CN101824465A - Primer for analyzing gene mutation - Google Patents

Abstract

The present invention provides a primer used for accurately and effectively detecting organism mutation. The analytical method of the gene base mutation comprises (a) a stage for amplifying a specific polynucleotide by using a forward primer and a reverse primer, (b) a stage for cutting the amplified specific polynucleotide with a restriction enzyme and producing two or more species of single chain polynucleotide fragments having a size of 2-32 bases and containing a mutated sequence and (c) a stage for measuring the molecular weight of the cut fragments.

Description

The primer that is used for analyzing gene mutation

The application is 200380101469.4 (international application no PCT/KR/2003/002179), the applying date to be dividing an application of the application that on October 17th, 2003, denomination of invention " detects the method for sudden change " for application number.

Technical field

The present invention relates to the method for detection of biological body genovariation, specifically relate to a kind of primer that is used for analyzing gene mutation.Genetic analysis is used for risk assessment, diagnosis, prognosis or the disease treatment of disease.For example, make prediction disease danger become possibility, promote the prevention of disease thus at the mutation analysis of specific people's specific gene.By mutation analysis, can detect the virus that causes disease and whether medicine produced resistance, thereby can effectively treat.

Background technology

The Human Genome Project makes us can more fully weigh danger, diagnosis or the prognosis of disease and prediction to the reaction of pharmacological agent.The analysis of the nucleotide sequence of a large amount of individualities presents pleomorphism site, is referred to as SNPs (single nucleotide polymorphism).SNP appears at variation in the chromosomal nucleotide sequence of organism with distinctive frequency.In human body, approximately SNP appears in per 1,000 base.Consider the size of human genome, millions of SNP are present in the human body.Owing to regard SNP as explain characteristic difference between the individuality means, therefore, SNP can be used for the prevention or the treatment of disease by the diagnosis cause of disease.

The SNP that is found by the Human Genome Project only shows that polymorphism is present in the human body, but does not show how those polymorphisms interrelate with disease.In order to disclose the relation between SNP and the disease, need comparative analysis to show polymorphism pattern among healthy people and the patient, i.e. SNP score.In order accurately to check the relation between SNP and the disease, should a large amount of SNP of correct analysis.

SNP point-score (SNP scoring method) comprises that dna sequencing, PCR-SSCP (polymerase chain reaction,PCR one single strand conformation polymorphism), allele-specific hybridization, oligonucleotide connect (oligo-ligation), micrometering preface (mini-sequencing) and enzyme cutting method.Use the method for DNA chip also to be suggested, but except the carrier that uses the immobilized oligonucleotide probe, this method and allele-specific hybridization are as broad as long on principle.

Two kinds of traditional methods that are used to carry out dna sequencing are Maxam﹠amp; Gilbert Maxam-Gilbert method, and the Sanger method of using recently.The dna sequencing method is in order to understand the nucleotide sequence of whole or portion gene, rather than detects the genovariation of specific site.Because can discern the genovariation of specific site by detecting nucleotide sequence, the dna sequencing method can be used in the SNP score.Yet owing to can read the adjacent nucleotide sequence that need not detect with target SNP, the dna sequencing method is very ineffective.

PCR-SSCP (ORITA, M.et al., Genomics, 1989,5:8874-8879) in, by the pcr amplification sequence that comprises SNP to be analyzed, be divided into strand then.After this, on polyacrylamide gel, carry out electrophoresis.Because the difference of sequence has changed the secondary structure of DNA, therefore can detect the sudden change in the sequence by difference by the electrophoretic migration speed that textural difference caused.

Allele-specific hybridization is by regulating for example hybridization conditions of temperature, using the DNA of labelled with radioisotope and attached to the probe hybridization on the nylon membrane, detect sudden change.

Oligonucleotide connects (Nucleic Acid Research 24,3728,1996) and detects series jump by reacting under certain condition, under this condition, if target DNA not with the template DNA complementation, then instead would not take place, whether take place thereby confirm to connect.

Micrometering preface (Genome Research 7:606,1997) is developed for the SNP score.This method is carried out the DNA polymerization under the condition of a target base of polymerizable only, discerning the polymerization base then is what.

Because polyacrylamide gel has all been used in PCR-SSCP, allele-specific hybridization, oligonucleotide link, therefore, these methods are not highly effective methods when analyzing many samples.And these methods can not be discerned the mistake that is caused by probe and non-target site mispairing.

Although the micrometering preface is simple and effective, but still can not discern the incorrect result that mistake caused of mispairing when analyzing many samples, and the micrometering preface can not be found the disappearance and the insertion of base.

For the SNP score, also developed enzyme cutting method (WO 01/90419).In enzyme cutting method, use for example proper method amplification sequence to be analyzed of PCR.This amplified production comprises can be by the sequence of two kinds of digestion with restriction enzyme or identification.Enzyme cutting method is by detecting sequence variations with two kinds of digestion with restriction enzyme amplified productions and the molecular weight that detects endonuclease bamhi.Because with behind the pcr amplification gene, can detect by mass spectroscopy by the segmental molecular weight of restriction enzyme reaction gained and to obtain, so enzyme cutting method has simply, advantage fast.Yet the enzyme cutting method of describing in patent WO 01/90419 can not be discerned the incorrect analysis that is caused by mistake.Although during PCR, when primer is combined on the non-target site, may cause incorrect analysis, can not discern this incorrect analysis.For example, the primer that is used to detect the polymorphism of CYP2C9 can combine with CYP2C8.In this case, owing to can not discern except CYP2C9, whether primer also combines with CYP2C8, and therefore, whether very difficult discovery mistake has taken place.This method can detect the replacement of a base, but can not detect base deletion or insertion.And this method can't detect the replacement of two or more adjacent bases simultaneously.

Summary of the invention

Therefore, the object of the present invention is to provide a kind of accurately and effectively method of detection of biological body sudden change that is used for.

To achieve these goals, in the specific embodiment of the present invention, provide a kind of accurately and effectively method of detection of biological body sudden change that is used for.

The present invention can simple and rapid detects the sudden change in many samples, and the mistake that can be caused in the combination of zone errors by primer by identification and accurately detect sudden change.And, the invention provides the method that detects two or more mutational sites, this mutational site is simultaneously adjacent within 32 bases; The present invention also provides the method that detects disappearance or insert.Particularly, when different genotype was arranged in individuality, the sudden change that the inventive method can identify different loci was to exist simultaneously in a genotype, still mixed to exist in different genotype.For example, the people has a pair of (two) karyomit(e) that comprises homologous genes information.When mutating now, it may or appear in two karyomit(e)s (homozygote), perhaps appears in the karyomit(e) (heterozygote).When the sudden change of two or more adjacent bases all be heterozygosis the time, those sudden changes may be present in the karyomit(e) simultaneously, perhaps may be present in the different karyomit(e).Because these two kinds of situations may have different effects to life, therefore they should be distinguished.Be subjected to the people under the situation of virus infection, the range gene type mixes.When the sudden change of adjacent base more than two all be heterozygosis the time, should distinguish those sudden changes is to be present in simultaneously in the genotype, still is present in the different genotype.

In order to analyze sudden change, method amplification target sequence of the present invention, site with the products therefrom that comprises being limited property endonuclease digestion, and will be made as by the base numerical control in the fragment of digestion with restriction enzyme and be less than 32, and at least one base among them is produced by duplicating of template rather than primer itself, after with restriction enzyme the amplified fragments enzyme being cut, detect segmental molecular weight to analyze sudden change.

In a specific embodiment of the present invention, the method that detects sudden change is provided, comprising:

A) use forward primer and reverse primer amplified target polynucleotide;

B) by the target polynucleotide with the digestion with restriction enzyme amplification, generate two or more strand polynucleotide passages, this fragment comprises one or more mutant nucleotide sequences that length is 2～32 bases; And

C) molecular weight of detection endonuclease bamhi (cleaved fragment).

Preferably, the polynucleotide of described amplification are cut into a sudden change that comprises in two or more different sudden changes in a strand polynucleotide passage, and in another strand nucleotide fragments, comprise all sudden changes.For example, when ... when A among the ATG... and G were mutant nucleotide sequence, first strand nucleotide fragments that is obtained by digestion with restriction enzyme only comprised two A in the mutant nucleotide sequence, and second strand Nucleotide comprises A and G simultaneously.

In order to analyze sudden change, method amplification target sequence of the present invention, so that it comprises such site, being limited property of the product endonuclease digestion that obtains in these sites amplifications, and endonuclease bamhi has following structure.

??5’-

Primer binding sequence 1

Restriction endonuclease recognition sequence

Primer binding sequence 2

The sudden change presequence

Mutant nucleotide sequence

Sudden change back sequence

Primer binding sequence 3

??-3’

Described " restriction endonuclease recognition sequence " is meant can be by different restriction enzyme simultaneously or the sequence of proximity identification, this sequence can be not to cut sequence corresponding with enzyme.For example, but the equal recognition sequence GGATG of FokI and BSTFSI.But described restriction enzyme site is adjacent to respectively from the 9th/the 13rd and the 2nd/the 0th bit base of 3 ' end of recognition sequence.Two kinds of restriction enzymes that are used to discern restriction endonuclease recognition sequence can have identical or different optimum temperuture.Be preferably and have different optimum temperutures.Preferably, described restriction enzyme is the restriction enzyme with higher optimum temperuture that is selected from the restriction enzyme with low optimum temperuture of FokI, Bbv I, Bsg I, Bcg I, BpmI, BseR I, Bae I and is selected from BSTF5 I, Taq I, BsaB I, Btr I, BstAP I, Fau I, Bcl I, Pci I, Apo 1.Preferred, described restriction enzyme is Fok l and BSTF5 I.

Described restriction enzyme with low optimum temperuture comprises Bae I (25 ℃), FokI, BbvI, Bsg I, Bcg I, Bpm I, BseR I, Mmel I, Ava II (37 ℃); Described restriction enzyme with higher optimum temperuture is BSTF5 I, Taq I (65 ℃), BsaB I, Btr I, BstAP I (60 ℃), Bcl I, Pci I, Apo I (50 ℃).

One of two primers that are used for pcr amplification comprise primer binding sequence 1, restriction endonuclease recognition sequence and primer binding sequence 2, and another primer comprises primer binding sequence 3.

Described " primer binding sequence " be and nucleic acid complementary sequence as template, but described restriction endonuclease recognition sequence can be not and the nucleic acid complementation.Described primer binding sequence 1,2 and 3 base number should be at least four or more, to combine with template DNA.Because described primer can combine with template DNA is good when 8～30 bases are long, therefore, preferred, the base number is 8～30.Described " sudden change presequence " (front sequence from mutation) is the sequence towards 5 ' end of sudden change to be detected.Described " mutant nucleotide sequence " (mutation sequence) is and the corresponding sequence of sudden change to be detected.The replacement of base, insertion and disappearance may take place, and wherein the number of base is generally 1, also can be two or more.Described " sudden change back sequence " (sequence behind mutation) is the sequence towards 3 ' end of mutant nucleotide sequence.

Preferably, the base overall number of described sudden change presequence and sudden change back sequence is one or more.The fragment that is cut into by restriction enzyme should comprise mutant nucleotide sequence, and segmental length is preferably 2～32 bases.Preferred, length is 12 bases.The reason of limited fragment length is, has in fragment under the situation of preferred length, and mass spectroscopy has result preferably.To such an extent as to the fragment of 32 bases is oversize can not to detect sudden change by using the mass spectrometric determination molecular weight because length surpasses, therefore above-mentioned segmental base number is preferred.And owing to only have the fragment of a mutant nucleotide sequence can not discern the combination of primer in wrong site, it is not preferred therefore the fragment of a base only being arranged.Because the identical or adjacent site of described two kinds of restriction enzymes identification is preferred, when a kind of restriction enzyme and amplified production reaction, another kind of restriction enzyme does not have activity.When with the digestion with restriction enzyme amplified fragments, consider the optimum temperuture of two kinds of restriction enzymes, can under different temperature, react continuously.In addition, described fragment can be used a kind of digestion with restriction enzyme earlier, and then use another kind of digestion with restriction enzyme.Here, cut through the enzyme of first kind of restriction enzyme and should not eliminate or damage recognition sequence or the restriction enzyme site that is present in second kind of restriction enzyme in the fragment that comprises mutant nucleotide sequence.

Brief description of drawings

From following and detailed description that accompanying drawing combines, can clearerly understand above-mentioned and further feature, aspect and the advantage of the preferred embodiment for the present invention, wherein:

Fig. 1 for when the 2741st bit base of the 4th intron of people maspin (serpinb5) gene for just often, the MALDI-TOF mass spectrum (C/C) of 7mer;

Fig. 2 for when the 2741st bit base of the 4th intron of people maspin gene for just often, the MALDI-TOF mass spectrum (C/C) of 13mer;

Fig. 3 is when the 2741st bit base of the 4th intron of people maspin gene is heterozygosis, the MALDI-TOF mass spectrum (C/T) of 7mer;

Fig. 4 is when the 2741st bit base of the 4th intron of people maspin gene is heterozygosis, the MALDI-TOF mass spectrum (C/T) of 13mer;

Fig. 5 is when the 2741st bit base of the 4th intron of people maspin gene all becomes T, the MALDI-TOF mass spectrum (T/T) of 7mer;

Fig. 6 is when the 2741st bit base of the 4th intron of people maspin gene all becomes T, the MALDI-TOF mass spectrum (T/T) of 13mer;

Fig. 7 for when the 3597th bit base of the 4th intron of people maspin gene for just often, the MALDI-TOF mass spectrum (C/C) of 7mer and 13mer;

Fig. 8 is when the 3597th bit base of the 4th intron of people maspin gene is heterozygosis, the mass spectrum of the MALDI-TOF of 7mer and 13mer (C/T); And

Fig. 9 is when the 3597th bit base of the 4th intron of people maspin gene all becomes T, the MALDI-TOF mass spectrum (T/T) of 7mer and 13mer.

Preferred forms of the present invention

Below, will describe preferred implementation of the present invention in conjunction with the accompanying drawings in detail.

The sudden change of the 2741st bit base of the 4th intron of [embodiment 1] people maspin gene

Detection is known as the sudden change of the 2741st bit base (1509477, the No. 18 chromosomal the 61001755th bit bases of rs) of people maspin (serpinb5) gene of metastasis of cancer suppressor gene.

1, pcr amplification and digestion with restriction enzyme

The sequence of template DNA (5 ' → 3 ') is as follows:

GTT TCACTTGATAAAGCAATAAAATGCTATTCAcAGCT GCATGAGGC TACACCCTTCTTTTGAATGCAG(SEQ?ID?NO：1)

Underlined sequence is and following primer 1 and 2 sites of hybridizing.The base of representing with lowercase is " mutant nucleotide sequence ".

Primer 1:5 '-TCACTTGATAAAGCAATAAAAggatgGCTATTCA-3 ' is (SEQ ID NO:2) (34mer)

Primer 2: 5 '-CATTCAAAAGAAGGGTGTAGCCTCATGC-3 ' (28mer) (SEQ ID NO:3)

The sequence of representing with lowercase is the recognition sequence of FokI and BSTF5I.

With PCR damping fluid (1 *), 2mM MgSO ₄, 200mM triphosphate deoxy-nucleotide (dNTP), 0.315U PlatinumTaq polymerase (Invitrogen, 10966-026), 0.5 μ M primer 1 and 0.5 μ M primer 2 and 36ng genomic dna add to 18 μ l total reaction volume.Then, carry out the PCR reaction under the following conditions.

94 ℃, 2 minutes,

94 ℃, 15 seconds 55 ℃, 15 seconds 72 ℃, 30 seconds (10 circulations),

94 ℃, 15 seconds 60 ℃, 15 seconds 72 ℃, 30 seconds (35 circulations)

Isolation of genomic DNA and purifying from blood.For example, when DNA isolation from blood, can use " SDS/ Proteinase K " method (Maniatis, Molecular Cloning, A laboratory Manual, ColdSpring Harbor Laboratory Press, Cold Spring Harbor, 1989) or QIAamp DNA trace quantity reagent kit 250 (Qiagen 51106).When the concentration of DNA was hanged down, available following method concentrated this DNA.At first 3M sodium-acetate (pH 5.3) and 2.5 volume of ethanol with 1/10 volume are added in the dna solution, slowly mix.Resulting solution is placed more than 1 hour at-20 ℃, then at 4 ℃, centrifugal 15 minutes with 13000 rev/mins.After removing supernatant liquor, add 70% ethanol, resulting solution is at 4 ℃, centrifugal 10 minutes with 13000 rev/mins.Then, drying is removed ethanol, and the distilled water of pre-determined volume is added in the gained solution.

By the fragments sequence that PCR obtains (5 ' → 3 ') as follows.

TCACTTGATAAAGCAATAAAAggatgGC TATTCA[C/T]AGCTGCATGAGGCTACACCCTTCTTTTGAATG(SEQ?ID?NO：4)

AGTGAACTATTTCGTTATTTTcctac CGATAAGT[G/A]TCGACGTACTCCGATGTGGGAAGAAAACTTAC(SEQ?ID?NO：5)

The site of representing with lowercase is the sequence of FokI and BstF5I identification, and underlined site is the fragments sequence that is produced by digestion with restriction enzyme, and the base of representing with square brackets is " mutant nucleotide sequence ".In reactant, add 1U FokI (NEB R109L), 1U BstF5I (NEB, V0031L), 50mM Potassium ethanoate, 20mM three (methylol) aminomethane acetate (Tris-acetate), 10mM magnesium acetate, 1mM dithiothreitol (DTT) (DTT) (pH7.9@25 ℃).Gained solution reacted 2 hours in the time of 25 ℃, and then reacted 2 hours in the time of 45 ℃.

In order to optimize enzyme reaction, when 25 ℃, 37 ℃, 45 ℃, 55 ℃ and 65 ℃, make the reaction of FokI and BstF5I and amplified production.As a result, under the situation that FokI exists, in the time of 25 ℃, carry out 70% enzyme reaction, in the time of 37 ℃, carried out surpassing 90% enzyme reaction.Under the situation that BstFSI exists, in the time of 25 ℃, enzyme reaction does not take place.Therefore, preferred, the at first reaction in the time of 25 ℃ of described amplified production, have only FokI to react this moment, then, and reaction when surpassing 37 ℃, this moment, BstF5I can react.

2, purifying and desalination

Preferably, from above-mentioned through the solution that restriction enzyme is handled purifies and separates go out dna fragmentation, then, detect this segmental molecular weight.For example, can use Nucleave Genotyping test kit (Variagenics, USA).The TEAA (triethyl ammonium acetate, pH 7.6) of 70 μ l 1M is added in this restriction enzyme reaction solution, placed 1 minute.The TEAA of 70 μ l 1M and the above-mentioned mixing solutions of 90 μ l are added on the specimen preparation plate (Sample preparation plate), and the TEAA with 85 μ 11M filters the specimen preparation plate five times then.This specimen preparation plate is centrifugal 5 minutes with 1000 rev/mins.After this, this specimen preparation plate is placed on the collecting board (collection plate), 60% Virahol with 60 μ 1 is added into wherein and filters then.When being collected in effluent liquid in the collecting board, with this collecting board 115 ℃ the time dry 75 minutes.

3, MALDI-TOF mass spectroscopy

6 μ l MALDI matrix (22.8mg Trisodium Citrate, 148.5mg hydroxy-picolinic acid, 1.12ml acetonitrile, 7.8ml water) are added in the collecting board, then the mixture of 4 μ l MALDI matrix and effluent liquid is placed on chip pad plate (the Anchor chip plate of MALDI-TOF, Biflex IV, Bruker) on.Drying is 30 minutes in the time of 37 ℃, is positioned over the room temperature cooling a little while, carries out MALDI-TOF then and analyzes.This analytical procedure is with reference to the MALDI-TOF handbook.

When the 2741st bit base of the 4th intron is normal (C/C), the segmental molecular weight that obtains after enzyme is cut be 2135.4D (dalton) (7mer) and 4078.6D (13mer) (seeing Fig. 1 and 2).When the 2741st bit base of the 4th intron is heterozygosis (C/T), segmental molecular weight is 2135.4D, 2150.4D (7mer) and 4078.6D, 4062.6D (13mer) (seeing Fig. 3 and 4).When the 2741st bit base of the 4th intron becomes T (T/T) entirely, segmental molecular weight is 2150.4D (7mer) and 4062.6D (13MER) (seeing Fig. 5 and 6).

Sudden change (the rs1396782 of the 3597th bit base of the 4th intron of [embodiment 2] people maspin (serpinb5) gene; Human No. 18 chromosomal the 61002611st bit base), known this gene behaviour metastasis of cancer suppressor gene

The sequence of template DNA is as follows.

CTG GAGTATTATCCTTGCAGGCTTGATATGAAGcTTGAAAT TTCTCC CCAAAGAGATTTAGTTAACAGGCAAA(SEQ?ID?NO：6)

Underlined sequence is and following primer 3 and 4 sites of hybridizing.Sport " mutant nucleotide sequence " with what lowercase was represented.

Primer 3:5 '-GAGTATTATCCTTGCAGGCTTggatgATATGAAG-3 ' is (SEQ ID NO:7) (34mer)

Primer 4:5 '-GCCTGTTAACTAAATCTCTTTGGGGAGAA-3 ' is (SEQ ID NO:8) (29mer)

In above-mentioned primer, the site of representing with lowercase is the sequence that is not present in the template DNA, but FokI and BstF5I can discern them.This comprises the experimental technique of PCR reaction identical with described in the embodiment 1.

By the fragments sequence that PCR obtains (5 ' → 3 ') as follows.

GAGTATTATCCTTGCAGGCTTggatgAT ATGAAG[C/T]TTGAAATTTCTCCCCAAAGAGATTTAGTTAACAGGC(SEQ?ID?NO：9)

CTCATAATAGGAACGTCCGAAcctac TATACTTC[G/A]AACTTTAAAGAGGGGTTTCTCTAAATCAATTGTCCG(SEQ?ID?NO：10)

The site of representing with lowercase in the above-mentioned sequence is a restriction endonuclease recognition sequence, the fragments sequence of underlined site for obtaining by digestion with restriction enzyme, and the base of representing with square brackets ([]) is " mutant nucleotide sequence ".With 1U FokI (NEB R109L), 1U BstF5I (NEB, V0031L), 50mM Potassium ethanoate, 20mM Tris-acetate, 10mM magnesium acetate, 1mM DTT (pH 7.9@25 ℃).Resulting solution reacted 2 hours in the time of 25 ℃, and then reacted 2 hours in the time of 45 ℃.

When the 3597th bit base of the 4th intron is normal (C/C), cutting the segmental molecular weight that obtains by enzyme is 2209.4D (7mer) and 3988.6D (13MER) (see figure 7).When the 3597th bit base of the 4th intron is heterozygosis (C/T), segmental molecular weight is 2209.4D, 2224.4D (7mer) and 3988.6D, 3972.6D (13mer) (see figure 8).When the 3597th bit base of the 4th intron becomes T (T/T) entirely, segmental molecular weight is 2224.4D (7mer) and 3972.6D (13mer) (see figure 9).

The base mutation in tyrosine-methionine(Met)-aspartic acid-aspartic acid (YMDD) site of [embodiment 3] hepatitis b virus dna polymerase

Detect the YMDD site mutation, this sudden change is arranged in the archaeal dna polymerase of the hepatitis B virus that causes human hepatitis B.The YMDD site mutation can produce the resistance to the lamivudine that is used for treating hepatitis B (1amivudine).Known, as methionine(Met) (M), promptly No. 552 codon when becoming Xie Ansuan (V) or Isoleucine (I), produced the resistance to lamivudine.

1, pcr amplification and digestion with restriction enzyme

(Qiagen CA), isolates hepatitis B virus DNA from 0.2ml serum, then 2 μ l DNA are used for pcr amplification to use QIAamp blood test kit.

The sequence of template DNA (5 ' → 3 ') is as follows.

TTCCCCCACTGTTTGGCTTTCAGTTATATG GATGATGTGGTATTGG GGGCCAAGTCTGTA(SEQ?ID?NO：11)

Underlined sequence is and following primer 5 and 6 sites of hybridizing.

Primer 5 (SEQ ID NO:12):

5′-TTCCCCCACTGTTTGGCTggatgTCAGTTAT-3′(31mer)

Primer 6 (SEQ ID NO:13):

5′-TACAGACTTGGCCCCCAATACCACAT GATC-3′(30mer)

The sequence of representing with lowercase in primer 5 is the recognition sequence of FokI and BstF5I, and this sequence is not included in the template DNA, but artificial insertion.The sequence that underlines in primer 6 is a sequence through the manual change, to prevent the identification of FokI.

By using 18 μ l to comprise 20mM Tris hydrochloride buffer (Tris-HCl, pH 8.4), 50mM Repone K, 0.2mM dNTP, 0.4U PlatinumTaq polymerase (Invitrogen, 10966-026), the reaction solution of 10pmol primer 5 and 10pmol primer 6, carry out the PCR reaction under the following conditions.

94 ℃, 2 minutes

94 ℃, 15 seconds 50 ℃, 15 seconds 72 ℃, 30 seconds (10 circulations),

94 ℃, 15 seconds 55 ℃, 15 seconds 72 ℃, 30 seconds (35 circulations)

As follows by the fragments sequence (5 ' → 3 ') that PCR obtains.

TTCCCCCACTGTTTGGCTggatgTC AGTTATATGGATCATGTGGTATTGGGGGCCAAGTCTGTA(SEQ?ID?NO：14)

AAGGGGGTGACAAACCGAcctac AGTCAATATACCTAGTACACCATAACCCCCGGTTCAGACAT(SEQ?ID?NO：15)

The site of representing with lowercase is FokI and the discernible sequence of BstF5I, the fragments sequence of underlined site for being obtained by digestion with restriction enzyme.With PCR product and 1U FokI (NEBR109L), 1U BstF5I (NEB, V0031L) and 10 μ l reaction solutions (50mM Potassium ethanoate, 20mMTris-acetate, 10mM magnesium acetate, 1mM DTT) mix.This mixing solutions reacted 2 hours in the time of 37 ℃, reacted 2 hours in the time of 45 ℃ then.At first, this PCR product was cut 2 hours with the FokI enzyme 37 ℃ the time, in the time of 45 ℃, cut 2 hours then with the BstF5I enzyme.

2, purifying and desalination and MALDI-TOF mass spectroscopy

Carry out this experiment according to the method identical with embodiment 1.

Cut the segmental theoretical length that obtains by enzyme and accurately accord with value, show and be lower than 0.1% difference (seeing Table 1) according to the actual molecular weight analyzing and testing.

Table 1

The guess value and the observed value of the oligonucleotide quality that obtains by the digestion with restriction enzyme of PCR product

		Infer fragments sequence		Infer segmental quality (Da)		Observe segmental quality (Da)
							Genotype codon No.552		??7mer????13mer		??7mer??13mer		??7mer??13mer
??YMDD?aTg??YVDD?aTg??YIDD?aTt??YIDD?aTc??YIDD?aTa		??AGTTATa?TCcAtATAACTGA??AGTTATg?TCcAcATAACTGA??AGTTATa?TCaAtATAACTGA??AGTTATa?TCgAtATAACTGA??AGTTATa?TCtAtATAACTGA		??2199.43997.6??2215.43982.6??2199.44021.6??2199.44037.6??2199.44012.6		??2199.63998.0??2215.93982.6??2199.64021.8??2199.64038.0??2199.64012.6

In last table, resolving power (removing the difference between observation quality and the supposition quality with inferring quality) is lower than 0.1%.

[embodiment 4] hepatitis C viruss (HCV) 5 ' NCR (non-coding region) site mutation

When Interferon, rabbit was used for the treatment of chronic hepatitis C, the difference of the result of treatment of performance depended on the genotype of hepatitis C in the human body.Therefore, the genotype of hepatitis C virus in should first human body before using Interferon, rabbit.In order to find genotype, the detection of 5 ' NCR sudden change is useful.In a specific embodiment of the present invention, the method for the 5 ' NCR site mutation that is used to analyze hepatitis C virus is disclosed.

1, reverse transcription polymerase chain reaction,PCR (RT PCR)

(Qiagen CA) isolates the RNA of hepatitis C virus from 0.14ml serum, then 10 μ l RNA are used for the RT pcr amplification to use QIAamp viral RNA trace quantity reagent kit.

The reaction solution that comprises 0.2mM dNTP, 0.4 μ M primer 2 and 10 μ l RNA reacted 5 minutes in the time of 65 ℃, placed on ice then 1 minute.With reaction solution and 20mM Tris HCl (pH 8.4), 50mM KCl, 4mM DTT, 0.4 μ M primer 1,100U SuperScript III ribonuclease H-reversed transcriptive enzyme (Invitrogen, 18080-044), 20U RNaseOUT (Invitrogen, 10777-019), (Invitrogen 10966-026) mixes 0.4U PlatinumTaq polymerase.Then, the solution with 25 μ l gained carries out RT PCR under following condition.

50 ℃, 45 minutes,

94 ℃, 2 seconds,

94 ℃, 15 seconds 55 ℃, 15 seconds 72 ℃, 30 seconds (35 circulations)

72 ℃, 5 minutes

The sequence of template DNA (5 ' → 3 ') is as follows.

GCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGT (omitting) ACTGCCTGATAGGGTGCTTGCGAG(SEQ ID NO:16)

Underlined sequence is and primer 7 and 8 sites of hybridizing.

Primer 7 (SEQ ID NO:17): 5 '-GCAGAAAGCGTCTAGCCATGGCGT-3 ' is (24mer)

Primer 8 (SEQ ID NO:18): 5 '-CTCGCAAGCACCCTATCAGGCAGT-3 ' is (24mer)

2, nest-type PRC (Nested PCR) and digestion with restriction enzyme

Above-mentioned RT PCR reaction solution is diluted to 1/50 of original content.With 2 μ l diluents and 18 μ l comprise 20mM Tris HCl (pH 8.4), 50mM KCl, 0.2mM dNTP, 0.4U PlatinumTaq polymerase (Invitrogen, 10966-026), 10pmol primer 9 and 10,10pmol primer 11 and 12 and the reaction solution of 10pmol primer 13 and 14 mix.Carrying out following three types PCR reaction and restriction enzyme with this mixing solutions handles.Primer 9 and 10 is used to react 1, and primer 11 and 12 is used to react 2, and primer 13 and 14 is used to react 3.The PCR temperature of reaction and the time of described three kinds of reactions are as described below.

94 ℃, 5 minutes,

94 ℃, 30 seconds 55 ℃, 30 seconds 72 ℃, 30 seconds (35 circulations)

72 ℃, 5 minutes

1) reaction 1

Use primer 9 and 10, in RT-PCR solution, carry out this pcr amplification.The sequence of template DNA (5 ' → 3 ') is as follows.

CGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCC... (omit) ... CTGCTAGCCGAGTAGTGTTGGGTCGCGAAAG GCCTTGTGGTACTGCCTGATAGGG(SEQ ID NO:19)

Underlined sequence is and following primer 9 and 10 sites of hybridizing.

Primer 9 (SEQ ID NO:20):

5′-CGTCTAGCCATGGCGTTAGggatgATGAGTGT-3′(32mer)

Primer 10 (SEQ ID NO:21):

5′-CCCTATCAGGCAGTACCACAAGGC-3′(24mer)

Fragments sequence (5 ' → 3 ') as follows by the pcr amplification generation.

CGTCTAGCCATGGCGTTAGggatgAT GAGTGTCGTGCAGCCTCCAGGACCC... (omit)

GCAGATCGGTACCGCAATCcctac TACTCACAGCACGTCGGAGGTCCTGGG... (omit)

...CTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGGG(SEQ?ID?NO：22)

...GACGATCGGCTCATCACAACCCAGCGCTTTCCGGAACACCATGACGGACTATCCC(SEQ?ID?NO：23)

The site of representing with lowercase is FokI and the discernible sequence of BstF5I.Underlined site is the fragments sequence (7mer and 13mer) that is produced by restriction enzyme.With PCR product and 1U FokI (NEB R109L), 1U BstF5I (NEB, V0031L) and 10 μ l reaction solutions (50mM Potassium ethanoate, 20mM Tris-acetate, 10mM magnesium acetate, 1mM DTT) mix.This mixing solutions reacted 2 hours in the time of 37 ℃, reacted 2 hours in the time of 45 ℃ then.The PCR product was cut 2 hours with the FokI enzyme 37 ℃ the time, in the time of 45 ℃, cut 2 hours then with the BstF5I enzyme.

2) reaction 2

Use primer 11 and 12, in RT-PCR solution, carry out this pcr amplification.The sequence of template DNA (5 ' → 3 ') is as follows.

GTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCC... (omit)

...CCCGCAAGACTG CTAGCCGAGTAGRGTTGGGTRGCGAA(SEQID?NO：24)

Underlined sequence is and following primer 11 and 12 sites of hybridizing.

Primer 11 (SEQ ID NO:25):

5′-GTGGTCTGtccaacCGGTGAGTACACCGGAAT-3′(32mer)

Primer 12 (SEQ ID NO:26):

5′-TTCGCRACCCAACRCTACtccaacggtcCGGCTAG-3′(35MER)

The represented base of R is VITAMIN B4 (A) or guanine (G).Use comprises the mixture of two kinds of primers of each base.

Fragments sequence (5 ' → 3 ') as follows by this PCR generation.

GTGGTCTGtccaacCGGTGAGTACACCGGAATTG CCAGGACGACCGGGTCC... (omit)

CACCAGACaggttgGCCACTCATGTGGCCTTA ACGGTCCTGCTGGCCC AGG... (omit)

...CCCCGC AAGACTGCTAGCCGgaccgttggaGTAGRGTTGGGTRGCGAA(SEQ?ID?NO：27)

...GGGG CGTTCTGACGATCGGCctggcaacctCATCRCAACCCARCGCTT(SEQ?ID?NO：28)

The site of representing with lowercase is MmeI and the discernible sequence of AvaII, and underlined site is the fragments sequence (13mer, 18mer, 24mer, 19mer) that produces with digestion with restriction enzyme.PCR product and 1.5U MmeI (NEB R0637L), 50 μ M SAM (S-adenosine-L-methionine(Met)) and 10 μ l, 1 * reaction solution (pH 7.9 for 50mM Potassium ethanoate, 20mM Tris-acetate, 10mM magnesium acetate, 1mMDTT) are mixed.This mixed solution reacted 2 hours in the time of 37 ℃, and (NEB R0153S) adds wherein with 1.5U AvaII then.The solution of gained reacted 2 hours in the time of 37 ℃.MmeI and AvaII can add in the mixed solution simultaneously.

3) reaction 3

Use primer 13 and 14, in RT-PCR solution, carry out this pcr amplification.The sequence of template DNA (5 ' → 3 ') is as follows.

GACIGGGTCCTTTCTTGGATCAACCCGCTCAATGCCTGGAG ATTTG GGCGTGCCCCCGC(SEQ?ID?NO：29)

Underlined sequence is and following primer 13 and 14 sites of hybridizing.

Primer 13 (SEQ ID NO:30):

5′-GACIGGGTCCTggatgTCTTGGA-3′(23mer)

Primer 14 (SEQ ID NO:31):

5′-GCGGGGGCACggatgCCCAAAT-3′(22mer)

The represented base of I is an inosine.

Fragments sequence (5 ' → 3) as follows by this PCR generation.

GACIGGGTCCTggatgTC TTGGATC? AACCCGCTCAATGC CTGGAGATTTGGG?catccGTGCCCCCGC(SEQ?ID?NO：32)

CTGICCCAGGAcctac AGAACCTAGTTGG? GCGAGTTACGGACC? TCTA AACCCgtaggCACGGGGGCG(SEQ?ID?NO：33)

The site of representing with lowercase is FokI and the discernible sequence of BstF5I, and underlined site is the fragments sequence that produces with digestion with restriction enzyme.The fragment that generates is 2 7mer, 2 13mer, and 2 14mer.With PCR product and 1U FokI (NEB R109L), 1U BstF5I (NEB, V0031L) and 10 μ l reaction solutions (50mM Potassium ethanoate, 20mM Tris-acetate, 10mM Potassium ethanoate, 1mM DTT) mix.This mixed solution reacted 2 hours in the time of 37 ℃, reacted 2 hours in the time of 45 ℃ then.This fragment was at first cut 2 hours with the FokI enzyme 37 ℃ the time, cut 2 hours with the BstF5I enzyme at 45 ℃ then.

2, purifying and desalination and MALDI-TOF mass spectroscopy

Adopt the PCR and the restriction enzyme reaction solution of three types of the method purifying identical, then the detection molecules amount with embodiment 1.

By reacting 1 (table 2), reacting the segmental length of 2 (tables 3) and the generation of reaction 3 (tables 4) shown in table 2～4.Determine the genotype of hepatitis C according to the fragment length that obtains by ready reckoner, shown in table 2～4.

Table 2

Genotype	??7mer	??13mer
			??1a	??2216.4	??3983.6
??1b	??2216.4	??3983.6
			??1c	??2216.4	??3983.6
??3a	??2216.4	??3983.6
			??3b	??2216.4	??3983.6
??3c	??2216.4	??3983.6
			??3d	??2216.4	??3983.6
??3e	??2216.4	??3983.6
			??3f	??2216.4	??3983.6
??6b	??2216.4	??3983.6
			??7a	??2216.4	??3983.6
??7b	??2216.4	??3983.6
			??7c	??2216.4	??3983.6
??2′	??2216.4	??3989.6
			??5a	??2216.4	??3989.6

Genotype	??7mer	??13mer
			??1b	??2216.4	??3998.6
??1d	??2216.4	??3998.6
			??1e	??2216.4	??3998.6
??1f	??2216.4	??3998.6
			??2a	??2216.4	??3998.6
??2b	??2216.4	??3998.6
			??2c	??2216.4	??3998.6
??2d	??2216.4	??3998.6
			??2e	??2216.4	??3998.6
??2′	??2216.4	??3998.6
			??4h	??2216.4	??3998.6
??6a	??2216.4	??3998.6
			??7d	??2216.4	??3998.6
??1b	??2231.4	??3967.6
			??4g	??2231.4	??3967.6
??4k	??2231.4	??3967.6
			??2a	??2231.4	??3982.6
??4a	??2231.4	??3982.6
			??4b	??2231.4	??3982.6
??4c	??2231.4	??3982.6

Genotype	??7mer	??13mer
			??4d	??2231.4	??3982.6
??4e	??2231.4	??3982.6
			??4e′	??2231.4	??3982.6
??4f	??2231.4	??3982.6
			??4f’	??2231.4	??3982.6

Table 3

Genotype	??13mer	??18mer	Genotype	??14mer	??19mer
						??1a	??4049.6	??5556.6	??2a	??4337.8	??5891.8
??1b	??4049.6	??5556.6	??2e	??4337.8	??5891.8
						??1c	??4049.6	??5556.6	??4b	??4337.8	??5891.8
??1d	??4049.6	??5556.6	??4e′	??4337.8	??5891.8
						??1e	??4049.6	??5556.6	??1a	??4352.8	??5875.8
??1f	??4049.6	??5556.6	??1c	??4352.8	??5875.8
						??6b	??4049.6	??5556.6	??1d	??4352.8	??5875.8
??7a	??4049.6	??5556.6	??1e	??4352.8	??5875.8
						??7b	??4049.6	??5556.6	??2a	??4352.8	??5875.8
??4a	??4049.6	??5572.6	??2b	??4352.8	??5875.8
						??6a	??4064.6	??5540.6	??2c	??4352.8	??5875.8
??7c	??4064.6	??5540.6	??2d	??4352.8	??5875.8

Genotype	??13mer	??18mer	Genotype	??14mer	??19mer
						??7d	??4064.6	??5540.6	??2′-1	??4352.8	??5875.8
??4f	??4065.6	??5541.6	??2′-2	??4352.8	??5875.8
						??4e′	??4064.6	??5556.6	??3a	??4352.8	??5875.8
??4f	??4065.6	??5557.6	??3b	??4352.8	??5875.8
						??4g	??4065.6	??5557.6	??3d	??4352.8	??5875.8
??5a	??4080.6	??5525.6	??3e	??4352.8	??5875.8
						??3b	??4080.6	??5541.6	??4c	??4352.8	??5875.8
??4b	??4080.6	??5541.6	??4d	??4352.8	??5875.8
						??4c	??4080.6	??5541.6	??4f	??4352.8	??5875.8
??4d	??4080.6	??5541.6	??4f	??4352.8	??5875.8
						??4e	??4080.6	??5541.6	??4g	??4352.8	??5875.8
??4h	??4080.6	??5541.6	??6a	??4352.8	??5875.8
						??4k	??4080.6	??5541.6	??6b	??4352.8	??5875.8
??2d	??4088.6	??5515.6	??7c	??4353.8	??5876.8
						??2b	??4088.6	??5530.6	??1b	??4368.8	??5860.8
??3f	??4096.6	??5526.6	??1f	??4368.8	??5860.8
						??2a	??4104.6	??5500.6	??3c	??4368.8	??5860.8
??2c	??4104.6	??5500.6	??3f	??4368.8	??5860.8
						??2e	??4104.6	??5500.6	??4a	??4368.8	??5860.8
??2′	??4104.6	??5500.6	??4e	??4368.8	??5860.8

Genotype	??13mer	??18mer	Genotype	??14mer	??19mer
						??2′	??4104.6	??5500.6	??4h	??4368.8	??5860.8
??3a	??4111.6	??5510.6	??4k	??4368.8	??5860.8
						??3c	??4111.6	??5510.6	??5a	??4368.8	??5860.8
??3d	??4111.6	??5510.6	??7a	??4368.8	??5860.8
						??3e	??4111.6	??5510.6	??7b	??4368.8	??5860.8
			??7d	??4368.8	??5860.8

Table 4

Industrial applicability

In an embodiment of the invention, can discern the improper analysis that the mistake in the method for conventional sense sudden change causes, and can detect 32 various sudden changes simultaneously with interior adjacent base.When the individuality with sudden change had the range gene type, the sudden change that can distinguish different loci was to be present in simultaneously in the genotype, still mixed to be present in the plural genotype.In addition, can detect the sudden change that causes by genetically deficient or insertion.

So far, detailed description the present invention.Yet, should be appreciated that because from this detailed description, to those skilled in the art, the variations and modifications that do not exceed spirit and scope of the invention are conspicuous, therefore, detailed description and specific embodiment that this has shown the preferred embodiment for the present invention only are exemplary.

Sequence table

＜110〉Genematrix Inc.; Liu Wangdun

＜120〉detect the method for suddenling change

<130>PCT03-058

<150>KR2002-0063832

<151>2002-10-18

<150>KR2003-0061066

<151>2003-09-02

<160>33

<170>KopatentIn?1.71

<210>1

<211>69

<212>DNA

＜213〉people

<400>1

gtttcacttg?ataaagcaat?aaaatgctat?tcacagctgc?atgaggctac?acccttcttt????60

tgaatgcag????????????????????????????????????????????????????????????69

<210>2

<211>34

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer of maspin gene the 4th intron

<400>2

tcacttgata?aagcaataaa?aggatggcta?ttca????????????????????????????????34

<210>3

<211>28

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer of maspin gene the 4th intron

<400>3

cattcaaaag?aagggtgtag?cctcatgc???????????????????????????????????????28

<210>4

<211>68

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the PCR fragment of gained

<400>4

tcacttgata?aagcaataaa?aggatggcta?ttcactagct?gcatgaggct?acacccttct????60

tttgaatg?????????????????????????????????????????????????????????????68

<210>5

<211>68

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the PCR fragment of gained

<400>5

agtgaactat?ttcgttattt?tcctaccgat?aagtgatcga?cgtactccga?tgtgggaaga????60

aaacttac?????????????????????????????????????????????????????????????68

<210>6

<211>73

<212>DNA

＜213〉people

<400>6

ctggagtatt?atccttgcag?gcttgatatg?aagcttgaaa?tttctcccca?aagagattta????60

gttaacaggc?aaa???????????????????????????????????????????????????????73

<210>7

<211>34

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer of maspin gene the 4th intron

<400>7

gagtattatc?cttgcaggct?tggatgatat?gaag????????????????????????????????34

<210>8

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer of maspin gene the 4th intron

<400>8

gcctgttaac?taaatctctt?tggggagaa??????????????????????????????????????29

<210>9

<211>72

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the PCR fragment of gained

<400>9

gagtattatc?cttgcaggct?tggatgatat?gaagctttga?aatttctccc?caaagagatt????60

tagttaacag?gc????????????????????????????????????????????????????????72

<210>10

<211>72

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the PCR fragment of gained

<400>10

ctcataatag?gaacgtccga?acctactata?cttcgaaact?ttaaagaggg?gtttctctaa????60

atcaattgtc?cg????????????????????????????????????????????????????????72

<210>11

<211>60

<212>DNA

＜213〉hepatitis B virus

<400>11

ttcccccact?gtttggcttt?cagttatatg?gatgatgtgg?tattgggggc?caagtctgta????60

60

<210>12

<211>31

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer of hepatitis B virus

<400>12

ttcccccact?gtttggctgg?atgtcagtta?t???????????????????????????????????31

<210>13

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer of hepatitis B virus

<400>13

tacagacttg?gcccccaata?ccacatgatc?????????????????????????????????????30

<210>14

<211>64

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the PCR fragment of gained

<400>14

ttcccccact?gtttggctgg?atgtcagtta?tatggatcat?gtggtattgg?gggccaagtc????60

tgta?????????????????????????????????????????????????????????????????64

<210>15

<211>64

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the PCR fragment of gained

<400>15

aagggggtga?caaaccgacc?tacagtcaat?atacctagta?caccataacc?cccggttcag????60

acat?????????????????????????????????????????????????????????????????64

<210>16

<211>244

<212>DNA

＜213〉artificial sequence

<220>

＜223〉5 ' of hepatitis C virus non-coding region

<400>16

gcagaaagcg?tctagccatg?gcgttagtat?gagtgtcgtg?cagcctccag?gaccccccct????60

cccgggagag?ccatagtggt?ctgcggaacc?ggtgagtaca?ccggaattgc?caggacgacc????120

gggtcctttc?ttggatcaac?ccgctcaatg?cctggagatt?tgggcgtgcc?cccgcaagac????180

tgctagccga?gtagtgttgg?gtcgcgaaag?gccttgtggt?actgcctgat?agggtgcttg????240

cgag?????????????????????????????????????????????????????????????????244

<210>17

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer of hepatitis C virus 5 ' non-coding region

<400>17

gcagaaagcg?tctagccatg?gcgt???????????????????????????????????????????24

<210>18

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer of hepatitis C virus 5 ' non-coding region

<400>18

ccctatcagg?cagtaccaca?aggc???????????????????????????????????????????24

<210>19

<211>226

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the PCR fragment of gained

<400>19

cgtctagcca?tggcgttagt?atgagtgtcg?tgcagcctcc?aggacccccc?ctcccgggag????60

agccatagtg?gtctgcggaa?ccggtgagta?caccggaatt?gccaggacga?ccgggtcctt????120

tcttggatca?acccgctcaa?tgcctggaga?tttgggcgtg?cccccgcaag?actgctagcc????180

gagtagtgtt?gggtcgcgaa?aggccttgtg?gtactgcctg?ataggg???????????????????226

<210>20

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer

<400>20

cgtctagcca?tggcgttagg?gatgatgagt?gt??????????????????????????????????32

<210>21

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer

<400>21

ccctatcagg?cagtaccaca?aggc???????????????????????????????????????????24

<210>22

<211>230

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the PCR primer of gained

<400>22

cgtctagcca?tggcgttagg?gatgatgagt?gtcgtgcagc?ctccaggacc?ccccctcccg????60

ggagagccat?agtggtctgc?ggaaccggtg?agtacaccgg?aattgccagg?acgaccgggt????120

cctttcttgg?atcaacccgc?tcaatgcctg?gagatttggg?cgtgcccccg?caagactgct????180

agccgagtag?tgttgggtcg?cgaaaggcct?tgtggtactg?cctgataggg???????????????230

<210>23

<211>230

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the PCR fragment of gained

<400>23

gcagatcggt?accgcaatcc?ctactactca?cagcacgtcg?gaggtcctgg?gggggagggc????60

cctctcggta?tcaccagacg?ccttggccac?tcatgtggcc?ttaacggtcc?tgctggccca????120

ggaaagaacc?tagttgggcg?agttacggac?ctctaaaccc?gcacgggggc?gttctgacga????180

tcggctcatc?acaacccagc?gctttccgga?acaccatgac?ggactatccc???????????????230

<210>24

<211>133

<212>DNA

＜213〉artificial sequence

<220>

＜223〉template DNA

<400>24

gtggtctgcg?gaaccggtga?gtacaccgga?attgccagga?cgaccgggtc?ctttcttgga????60

tcaacccgct?caatgcctgg?agatttgggc?gtgcccccgc?aagactgcta?gccgagtagr????120

gttgggtrgc?gaa???????????????????????????????????????????????????????133

<210>25

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer

<400>25

gtggtctgtc?caaccggtga?gtacaccgga?at??????????????????????????????????32

<210>26

<211>35

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer

<400>26

ttcgcraccc?aacrctactc?caacggtccg?gctag???????????????????????????????35

<210>27

<211>142

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the PCR fragment of gained

<400>27

gtggtctgtc?caaccggtga?gtacaccgga?attgccagga?cgaccgggtc?ctttcttgga????60

tcaacccgct?caatgcctgg?agatttgggc?gtgcccccgc?aagactgcta?gccggaccgt????120

tggagtagrg?ttgggtrgcg?aa?????????????????????????????????????????????142

<210>28

<211>142

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the PCR fragment of gained

<400>28

caccagacag?gttggccact?catgtggcct?taacggtcct?gctggcccag?gaaagttcct????60

agttgggcga?gttacggacc?tctaaacccg?cacgggggcg?ttctgacgat?cggcctggca????120

acctcatcrc?aacccarcgc?tt?????????????????????????????????????????????142

<210>29

<211>59

<212>DNA

＜213〉artificial sequence

<220>

＜223〉template DNA

<220>

＜221〉base of Xiu Shiing

<222>(4)

<223>i

<400>29

gacngggtcc?tttcttggat?caacccgctc?aatgcctgga?gatttgggcg?tgcccccgc?????59

<210>30

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer

<220>

＜221〉base of modified

<222>(4)

<223>i

<400>30

gacngggtcc?tggatgtctt?gga????????????????????????????????????????????23

<210>31

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer

<400>31

gcgggggcac?ggatgcccaa?at?????????????????????????????????????????????22

<210>32

<211>67

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the PCR fragment of gained

<220>

＜221〉base of Xiu Shiing

<222>(4)

<223>i

<400>32

gacngggtcc?tggatgtctt?ggatcaaccc?gctcaatgcc?tggagatttg?ggcatccgtg????60

cccccgc??????????????????????????????????????????????????????????????67

<210>33

<211>67

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the PCR fragment of gained

<220>

＜221〉base of Xiu Shiing

<222>(4)

<223>i

<400>33

ctgncccagg?acctacagaa?cctagttggg?cgagttacgg?acctctaaac?ccgtaggcac????60

gggggcg??????????????????????????????????????????????????????????????67

Claims (5)

1. primer that is used for analyzing gene mutation, comprise primer binding sequence 1, restriction endonuclease recognition sequence and primer binding sequence 2, wherein, generate two and a plurality of strand polynucleotide passages by cutting with the amplification of this primer with the enzyme of the restriction enzyme of two or more identification restriction endonuclease recognition sequences, described strand polynucleotide passage comprises at least one mutant nucleotide sequence respectively and has 2～32 bases.

2. primer according to claim 1 is characterized in that, forward primer is the primer that is selected from sequence shown in SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:12, SEQ ID NO:20, SEQ ID NO:25, the SEQ IDNO:30.

3. primer according to claim 1 is characterized in that described restriction enzyme has different optimum temperutures.

4. primer according to claim 3, it is characterized in that, described restriction enzyme is to be selected from the restriction enzyme with low optimum temperuture of FokI, Bbv I, Bsg I, Bcg I, Bpm I, BseR I, Bae I and to be selected from BstF5 I, Taq I, the restriction enzyme with higher optimum temperuture of BsaB I, Btr I, BstAP I, Fau I, Bcl I, Pci I, Apo I.

5. primer according to claim 1, it is characterized in that, described primer is used for the 2741st or the mutation analysis of 3597 bit bases of the 4th intron of people maspin gene, the mutation analysis that perhaps is used for the hepatitis B virus of anti-lamivudine perhaps is used for the mutation analysis of hepatitis C virus.

Images