KR100642829B1 - Method for detecting base mutation - Google Patents

Abstract

The present invention relates to a method for accurately and efficiently examining genetic nucleotide variations in living organisms.

Description

Method for detecting base mutation

1 is a Maldi-tope mass spectrometry diagram of 7mer when the 2741 base of the fourth intron of the human maspin (serpinb5) gene is normal (C / C).

FIG. 2 is a Maldi-tope mass spectrometry plot of 13mer when the 2741 base of the fourth intron of the human maspin gene is normal (C / C). FIG.

FIG. 3 is a Maldi-tope mass spectrometry plot of 7mer when the 2741 base of the fourth intron of the human maspin gene is hetero (C / T). FIG.

FIG. 4 is a Maldi-tope mass spectrometry plot of 13mer when the 2741 base of the fourth intron of the human maspin gene is hetero (C / T). FIG.

Figure 5 is a Maldi-tope mass spectrometry figure of 7mer when the 2741th base of the fourth intron of the human maspin gene is all mutated to T (T / T).

FIG. 6 is a Maldi-tope mass spectrometry plot of 13mers when all 2741 bases of the fourth intron of the human maspin gene are mutated to T (T / T). FIG.

7 is a figure of 7 mer and 13 mer maldi-tope mass spectrometry when the 3597th base of the fourth intron of the human maspin gene is normal (C / C).

8 is a figure of 7 mer and 13 mer maldi-tope mass spectrometry when the 3597th base of the fourth intron of the human maspin gene is hetero (C / T).

Figure 9 is a figure of 7 mer and 13 mer maldi-tope mass spectrometry when the 3597th base of the fourth intron of the human maspin gene is all mutated to T (T / T).

Genetic analysis of living organisms is widely used in relation to the risk of disease, diagnosis, prediction or treatment. For example, mutation analysis of specific genes of a specific person may lead to preventive efforts by predicting the degree of disease risk. Alternatively, through genetic analysis of other organisms causing infections, such as viruses, it is possible to induce effective treatment by examining whether the virus is resistant to the therapeutic drug. The present invention relates to a method for analyzing genes in living organisms, and more particularly, to a method for examining genetic variation.

As human genome maps are completed, it is possible to make more extensive estimates of disease risk, diagnose or predict disease, and predict response to drugs. Genomic sequencing of a large number of individuals reveals chromosomal locations that show diversity among individuals, which is called single nucleotide polymorphism (SNP). SNP is a variation that occurs more than a certain frequency among the nucleotide sequences arranged in the chromosome of life, and in humans, it appears that there is a probability of about one in every 1,000 bases. Given the size of human chromosomes, there are millions of SNPs. SNPs are believed to be a means of explaining the differences between individuals and can be used to identify or cause disease.

The SNPs discovered by the Human Genome Project only show the diversity between individuals, but do not reveal how the diversity relates to disease. In order to elucidate the relationship between SNP and disease, a process of comparative analysis (SNP scoring) of SNP variation patterns in normal people and patients is required. In order to clarify the relationship between SNP and disease, not only should a large number of SNPs be analyzed, but also the mutations can be analyzed without errors.

SNP scoring methods include DNA sequencing, PCR-SSCP (Polymerase chain reaction-Single stranded conformation polymorphism), allele specific hybridization, oligo-ligation, mini-sequencing And by enzyme digestion. A method using a DNA chip has also been introduced. In principle, it is not different from allel specific hybridization, except that it is differentiated from a stationary phase to which an oligonucleotide probe is attached.

DNA sequencing includes the Macsam-Gilbert method and the Sanger method, but the latter method is mainly used. This method is not for investigating the genetic variation of a specific position, but rather to reveal the nucleotide sequence of all or a part of the gene. However, if the nucleotide sequence is revealed, the genetic variation of a specific position can be identified, so it can be used for SNP scoring. have. However, it is inefficient in that it reads not only the mutation of the SNP to be investigated but also reads the nucleotide sequence of the surrounding which does not need to be investigated.

PCR-SSCP (Orita, M. et.al, Genomics, 1989, 5: 8874-8879) amplifies the sequences containing the SNPs to be analyzed by PCR, separates them into their respective chains, and then polyacrylamide gels. Perform electrophoresis at. Since the secondary structure of the DNA chain is changed by the difference of the base, the base variation is examined according to the difference in the electrophoretic movement speed due to this difference.

Allel specific hybridization is a method of hybridizing a sample DNA labeled with a radioisotope to a probe attached to a nylon filter or the like, and examining whether or not there is a base mutation by controlling conditions such as temperature and hybridization.

Nucleic Acid Research 24, 3728, 1996 investigates base mutations by performing reactions under conditions where ligation does not occur in a condition that is not complementary to template DNA and by checking whether the ligation proceeds. That's how.

Minisequencing (Genome Research 7: 606, 1997) is a method designed to condition that only one base at the position to be examined for polymerization is polymerized and that the detection reaction is different depending on what is polymerized one base. It was developed for scoring.

PCR-SSCP, allel specific hybridization, oligolization, etc. make it difficult to analyze a large amount of samples using polyacrylamide gels, or fail to identify errors caused by failure of the probe to bind to a desired position. There is this.

Minisequencing is a technique developed for SNP scoring, which is easy to analyze and is advantageous for analyzing large amounts of samples, but still has the disadvantage of failing to identify false results due to errors, and deletion and insertion of bases. There is a limit that can not be found.

Another technique developed for SNP scoring is enzymatic cleavage (WO 01/90419). This method amplifies the nucleotide sequence to be analyzed by PCR, but the amplified product includes a nucleotide sequence that can be cleaved or recognized by two restriction enzymes. The amplified result is a method of measuring the molecular weight of the fragment generated by cleavage with two restriction enzymes to determine the base variation. This analytical method has the advantage of easy and fast analysis step because the fragment is made by restriction enzyme reaction immediately after amplification of the gene by PCR and the molecular weight is measured by mass spectrometry. However, the enzymatic digestion method described in WO 01/90419 still does not confirm the erroneous analysis by error. For example, when primers bind to unwanted positions during PCR, incorrect analysis results may occur, but there is a problem that it is impossible to check whether the primers bind to unwanted positions. For example, the primer used to examine the base mutation of CYP2C9 may bind to CYP2C8. In this case, it is difficult to confirm whether an error occurs because the primer cannot bind to CYP2C8 rather than CYP2C9. In addition, the mutation in which one base is substituted with another base can be detected, but there is a problem in that a mutation due to deletion or insertion of a base cannot be detected. In addition, there is a problem that two or more adjacent base mutations cannot be detected at the same time.

The present invention solves the above problems, and it is an object of the present invention to provide a method that can accurately and efficiently investigate the genetic variation of life.

In order to achieve the above object, the present invention provides a method for accurately and efficiently analyzing genetic variation of living organisms.

Briefly describing the present invention, the present invention enables a precise base mutation investigation by allowing the base mutation investigation of a large number of samples to be easily and quickly performed while verifying an error that may be generated by binding a primer to a wrong position. In addition to simultaneously examining mutations in multiple bases within range, we have developed a method that can detect genetic variations due to deletion or insertion. In particular, when several genotypes exist in one organism at the same time, it is possible to distinguish whether base mutations at different positions exist simultaneously in one genotype or are mixed in different genotypes. For example, humans have two (one pair) chromosomes that contain the same genetic information, so if a genetic mutation occurs, both chromosomes may be mutated (homo), but only on one chromosome. (Hetero). If two or more adjacent base variants are all hetero, both base variants may be present on one chromosome at the same time, but may also be present on different chromosomes. The two cases may differ in their impact on life and need to be distinguished. In the case of viruses that infect humans, various genotypes may exist. If two or more adjacent base variants are all hetero, it is necessary to distinguish whether the two base variants exist in one genotype at the same time or in different genotypes.

The present invention amplifies the desired nucleotide sequence so that the result includes a site that can be cleaved with a restriction enzyme in order to analyze the genetic variation, so that the number of the base of the fragment cleaved by the restriction enzyme is 32 or less and at least 1 Dog bases are produced by replication of a template rather than a primer and provide a method for analyzing genetic variation by cleaving the amplified product with restriction enzymes and measuring the molecular weight.

That is, the present invention comprises amplifying a specific polynucleotide using a forward primer and a reverse primer; Cutting the amplified specific polynucleotide with a restriction enzyme to generate two or more single-stranded polynucleotide fragments containing a mutation sequence having a size of 2 to 32 bases; And it provides a genetic mutation analysis method comprising the step of measuring the molecular weight of the cut fragments.

In the present invention, one of two or more base mutations different from each other is present in only one single-stranded polynucleotide fragment, and another single-stranded nucleotide fragment is preferably cleaved to include two or more base variants. For example, if A and G in the sequence ... ATG ... are variant sequences, the first single-stranded nucleotide produced by restriction enzyme cleavage contains only A of the two variant sequences and the second Single stranded nucleotides are cleaved to include both A and G.

The present invention provides a method for amplifying a desired nucleotide sequence to include a site where the product can be cleaved with a restriction enzyme in order to analyze a genetic variation, while providing a fragment having a structure as shown below.

5'- Primer binding sequence 1 Restriction Enzyme Recognition Sequence Primer binding sequence 2 Mutation sequence Variant sequence Post-mutation sequence Primer binding sequence 3 -3 '

A restriction enzyme recognition sequence may not match a sequence that is cleaved as a sequence recognized simultaneously or adjacent by different restriction enzymes. For example, Fok1 and BstF5I both recognize the GGATG sequence, but the cleavage position is after the 9th / 13th and 2nd / 0th bases, respectively, from the 3 'end of the recognition sequence. The two restriction enzymes that can be used in the present invention for recognizing restriction enzyme sequences may be all restriction enzymes that can be used for the purpose of the present invention, namely restriction enzymes having the same optimum temperature or different optimal temperatures, among others. It is more preferable to have an optimum temperature, a restriction enzyme having a relatively low optimum temperature, Fok1, Bbv I, Bsg I, Bcg I, Bpm I, BseR I, or Bae I is preferred, a relatively high optimum temperature Restriction enzymes having BstF5 I, Taq I, BsaB I, Btr I, BstAP I, Fau I, Bcl I, Pci I, or Apo I are preferred, and Fok1 and BstF5 I pairs are most preferred.

Restriction enzymes Bae I at 25 ° C, Fok1, Bbv I, Bsg I, Bcg I, Bpm I, BseR I, Mmel I It has a relatively low optimum temperature of 37 ° C., BstF5 I and Taq I are 65 ° C., BsaB I, Btr I and BstAP I are 60 ° C., Fau I is 55 ° C., Bcl I, Pci I and Apo I are 50 ° C. It has a relatively high optimum temperature.

One of the two primers used for PCR amplification consists of primer binding sequence 1, restriction enzyme recognition sequence and primer binding sequence 2, and the other consists of primer binding sequence 3.

The 'primer binding sequence' is a sequence capable of complementarily binding to a nucleic acid that is a template, but the restriction enzyme sequence may not be complementary to the nucleic acid. Primer binding sequences 1, 2 and 3 should be at least 4 bases in order for primers to bind to template DNA, and should be at least 4 bases. It is preferable that it is 30 or less. The 'mutant sequence' is a sequence on the 5 'side of the base mutation to be investigated. 'Variation sequence' is a sequence corresponding to the variation of the base to be investigated. Substitutions, insertions, and deletions of bases may occur. The number of bases is usually one, but may be two or more. Post-mutation sequence is the sequence on the 3 'side of the mutation sequence.

It is preferable that the sequence before mutation and the sequence after mutation be one or more. The fragments generated after restriction enzyme digestion should contain the mutant sequence, and the number of bases of the fragments is preferably 2 to 32. More preferably, it has 12 bases. The reason for limiting the size of the cut sections is that the analysis results reflect the size of the good sections when analyzed by mass spectrometry. Since the fragments having a size of more than 32 are too large to investigate the base variation by calculating the molecular weight using mass spectrometry, the number of bases of such fragments is preferable. In addition, the fragment consisting of only one base is not preferable because it contains only the mutant sequence, so it is difficult to confirm whether the primer is bound to the wrong position. Since the two restriction enzymes recognize the same or adjacent sites, it is preferable that the other restriction enzyme does not act during the reaction of either restriction enzyme. In this case, when the amplified product is cleaved with the restriction enzyme, it can be reacted successively at different temperatures in consideration of the optimum temperature of the two restriction enzymes. Alternatively, one restriction enzyme may be cleaved first and then the other enzyme. At this time, the cleavage by the restriction enzyme to be used should not remove or corrupt the recognition sequence or cleavage position of the second restriction enzyme present in the fragment including the mutant sequence.

Example 1 Nucleotide Mutations of the 2741th Base of the 4th Intron of the Human Maspin Gene

The mutation of the 2741 base (rs1509477; 61001755 base on chromosome 18) of the 4th intron of the maspin (serpinb5) gene known as a human metastasis suppressor gene was examined.

1. PCR Amplification and Restriction Enzyme Cleavage

The sequence of template DNA (5 '→ 3') is as follows.

GTT TCACTTGATAAAGCAATAAAATGCTATTCA cAGCT GCATGAGGCTACACCCTTCTTTTGAAT GCAG (SEQ ID NO: 1)

The underlined sequences are the sites where primers 1 and 2 bind below. Bases written in lowercase are 'sequence sequences'.

Primer 1.5'-TCACTTGATAAAGCAATAAAAggatgGCTATTCA-3 '(34mer) (SEQ ID NO: 2)

Primer 2. 5'- CATTCAAAAGAAGGGTGTAGCCTCATGC-3 '(28mer) (SEQ ID NO: 3)

Lowercase sequences are the recognition sequences of Fok1 and BstF5I.

Add PCR buffer (1x), MgSO ₄ 2 mM, dNTP 200 mM, Platinum Taq Polymerase (Invitrogen, 10966-026) 0.315U, 0.5 μM of primers 1 and 2, 36 ng of genome DNA, and adjust the total reaction volume to 18 ul. . And PCR reaction is performed under the following conditions.

94 minutes 2 minutes,

94 ℃ 15 seconds 55 ℃ 15 seconds 72 ℃ 30 seconds (10 cycles),

94 ° C 15s 60 ° C 15s 72 ° C 30s (35 cycles)

Genome DNA is extracted from blood and isolated purely according to conventional methods. For example, the 'SDS / Protease K' method can be used (Maniatis, Molecular Cloning, A laboratory Manual, Cold Spring Harber Laboratory Press, Cold Spring Harbor, 1989) or QIAamp DNA Mini Kit 250 (Qiagen 51106). Can be used to separate DNA from blood. If the DNA concentration is low, the DNA can be concentrated and used in the following way. Add 1/10 volume of 3M Sodium acetate (pH 5.3) and 2.5 volumes of ethanol to the DNA solution, mix gently and leave at -20 ℃ for at least 1 hour. Centrifuge for 15 minutes at 4 ° C., 13000 rpm. Carefully remove the supernatant and add 70% ethanol and centrifuge for 10 min at 4 ° C and 13000 rpm. The ethanol is dried and then dissolved in a desired volume of distilled water.

The sequence of fragments generated by PCR is as follows (5 '-> 3').

TCACTTGATAAAGCAATAAAAggatgGC TATTCA [C / T] AGCTGCATGAGGCTACACCCTTCTTTTGAATG (SEQ ID NO: 4)

AGTGAACTATTTCGTTATTTTcctac CGATAAGT [G / A] TCGA CGTACTCCGATGTGGGAAGAAAACTTAC (SEQ ID NO: 5)

The lower case region is the sequence recognized by Fok1 and BstF5I, the underlined region is the sequence of the fragment produced by cleavage of the restriction enzyme, and the base indicated in square brackets ([]) is the 'sequence sequence'. FokI (NEB R109L) 1 U, BstF5I (NEB, V0031L) 1 U, 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM dithiothreitol (PH 7.9, 25 ° C) reaction Under the composition, the reaction is carried out at 25 ° C. for 2 hours, at 45 ° C. for 2 hours.

In order to optimize the enzymatic reaction, the amplified product was reacted with Fok1 and BstF5I at 25 ° C, 37 ° C, 45 ° C, 55 ° C and 65 ° C, respectively. For Fok I, 70%, 25% and 90% It was confirmed that an abnormal reaction proceeds. In addition, in the case of BstF5I it was confirmed that the enzyme reaction proceeds at a temperature except 25 ℃. Therefore, it is preferable to first react at 25 ° C, which is the temperature at which FokI can act, and then at 37 ° C or higher, which is the temperature at which BstF5I can react.

2. Purification and Desalting

It is preferable to purely separate the DNA fragment from the above solution treated with the restriction enzyme and then measure the molecular weight. For example, the Nucleave Genotyping Kit (variagenics, USA) can be used. First, 70 μl of 1M TEAA (Triethylammoniumacetate, pH 7.6) is added to the restriction enzyme reaction solution and left for 1 minute. After passing 70 μl of 1M TEAA and 90 μl of the above mixture into the sample preparation plate, pass through 85 μl of 0.1 M TEAA five times. Centrifuge the Sample Preparation Plate at 1000 rpm for 5 minutes. Place the Sample Preparation Plate on the Collection Plate and add 60 μl of 60% isopropanol. Once the eluate is collected on the collection plate, dry the collection plate at 115 ° C for 75 minutes.

3. MALDI-TOF Mass Spectrometry

Add 6μl of MALDI matrix (22.8 mg ammonium citrate, 148.5 mg hydroxypicolinic acid, 1.12 ml acetonitrile, 7.8 ml H2O) to the collection plate and place 4μl on the Anchor chip plate of MALDI-TOF (Biflex IV, Bruker). Dry at 37 ° C. for 30 minutes, leave to room temperature for a while to cool and analyze by MALDI-TOF. The method of analysis follows the manual of MALDI-TOF.

When the 2741 base of the fourth intron is normal (C / C), the molecular weights of the fragments generated after enzyme cleavage are 2135.4 D (7 mer) and 4078.6 (13 mer) D (Figs. 1 and 2). In the case of hetero (C / T), the molecular weights of the resulting fragments are 2135.4 D, 2150.4 D (more than 7 mer), 4078.6 D and 4062.6 D (13 mer) (Figures 3 and 4). On the other hand, when all are converted to T (T / T), the molecular weight of the fragment is 2150.4 D (7 mer) and 4062.6 D (13 mer) (Figs. 5 and 6).

Example 2. Variation of the 3597th base (rs1396782; 61002611th base on chromosome 18) of the fourth intron of the maspin (serpinb5) gene known as a human cancer metastasis suppressor gene

The sequence of template DNA is as follows.

CTG GAGTATTATCCTTGCAGGCTTGATATGAAG cTTGAAAT TTCTCCCCAAAGAGATTTAGTTAACAGGC AAA (SEQ ID NO: 6)

The underlined portion of the sequence above is the portion to which the primers 3 and 4 bind respectively. The lowercased variant is the variant sequence.

Primer 3. 5 'GAGTATTATCCTTGCAGGCTTggatgATATGAAG 3' (34 mer) (SEQ ID NO: 7)

Primer 4. 5 '-GCCTGTTAACTAAATCTCTTTGGGGAGAA 3' (29 mer) (SEQ ID NO: 8)

The site indicated in lowercase letters in the above primer is a sequence which is not present in Template DNA and is recognized by Fok1 and BstF5I. Experimental method including the PCR reaction is the same as in Example 1.

The sequence of fragments generated by PCR is as follows (5 '-> 3').

GAGTATTATCCTTGCAGGCTTggatgAT ATGAAG [C / T] TTGAAATTTCTCCCCAAAGAGATTTAGTTAACAGGC (SEQ ID NO: 9)

CTCATAATAGGAACGTCCGAAcctac TATACTTC [G / A] AACT TTAAAGAGGGGTTTCTCTAAATCAATTG TCCG (SEQ ID NO: 10)

In the above sequence, the lower case region is a restriction enzyme sequence and the underlined region is a sequence of fragments produced by cleavage of the restriction enzyme, and the bases indicated by square brackets ([]) are 'mutation sequences'. FokI (NEB R109L) 1 U, BstF5I (NEB, V0031L) 1 U, 50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM dithiothreitol (PH 7.9, 25 ° C) reaction Under the composition, the reaction is carried out for 2 hours at 25 ° C. for 2 hours.

When the 3597th base of the fourth intron is normal (C / C), the molecular weights of the fragments generated after the enzyme cleavage are 2209.4 D (7 mer) and 3988.6 (13 mer) D (FIG. 7). In the case of hetero (C / T), the resulting molecular weights are 2209.4 D, 2224.4 D (more than 7 mer), 3988.6 D and 3972.6 D (13 mer) (FIG. 8). On the other hand, when all are transformed to T (T / T), the molecular weight of the fragment is 2224.4 D (7 mer) and 3972.6 D (13 mer) (Fig. 9).

Example 3 Tyrosine-Methionine-Aspartate-Aspartate (YMDD) Site Variation of Hepatitis B Virus DNA Polymerase

The base mutation of the YMDD site located in the DNA polymerase gene of hepatitis B virus causing human hepatitis B was investigated. Base mutation at this site results in resistance to lamivudine, a therapeutic agent for hepatitis B. It is known that resistance to lamivudine occurs when methionine (M), the codon 552, is changed to valine (V) or isoleucine (I).

1. PCR Amplification and Restriction Enzyme Cleavage

The DNA of hepatitis B virus is extracted from 0.2 ml of serum using a QIAamp blood kit (Qiagen, CA) and 2 ul of this is used for PCR amplification.

The sequence of template DNA (5 '→ 3') is as follows.

TTCCCCCACTGTTTGGCTTTCAGTTAT ATG GATGATGTGGTATTGGGGGCCAAGTCTGTA (SEQ ID NO: 11)

The underlined sequences are the sites to which primers 5 and 6 bind below.

Primer 5 (SEQ ID NO: 12). 5'- TTCCCCCACTGTTTGGCTggatgTCAGTTAT-3 '(31mer)

Primer 6 (SEQ ID NO: 13). 5'- TACAGACTTGGCCCCCAATACCACAT G ATC-3 '(30mer)

The lowercased sequence in primer 5 is an cognitive sequence of Fok1 and BstF5I that is artificially inserted into the template DNA, and the sequence underlined in primer 6 is an artificially modified sequence to prevent recognition by Fok1.

PCR reaction was performed under the following conditions using 18 ul of a reaction solution containing 20 mM TrisHCl (pH 8.4), 50 mM KCl, 0.2 mM dNTP, 0.4 U Platinum Taq Polymerase (Invitrogen, 10966-026), and 10 pmol of primers 5 and 6, respectively. Do this.

94 minutes 2 minutes,

94 ℃ 15 seconds 50 ℃ 15 seconds 72 ℃ 30 seconds (10 cycles),

94 ° C 15s 55 ° C 15s 72 ° C 30s (35 cycles)

The sequence of fragments generated by PCR is as follows (5 '-> 3').

TTCCCCCACTGTTTGGCTggatgTC AGTTATA TGGATCATGTGGTATTGGGGGCCAAGTCTGTA (SEQ ID NO: 14)

AAGGGGGTGACAAACCGAcctac AGTCAATATACCT AGTACACCATAACCCCCGGTTCAGACAT (SEQ ID NO: 15)

Lowercase sites are sequences recognized by Fok1 and BstF5I and underlined sites are sequences of fragments produced by cleavage of restriction enzymes. The PCR reaction was mixed with FokI (NEB R109L) 1 U, BstF5I (NEB, V0031L) 1 U and the reaction solution (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT) at 37 ° C. The reaction is carried out for 2 hours and at 45 ° C for 2 hours. The first cut with FokI for 2 hours at 37 ℃, then BstF5I may be added for 2 hours at 45 ℃.

2. Purification and Desalting and MALDI-TOF Mass Spectrometry

It is carried out in the same manner as in Example 1.

The calculated size of the fragments produced by the enzymatic cleavage and the value measured by the actual molecular weight analysis were exactly matched to show a difference of less than 0.1% (Table 1).

TABLE 1 Expected and Observed Mass of Oligonucleotides by Restriction Enzyme Cleavage of PCR Products

In the above table, the resolution (the difference between the observed mass and the expected mass divided by the expected mass) is all 0.1% or less.

Example 4 Base Variation of 5'NCR (Non Coding Region) Site of Hepatitis C Virus

The use of interferon for the treatment of chronic hepatitis C shows different therapeutic effects depending on the genotype of the hepatitis C virus in the human body. Therefore, it is necessary to investigate the genotype of hepatitis C virus in the body before using interferon. . In order to determine the genotype it is useful to examine the base mutation of 5'NCR, this example describes a method for analyzing the base mutation of the 5'NCR region of hepatitis C virus.

RT PCR

RNA of hepatitis C virus is extracted from 0.14 ml of serum using a QIAamp viral RNA Mini kit (Qiagen, CA), of which 10 ul is used for RT PCR amplification.

The reaction solution containing 0.2 mM dNTP, 0.4 uM primer 2, and 10 ul RNA is allowed to stand on ice for 1 minute after reaction at 65 ° C for 5 minutes. 20 mM TrisHCl (pH 8.4), 50 mM KCl, 4 mM DTT, 0.4 uM primer 1, 100 U SuperScript III RNase H- Reverse Transcriptase (Invitrogen, 18080-044), 20 U RNaseOUT (Invitrogen, 10777-). 019), 25 ul of the reaction solution mixed with 0.4 U Platinum Taq Polymerase (Invitrogen, 10966-026) is carried out by RT PCR under the following conditions.

50 ° C. 45 minutes,

94 minutes 2 minutes,

94 ° C 15s 55 ° C 15s 72 ° C 15s (35 cycles)

72 ℃ 5 minutes

The sequence of template DNA (5 '→ 3') is as follows.

GCAGAAAGCGTCTAGCCATGGCGT TAGTATGAGT (middle omitted) ACTGCCTGATAGGGTGCTTGCGAG (SEQ ID NO: 16)

The underlined sequences are the sites to which primers 7 and 8 bind below.

Primer 7 (SEQ ID NO: 17). 5'- GCAGAAAGCGTCTAGCCATGGCGT-3 '(24 mer)

Primer 8 (SEQ ID NO: 18). 5'- CTCGCAAGCACCCTATCAGGCAGT-3 '(24 mer)

2. Nested PCR and restriction enzyme cleavage

Dilute the above RT PCR reaction solution to 1/50, 2 ul of which is 20 mM TrisHCl (pH 8.4), 50 mM KCl, 0.2 mM dNTP, 0.4U Platinum Taq Polymerase (Invitrogen, 10966-026), primers 9, 10, 11 The following three PCR reactions and restriction enzyme treatment were carried out using 18 ul of the reaction solution containing 10 pmol of 12 or 13 or 14, respectively. In reaction 1, primers 9 and 10, in reaction 2, primers 11 and 12, and in reaction 3, primers 13 and 14 are used. PCR reaction temperature and time for all three reactions are as follows.

5 minutes at 94 ° C,

94 ° C 30sec 55 ° C 30sec 72 ° C 30sec (35 cycles)

72 ℃ 5 minutes

1) Reaction ①

The RT-PCR reaction solution is subjected to PCR using primers 9 and 10. The sequence of template DNA (5 '→ 3') is as follows.

CGTCTAGCCATGGCGTTAGTATGAGTGT CGTGCAGCCTCCAGGACCC ... (Omitted)

... CTGCTAGCCGAGTAGTGTTGGGTCGCGAAAG GCCTTGTGGTACTGCCTGATAGGG (SEQ ID NO: 19)

The underlined sequences are the sites to which primers 9 and 10 bind below.

Primer 9 (SEQ ID NO: 20). 5'- CGTCTAGCCATGGCGTTAGggatgATGAGTGT-3 '(32 mer)

Primer 10 (SEQ ID NO: 21). 5'- CCCTATCAGGCAGTACCACAAGGC-3 '(24 mer)

The sequence of fragments generated by PCR is as follows (5 '-> 3').

CGTCTAGCCATGGCGTTAGggatgAT GAGTGTC GTGCAGCCTCCAGGACCC ... (omitted)

GCAGATCGGTACCGCAATCcctac TACTCACAGCACG TCGGAGGTCCTGGG ... (omitted)

... CTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGGG (SEQ ID NO 22)

... GACGATCGGCTCATCACAACCCAGCGCTTTCCGGAACACCATGACGGACTATCCC (SEQ ID NO 23)

Lowercase sites are sequences recognized by Fok1 and BstF5I and underlined sites are sequences of fragments produced by cleavage of restriction enzymes (7mers and 13mers). The PCR reaction was mixed with FokI (NEB R109L) 1 U, BstF5I (NEB, V0031L) 1 U and the reaction solution (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT) at 37 ° C. The reaction is carried out for 2 hours and at 45 ° C for 2 hours. First cut with FokI for 2 hours at 37 ℃, BstF5I can be added to cut for 2 hours at 45 ℃.

2) Reaction ②

The RT-PCR reaction solution is subjected to PCR using primers 11 and 12. The sequence of template DNA (5 '→ 3') is as follows.

GTGGTCTGCGGAACCGGTGAGTACACCGGAAT TGCCAGGACGACCGGGTCC ... (Omitted)

... CCCCGCAAGACTG CTAGCCGAGTAGRGTTGGGTRGCGAA (SEQ ID NO.24 )

The underlined sequences are the sites to which primers 11 and 12 bind below.

Primer 11 (SEQ ID NO: 25). 5'- GTGGTCTGtccaacCGGTGAGTACACCGGAAT-3 '(32 mer)

Primer 12 (SEQ ID NO: 26). 5'- TTCGCRACCCAACRCTACtccaacggtcCGGCTAG-3 '(35 mer)

The base designated by R is adenine (A) or guanine (G), using a mixture of two primers containing each base.

The sequence of fragments generated by PCR is as follows (5 '-> 3').

GTGGTCTGtccaacCGGTGAGTACACCGGAATTG CCAGGACGACCGG GTCC ... (Omitted)

CACCAGACaggttgGCCACTCATGTGGCCTTA ACGGTCCTGCTGGCCCAG G ... (Omitted)

... CCCCGC AAGACTGCTAGCCG gaccgttggaGTAGRGTTGGGTRGCGAA (SEQ ID NO 27)

... GGGG CGTTCTGACGATCGGCctg gcaacctCATCRCAACCCARCGCTT (SEQ ID NO 28)

Lowercase letters are Mme1 And AvaII The underlined site is the sequence of the fragment produced by cleavage of the restriction enzyme (13mer, 18mer, 24mer and 19mer). PCR reaction was mixed with 10ul of MmeI (NEB R0637L) 1.5U, 50 uM SAM and 1 X reaction solution (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT, pH 7.9) at 37 ° C. 2 hours and 1.5U of AvaII (NEB, R0153S) were added and the reaction was performed at 37 ° C. for 2 hours. MmeI and AvaII can be added and reacted at the same time.

3) Reaction ③

PCR is performed on the RT-PCR reaction solution using primers 13 and 14. The sequence (5 '→ 3') of the template DNA is as follows.

GACIGGGTCCTTTCTTGGA TCAACCCGCTCAATGCCTGGAG ATTTGGGCGTGCCCCCGC (SEQ ID NO 29)

The underlined sequences are the sites to which primers 13 and 14 bind below.

Primer 13 (SEQ ID NO: 30). 5'- GACIGGGTCCTggatgTCTTGGA-3 '(23 mer)

Primer 14 (SEQ ID NO: 31). 5'- GCGGGGGCACggatgCCCAAAT-3 '(22 mer)

The base designated I is Inosine.

The sequence of fragments generated by PCR is as follows (5 '-> 3').

GACIGGGTCCTggatgTC TTGGATC AACCCGCTCAATGC CTGGAGATTTGGG catccGTGCCCCCGC (SEQ ID NO 32)

CTGICCCAGGAcctac AGAACCTAGTTGG GCGAGTTACGGACC TCTAAAC CCgtaggCACGGGGGCG (SEQ ID NO: 33)

Lowercase sites are sequences recognized by Fok1 and BstF5I and underlined sites are sequences of fragments produced by cleavage of restriction enzymes. The resulting intercepts are two 3mers, two 13mers and two 14mers. The PCR reaction was mixed with FokI (NEB R109L) 1 U, BstF5I (NEB, V0031L) 1 U and the reaction solution (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT) at 37 ° C. The reaction is carried out for 2 hours and at 45 ° C for 2 hours. The first cut with FokI for 2 hours at 37 ℃, then BstF5I may be added for 2 hours at 45 ℃.

2. Purification and Desalting and MALDI-TOF Mass Spectrometry

Three types of PCR and restriction enzyme cleavage reaction solution were purified in the same manner as in Example 1 and the molecular weight was measured.

The size of the fragments generated by reactions ① (Table 2), ② (Table 3) and ③ (Table 4) is as shown in the following Tables 2 to 4. The genotype of hepatitis C virus is determined by the size of the sections according to the lookup table shown in Tables 2-4.

TABLE 2

Genotype 7 mer 13 mer 1a 2216.4 3983.6 1b 2216.4 3983.6 1c 2216.4 3983.6 3a 2216.4 3983.6 3b 2216.4 3983.6 3c 2216.4 3983.6 3d 2216.4 3983.6 3e 2216.4 3983.6 3f 2216.4 3983.6 6b 2216.4 3983.6 7a 2216.4 3983.6 7b 2216.4 3983.6 7c 2216.4 3983.6 2' 2216.4 3989.6 5a 2216.4 3989.6 1b 2216.4 3998.6 1d 2216.4 3998.6 1e 2216.4 3998.6 1f 2216.4 3998.6 2a 2216.4 3998.6 2b 2216.4 3998.6 2c 2216.4 3998.6 2d 2216.4 3998.6 2e 2216.4 3998.6 2' 2216.4 3998.6 4h 2216.4 3998.6 6a 2216.4 3998.6 7d 2216.4 3998.6 1b 2231.4 3967.6 4 g 2231.4 3967.6 4k 2231.4 3967.6 2a 2231.4 3982.6 4a 2231.4 3982.6 4b 2231.4 3982.6 4c 2231.4 3982.6 4d 2231.4 3982.6 4e 2231.4 3982.6 4e ' 2231.4 3982.6 4f 2231.4 3982.6 4f ' 2231.4 3982.6

TABLE 3

Genotype 13 mer 18 mer Genotype 14mer 19 mer 1a 4049.6 5556.6 2a 4337.8 5891.8 1b 4049.6 5556.6 2e 4337.8 5891.8 1c 4049.6 5556.6 4b 4337.8 5891.8 1d 4049.6 5556.6 4e ' 4337.8 5891.8 1e 4049.6 5556.6 1a 4352.8 5875.8 1f 4049.6 5556.6 1c 4352.8 5875.8 6b 4049.6 5556.6 1d 4352.8 5875.8 7a 4049.6 5556.6 1e 4352.8 5875.8 7b 4049.6 5556.6 2a 4352.8 5875.8 4a 4049.6 5572.6 2b 4352.8 5875.8 6a 4064.6 5540.6 2c 4352.8 5875.8 7c 4064.6 5540.6 2d 4352.8 5875.8 7d 4064.6 5540.6 2'-1 4352.8 5875.8 4f ' 4065.6 5541.6 2'-2 4352.8 5875.8 4e ' 4064.6 5556.6 3a 4352.8 5875.8 4f 4065.6 5557.6 3b 4352.8 5875.8 4 g 4065.6 5557.6 3d 4352.8 5875.8 5a 4080.6 5525.6 3e 4352.8 5875.8 3b 4080.6 5541.6 4c 4352.8 5875.8 4b 4080.6 5541.6 4d 4352.8 5875.8 4c 4080.6 5541.6 4f 4352.8 5875.8 4d 4080.6 5541.6 4f ' 4352.8 5875.8 4e 4080.6 5541.6 4 g 4352.8 5875.8 4h 4080.6 5541.6 6a 4352.8 5875.8 4k 4080.6 5541.6 6b 4352.8 5875.8 2d 4088.6 5515.6 7c 4353.8 5876.8 2b 4088.6 5530.6 1b 4368.8 5860.8 3f 4096.6 5526.6 1f 4368.8 5860.8 2a 4104.6 5500.6 3c 4368.8 5860.8 2c 4104.6 5500.6 3f 4368.8 5860.8 2e 4104.6 5500.6 4a 4368.8 5860.8 2' 4104.6 5500.6 4e 4368.8 5860.8 2' 4104.6 5500.6 4h 4368.8 5860.8 3a 4111.6 5510.6 4k 4368.8 5860.8 3c 4111.6 5510.6 5a 4368.8 5860.8 3d 4111.6 5510.6 7a 4368.8 5860.8 3e 4111.6 5510.6 7b 4368.8 5860.8 7d 4368.8 5860.8

TABLE 4

HCV nt-140 Forward HCV nt-140 Reverse nt-140_Intra (14mer) Genotype 7 mer 13 mer Genotype 7 mer 13 mer Genotype Forward Reverse 6a 2191.4 4053.6 2'-2 2144.4 4110.6 2d 4247.8 4392.8 6b 2191.4 4053.6 4f ' 2144.4 4110.6 2a 4247.8 4408.8 7d 2191.4 4053.6 5a 2144.4 4110.6 2c 4247.8 4408.8 1f 2191.4 4062.6 1a 2144.4 4125.6 2e 4247.8 4408.8 1a 2191.4 4078.6 1b 2144.4 4125.6 2'-1 4247.8 4408.8 1b 2191.4 4078.6 1c 2144.4 4125.6 2'-2 4247.8 4408.8 1e 2191.4 4078.6 1d 2144.4 4125.6 1d 4248.8 4368.8 4a 2191.4 4078.6 1e 2144.4 4125.6 1f 4287.8 4368.8 4b 2191.4 4078.6 1f 2144.4 4125.6 3a 4256.8 4414.8 4e ' 2191.4 4078.6 6a 2144.4 4125.6 3c 4256.8 4414.8 7a 2191.4 4078.6 6b 2144.4 4125.6 3e 4256.8 4414.8 7b 2191.4 4078.6 7a 2144.4 4125.6 2b 4562.0 4714.0 7c 2191.4 4078.6 7b 2144.4 4125.6 1a 4272.8 4368.8 3d 2200.4 4044.6 7c 2144.4 4125.6 1b 4272.8 4368.8 4 g 2200.4 4044.6 7d 2144.4 4125.6 1c 4272.8 4368.8 4k 2200.4 4053.6 3a 2159.4 4078.6 1e 4272.8 4368.8 3b 2200.4 4069.6 3c 2159.4 4078.6 4a 4272.8 4368.8 3c 2200.4 4069.6 3d 2159.4 4078.6 4e ' 4272.8 4368.8 3e 2200.4 4069.6 3e 2159.4 4078.6 7a 4272.8 4368.8 4e 2206.4 4037.6 3b 2159.4 4094.6 7b 4272.8 4368.8 1b 2206.4 4062.6 3f 2159.4 4094.6 3d 4570.0 4744.0 1c 2206.4 4062.6 4c 2159.4 4094.6 3f 4546.0 4744.0 2'-2 2206.4 4062.6 4d 2159.4 4094.6 3b 4272.8 4384.8 4f ' 2206.4 4062.6 4e 2159.4 4094.6 4b 4272.8 4384.8 5a 2206.4 4062.6 4f 2159.4 4094.6 4c 4272.8 4384.8 1b 2215.4 4053.6 4h 2159.4 4094.6 4d 4272.8 4384.8 2a 2215.4 4053.6 4k 2159.4 4094.6 4f ' 4272.8 4384.8 2b 2215.4 4053.6 4a 2159.4 4109.6 5a 4272.8 4384.8 2c 2215.4 4053.6 4e ' 2159.4 4109.6 4e 4296.8 4384.8 2d 2215.4 4053.6 4b 2184.4 4070.6 4 g 4586.0 4714.0 2e 2215.4 4053.6 4 g 2184.4 4070.6 4k 4287.8 4384.8 2'-1 2215.4 4053.6 2a 2193.4 4061.6 4f 4562.0 4384.8 3f 2215.4 4053.6 2b 2193.4 4061.6 4h 4562.0 4384.8 4c 2215.4 4053.6 2e 2193.4 4061.6 6a 4586.0 4698.0 4d 2215.4 4053.6 2d 2193.4 4076.6 6b 4586.0 4698.0 4f 2215.4 4053.6 2c 2209.4 4046.6 7d 4586.0 4698.0 4h 2215.4 4053.6 2'-1 2209.4 4046.6 1b 4288.8 4353.8 3a 2216.4 4054.6 2c 2209.4 4030.6 7c 4288.8 4353.8 1d 2215.4 4078.6

The present invention can verify the wrong analysis due to the error of the existing base mutation analysis method, and can simultaneously investigate the variation of several adjacent bases within the 32 base range. In particular, when there are various genotypes of living organisms showing variations in bases, it is possible to distinguish whether base mutations of different positions exist simultaneously in one genotype or are mixed in two or more genotypes. In addition, genetic variation due to deletion or insertion can be detected.

<110> GeneMatrix Inc .; Yoo, Wang Don <120> Method for detecting base mutation <130> 03DPA158 <150> KR2002-0063832 <151> 2002-10-18 <160> 33 <170> KopatentIn 1.71 <210> 1 <211> 69 <212> DNA <213> Homo sapiens <400> 1 gtttcacttg ataaagcaat aaaatgctat tcacagctgc atgaggctac acccttcttt 60 tgaatgcag 69 <210> 2 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for 4th intron region of maspin gene <400> 2 tcacttgata aagcaataaa aggatggcta ttca 34 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for 4th intron region of maspin gene <400> 3 cattcaaaag aagggtgtag cctcatgc 28 <210> 4 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Resulting PCR Fragment <400> 4 tcacttgata aagcaataaa aggatggcta ttcactagct gcatgaggct acacccttct 60 tttgaatg 68 <210> 5 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Resulting PCR Fragment <400> 5 agtgaactat ttcgttattt tcctaccgat aagtgatcga cgtactccga tgtgggaaga 60 aaacttac 68 <210> 6 <211> 73 <212> DNA <213> Homo sapiens <400> 6 ctggagtatt atccttgcag gcttgatatg aagcttgaaa tttctcccca aagagattta 60 gttaacaggc aaa 73 <210> 7 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for 4th intron region of maspin gene <400> 7 gagtattatc cttgcaggct tggatgatat gaag 34 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for 4th intron region of maspin gene <400> 8 gcctgttaac taaatctctt tggggagaa 29 <210> 9 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> Resulting PCR Fragment <400> 9 gagtattatc cttgcaggct tggatgatat gaagctttga aatttctccc caaagagatt 60 tagttaacag gc 72 <210> 10 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> Resulting PCR Fragment <400> 10 ctcataatag gaacgtccga acctactata cttcgaaact ttaaagaggg gtttctctaa 60 atcaattgtc cg 72 <210> 11 <211> 60 <212> DNA <213> Hepatitis B virus <400> 11 ttcccccact gtttggcttt cagttatatg gatgatgtgg tattgggggc caagtctgta 60                                                                           60 <210> 12 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for HBV <400> 12 ttcccccact gtttggctgg atgtcagtta t 31 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for HBV <400> 13 tacagacttg gcccccaata ccacatgatc 30 <210> 14 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> Resulting PCR fragment <400> 14 ttcccccact gtttggctgg atgtcagtta tatggatcat gtggtattgg gggccaagtc 60 tgta 64 <210> 15 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> Resulting PCR fragment <400> 15 aagggggtga caaaccgacc tacagtcaat atacctagta caccataacc cccggttcag 60 acat 64 <210> 16 <211> 58 <212> DNA <213> Artificial Sequence <220> 5223 Noncoding region of HCV <400> 16 gcagaaagcg tctagccatg gcgttagtat gagtactgcc tgatagggtg cttgcgag 58 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of 5'NCR of HCV <400> 17 gcagaaagcg tctagccatg gcgt 24 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of 5'NCR of HCV <400> 18 ccctatcagg cagtaccaca aggc 24 <210> 19 <211> 106 <212> DNA <213> Artificial Sequence <220> <223> Resulting PCR fragment <400> 19 cgtctagcca tggcgttagg gatgatgagt gtcgtgcagc ctccaggacc cctgctagcc 60 gagtagtgtt gggtcgcgaa aggccttgtg gtactgcctg ataggg 106 <210> 20 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 20 cgtctagcca tggcgttagg gatgatgagt gt 32 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 21 ccctatcagg cagtaccaca aggc 24 <210> 22 <211> 106 <212> DNA <213> Artificial Sequence <220> <223> Resulting PCR fragment <400> 22 cgtctagcca tggcgttagg gatgatgagt gtcgtgcagc ctccaggacc cctgctagcc 60 gagtagtgtt gggtcgcgaa aggccttgtg gtactgcctg ataggg 106 <210> 23 <211> 106 <212> DNA <213> Artificial Sequence <220> <223> Resulting PCR fragment <400> 23 gcagatcggt accgcaatcc ctactactca cagcacgtcg gaggtcctgg ggacgatcgg 60 ctcatcacaa cccagcgctt tccggaacac catgacggac tatccc 106 <210> 24 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> Template DNA <400> 24 gtggtctgcg gaaccggtga gtacaccgga attgccagga cgaccgggtc cccccgcaag 60 actgctagcc gagtagrgtt gggtrgcgaa 90 <210> 25 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 25 gtggtctgtc caaccggtga gtacaccgga at 32 <210> 26 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 26 ttcgcraccc aacrctactc caacggtccg gctag 35 <210> 27 <211> 99 <212> DNA <213> Artificial Sequence <220> <223> Resulting PCR fragment <400> 27 gtggtctgtc caaccggtga gtacaccgga attgccagga cgaccgggtc cccccgcaag 60 actgctagcc ggaccgttgg agtagrgttg ggtrgcgaa 99 <210> 28 <211> 99 <212> DNA <213> Artificial Sequence <220> <223> Resulting PCR fragment <400> 28 caccagacag gttggccact catgtggcct taacggtcct gctggcccag gggggcgttc 60 tgacgatcgg cctggcaacc tcatcrcaac ccarcgctt 99 <210> 29 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Template DNA <220> <221> modified_base <222> (4) <223> i <400> 29 gacngggtcc tttcttggat caacccgctc aatgcctgga gatttgggcg tgcccccgc 59 <210> 30 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <220> <221> modified_base <222> (4) <223> i <400> 30 gacngggtcc tggatgtctt gga 23 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 31 gcgggggcac ggatgcccaa at 22 <210> 32 <211> 67 <212> DNA <213> Artificial Sequence <220> <223> Resulting PCR fragment <220> <221> modified_base <222> (4) <223> i <400> 32 gacngggtcc tggatgtctt ggatcaaccc gctcaatgcc tggagatttg ggcatccgtg 60 cccccgc 67 <210> 33 <211> 67 <212> DNA <213> Artificial Sequence <220> <223> Resulting PCR fragment <220> <221> modified_base <222> (4) <223> i <400> 33 ctgncccagg acctacagaa cctagttggg cgagttacgg acctctaaac ccgtaggcac 60 gggggcg 67

Claims (18)

a) amplifying a specific polynucleotide using a forward primer and a reverse primer; b) cleaving the amplified specific polynucleotides with restriction enzymes to generate two or more single stranded polynucleotide fragments having a mutation sequence of 2 to 32 bases and comprising a mutant sequence; And c) Gene mutation analysis method comprising the step of measuring the molecular weight of the cleaved section. The method of claim 1, Genetic variation analysis method in which one variation of two or more base mutations exists only in one polynucleotide fragment, and the other nucleotide fragment is cleaved to include both two or more base mutations. a) amplifying a specific polynucleotide using a forward primer and a reverse primer; b) cleaving the specific polynucleotide amplified by allowing the second restriction enzyme to react after the reaction of the second restriction enzyme does not proceed while the first restriction enzyme reaction is in progress ; And c) Gene mutation analysis method comprising the step of measuring the molecular weight of the cleaved section. The method according to claim 1 or 3, The forward primer is a genetic mutation analysis method comprising a primer binding sequence 1, restriction enzyme recognition sequence, and primer binding sequence 2. The method of claim 4, wherein The forward primer is a gene mutation analysis method characterized in that the one of the primers selected from the group consisting of SEQ ID NO: 2, 7, 12, 20, 25 and 30. The method according to claim 1 or 3, The restriction enzyme treatment step is a genetic mutation analysis method characterized in that using the restriction enzyme having a different optimum temperature. The method of claim 6, The restriction enzymes include one low optimal temperature restriction enzyme selected from the group consisting of Fok1, Bbv I, Bsg I, Bcg I, Bpm I, BseR I, and Bae I and BstF5 I, Taq I, BsaB I, Btr I, BstAP I, Fau I, Bcl I, Pci I, and Apo I gene mutation analysis method characterized in that the restriction enzyme having a high optimum temperature selected from the group consisting of. The method of claim 3, wherein A fragment produced by cleavage of the restriction enzyme comprises a mutation sequence. The method according to claim 3 or 8, Gene mutation analysis method, characterized in that the number of bases of the fragment produced by cleavage of the restriction enzyme is 2-32. The method according to claim 1 or 3, Specific polynucleotide of step a) is a genetic variation analysis method comprising a tyrosine-methionine-aspartate-aspartate (YMDD) site, the active site of hepatitis B virus polymerase The method according to claim 1 or 3, The specific polynucleotide of step a) is genetic variation analysis method comprising the hepatitis C virus 5'- non-coding region (NCR) site. The method according to claim 1 or 3, The specific polynucleotide of step a) comprises the 2741th or 3597th base region of the fourth intron of the human maspin gene. Polynucleotide fragments, including a primer binding sequence 1, a restriction enzyme sequence, and a primer binding sequence 2, but cleaved by two or more restriction enzymes that recognize the restriction enzyme sequence comprise a mutation sequence and the size of the fragment is between 2 and 32 A kit for genetic variation analysis comprising a primer for gene mutation analysis selected from the group consisting of SEQ ID NOs: 2, 7, 12, 20, 25, and 30, characterized in that it is configured to have a size of a base. delete The method of claim 13, Gene restriction analysis kit, characterized in that the restriction enzymes have the same or different optimum temperature. The method according to claim 13 or 15, Gene restriction analysis kit, characterized in that the restriction enzymes have a different optimum temperature. The method of claim 16, The restriction enzymes include one low optimal temperature restriction enzyme selected from the group consisting of Fok1, Bbv I, Bsg I, Bcg I, Bpm I, BseR I, and Bae I and BstF5 I, Taq I, BsaB I, Btr I, BstAP I, Fau I, Bcl I, Pci I, and Apo I A kit for genetic analysis, characterized in that the restriction enzyme having a high optimal temperature selected from the group consisting of. The method of claim 13, The primers are used for mutation analysis of the 2741th or 3597th base of the fourth intron of the human maspin gene, lamivudine-resistant hepatitis B virus displacement analysis, or genotype mutation analysis of hepatitis C virus. Gene mutation analysis kit.

Images