Methods for producing polyhydroxyalkanoates from biodiesel-glycerol
Ashby et al. Glycerine and levulinic acid: Renewable co-substrates for the fermentative synthesis of short-chain poly (hydroxyalkanoate) biopolymers
CN101845414B (en) Method for preparing hydroxyalkanoate homopolymer and special bacteria thereof
EP2669365B1 (en) Method for producing high-molecular-weight pha
Wang et al. Biosynthetic pathway for poly (3-hydroxypropionate) in recombinant Escherichia coli
WO2024169578A1 (en) Recombinant bacterium which produces poly(hydroxy fatty acid-co-lactic acid), and application thereof
JPWO2017056442A1 (en) Microorganism having gene encoding PHA synthase and method for producing PHA using the same
JPWO2009147918A1 (en) Polyhydroxyalkanoic acid copolymer and process for producing the same
EP2910641B1 (en) High molecular weight pha-producing microbe and method of producing high molecular weight pha using same
US8546125B2 (en) Recombinant hosts and methods for manufacturing polyhydroxyalkanoate
JP6853787B2 (en) A PHA-producing microorganism having sucrose assimilation property, and a method for producing PHA using the microorganism.
EP1862536A1 (en) Microorganism capable of accumulating ultra high molecular weight polyester
CN111363713A (en) Construction method and application of genetic engineering escherichia coli for improving content of lactic acid component in polyhydroxybutyrate lactate
JP2011527367A (en) Polymerization method of glycolic acid using microorganisms
Wang et al. The effect of co-substrate feeding on polyhydroxyalkanoate (PHA) homopolymer and copolymer production in recombinant Escherichia coli LS5218
EP2310518A1 (en) Method for polymerising glycolic acid with microorganisms
WO2024166830A1 (en) Transformed microorganism, and production method of polyhydroxyalkanoic acid
WO2024162411A1 (en) Transformed microorganism, and method for producing copolymerized polyhydroxyalkanoate
Wang et al. Production and Characterization of Copolymers Consisting of 3-Hydroxybutyrate and Enriched 3-Hydroxyvalerate by Beta-Oxidation Weakened Halomonas Bluephagenesis

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant