KR100477766B1 - Primers and method for detecting base mutation - Google Patents

Abstract

The present invention relates to a method for accurately and efficiently examining genetic nucleotide variations in living organisms.

Description

Primer and method for detecting base mutation

Genetic analysis of living organisms is widely used in relation to the risk of disease, diagnosis, prediction or treatment. For example, mutation analysis on specific genes of a specific person can lead to preventive efforts by predicting the degree of risk for the disease. The present invention relates to a method for analyzing genes in living organisms, and more particularly, to a method for examining genetic variation and a primer used in the method.

As human genome maps are completed, it is possible to make more extensive estimates of disease risk, diagnose or predict disease, and predict response to drugs. Genomic sequencing of a large number of individuals reveals chromosomal locations that show diversity among individuals, which is called single nucleotide polymorphism (SNP). SNP is a variation that occurs more than a certain frequency among the nucleotide sequences arranged in the chromosome of life, and in humans, it appears that there is a probability of about one in every 1,000 bases. Given the size of human chromosomes, there are millions of SNPs. SNPs are believed to be a means of explaining the differences between individuals and can be used to identify or cause disease.

The SNPs discovered by the Human Genome Project only show the diversity between individuals, but do not reveal how the diversity relates to disease. In order to elucidate the relationship between SNP and disease, a process of comparative analysis (SNP scoring) of SNP variation patterns in normal people and patients is required. In order to clarify the relationship between SNP and disease, not only should a large number of SNPs be analyzed, but also the mutations can be analyzed without errors.

SNP scoring methods include DNA sequencing, PCR-SSCP (Polymerase chain reaction-Single stranded conformation polymorphism), allele specific hybridization, oligo-ligation, mini-sequencing And by enzyme digestion. A method using a DNA chip has also been introduced. In principle, it is not different from allel specific hybridization, except that it is differentiated from a stationary phase to which an oligonucleotide probe is attached.

DNA sequencing includes the Macsam-Gilbert method and the Sanger method, but the latter method is mainly used. This method is not for investigating the genetic variation of a specific position, but rather to reveal the nucleotide sequence of all or a part of the gene. However, if the nucleotide sequence is revealed, the genetic variation of a specific position can be identified, so it can be used for SNP scoring. have. However, it is inefficient in that it reads not only the mutation of the SNP to be investigated but also reads the nucleotide sequence of the surrounding which does not need to be investigated.

PCR-SSCP (Orita, M. et.al, Genomics, 1989, 5: 8874-8879) amplifies the sequences containing the SNPs to be analyzed by PCR, separates them into their respective chains, and then polyacrylamide gels. Perform electrophoresis at. Since the secondary structure of the DNA chain is changed by the difference of the base, the base variation is examined according to the difference in the electrophoretic movement speed due to this difference.

Allel specific hybridization is a method of hybridizing a sample DNA labeled with a radioisotope to a probe attached to a nylon filter or the like, and examining whether or not there is a base mutation by controlling conditions such as temperature and hybridization.

Nucleic Acid Research 24, 3728, 1996 investigates base mutations by performing reactions under conditions where ligation does not occur in a condition that is not complementary to template DNA and by checking whether the ligation proceeds. That's how.

Minisequencing (Genome Research 7: 606, 1997) is a method designed to condition that only one base at the position to be examined for polymerization is polymerized and that the detection reaction is different depending on what is polymerized one base. It was developed for scoring.

PCR-SSCP, allel specific hybridization, oligolization, etc. make it difficult to analyze a large amount of samples using polyacrylamide gels, or fail to identify errors caused by failure of the probe to bind to a desired position. There is this.

Minisequencing is a technique developed for SNP scoring, which is easy to analyze and is advantageous for analyzing large amounts of samples, but still has the disadvantage of failing to identify false results due to errors, and deletion and insertion of bases. There is a limit that can not be found.

Another technique developed for SNP scoring is enzymatic cleavage (WO 01/90419). This method amplifies the nucleotide sequence to be analyzed by PCR, but the amplified product includes a nucleotide sequence that can be cleaved or recognized by two restriction enzymes. The amplified result is a method of measuring the molecular weight of the fragment generated by cleavage with two restriction enzymes to determine the base variation. This analytical method has the advantage of easy and fast analysis step because the fragment is made by restriction enzyme reaction immediately after amplification of the gene by PCR and the molecular weight is measured by mass spectrometry. However, the enzymatic digestion method described in WO 01/90419 still does not confirm the erroneous analysis by error. For example, when primers bind to unwanted positions during PCR, incorrect analysis results may occur, but there is a problem that it is impossible to check whether the primers bind to unwanted positions. For example, CYP450 genes (CYP2C9, CYP2C19, CYP2C8, etc.), which are well known as drug metabolic genes, are very similar in sequence even though they are involved in different drug metabolisms. There is a high probability of generating errors by binding to a gene other than the gene to be investigated. That is, the primer used to examine the CYP2C9 base mutation may be bound to CYP2C8. In this case, it is difficult to confirm whether an error occurred because the primer was not bound to CYP2C8 but CYP2C9. In addition, the mutation in which one base is substituted with another base can be detected, but there is a problem in that a mutation due to deletion or insertion of a base cannot be detected.

In the present invention, a method for accurately and efficiently investigating genetic variation in living organisms has been developed. In other words, the SNP scoring of many samples can be performed easily and quickly, and the primer can be verified by binding to the wrong position, thereby enabling accurate base mutation investigation and detecting genetic variation due to deletion or insertion. I developed a way to do it.

The present invention provides a method for accurately and efficiently analyzing genetic variation in living organisms.

The present invention amplifies the desired nucleotide sequence so that the result includes a site that can be cleaved with a restriction enzyme in order to analyze the genetic variation, so that the number of the base of the fragment cleaved by the restriction enzyme is 32 or less and at least 1 Dog bases are produced by replication of a template rather than a primer and provide a method for analyzing genetic variation by cleaving the amplified product with restriction enzymes and measuring the molecular weight.

The present invention is to amplify the desired nucleotide sequence so that the product includes a site that can be cleaved with a restriction enzyme in order to analyze the genetic variation, to make a fragment of the structure as shown below, and cut the amplified product with a restriction enzyme It then provides a method for analyzing the genetic variation by measuring the molecular weight.

5 ' Primer binding sequence 1 Restriction Enzyme Sequence 1 Primer binding sequence 2 Mutation sequence Variant sequence Post-mutation sequence Primer binding sequence 3 Restriction Enzyme Sequence 2 Primer binding sequence 4 3 '

The restriction enzyme sequencing may not match the sequence to be cleaved as the sequence recognized by the restriction enzyme. For example, the sequence recognized by EcoR1 is truncated at the same and stepped position as the GAATTC. The sequence recognized by Fsp1 is identical to the position that is also cleaved as TGCGCA and is truncated. On the other hand, the sequence recognized by Fok1 and BstF5I is GGATG, but the cleaved position is after the 9th / 13th and 2nd / 0th bases from the 3 'end of the recognition sequence, respectively. The restriction enzyme on the 5 'side or the sequence 1 on the 3' side may be a sequence recognized by the same restriction enzyme or a sequence recognized by different restriction enzymes.

One of the two primers used for PCR amplification consists of primer binding sequence 1, restriction enzyme sequence 1 and primer binding sequence 2, and the other primer is primer binding sequence 4, restriction enzyme sequence 2 and primer binding sequence 3 consist of.

The four primer binding sequences are sequences capable of complementarily binding to the nucleic acid that is a template, but the two restriction enzyme sequences may not be complementary to the template. The number of bases of the primer binding sequences 1 and 4 should be 4 or more, but preferably 15 or more and 30 or less. The number of bases of the primer binding sequences 2 and 3 should be 4 or more and 13 or less. Preferably it has 8 bases. The 'mutant sequence' is a sequence of 5 'side of the base mutation to be investigated, and the number of bases should be 0 to 31. 'Variation sequence' is a sequence corresponding to the variation of the base to be investigated. Substitutions, insertions, and deletions of bases may occur. The number of bases is usually one, but may be two or more. Post-mutation sequence is the sequence on the 3 'side of the mutation sequence, the number of bases should be 0 to 31.

Pre-mutation sequence and post-mutation sequence should be one base or more, and fragments generated after restriction enzyme digestion should contain the mutation sequence, and the number of bases of the fragment should be 2 to 32. Preferably it has 12 bases.

Example 1 Mutation of the 1305th Sequence of the Human MTHFR (Methylene Tetrahydrofolate Reductase) Gene

1. PCR amplification and restriction enzyme digestion.

Template DNA (Template DNA) has the following sequence (5 '→ 3').

GGAGCTGACCAGTGAAGAAAGTGTCTT TGAAGTCTTtGTTCTT TACCTCTCGGGAGAACCAAACCGGAAT (SEQ ID NO: 1)

The underlined sequences are the sites where primers 1 and 2 bind below. Bases written in lowercase are 'sequence sequences'. Primers for PCR amplification are as follows.

Primer 1. 5'-GGAGCTGACCAGTGAAGAggatgAGTGTCTT-3 '(31mer) (SEQ ID NO: 2)

Primer 2. 5'-ATTCCGGTTTGGTTCTCCggatgGAGAGGTA-3 '(31mer) (SEQ ID NO: 3)

Lowercase sequences are the recognition sequences of Fok1.

First, PCR buffer (1x), MgSO ₄ 2mM, Enhancer buffer 1x, dNTP 200uM, Platinum Taq Add 0.315U of Polymerase (Invitrogen, 10966-026), 0.5uM of primers 1 and 2, and 45ng of genome DNA to make 18ul of the total reaction solution. PCR reaction is performed under the following conditions.

94 minutes 2 minutes,

94 ℃ 15 seconds-55 ℃ 15 seconds-72 ℃ 30 seconds (10 cycles),

94 ℃ 15sec-60 ℃ 15sec-72 ℃ 30sec (35 cycles)

Genome DNA is extracted from blood and isolated purely according to conventional methods. For example, the SDS / Protease K 'method can be used (Maniatis, Molecular Cloning, A laboratory Manual, Cold Spring Harber Laboratory Press, Cold Spring Harbor, 1989) or QIAamp DNA Mini Kit 250 (Qiagen 51106). Can be used to separate DNA from blood. If the DNA concentration is low, the DNA can be concentrated and used in the following way. Add 1/10 volume of 3M Sodium acetate (pH 5.3) and 2.5 volumes of ethanol to the DNA solution, mix gently and leave at -20 ℃ for at least 1 hour. Centrifuge for 15 min at 4 ° C., 13000 rpm. Carefully remove the supernatant, add 70% ethanol and centrifuge for 10 min at 4 ° C and 13000 rpm. The ethanol is dried and then dissolved in a desired volume of distilled water.

The sequence of fragments obtained through PCR reaction is as follows (5 '→ 3').

GGAGCTGACCAGTGAAGAA ggatg GTGTCTTTG AAGTCTTNG TTCTTTACCTCTCcatccGGAGAACCAAACCGGAAT (SEQ ID NO: 4)

CCTCGACTGGTCACTTCTTcctacCACAGAAACTTCA GAANCAAGA AATGGAGAG gtagg CCTCTTGGTTTGGCCTTA (SEQ ID NO: 5)

The bold region in the above sequence is a sequence recognized by Fok1, the underlined region is a sequence of fragments produced by cleavage of restriction enzymes, and the base denoted by 'N' is a 'variable sequence'. Catcc, shown in lowercase, is a complementary sequence of gtagg in bold, and is one strand of the sequence recognized by Fok1. In other words, two strands written in lowercase, including bold, form a pair, which is the cognitive sequence of the enzyme. To the above reaction, NEB buffer # 4 1x, Fok (NEB R109L) I 1 U, Platinum Taq Antibody (Invitrogen 10965-028) 1U, and 10 μl of a solution containing Sigma water were added and reacted at 37 ° C. for 2 hours to obtain a section.

2. Purification and Desalting

It is preferable to purely separate the DNA fragment from the above solution treated with the restriction enzyme and then measure the molecular weight. For example, the Nucleave Genotyping Kit (variagenics, USA) can be used. First, add 70ul of Conditioning reagent (1M TEAA) to the restriction enzyme reaction solution and leave for 1 minute. Add 70 ul of the conditioning reagent and 90 ul of the mixture to the sample preparation plate, pass through the column, and pass through 85 ul of Wash Reagent (0.1M TEAA) five times. Centrifuge the Sample Preparation Plate at 1000 rpm for 5 minutes. Place the Sample Preparation Plate on the Collection Plate and add 60ul of Elution Reagent (60% isopropanol). Once the eluate is collected on the collection plate, dry the collection plate at 115 ° C for 75 minutes.

3.MALDI-TOF Mass Spectrometry

Add 6ul of MALDI matrix (22.8 mg ammonium citrate, 148.5 mg hydroxypicolinic acid, 1.12 ml acetonitrile, 7.8 ml H2O) to the collection plate and place 4ul of them on the Anchor chip plate of MALDI-TOF (Biflex IV, Bruker). Dry at 37 ° C. for 30 minutes, leave to room temperature for a while to cool and analyze by MALDI-TOF. The method of analysis follows the manual of MALDI-TOF.

When the 1305rd base (variable sequence) is normal (thymine, T), the molecular weights of the fragments generated after enzyme cleavage are 3138 D and 3158 D (see Fig. 1).

On the other hand, the molecular weight of the resulting fragment when the cytosine (C) is changed by the mutation is 3123 and 3174, respectively (see Figure 2).

Example 2. Base mutation analysis of the 1897th sequence of the human dihydropyrimidine dehydrogenase (DPYD) gene.

The base sequence of the template DNA is as follows (5 '→ 3').

5'- ATTGGTGTCAAAGTGTCACTGAACTAA AGGCTGACTTCcCAGACAACGTAAGTGTGATTTAACATCTAAAACAAG (SEQ ID NO: 6)

3'- TAACCACAGTTTCACAGTGACTTGATTTCCGACTGAAGgGTCTGT TGCATTCACACTAAATTGTAGATTTTGTTC (SEQ ID NO: 7)

Underlined sites in the above sequence are the sites where primers 3 and 4 bind, respectively. The base in lowercase is the variant sequence.

Primer 3. 5'- ATTGGTGTCAAAGTGTCAggatgTGAACTAA-3 '(31mer) (SEQ ID NO: 8)

Primer 4. 5'- CTTGTTTTAGATGTTAAATCAggatgACTTACGT-3 '(34mer) (SEQ ID NO: 9)

The lower case region in the above primer is a sequence which does not exist in the template DNA and artificially inserts the recognition sequence of Fok1. Experimental method including a PCR reaction is the same as in Example 1.

The sequence of fragments generated by PCR is as follows (5 '→ 3').

ATTGGTGTCAAAGTGTCA ggatg TGAACTAAA GGCTGACTTCNC AGACAACGTAAGTcatccTGATTTAACATCTAAAACAAG (SEQ ID NO: 10)

GAACCACAGTTTCACAGTcctacACTTGATTTCCGA CTGAAGNGTCTG TTGCATTCA gtagg ACTAAATTGTACATTTTGTTC (SEQ ID NO: 11)

In the above sequence, the bold region is a sequence recognized by Fok1, the underlined region is a sequence of a fragment generated by restriction enzyme cleavage, and the base designated 'N' is a 'mutation sequence'. catcc is one of the sequences recognized by Fok1 as the complementary sequence of gtagg in bold. In other words, two strands written in lowercase, including bold, form a pair, which is the cognitive sequence of the enzyme.

When the 1897th base is normal (cytosine, C), the molecular weights of the fragments generated after enzyme cleavage are 3692.4 D and 3765.4 D (see FIG. 3).

On the other hand, when the cytosine is deleted by the mutation, the molecular weight of the resulting fragments is 3403.2 and 3436.2, respectively (see FIG. 4).

Example 3. Nucleotide Mutation Analysis of Sequences 295-298 of the Human DPYD Gene

The sequence of the template DNA is as follows (5 '→ 3').

5'- TC AGAAGAGCTGTCCAACTAATCTTGATA TTAAAtcatTCATAGTATTGCAAACAAGGTAAATTCAGATTTA (SEQ ID NO: 12)

3'- AGTCTTCTCGACAGGTTGATTAGAACTATAATTTagtaGTGTT CATAACGTTTGTTCCATTTAAGTCTAA AT (SEQ ID NO: 13)

The underlined portion is a sequence to which the primers 5 and 6 bind below, and the portion indicated in lower case is a 'mutation sequence'.

Primers for PCR reactions are as follows.

Primer 5. 5'- AGAAGAGCTGTCCAACTAggatgTCTTGATA-3 '(31mer) (SEQ ID NO: 14)

Primer 6. 5'- AATCTGAATTTACCTTGTggatgTGCAATAC-3 '(31mer) (SEQ ID NO: 15)

Lowercase letters in the primer sequence are the recognition sequences of the restriction enzymes. Experimental method including a PCR reaction is the same as in Example 1. The sequence of fragments generated after the PCR reaction is as follows (5 '→ 3').

AGAAGAGCTGTCCAACTA ggatg TCTTGATAT TAAAtcatTCAT AGTATTGCAcatccACAAGGTAAATTCAGATT (SEQ ID NO: 16)

TCTTCTCGACAGGTTGATcctacAGAACTATA ATTTagtaGTGT TCATAACGT gtagg TGTTCCATTTAAGTCTAA (SEQ ID NO: 17)

The site indicated in bold is the recognition sequence of Fok1, and the underlined site is the sequence of the fragment generated after the enzyme cleavage. catcc is one of the sequences recognized by Fok1 as the complementary sequence of gtagg in bold. In other words, two strands written in lowercase, including bold, form a pair, which is the cognitive sequence of the enzyme. Lowercase letters indicate the sequence of mutations that occur.

When the 295-298th base is left undeleted, the molecular weights of the fragments generated after the enzyme cleavage are 3683.4 D and 3804.4 D (see Fig. 5).

On the other hand, the molecular weight of the resulting fragment when the tetrabase is deleted by the mutation is 2472.6 and 2544.6, respectively (see Figure 6).

Example 4. Nucleotide Variation of the 1056th Sequence of Human MTHFR Gene

The base sequence of the template DNA is as follows.

5'- CATCCTCACCCAGGCGTCCCCTACCCT GGGCTCTCAGcGCCCACCC CAAGCGCCGAGAGGAAGATGTACGTCC (SEQ ID NO: 18)

The underlined sites in the sequence above are the sites to which the primers 7 and 8 bind, respectively. The base in lowercase is the variant sequence.

Primer 7. 5'- CATCCTCACCCAGGCGTC GGATG CCTACCCT-3 '(31mer) (SEQ ID NO: 19)

Primer 8. 5'- GGACGTACATCTTCCTCT GGATG GGCGCTTG-3 '(34mer) (SEQ ID NO: 20)

The lower case region in the above primer is the recognition sequence of Fok1. Experimental method including a PCR reaction is the same as in Example 1.

The sequence of fragments generated by PCR is as follows (5 '→ 3').

CATCCTCACCCAGGCGT C ggatg CCTACCCTG GGCTCTCAGNGCC CACCCCAAGCGCCcatccAGAGGAAGATGTACGTCC (SEQ ID NO: 21)

GTAGGAGTGGGTCCGCAGcctacGGATGGGACCCGA GAGTCNCGGGTGG GGTTCGCGG gtagg TCTCCTTCTACATGCAGG (SEQ ID NO: 22)

The boxed region in the above sequence is the sequence recognized by Fok1, the underlined region is the sequence of the fragment produced by restriction enzyme cleavage and catcc is the complementary sequence of gtagg in bold, among the sequences recognized by Fok1. One strand. In other words, two strands written in lowercase, including bold, form a pair, which is the cognitive sequence of the enzyme. The base denoted by 'N' is the 'mutation sequence'.

When the 1056th base is normal (cytosine, C), the molecular weights of the fragments generated after enzyme cleavage are 3992 D and 4152 D (see FIG. 7).

On the other hand, the molecular weight of the resulting fragment in the case of thymine by the mutation is 4006 and 4136, respectively (see Figure 8). The figure below shows the result when one of the pair of chromosomes is normal and the other is mutant (hetero).

The present invention solves the problem of incorrect analysis by the error of the existing base mutation analysis method and the inability to inspect for insertion and deletion.

1 is a diagram showing the MALDI-TOF mass spectrometry results when the 1305th nucleotide sequence of the human MTHFR (Methylene tetrahydrofolate reductase) gene is normal.

Figure 2 is a diagram showing the MALDI-TOF mass spectrometry results when the 1305th nucleotide sequence of the human MTHFR (Methylene tetrahydrofolate reductase) gene is changed to cytosine by mutation.

Figure 3 is a diagram showing the MALDI-TOF mass spectrometry results when the 1897th sequence of the human DPYD (dihydropyrimidine dehydrogenase) gene is normal.

4 is a diagram showing the results of MALDI-TOF mass spectrometry when cytosine is deleted by mutation of the 1897th sequence of human DPYD (dihydropyrimidine dehydrogenase) gene.

Figure 5 is a diagram showing the MALDI-TOF mass spectrometry results when the base mutation of the 295 ~ 298 nucleotide sequence of the human DPYD gene is left undeleted.

Figure 6 is a diagram showing the MALDI-TOF mass spectrometry results when the 295 ~ 298 nucleotide sequence of the human DPYD gene is deleted by mutation.

7 is a diagram showing the MALDI-TOF mass spectrometry results when the 1056th base of the human MTHFR gene is normal.

8 is a diagram showing the MALDI-TOF mass spectrometry results when thymine is produced by mutation of the 1056th base of the human MTHFR gene.

<110> GeneMatrix Inc .; Yoo, Wang Don <120> Primers and method for detecting base mutation <130> 2002DPA118 <160> 22 <170> KopatentIn 1.71 <210> 1 <211> 70 <212> DNA <213> Homo sapiens <400> 1 ggagctgacc agtgaagaaa gtgtctttga agtctttgtt ctttacctct cgggagaacc 60 aaaccggaat 70 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer1 <400> 2 ggagctgacc agtgaagagg atgagtgtct t 31 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer2 <400> 3 attccggttt ggttctccgg atggagaggt a 31 <210> 4 <211> 78 <212> DNA <213> Artificial Sequence <220> <223> 5 'DNA fragment produced by PCR <400> 4 ggagctgacc agtgaagaag gatggtgtct ttgaagtctt ngttctttac ctctccatcc 60 ggagaaccaa accggaat 78 <210> 5 <211> 78 <212> DNA <213> Artificial Sequence <220> <223> 3 'DNA fragment produced by PCR <400> 5 cctcgactgg tcacttcttc ctaccacaga aacttcagaa ncaagaaatg gagaggtagg 60 cctcttggtt tggcctta 78 <210> 6 <211> 75 <212> DNA <213> Homo sapiens <400> 6 attggtgtca aagtgtcact gaactaaagg ctgacttccc agacaacgta agtgtgattt 60 aacatctaaa acaag 75 <210> 7 <211> 75 <212> DNA <213> Homo sapiens <400> 7 taaccacagt ttcacagtga cttgatttcc gactgaaggg tctgttgcat tcacactaaa 60 ttgtagattt tgttc 75 <210> 8 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer3 <400> 8 attggtgtca aagtgtcagg atgtgaacta a 31 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer4 <400> 9 cttgttttag atgttaaatc aggatgactt acgt 34 <210> 10 <211> 83 <212> DNA <213> Artificial Sequence <220> <223> DNA fragment produced by PCR <400> 10 attggtgtca aagtgtcagg atgtgaacta aaggctgact tcncagacaa cgtaagtcat 60 cctgatttaa catctaaaac aag 83 <210> 11 <211> 83 <212> DNA <213> Artificial Sequence <220> <223> DNA fragment produced by PCR <400> 11 gaaccacagt ttcacagtcc tacacttgat ttccgactga agngtctgtt gcattcagta 60 ggactaaatt gtacattttg ttc 83 <210> 12 <211> 72 <212> DNA <213> Homo sapiens <400> 12 tcagaagagc tgtccaacta atcttgatat taaatcattc atagtattgc aaacaaggta 60 aattcagatt ta 72 <210> 13 <211> 72 <212> DNA <213> Homo sapiens <400> 13 agtcttctcg acaggttgat tagaactata atttagtagt gttcataacg tttgttccat 60 ttaagtctaa at 72 <210> 14 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer5 <400> 14 agaagagctg tccaactagg atgtcttgat a 31 <210> 15 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer6 <400> 15 aatctgaatt taccttgtgg atgtgcaata c 31 <210> 16 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> DNA fragment produced by PCR <400> 16 agaagagctg tccaactagg atgtcttgat attaaatcat tcatagtatt gcacatccac 60 aaggtaaatt cagatt 76 <210> 17 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> DNA fragment produced by PCR <400> 17 tcttctcgac aggttgatcc tacagaacta taatttagta gtgttcataa cgtgtaggtg 60 ttccatttaa gtctaa 76 <210> 18 <211> 73 <212> DNA <213> Homo sapiens <400> 18 catcctcacc caggcgtccc ctaccctggg ctctcagcgc ccaccccaag cgccgagagg 60 aagatgtacg tcc 73 <210> 19 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer7 <400> 19 catcctcacc caggcgtcgg atgcctaccc t 31 <210> 20 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer8 <400> 20 ggacgtacat cttcctctgg atgggcgctt g 31 <210> 21 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> DNA fragment produced by PCR <400> 21 catcctcacc caggcgtcgg atgcctaccc tgggctctca gngcccaccc caagcgccca 60 tccagaggaa gatgtacgtc c 81 <210> 22 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> DNA fragment produced by PCR <400> 22 gtaggagtgg gtccgcagcc tacggatggg acccgagagt cncgggtggg gttcgcgggt 60 aggtctcctt ctacatgcag g 81

Claims (5)

delete delete delete a) one primer selected from the group consisting of SEQ ID NOs: 2, 8, 14 and 19; And b) a primer composition for base mutation analysis having one primer selected from the group consisting of SEQ ID NOs: 3, 9, 15 and 20. a) a first primer consisting of primer binding sequence 1, restriction enzyme recognition sequence 1 and primer binding sequence 2; And amplifying the desired nucleotide sequence to include a site where the PCR result can be cleaved with a restriction enzyme using a nucleotide analysis primer consisting of a second primer consisting of primer binding sequence 4, restriction enzyme recognition sequence 2 and primer binding sequence 3 Amplifying the number of bases of the fragment cleaved by the restriction enzyme so that the number of bases is 32 or less, and at least one of the bases is generated by replication of a template rather than a primer; b) cleaving the amplified product with restriction enzymes; And c) Genetic analysis method comprising the step of measuring the cleaved fragments and compare with normal.