KR20130110811A

KR20130110811A - Method for detecting mutations in drug-resistant related genes of hiv using restriction fragments mass polymorphism

Info

Publication number: KR20130110811A
Application number: KR1020120033068A
Authority: KR
Inventors: 이주형; 신수경; 김수옥; 유왕돈; 김석준; 홍선표
Original assignee: (주)진매트릭스
Priority date: 2012-03-30
Filing date: 2012-03-30
Publication date: 2013-10-10
Also published as: WO2013147352A1

Abstract

PURPOSE: A method for detecting a mutant gene with drug resistance to an HIV drug using restriction fragment mass polymorphism is provided to early diagnose an HIV drug resistant mutation in an HIV-infected patient and to allow the patient to medicate a suitable drug, thereby preventing the patient from missing a treatment period or blocking worsening diseases. CONSTITUTION: A method for detecting a mutant gene with drug resistance to an HIV drug comprises the steps of: amplifying a polynucleotide template containing a mutation site of a reverse transcriptase gene or a protease gene which exists in an HIV pol gene using a forward primer and a reverse primer; cleaving the amplified polynucleotide using restriction enzyme and generating two or more kinds of single stranded polynucleotide fragments which contain the mutation site and have the limited number of bases; and analyzing the presence of a mutant gene with drug resistance in the reverse transcriptase gene or the protease gene and the mutation kind of the gene by measuring molecular weight of the fragments. [Reference numerals] (AA) Codon 215T; (BB) Codon 215Y; (CC) Mass per unit charge, m/z (mass-to-charge ratio)

Description

Method for detecting mutations in drug-resistant related genes of HIV using restriction fragments mass polymorphism}

The present invention relates to a method for detecting drug resistance gene mutation against HIV (human immunodeficiency virus) virus, which is a cause of AIDS, by using restriction fragments mass polymorphism (RFMP). The present invention relates to primers for detecting HIV drug resistance gene mutations used, and kits for detecting HIV drug resistance gene mutations including the primers.

Specifically, the present invention can quickly and sensitively and accurately test HIV drug resistance gene mutations caused by antiretroviral agents, even when a double mutation occurs in which two nucleotides are changed in one codon. The present invention relates to a method for detecting HIV drug resistance gene mutations that can identify the type of mutation.

In addition, the present invention provides a novel detection method suitable for testing drug resistance gene mutations in HIV-infected patients prior to or taking antiretroviral agents, thereby providing early diagnosis and detection of HIV drug-resistant mutations in HIV-infected patients. The present invention relates to a new technology that enables proper medication so as to prevent the timing of the patient's treatment or prevent the disease from worsening.

HIV / AIDS, called Acquired Immune Deficiency Syndrome, is caused by a viral infection known as the Human Immunodeficiency Virus (HIV).

The World Health Organization (WHO) has declared that HIV infection is a pandemic, AIDS has killed more than 25 million people since 1981-2006, and 0.6% of the world's population is infected with HIV. Announced. Recently, antiretroviral therapies have been widely used to reduce mortality from HIV infection.

Highly active antiretroviral therapy (HAAT) has made progress to dramatically reduce mortality by prolonging the survival of infected people by effectively inhibiting HIV replication mechanisms and improving immune responses in infected patients. However, as the antiretroviral drug was administered for a long time, drug-resistant strains appeared, resulting in a problem of treatment failure due to an increase in HIV level and a decrease in immune response. Thus, the diagnosis of antiretroviral resistance mutations in the treatment and management of HIV-infected patients has emerged as the most important factor in determining the success or failure of treatment.

In light of these antiretroviral resistance mutations, the U.S. Department of Health and Human Service (DHHS) recommends genotyping drug resistance testing before commencement of antiretroviral therapy or before treatment. Genotyping and phenotyping is recommended for patients with unsuccessful treatment or incompletely suppressed HIV virus by antiretroviral combination therapy.

Antiretrovirals, which are used worldwide as treatments for HIV / AIDS infections, include nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs), and proteins. There are about 30 species in six families, including protease inhibitors (PIs).

On the other hand, the occurrence of drug resistance gene mutations in patients with HIV depends on the type of antiretroviral agent described above, and is mainly used for nucleic acid-based reverse transcriptase inhibitors, non-nucleic acid reverse transcriptase inhibitors or protease inhibitors. In this case, drug resistance gene mutations are known to occur in reverse transcriptase genes (codon 1 to codon 335) and protease genes (codon 1 to codon 99) present in HIV pol gene. Among the antiretroviral drugs, codonK65RN, codonT69Ins / D, codonQ151M and codonM184VI in the reverse transcriptase gene have been reported as drug resistance gene mutations against lamivudine, a nucleic acid-based reverse transcriptase inhibitor. CodonK103NS, codonV106AM, and codonY181CIV in reverse transcriptase genes have been reported as drug resistance gene mutations for epavirens. Drug resistance gene mutations for Darnavir, a protease inhibitor, are codonI50V and codonI54LM in protease genes. And codon I84VAC are reported.

Currently, HIV genotyping drug resistance tests are known as sequencing and reverse hybridization. The sequencing method is a method of amplifying and analyzing a wide range of nucleotide sequences including a specific position of a gene to be analyzed by PCR. However, this method has a low analytical sensitivity [> 1000 copies / ml] and can only be detected when drug resistant viruses are present in more than 20% of the total virus, and double mutations within one codon. If this occurs, there is a problem that cannot be interpreted as the correct type. In addition, by simultaneously analyzing the nucleotide sequence around a specific location that does not have to be analyzed, there is a problem that unnecessary cost and time is consumed, and large-scale execution is difficult.

In addition, the reverse hybridization method is more sensitive than the sequencing method, but an error caused by the inability to bind the oligonucleotide probe to the desired position is inevitable, for example, when the oligonucleotide probe does not have an HIV drug resistance gene mutation. In addition, there is a problem of false positives that can be diagnosed as HIV drug resistance mutations in combination with the sample genome.

As a result, conventional diagnostic methods for diagnosing HIV drug resistance gene mutations have problems with sensitivity, accuracy and errors or time-consuming testing, especially when a double mutation occurs in which two nucleotides change in one codon. There was a limitation that could not determine the exact type of mutation.

Meanwhile, Korean Patent Laid-Open Publication No. 10-2012-0020066 and Korean Patent Laid-Open Publication No. 10-2012-0018735 disclose a kit for detecting HIV-1 and HIV-2, respectively, and these methods include real-time PCR ( Real time PCR) has the advantage of quantitatively detecting HIV infection in a large amount of time in a short time for a large number of samples, but the problems appearing in the prior art such as the sequencing method and the reverse hybridization method described above In particular, it is not a technique to solve a problem that can be interpreted as various results, especially when a double mutation occurs in one codon, and does not disclose or imply any technical means for solving these problems.

Therefore, in the technical field of the present invention, HIV drug resistance gene mutations can be detected quickly and sensitively, accurately and in large capacity, compared to conventional HIV drug resistance gene mutation diagnostics, and in particular, a double nucleotide variable in one codon Even in the event of mutations, new genetic analysis methods are needed to identify the exact type of mutation.

On the other hand, the present inventors have developed genetic mutation detection methods that can accurately and efficiently analyze genetic variations in living organisms. Examples of such gene mutation detection methods are disclosed in Korean Patent Nos. 10-0477766 and 10-0642829. These gene mutation detection methods describe restriction enzyme fragment mass polymorphism (RFMP), which is used to examine the genotype of hepatitis C virus and to detect nucleotide variations of human MTHFR genes. These techniques developed by the inventors must be excellent technologies, but nevertheless, continuous improvement can be made as with other excellent technologies.

Therefore, the present inventors have used a novel restriction fragment mass polymorphism (RFMP) as a base technology to identify the exact type of mutation even when a double mutation occurs in which two nucleotides are changed in one codon. A method for detecting HIV drug resistance gene mutations, primers for detecting HIV drug resistance gene mutations, and kits for detecting HIV drug resistance gene mutations including the primers have been devised.

Republic of Korea Patent Publication No. 10-2012-0020066 (2012.03.07) Republic of Korea Patent Publication No. 10-2012-0018735 (2012.03.05) Republic of Korea Patent Publication No. 10-0477766 (2005.03.21) Republic of Korea Patent Publication No. 10-0642829 (2006.11.10)

SUMMARY OF THE INVENTION An object of the present invention is to detect drug resistance gene mutations in HIV-infected patients, and to detect HIV drug resistance gene mutations using restriction fragments mass polymorphism (RFMP), and the HIV used therein. The present invention provides a primer for detecting drug resistance gene mutation, and a kit for detecting HIV drug resistance gene mutation containing the primer.

Specifically, it is an object of the present invention to detect HIV drug resistance gene mutations caused by antiretroviral agents quickly and sensitively, accurately and in large quantities, in particular a double mutation in which two nucleotides are changed in one codon. In this case, the present invention also provides a method for detecting HIV drug resistance gene mutations that can identify the exact type of mutation.

It is also an object of the present invention to provide a novel detection method suitable for testing drug resistance gene mutations in HIV infected patients prior to or taking antiretroviral agents, thereby premature HIV drug resistance mutations in HIV infected patients. By providing diagnostics and appropriate medications, new technologies can be used to prevent patients from missed treatment or prevent the risk of disease worsening.

The present invention is a representative antiretroviral agent that causes drug resistance gene mutations in the HIV pol gene region using restriction fragment mass polymorphism (RFMP). A new detection method is provided that identifies a total of 17 codon resistance mutations for enzyme inhibitors or protease inhibitors.

In other words, the present invention relates to drug resistance gene mutations that may occur in HIV-infected patients using restriction enzyme fragment mass polymorphism (RFMP), and to reverse transcriptase genes (codon 1 to codon 335) and HIV pol in the HIV pol gene of the subject. It provides a method for rapidly and sensitively, accurately and largely testing gene mutations of a total of 17 codons located within protease genes (codons 1 to codon 99) in genes. Meanwhile, the codon numbers of the reverse transcriptase gene and the codon numbers of the protease gene in the HIV pol gene described herein refer to the complete genome of HIV type 1 (HXB2) (GeneBank accession number K03455). As a reference, PCR amplification is also performed based on this.

First, the terms used in the specification of the present invention will be described.

The restriction enzyme fragment mass polymorphism (hereinafter referred to as "RFMP method") used in the specification of the present invention refers to a restriction enzyme that recognizes a nucleotide sequence site where a mutation is located after amplifying a gene to be analyzed by PCR. When the cleavage is performed, the mass of the cleaved gene fragment is changed according to the presence or absence of a change in base, and this means a method of analyzing the genotype by measuring the mass difference of the cleaved gene fragment (Korea Patent No. 10-0477766 and Article 10). 10-0642829).

In addition, the term "restriction enzyme recognition sequence" used in the specification of the present invention may not coincide with a sequence that is cleaved as a sequence recognized by a restriction enzyme when performing the "RFMP method" described above. Specifically, restriction enzyme FokI used as an example in the embodiments of the present invention described below recognizes the GGATG sequence, but the cleavage position is next to the 9th / 13th base from the 3 'end of the recognition sequence. On the other hand, restriction enzymes that can be used in the present invention that recognizes restriction enzyme recognition sequences are all restriction enzymes that can be used for the purposes of the present invention. For example, restriction enzymes having a relatively low optimum temperature include FokI, BbvI, BsgI, BcgI, BpmI, BseRI, MmelI, AvaII or BaeI, and restriction enzymes having a relatively high optimum temperature include BtsCI, BstF5I, TaqI, BsaBI, BtrI, BstAPI, FauI, BclI, PciI, or ApoI and the like (see Korean Patent Nos. 10-0477766 and 10-0642829). However, such a restriction enzyme does not limit the present invention, and of course, various restriction enzymes known in the art to which the present invention belongs may be used.

HIV drug resistance gene mutation detection method of an embodiment of the present invention, using a forward primer and a reverse primer, a polynucleotide template comprising a mutant base of the reverse transcriptase gene or protease gene present in the HIV pol gene Amplifying and cutting the amplified polynucleotide with a restriction enzyme to generate two or more single-stranded polynucleotide fragments comprising a mutated base while the number of bases of the fragments after the cleavage is within a limited range; Analyzing the presence of drug resistance gene mutations in the reverse transcriptase gene or protease gene by measuring the molecular weight of the cleaved fragments, and analyzing the types of drug resistance gene mutations.

The HIV drug resistance gene mutation detection method of an embodiment of the present invention may include analyzing the occurrence of a double mutation in which two nucleotides change in one codon in the reverse transcriptase gene or protease gene. Based on these assays, the types of drug resistance gene mutations can be analyzed.

The HIV drug resistance gene mutation detection method of one embodiment of the present invention is a drug resistance mutation mainly in HIV-infected patients, codon 65, codon 69, codon 74, codon 103, codon 106, codon 151 located in the reverse transcriptase gene. At least one codon selected from the group consisting of: codon 181, codon 184 and codon 215, and codon 30, codon 46, codon 48, codon 50, codon 54, codon 82, codon 84, and codon 90 located within the protease gene. It is characterized by analyzing the mutations.

In the HIV drug resistance gene mutation detection method of an embodiment of the present invention, a primer pair of SEQ ID NO: 10 and SEQ ID NO: 11, a primer pair of SEQ ID NO: 12 and SEQ ID NO: 13, a primer pair of SEQ ID NO: 14 and SEQ ID NO: 15, sequence Primer pairs of SEQ ID NO: 16 and SEQ ID NO: 17, primer pairs of SEQ ID NO: 18 and SEQ ID NO: 19, primer pairs of SEQ ID NO: 20 and SEQ ID NO: 21, primer pairs of SEQ ID NO: 22, and SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 Primer pairs, and primer pairs of SEQ ID NO: 26 and SEQ ID NO: 27 are codon 65, codon 69, codon 74, codon 103, codon 106, codon 151, codon 181, codon 184, and located in the reverse transcriptase gene, respectively. And to amplify a template comprising a gene mutation of codon 215.

In the HIV drug resistance gene mutation detection method of an embodiment of the present invention, a primer pair of SEQ ID NO: 54 and SEQ ID NO: 55, a primer pair of SEQ ID NO: 56 and SEQ ID NO: 57, a primer pair of SEQ ID NO: 58 and SEQ ID NO: 59, sequence Primer pair of SEQ ID NO: 60 and SEQ ID NO: 61, primer pair of SEQ ID NO: 62 and SEQ ID NO: 63, primer pair of SEQ ID NO: 64 and SEQ ID NO: 65, primer pair of SEQ ID NO: 66 and SEQ ID NO: 67, and SEQ ID NO: 68 and SEQ ID NO: Primer pairs of 69 are for amplifying a template comprising gene mutations of codon 30, codon 46, codon 48, codon 50, codon 54, codon 82, codon 84, and codon 90, respectively, located within said protease gene. It features.

In the HIV drug resistance gene mutation detection method of an embodiment of the present invention, at least one base of the fragment after cleavage with a restriction enzyme is used for replication of a reverse transcriptase gene or a protease gene template rather than a primer. It is preferred to generate by means of the present invention, and to include a mutated base while the number of bases in the fragment is within a limited range of 2 to 32. More preferably, the number of bases in the fragment is 2 to 14, and even more preferably 8 to 14 bases. This is when the analysis by mass spectrometry, the analysis results reflect the size of the good section. If the fragment consists of only one base, it contains only the mutant sequence, and thus it is not preferable because it is difficult to determine whether the primer is bound to the wrong position.

In addition, the primer for detecting a HIV drug resistance gene mutation of an embodiment of the present invention amplifies a polynucleotide template including a mutated base of a reverse transcriptase gene or a protease gene present in an HIV pol gene, and amplified poly A primer for cleaving a nucleotide with a restriction enzyme to generate two or more single-stranded polynucleotide fragments containing mutagenic bases within a limited range of the number of bases after the cleavage, wherein the primers of SEQ ID NO: 10 and SEQ ID NO: 11 Pairs, primer pairs of SEQ ID NO: 12 and SEQ ID NO: 13, primer pairs of SEQ ID NO: 14 and SEQ ID NO: 15, primer pairs of SEQ ID NO: 16 and SEQ ID NO: 17, primer pairs of SEQ ID NO: 18, and SEQ ID NO: 19, SEQ ID NO: 20, and Primer pair of SEQ ID NO: 21, primer pair of SEQ ID NO: 22 and SEQ ID NO: 23, standing At least one primer pair selected from the group consisting of primer pairs of SEQ ID NO: 24 and SEQ ID NO: 25 and primer pairs of SEQ ID NO: 26 and SEQ ID NO: 27, or primer pairs of SEQ ID NO: 54 and SEQ ID NO: 55, SEQ ID NO: 56, and SEQ ID NO: 57 Primer pair of SEQ ID NO: 58, SEQ ID NO: 58 and SEQ ID NO: 59, primer pair of SEQ ID NO: 60 and SEQ ID NO: 61, primer pair of SEQ ID NO: 62 and SEQ ID NO: 63, primer pair of SEQ ID NO: 64 and SEQ ID NO: 65, SEQ ID NO: At least one primer pair selected from the group consisting of a primer pair of 66 and SEQ ID NO: 67 and a primer pair of SEQ ID NO: 68 and SEQ ID NO: 69.

In the primer for detecting HIV drug resistance gene mutation of an embodiment of the present invention, a primer pair of SEQ ID NO: 10 and SEQ ID NO: 11, a primer pair of SEQ ID NO: 12 and SEQ ID NO: 13, a primer pair of SEQ ID NO: 14 and SEQ ID NO: 15, Primer pairs of SEQ ID NO: 16 and SEQ ID NO: 17, primer pairs of SEQ ID NO: 18 and SEQ ID NO: 19, primer pairs of SEQ ID NO: 20 and SEQ ID NO: 21, primer pairs of SEQ ID NO: 22, and SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: A primer pair of 25 and a primer pair of SEQ ID NO: 26 and SEQ ID NO: 27 are codon 65, codon 69, codon 74, codon 103, codon 106, codon 151, codon 181, codon 184, respectively, located in the reverse transcriptase gene. And it is characterized in that for amplifying a template comprising a gene mutation of codon 215.

In the primer for detecting HIV drug resistance gene mutation of an embodiment of the present invention, a primer pair of SEQ ID NO: 54 and SEQ ID NO: 55, a primer pair of SEQ ID NO: 56 and SEQ ID NO: 57, a primer pair of SEQ ID NO: 58 and SEQ ID NO: 59, Primer pairs of SEQ ID NO: 60 and SEQ ID NO: 61, primer pairs of SEQ ID NO: 62 and SEQ ID NO: 63, primer pairs of SEQ ID NO: 64 and SEQ ID NO: 65, primer pairs of SEQ ID NO: 66 and SEQ ID NO: 67, and SEQ ID NO: 68 and SEQ ID NO: Primer No. 69 was used to amplify a template comprising a gene mutation of codon 30, codon 46, codon 48, codon 50, codon 54, codon 82, codon 84 and codon 90, respectively, located within the protease gene. It is characterized by.

HIV drug resistance gene mutation detection kit of an embodiment of the present invention, the primer pair of SEQ ID NO: 10 and SEQ ID NO: 11, primer pair of SEQ ID NO: 12 and SEQ ID NO: 13 as the primer for detecting HIV drug resistance gene mutation as described above , Primer pairs of SEQ ID NO: 14 and SEQ ID NO: 15, primer pairs of SEQ ID NO: 16 and SEQ ID NO: 17, primer pairs of SEQ ID NO: 18 and SEQ ID NO: 19, primer pairs of SEQ ID NO: 20 and SEQ ID NO: 21, SEQ ID NO: 22, and SEQ ID NO: At least one primer pair selected from the group consisting of a primer pair of SEQ ID NO: 23, a primer pair of SEQ ID NO: 24 and SEQ ID NO: 25, and a primer pair of SEQ ID NO: 26 and SEQ ID NO: 27, or a primer pair of SEQ ID NO: 54 and SEQ ID NO: 55, Primer pairs of SEQ ID NO: 56 and SEQ ID NO: 57, primer pairs of SEQ ID NO: 58 and SEQ ID NO: 59, and primers of SEQ ID NO: 60 and SEQ ID NO: 61 Reimer pair, primer pair of SEQ ID NO: 62 and SEQ ID NO: 63, primer pair of SEQ ID NO: 64 and SEQ ID NO: 65, primer pair of SEQ ID NO: 66 and SEQ ID NO: 67, and primer pair of SEQ ID NO: 68 and SEQ ID NO: 69 A polynucleotide template comprising at least one primer pair selected and a mutated base of a reverse transcriptase gene or protease gene amplified by the primer pair and present in the HIV pol gene, DNA polymerase, dNTPs, Contains buffer.

In the kit for detecting HIV drug resistance gene mutation of an embodiment of the present invention, a primer pair of SEQ ID NO: 10 and SEQ ID NO: 11, a primer pair of SEQ ID NO: 12 and SEQ ID NO: 13, a primer pair of SEQ ID NO: 14 and SEQ ID NO: 15, Primer pairs of SEQ ID NO: 16 and SEQ ID NO: 17, primer pairs of SEQ ID NO: 18 and SEQ ID NO: 19, primer pairs of SEQ ID NO: 20 and SEQ ID NO: 21, primer pairs of SEQ ID NO: 22, and SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: A primer pair of 25 and a primer pair of SEQ ID NO: 26 and SEQ ID NO: 27 are codon 65, codon 69, codon 74, codon 103, codon 106, codon 151, codon 181, codon 184, respectively, located in the reverse transcriptase gene. And it is characterized in that for amplifying a template comprising a gene mutation of codon 215.

In the kit for detecting HIV drug resistance gene mutation of an embodiment of the present invention, a primer pair of SEQ ID NO: 54 and SEQ ID NO: 55, a primer pair of SEQ ID NO: 56 and SEQ ID NO: 57, a primer pair of SEQ ID NO: 58 and SEQ ID NO: 59, Primer pairs of SEQ ID NO: 60 and SEQ ID NO: 61, primer pairs of SEQ ID NO: 62 and SEQ ID NO: 63, primer pairs of SEQ ID NO: 64 and SEQ ID NO: 65, primer pairs of SEQ ID NO: 66 and SEQ ID NO: 67, and SEQ ID NO: 68 and SEQ ID NO: Primer No. 69 was used to amplify a template comprising a gene mutation of codon 30, codon 46, codon 48, codon 50, codon 54, codon 82, codon 84 and codon 90, respectively, located within the protease gene. It is characterized by.

The present invention can quickly and sensitively and accurately detect HIV drug resistance gene mutations caused by antiretroviral agents, especially when a double mutation occurs in which two nucleotides change in one codon. There is an advantage to check the type.

In addition, according to the present invention, it is possible to effectively determine whether a drug resistance gene mutation occurs in HIV-infected patients before or while taking an antiretroviral agent, so that early diagnosis and appropriate administration of HIV drug-resistant mutations in HIV-infected patients can be performed. Treatment can be missed, preventing the patient from timing treatment or preventing the risk of disease worsening.

Figure 1 (A) is 100% of the HIV having codon 103 drug resistance mutations of the reverse transcriptase gene located in the pol gene of HIV, Figure 1 (B) of FIG. When (C) is present at 20%, (D) is present at 10%, FIG. 1 (E) is present at 5%, and FIG. 1 (F) is present at 1%. Maldi-Top mass spectrometry graph according to the method of the invention.
Figure 2 is a maldi-tope mass spectrometry graph according to the method of the present invention when a double drug resistance mutation occurs in codon 215 of the reverse transcriptase gene located in the pol gene of HIV.
Figure 3 is a diagram showing the results according to the conventional sequencing method when a double drug resistance mutation occurs in codon 215 of the reverse transcriptase gene located in the pol gene of HIV.
Figure 4 (A) is a maldi-tope mass spectrometry graph when the base of the codon 103 of the reverse transcriptase gene located in the pol gene of HIV is normal, Figure 4 (B) is a codon of the protease gene Maldi-tope mass spectrometry graph when base of 54 is normal.

Hereinafter, the present invention will be described in more detail based on examples. It should be understood that the following embodiments of the present invention are only for embodying the present invention and do not limit or limit the scope of the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. The references cited in the present invention are incorporated herein by reference.

Example

Example 1: HIV pol Base mutation analysis of reverse transcriptase gene in gene

1. RT-PCR Amplification and Restriction Enzyme Cleavage

The RNA of HIV virus was extracted from 0.2 ml of serum using the High Pure Viral RNA Kit (Roche Diagnostics, Mannheim, Germany), and the cDNA was synthesized using the RNA PCR kit (TaKaRa, Otsu, Japan). do.

RT-PCR reaction solution containing cDNA synthesized as above was diluted to 1/50 and 2 μl of 20 mM TrisHCl (pH 8.4), 50 mM KCl, 0.2 mM dNTP, 0.4U platinum Taq Polymerase (Platinum Taq Polymerase) (Invitrogen, 10966-026), and primer pairs of primers 1 and 2, primer pairs of primers 3 and 4, primer pairs of primers 5 and 6, primer pairs of primers 7 and 8, and primer 9 A reaction solution containing 10 pmol each of a primer pair of primer 10, a primer pair of primer 11 and primer 12, a primer pair of primer 13 and primer 14, a primer pair of primer 15 and primer 16, and a primer pair of primer 17 and primer 18 18 μl is used to perform the following nine PCR reactions and restriction enzyme treatments.

Reaction 1 is a primer pair of primer 1 and primer 2, reaction 2 is a primer pair of primer 3 and primer 4, reaction 3 is a primer pair of primer 5 and primer 6, reaction 4 is a primer pair of primer 7 and primer 8, reaction 5 Is a primer pair of primer 9 and primer 10, reaction 6 is primer pair of primer 11 and primer 12, reaction 7 is primer pair of primer 13 and primer 14, reaction 8 is primer pair of primer 15 and primer 16, reaction 9 is primer Primer pairs of 17 and primer 18 are used. The PCR reaction temperature and time of reactions 1 to 9 are as follows:

94 DEG C for 5 minutes,

94 ° C. 15 sec 55 ° C. 15 sec 72 ° C. 15 sec (eg 35 cycles),

72 ° C. 5 minutes.

The sequence (5 '→ 3') of the template DNA of the reverse transcriptase gene in the HIV pol gene to be analyzed for base mutation is as follows.

Codon 65

CCATACAA TACTCCAGTATTTGCCATAAAG aaa AAAGACAGTACTAAATGGAGAA AATTAGTA (SEQ ID NO: 1)

Codon 69

ACT CCAGTATTTGCCATAAAGAAAAAAGACAGT actAAA TGGAGAAAATTAGTAGATTTCAGAGAACTT AAT (SEQ ID NO: 2)

Codon 74

AAAAA AGACAGTACTAAATGGAGAAAA tta GTAGATTTCAGAGAACTTAATA AGAGA (SEQ ID NO: 3)

Codon 103

TTAGG AATACCACATCCCGCAGGGTTAAAAAAG aaa AAATCAGTAACAGTACTGGATGTGGGTG ATGCA (SEQ ID NO: 4)

Codon 106

CCACA TCCCGCAGGGTTAAAAAAGAAAAAATCA gta ACAGTACTGGATGTGGGTGATGCATATTTTT CA (SEQ ID NO: 5)

Codon 151

ATTAG ATATCAGTACAATGTGCTTCCA cag GGATGGAAAGGATCACCAGCAATATTCCAAA GTAGC (SEQ ID NO: 6)

Codon 181

CCTTT TAGAAAACAAAATCCAGACATAGTTATC tat CAATACATGGATGATTTGTATGTAGGAT CTGAC (SEQ ID NO: 7)

Codon 184

AAACA AAATCCAGACATAGTTATCTATCAATAC atg GATGATTTGTATGTAGGATCTGACTTAGA AATA (SEQ ID NO: 8)

Codon 215

AG ACAACATCTGTTGAGGTGGGGACTT acc ACACCAGACAAAAAACATCAGA AAGAA (SEQ ID NO: 9)

The underlined sequences of the template DNA of the reverse transcriptase gene are sites where the forward primer and the reverse primer bind to each other, and the bases written in lowercase letters are “mutated sequences”.

Codon 65 primer pairs

Primer 1. 5'-TACTCCggatgCATGTTTGCCATAAAG-3 '(27mer) (SEQ ID NO: 10)

Primer 2. 5'-TTCTCCATTTggatgAGTACTGTCTTT-3 '(27mer) (SEQ ID NO: 11)

Codon 69 primer pair

Primer 3. 5'-CCAGTATTTGCCAggatgGAAGAAGAAAGACAGT-3 '(34mer) (SEQ ID NO: 12)

Primer 4. 5'-AAGTTCTCTGAAATCTACTAAggatgTTTCTCCA-3 '(34mer) (SEQ ID NO: 13)

Codon 74 primer pair

Primer 5. 5'-AGACAggatgGTACTAAATGGAGAAAA-3 '(27mer) (SEQ ID NO: 14)

Primer 6. 5'-TATTAAGTTCTggatgCTGAAATCTAC-3 '(27mer) (SEQ ID NO: 15)

Codon 103 primer pair

Prime 7.5'-AATACCACATGCCGCggatgGGGTTAACAAAG-3 '(32mer) (SEQ ID NO: 16)

Primer 8. 5'-CACCCACATCggatgAGTACTGTTACTGATTT-3 '(32mer) (SEQ ID NO: 17)

Codon 106 primer pair

Primer 9. 5'-TCCCGCAGGGTTAACggatgAAGACAAGATCA-3 '(32mer) (SEQ ID NO: 18)

Primer 10.5'-CAAATATGCATCggatgCCCACAACCAGAGCTGT-3 '(34mer) (SEQ ID NO: 19)

Codon 151 primer pair

Primer 11. 5'-ATATCAGTACggatgAATGTGCTTCCA-3 '(27mer) (SEQ ID NO: 20)

Primer 12. 5'-TTGggatgCTGGTGATCCTTTCAATCC-3 '(27mer) (SEQ ID NO: 21)

Codon 181 primer pairs

Primer 13. 5'-TAGAACACATAATCCggatgGACATAGTTATC-3 '(32mer) (SEQ ID NO: 22)

Primer 14. 5'-ATCGTACATggatgCAAATCATCAATGTATTG-3 '(32mer) (SEQ ID NO: 23)

Codon 184 primer pair

Prime 15.5'-CAATCCAggatgACATAGTTATTTATCCTTAC-3 '(32mer) (SEQ ID NO: 24)

Primer 16.5'-TCTAAGTCAGATCATACggatgTACAAATAATC-3 '(33mer) (SEQ ID NO: 25)

Codon 215 primer pair

Primer 17. 5'-ACAggatgTCTGTTGAGGTGGGGATTT-3 '(27mer) (SEQ ID NO: 26)

Primer 18. 5'-TCTGATGTAAggatgTTTGTCTGGTGT-3 '(27mer) (SEQ ID NO: 27)

The primer pairs each consist of a forward primer and a reverse primer, and the sequence shown in lowercase in the primer is the recognition sequence of the restriction enzyme FokI.

Sequences of reverse transcriptase gene fragments generated by PCR amplification of reactions 1 to 9 using the primer pairs are as follows (5 ′ → 3 ′).

Codon 65 amplification products

TACTCCggatgCATGTTTGC CATAAAGAA AAAGACAGTACTCATCCAAATGGAGAA (SEQ ID NO: 28)

TTCTCCATTTggatgAGTACTGTC TTTTTTCTT TATGGCAAATACTGGAGTA (SEQ ID NO: 29)

Codon 69 Amplification Products

CCAGTATTTGCCAggatgGAAGAAGAA AGACAGTA CTAAATGGAGAAACATCCTTAGTAGATTTCAGAGAACTT (SEQ ID NO: 30)

AAGTTCTCTGAAATCTACTAAggatgTTTCTCCAT TTAGTACT GTCTTTCTTCTTCCATCCTGGCAAATACTGG (SEQ ID NO: 31)

Codon 74 amplification products

AGACAggatgGTACTAAAT GGAGAAAAT ATTAAGTTCTCTGAAATCTACTAA (SEQ ID NO: 32)

TATTAAGTTCTggatgCTGAAATCTAC ACTAATTTT CTCCATTTAGTACTGTCT (SEQ ID NO: 33)

Codon 103 Amplification Products

AATACCACATGCCGCggatgGGGTTAACA AAGAAAAAAT CAGTAACAGTACTGGATGTGGGTG (SEQ ID NO: 34)

CACCCACATCggatgAGTACTGTT ACTGATTTTT TAAATCAGTAACAGTACTCATCCGATGTGGGTG (SEQ ID NO: 35)

Codon 106 amplification products

TCCCGCAGGGTTAACggatgAAGACAAGATCAAAA TCAGTAACAG CTCTGGGGTTGTGGGCATCCGATGCATATTTG (SEQ ID NO: 36)

CAAATATGCATCggatgCCCACAACC AGAGCTGTTA CACAGCTCTGGTTGTGGGCATCCGATGCATATTTG (SEQ ID NO: 37)

Codon 151 Amplification Product

ATATCAGTACggatgAATGTGCTT CCACAGGGATTGA AAGGATCACCAGCCATCCATATTCCAAA (SEQ ID NO: 38)

TTGggatgCTGGTGAT CCTTTCAATCCCT GTGGAAGCACATTCATCCGTACTGATAT (SEQ ID NO: 39)

Codon 181 Amplification Product

TAGAACACATAATCCggatgGACATAGTT ATCCTATCAATA CATTGATGATTTGCATCCATGTACGAT (SEQ ID NO: 40)

ATCGTACATggatgCAAATCATC AATGTATTGAT AGATAACTATGTCCATCCGGATTATGTGTTCTA (SEQ ID NO: 41)

Codon 184 Boost

CAATCCAggatgACATAGTTA TTTATCCTTACA TGGATTATTTGTACATCCGTATGATCTGACTTAGA (SEQ ID NO: 42)

TCTAAGTCAGATCATACggatgTACAAATAA TCCATGTAAGGA TAAATAACTATGTCATCCTGGATTG (SEQ ID NO: 43)

Codon 215 Amplification Product

ACAggatgTCTGTTGAG GTGGGGATTTAC CACACCAGACAAACATCCTTACATCAGA (SEQ ID NO: 44)

TCTGATGTAAggatgTTTGTCTGG TGTGGTAAATCC CCACCTCAACAGACATCCTGT (SEQ ID NO: 45)

The sites written in lowercase in the sequence of the PCR amplification products of Reactions 1 to 9 are sequences recognized by FokI, a restriction enzyme, and the underlined sites are sequences of fragments generated by FokI restriction enzyme cleavage. The PCR amplification products of the reactions 1 to 9 were each prepared with 1 U of FokI (NEB R109L) and 10 μl of a reaction solution (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, and 1 mM DTT). Mix and cut at 37 ° C. for 2 hours.

2. Purification and Desalting

For each of the PCR amplification products of Reactions 1 to 9, the DNA fragments were purified from the above solution treated with FokI restriction enzyme, and then the molecular weight of the separated DNA fragments is preferably measured. For example, Oasis (Waters) C18 reverse phase column chromatography can be used for pure separation of DNA fragments cut by restriction enzymes. First, 70 μl of 0.15 M triethylammonium acetate (TEAA, pH 7.6) is added to the solution treated with the restriction enzyme and placed for 1 minute. Resin was activated by passing 100 ml of acetonitrile (ACN; Sigma, USA) and 1 ml of 0.1 M TEAA, followed by 100 µl of a solution treated with the restriction enzyme and 0.15 M TEAA, 0.1 M TEAA. 2 µl and 1 ml of tertiary distilled water are passed through in turn. Place the column on a Collection Plate and pass 100 μl of 70% ACN. Once the eluate is collected on the collection plate, the collection plate is dried at 120 ° C. for 60 minutes.

3. Maldi-TOF Mass Spectrometry

4 μL of Maldi matrix [22.8 mg ammonium citrate, 148.5 mg hydroxypicolinic acid, 1.12 mL acetonitrile, 7.8 mL H ₂ O] was added to the Maldi-tope mass spectrometry (Microflex, Bruker). After dotting in advance to the anchor chip plate of the () and dried for 30 minutes at 37 ℃. 10 μl of tertiary distilled water was dissolved in a sample of the collection plate that had been purified and desalted, and then 2 μl of the dried maldi matrix was dried, and the maldi matrix was dried again at 37 ° C. for 30 minutes, followed by maldi-tope mass. Analyze with spectrometry. The analytical method follows the manual of the Maldie-Thof mass spectrometry.

The size of the fragments produced by each reaction is shown in Table 1 below. The size of the fragments based on the lookup table in Table 1 determines the HIV drug resistance gene mutation.

Pol gene Target codon amino acid Calculated molecular weight (Da) Upper Down RT 65 Lys (K) 2819.8 2740.8 Arg (R) 2835.8 2725.8 69 Thr (T) 2522.6 2479.6 Asp (D) 2538.6 2439.6 74 Leu (L) 2875.8 2767.8 Val (V) 2900.8 2743.8 Ile (I) 2884.8 2758.8 103 Lys (K) 3157.0 3088.0 Asn (N) 3133.0 3113.0 106 Val (V) 3116.0 3147.0 Ala (A) 3101.0 3163.0 Met (M) 3116.0 3132.0 151 Gln (Q) 4063.6 3900.6 Met (M) 4078.6 3909.6 181 Tyr (Y) 3379.2 3450.2 Cys (C) 3395.2 3435.2 184 Met (M) 3650.4 3749.4 Ile (I) 3650.4 3764.4 Val (V) 3666.4 3734.4 215 Thr (T) 3796.4 3740.4 Phe (F) 3802.4 3733.4 Tyr (Y) 3811.4 3724.4

Example 2: HIV pol Base mutation analysis of protease genes in genes

1. RT-PCR Amplification and Restriction Enzyme Cleavage

It is carried out in the same manner as in Example 1. Reaction 10 is a primer pair of primer 19 and primer 20, reaction 11 is a primer pair of primer 21 and primer 22, reaction 12 is a primer pair of primer 23 and primer 24, reaction 13 is a primer pair of primer 25 and primer 26, reaction 14 Is a primer pair of primer 27 and primer 28, reaction 15 is a primer pair of primer 29 and primer 30, reaction 16 is a primer pair of primer 31 and primer 32, and reaction 17 is a primer pair of primer 33 and primer 34. PCR reaction temperature and time of the reaction 10 to 17 is the same as in Example 1.

The sequence (5 '→ 3') of the template DNA of the protease gene in the HIV pol gene to be analyzed for base mutation is as follows.

Codon 30

GGGCAA CTAAAGGAAGCTCTATTAGATACAGGAGCAGAT gat ACAGTATTAGAAGAAATGAGTTTGCCAGG AAGATGGAA (SEQ ID NO: 46)

Codon46

AGAAGAAA TGAGTTTGCCAGGAAGATGGAAACCAAAA atg ATAGGGGGAATTGGAGGTTTTATCAAAGTA AGACAGTATG (SEQ ID NO: 47)

Codon 48

AGAAGAAAT GAGTTTGCCAGGAAGATGGAAACCAAAAATGATA ggg GGAATTGGAGGTTTTATCAAAGTAAGAC AGTATG (SEQ ID NO 48)

Codon 50

AGT TTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGA att GGAGGTTTTATCAAAGTAAGACAGTAT GATCAGATACT (SEQ ID NO: 49)

Codon 54

A CCAAAAATGATAGGGGGAATTGGAGGTTTT atc AAAGTAAGACAGTATGATCAGATACTCATA GAAATC (SEQ ID NO: 50)

Codon 82

AAGCTA TAGGTACAGTATTAGTAGGACCTACACCT gtc AACATAATTGGAAGAAATCTGTTGACTCA GAT (SEQ ID NO: 51)

Codon 84

TA CAGTATTAGTAGGACCTACACCTGTCAAC ata ATTGGAAGAAATCTGTTGACTCAGATTGG TTGCACT (SEQ ID NO: 52)

Codon 90

TACAGTATTAG TAGGACCTACACCTGTCAACATAATTGGAAGAAATCTG ttg ACTCAGATTGGTTGCACTTTAAATTTT C (SEQ ID NO: 53)

The underlined sequences of the template DNA of the protease gene are sites where the forward primer and the reverse primer bind to each other, and the bases written in lowercase letters are “mutated sequences”.

Codon 30 primer pairs

Primer 19. 5'-CTAAAGGAAGCTCTAggatgTAGATACAGGAGCAGAT-3 '(37mer) (SEQ ID NO: 54)

Primer 20. 5'-CCTGGCAAACTCATTggatgTCTAATACTGT-3 '(31mer) (SEQ ID NO: 55)

Codon 46 primer pair

Primer 21. 5'-TGAGTTTGCCAGGAAAggatgTGGAAACCAAAA-3 '(33mer) (SEQ ID NO: 56)

Primer 22. 5'-TACTTTGATAAggatgCCTCCAATTCCCCCTAT-3 '(33mer) (SEQ ID NO: 57)

Codon 48 primer pairs

Primer 23. 5'-GAGTTTGCCAGGAAAggatgTGGAAACCAAAAATGATA-3 '(38mer) (SEQ ID NO: 58)

Primer 24. 5'-GTCTTACTTTGATAAggatgACCTCCAATTCC-3 '(32mer) (SEQ ID NO: 59)

Codon 50 primer pairs

Primer 25. 5'-TTGCCAGGAAAATGGggatgAACCAAAAATGATAGGGGGA-3 '(40mer) (SEQ ID NO: 60)

Primer 26. 5'-ATACTGTCTTACTTTggatgATAAAACCTCC-3 '(31mer) (SEQ ID NO: 61)

Codon 54 Primer Pair

Primer 27. 5'-CAAAAATGATAGAAGGggatgATTGGAGGTATT-3 '(33mer) (SEQ ID NO: 62)

Primer 28. 5'-CATGAGTATggatgGATCATACTGAGGTACTTT-3 '(33mer) (SEQ ID NO: 63)

Codon 82 primer pair

Primer 29. 5'-TAGGTACAGTATTAGTggatgGGAGCTACAGCT-3 '(33mer) (SEQ ID NO: 64)

Primer 30. 5'-TGAGTCAAggatgAGATTTCTTGGAATTCTGTT-3 '(33mer) (SEQ ID NO: 65)

Codon 84 primer pair

Primer 31. 5'-CAGTATTAATAGGACCggatgACACCTGTCAAC-3 '(33mer) (SEQ ID NO: 66)

Primer 32. 5'-CCAATCTGggatgGTCAACAGAGAGATTGCAAT-3 '(33mer) (SEQ ID NO: 67)

Codon 90 primer pair

Primer 33. 5'-TAGGACCTACACCTGggatgCAACATAATTGGAAGAAATCTG-3 '(42mer) (SEQ ID NO: 68)

Primer 34. 5'-AAAATTTAAAGTGCAggatgCCAATCTGAGT-3 '(31mer) (SEQ ID NO: 69)

The sequence of the protease gene fragment generated by PCR amplification of reactions 10 to 17 using the primer pairs is as follows (5 '→ 3').

Codon 30 amplification products

CTAAAGGAAGCTCTAggatgTAGATACAG GAGCAGATG ATACAGTATTAGACATCCAATGAGTTTGCCAGG (SEQ ID NO: 70)

CCTGGCAAACTCATTggatgTCTAATACT GTATCATCT GCTCCTGTATCTACATCCTAGAGCTTCCTTTAG (SEQ ID NO: 71)

Codon 46 Amplification Products

TGAGTTTGCCAGGAAAggatgTGGAAACCA AAAATGATAG GGGGAATTGGAGGCATCCTTATCAAAGTA (SEQ ID NO: 72)

TACTTTGATAAggatgCCTCCAATT CCCCCTATCA TTTTTGGTTTCCACATCCTTTCCTGGCAAACTCA (SEQ ID NO: 73)

Codon 48 amplification products

GAGTTTGCCAGGAAAggatgTGGAAACCA AAAATGATAGG GGGAATTGGAGGTCATCCTTATCAAAGTAAGAC (SEQ ID NO: 74)

GTCTTACTTTGATAAggatgACCTCCAAT TCCCCCTATCA TTTTTGGTTTCCACATCCTTTCCTGGCAAACTC (SEQ ID NO: 75)

Codon 50 Amplification Products

TTGCCAGGAAAATGGggatgAACCAAAAA TGATAGGGGGAA TTGGAGGTTTTATCATCCAAAGTAAGACAGTAT (SEQ ID NO: 76)

ATACTGTCTTACTTTggatgATAAAACCT CCAATTCCCCCT ATCATTTTTGGTTCATCCCCATTTTCCTGGCAA (SEQ ID NO: 77)

Codon 54 Amplification Products

CAAAAATGATAGAAGGggatgATTGGAGGT ATTATCAAAGTA CCTCAGTATGATCCATCCATACTCATG (SEQ ID NO: 78)

CATGAGTATggatgGATCATACT GAGGTACTTTGA TAATACCTCCAATCATCCCCTTCTATCATTTTTG (SEQ ID NO: 79)

Codon 82 amplification products

TAGGTACAGTATTAGTggatgGGAGCTACA GCTGTCAACAGAA TTCCAAGAAATCTCATCCTTGACTCA (SEQ ID NO: 80)

TGAGTCAAggatgAGATTTCTT GGAATTCTGTTGA CAGCTGTAGCTCCCATCCACTAATACTGTACCTA (SEQ ID NO: 81)

Codon 84 Amplification Products

CAGTATTAATAGGACCggatgACACCTGTC AACATAATTGCAA TCTCTCTGTTGACCATCCCAGATTGG (SEQ ID NO: 82)

CCAATCTGggatgGTCAACAGA GAGATTGCAATTA TGTTGACAGGTGTCATCCGGTCCTATTAATACTG (SEQ ID NO: 83)

Codon 90 amplification products

TAGGACCTACACCTGggatgCAACATAAT TGGAAGAAATCTGT TGACTCAGATTGGCATCCTGCACTTTAAATTTT (SEQ ID NO: 84)

AAAATTTAAAGTGCAggatgCCAATCTGA GTCAACAGATTTCT TCCAATTATGTTGCATCCCAGGTGTAGGTCCTA (SEQ ID NO: 85)

The sites written in lowercase in the sequence of PCR amplification products of Reactions 10 to 17 are sequences recognized by FokI, a restriction enzyme, and the underlined sites are sequences of fragments generated by FokI restriction enzyme cleavage. Restriction enzyme treatment process for the PCR amplification products of the reaction 10 to reaction 17 is the same as in Example 1.

2. Purification and Desalting

It is carried out in the same manner as in Example 1.

3. Maldi-TOF Mass Spectrometry

It is carried out in the same manner as in Example 1.

The size of the fragments produced by each reaction is shown in Table 2 below. The size of the fragments based on the lookup table in Table 2 determines the HIV drug resistance gene mutation.

Pol gene Target codon amino acid Calculated molecular weight (Da) Upper Down PR 30 Asp (D) 2867.8 2768.8 Asn (N) 2851.8 2783.8 46 Met (M) 3164.0 2988.0 Ile (I) 3148.0 3003.0 48 Gly (G) 3493.2 3292.2 Val (V) 3468.2 3316.2 50 Ile (I) 3854.4 3581.4 Val (V) 3870.4 3566.4 54 Ile (I) 3732.4 3780.4 Leu (L) 3708.4 3780.4 Ser (S) 3708.4 3796.4 82 Val (V) 4047.6 4084.6 Ala (A) 4032.6 4100.6 84 Ile (I) 4030.6 4077.6 Val (V) 4046.6 4077.6 90 Leu (L) 4406.8 4317.8 Met (M) 4415.8 4308.8

Example 3 Performance Comparison of the Method of the Present Invention and the Conventional Method

1. Minimum detection limit

The minimum detection limit (analytical sensitivity) performance between the HIV drug resistance gene mutation detection method and the conventional sequencing method according to the present invention was compared.

As a result of 10 repeated tests using serially diluted HIV RNA standards and analysis through probit analysis, the detection limit of the HIV drug resistance gene mutation detection method according to the present invention was 223.02 copies / copies / While ml (95% CI: 132.64-693), the conventional sequencing method was 1268.11 copies / ml (95% CI: 863.09-3656.80). In other words, it can be seen that the method of the present invention can detect HIV drug resistance gene mutations more sensitively than the conventional method.

The detection rate and the detection limit according to the serial dilution factor are summarized in Table 3 below. As can be seen in Table 3, the detection limit (sensitivity) of the HIV drug resistance gene mutation detection method according to the present invention can be seen that more than five times better than the conventional sequencing method.

HIV RNA
Copy number / ml Inspection The method of the present invention Conventional sequencing method Detection % Of detection Detection % Of detection 5000 10 10 100% 10 100% 2500 10 10 100% 10 100% 1000 10 10 100% 9 90% 500 10 10 100% 4 40% 250 10 10 100% One 10% 100 10 8 80% 0 0% 50 10 3 30% 0 0% 25 10 One 10% 0 0% 10 10 One 10% 0 0% Detection limit 223.02 copy number / ml
(95% CI: 132.64-693.00) 1268.11 copy number / ml
(95% CI: 863.09-3656.80)

2. Detection performance of HIV virus mixed type

When the genotypes of HIV were mixed, the detection performance of the minority type for the predominant type was confirmed using the HIV drug resistance gene mutation detection method according to the present invention. This means the ability to detect early in the development of resistant mutations in wild-type HIV viruses, which is important for early diagnosis of drug resistance clinically.

Recombinant HIV clones were used as test samples, and drug-resistant virus (codon 103 drug-resistant virus of reverse transcriptase gene) was 100%, 50%, 20%, 10%, 5%, and 1% of the total virus. It was used by mixing to exist. Figure 1 (A) is 100% of the HIV having codon 103 drug resistance mutations of the reverse transcriptase gene located in the pol gene of HIV, Figure 1 (B) of FIG. When (C) is present at 20%, (D) is present at 10%, (E) of FIG. 1 is present at 5%, and (F) of FIG. 1 is present at 1%. Maldi-Top mass spectrometry graph.

In general, when the HIV wild type virus and the drug resistant virus are mixed, the conventional sequencing method can detect the drug resistant virus only when 20% or more of the virus is present. Even if the presence of the% can be detected, showing the early detection ability more than four times better than the conventional sequencing method (see Fig. 1).

3. Comparison of mutation type identification performance when double mutation occurs

The accuracy of the HIV drug resistance gene mutation detection method according to the present invention and the conventional sequencing method were compared. The analysis result was consistent with one nucleotide mutation in one codon, but there was a difference in accuracy when a double mutation occurred in which two nucleotides were changed in one codon. That is, when a double mutation occurs in one codon, the conventional sequencing method can be interpreted with various results, which makes it difficult to determine the exact result (see FIG. 3). However, the HIV drug resistance gene mutation detection of the present invention is detected. The method was able to determine the exact type of mutations by analyzing several mutations (haplotype of multiple variation) with one mass.

As shown in FIG. 3, when mutations occur at the first (A or T) and the second (A or C) positions of reverse transcriptase codon 215, the conventional sequencing method has a haplotype tyrosine. ( TA C), serine ( TC C), threonine ( AC C), asparagine ( AA C), thus threonine (ACC) + tyrosine (TAC), or serine (TCC) + asparagine (AAC) , Or threonine (ACC) + serine (TCC) + tyrosine (TAC) can be genotype in three cases can not be identified as a specific mutation-related genotype, while the HIV drug resistance gene mutation detection method according to the present invention Can be analyzed simply and accurately with the mixed infection genotype of "Threonine (ACC) + Tyrosine (TAC)" (see Figure 2).

Finally, as can be seen in Figures 1, 2 and 4, the HIV drug resistance gene mutation detection method of the present invention is a rapid, sensitive and accurate screening of HIV drug resistance gene mutations caused by antiretroviral agents In particular, even when a double mutation occurs in which two nucleotides are changed in one codon, there is an advantage of identifying the exact type of mutation. Therefore, the present invention can effectively determine whether the drug resistance gene mutation before or before taking anti-retroviral agent, early diagnosis and appropriate medication treatment of HIV drug resistance mutation in HIV infected patients Application is possible.

Although the present invention has been described with reference to the above embodiments, the present invention is not limited thereto. It will be understood by those skilled in the art that modifications and variations may be made without departing from the spirit and scope of the invention, and that such modifications and variations are also contemplated by the present invention.

<110> GENEMATRIX INC. <120> Method for detecting mutations in drug-resistant related genes of HIV using restriction fragments mass polymorphism <130> P12-0280KR <160> 85 <170> Kopatentin 1.71 <210> 1 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> codon65 <400> 1 ccatacaata ctccagtatt tgccataaag aaaaaagaca gtactaaatg gagaaaatta 60 gta 63 <210> 2 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> codon69 <400> 2 actccagtat ttgccataaa gaaaaaagac agtactaaat ggagaaaatt agtagatttc 60 agagaactta at 72 <210> 3 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> codon74 <400> 3 aaaaaagaca gtactaaatg gagaaaatta gtagatttca gagaacttaa taagaga 57 <210> 4 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> codon103 <400> 4 ttaggaatac cacatcccgc agggttaaaa aagaaaaaat cagtaacagt actggatgtg 60 ggtgatgca 69 <210> 5 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> codon106 <400> 5 ccacatcccg cagggttaaa aaagaaaaaa tcagtaacag tactggatgt gggtgatgca 60 tatttttca 69 <210> 6 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> codon151 <400> 6 attagatatc agtacaatgt gcttccacag ggatggaaag gatcaccagc aatattccaa 60 agtagc 66 <210> 7 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> codon181 <400> 7 ccttttagaa aacaaaatcc agacatagtt atctatcaat acatggatga tttgtatgta 60 ggatctgac 69 <210> 8 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> codon184 <400> 8 aaacaaaatc cagacatagt tatctatcaa tacatggatg atttgtatgt aggatctgac 60 ttagaaata 69 <210> 9 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> codon215 <400> 9 agacaacatc tgttgaggtg gggacttacc acaccagaca aaaaacatca gaaagaa 57 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> codon65 forward primer <400> 10 tactccggat gcatgtttgc cataaag 27 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> codon65 reverse primer <400> 11 ttctccattt ggatgagtac tgtcttt 27 <210> 12 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> codon69 forward primer <400> 12 ccagtatttg ccaggatgga agaagaaaga cagt 34 <210> 13 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> codon69 reverse primer <400> 13 aagttctctg aaatctacta aggatgtttc tcca 34 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> codon74 forward primer <400> 14 agacaggatg gtactaaatg gagaaaa 27 <210> 15 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> codon74 reverse primer <400> 15 tattaagttc tggatgctga aatctac 27 <210> 16 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> codon 103 forward primer <400> 16 aataccacat gccgcggatg gggttaacaa ag 32 <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> codon 103 reverse primer <400> 17 cacccacatc ggatgagtac tgttactgat tt 32 <210> 18 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> codon 106 forward primer <400> 18 tcccgcaggg ttaacggatg aagacaagat ca 32 <210> 19 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> codon 106 reverse primer <400> 19 caaatatgca tcggatgccc acaaccagag ctgt 34 <210> 20 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> codon151 forward primer <400> 20 atatcagtac ggatgaatgt gcttcca 27 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> codon151 reverse primer <400> 21 ttgggatgct ggtgatcctt tcaatcc 27 <210> 22 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> codon181 forward primer <400> 22 tagaacacat aatccggatg gacatagtta tc 32 <210> 23 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> codon181 reverse primer <400> 23 atcgtacatg gatgcaaatc atcaatgtat tg 32 <210> 24 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> codon184 forward primer <400> 24 caatccagga tgacatagtt atttatcctt ac 32 <210> 25 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> codon184 reverse primer <400> 25 tctaagtcag atcatacgga tgtacaaata atc 33 <210> 26 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> codon215 forward primer <400> 26 acaggatgtc tgttgaggtg gggattt 27 <210> 27 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> codon215 reverse primer <400> 27 tctgatgtaa ggatgtttgt ctggtgt 27 <210> 28 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> codon 65 PCR product F <400> 28 tactccggat gcatgtttgc cataaagaaa aagacagtac tcatccaaat ggagaa 56 <210> 29 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> codon 65 PCR product R <400> 29 ttctccattt ggatgagtac tgtctttttt ctttatggca aatactggag ta 52 <210> 30 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> codon 69 PCR product F <400> 30 ccagtatttg ccaggatgga agaagaaaga cagtactaaa tggagaaaca tccttagtag 60 atttcagaga actt 74 <210> 31 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> codon 69 PCR product R <400> 31 aagttctctg aaatctacta aggatgtttc tccatttagt actgtctttc ttcttccatc 60 ctggcaaata ctgg 74 <210> 32 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> codon 74 PCR product F <400> 32 agacaggatg gtactaaatg gagaaaatat taagttctct gaaatctact aa 52 <210> 33 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> codon 74 PCR product R <400> 33 tattaagttc tggatgctga aatctacact aattttctcc atttagtact gtct 54 <210> 34 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> codon 103 PCR product F <400> 34 aataccacat gccgcggatg gggttaacaa agaaaaaatc agtaacagta ctggatgtgg 60 gtg 63 <210> 35 <211> 67 <212> DNA <213> Artificial Sequence <220> <223> codon 103 PCR product R <400> 35 cacccacatc ggatgagtac tgttactgat tttttaaatc agtaacagta ctcatccgat 60 gtgggtg 67 <210> 36 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> codon 106 PCR product F <400> 36 tcccgcaggg ttaacggatg aagacaagat caaaatcagt aacagctctg gttgtgggca 60 tccgatgcat atttg 75 <210> 37 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> codon 106 PCR product R <400> 37 caaatatgca tcggatgccc acaaccagag ctgttacaca gctctggttg tgggcatccg 60 atgcatattt g 71 <210> 38 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> codon 151 PCR product F <400> 38 atatcagtac ggatgaatgt gcttccacag ggattgaaag gatcaccagc catccatatt 60 ccaaa 65 <210> 39 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> codon 151 PCR product R <400> 39 ttgggatgct ggtgatcctt tcaatccctg tggaagcaca ttcatccgta ctgatat 57 <210> 40 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> codon 181 PCR product F <400> 40 tagaacacat aatccggatg gacatagtta tcctatcaat acattgatga tttgcatcca 60 tgtacgat 68 <210> 41 <211> 67 <212> DNA <213> Artificial Sequence <220> <223> codon 181 PCR product R <400> 41 atcgtacatg gatgcaaatc atcaatgtat tgatagataa ctatgtccat ccggattatg 60 tgttcta 67 <210> 42 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> codon 184 PCR product F <400> 42 caatccagga tgacatagtt atttatcctt acatggatta tttgtacatc cgtatgatct 60 gacttaga 68 <210> 43 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> codon 184 PCR product R <400> 43 tctaagtcag atcatacgga tgtacaaata atccatgtaa ggataaataa ctatgtcatc 60 ctggattg 68 <210> 44 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> codon 215 PCR product F <400> 44 acaggatgtc tgttgaggtg gggatttacc acaccagaca aacatcctta catcaga 57 <210> 45 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> codon 215 PCR product R <400> 45 tctgatgtaa ggatgtttgt ctggtgtggt aaatccccac ctcaacagac atcctgt 57 <210> 46 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> codon 30 <400> 46 gggcaactaa aggaagctct attagataca ggagcagatg atacagtatt agaagaaatg 60 agtttgccag gaagatggaa 80 <210> 47 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> codon 46 <400> 47 agaagaaatg agtttgccag gaagatggaa accaaaaatg atagggggaa ttggaggttt 60 tatcaaagta agacagtatg 80 <210> 48 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> codon 48 <400> 48 agaagaaatg agtttgccag gaagatggaa accaaaaatg atagggggaa ttggaggttt 60 tatcaaagta agacagtatg 80 <210> 49 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> codon 50 <400> 49 agtttgccag gaagatggaa accaaaaatg atagggggaa ttggaggttt tatcaaagta 60 agacagtatg atcagatact 80 <210> 50 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> codon 54 <400> 50 accaaaaatg atagggggaa ttggaggttt tatcaaagta agacagtatg atcagatact 60 catagaaatc 70 <210> 51 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> codon 82 <400> 51 aagctatagg tacagtatta gtaggaccta cacctgtcaa cataattgga agaaatctgt 60 tgactcagat 70 <210> 52 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> codon 84 <400> 52 tacagtatta gtaggaccta cacctgtcaa cataattgga agaaatctgt tgactcagat 60 tggttgcact 70 <210> 53 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> codon 90 <400> 53 tacagtatta gtaggaccta cacctgtcaa cataattgga agaaatctgt tgactcagat 60 tggttgcact ttaaattttc 80 <210> 54 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> codon 30 forward primer <400> 54 ctaaaggaag ctctaggatg tagatacagg agcagat 37 <210> 55 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> codon 30 reverse primer <400> 55 cctggcaaac tcattggatg tctaatactg t 31 <210> 56 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> codon 46 forward primer <400> 56 tgagtttgcc aggaaaggat gtggaaacca aaa 33 <210> 57 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> codon 46 reverse primer <400> 57 tactttgata aggatgcctc caattccccc tat 33 <210> 58 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> codon 48 forward primer <400> 58 gagtttgcca ggaaaggatg tggaaaccaa aaatgata 38 <210> 59 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> codon 48 reverse primer <400> 59 gtcttacttt gataaggatg acctccaatt cc 32 <210> 60 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> codon 50 forward primer <400> 60 ttgccaggaa aatggggatg aaccaaaaat gataggggga 40 <210> 61 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> codon 50 reverse primer <400> 61 atactgtctt actttggatg ataaaacctc c 31 <210> 62 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> codon 54 forward primer <400> 62 caaaaatgat agaaggggat gattggaggt att 33 <210> 63 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> codon 54 reverse primer <400> 63 catgagtatg gatggatcat actgaggtac ttt 33 <210> 64 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> codon 82 forward primer <400> 64 taggtacagt attagtggat gggagctaca gct 33 <210> 65 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> codon 82 reverse primer <400> 65 tgagtcaagg atgagatttc ttggaattct gtt 33 <210> 66 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> codon 84 forward primer <400> 66 cagtattaat aggaccggat gacacctgtc aac 33 <210> 67 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> codon 84 reverse primer <400> 67 ccaatctggg atggtcaaca gagagattgc aat 33 <210> 68 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> codon 90 forward primer <400> 68 taggacctac acctgggatg caacataatt ggaagaaatc tg 42 <210> 69 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> codon 90 reverse primer <400> 69 aaaatttaaa gtgcaggatg ccaatctgag t 31 <210> 70 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> codon 30 PCR product F <400> 70 ctaaaggaag ctctaggatg tagatacagg agcagatgat acagtattag acatccaatg 60 agtttgccag g 71 <210> 71 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> codon 30 PCR product R <400> 71 cctggcaaac tcattggatg tctaatactg tatcatctgc tcctgtatct acatcctaga 60 gcttccttta g 71 <210> 72 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> codon 46 PCR product F <400> 72 tgagtttgcc aggaaaggat gtggaaacca aaaatgatag ggggaattgg aggcatcctt 60 atcaaagta 69 <210> 73 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> codon 46 PCR product R <400> 73 tactttgata aggatgcctc caattccccc tatcattttt ggtttccaca tcctttcctg 60 gcaaactca 69 <210> 74 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> codon 48 PCR product F <400> 74 gagtttgcca ggaaaggatg tggaaaccaa aaatgatagg gggaattgga ggtcatcctt 60 atcaaagtaa gac 73 <210> 75 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> codon 48 PCR product R <400> 75 gtcttacttt gataaggatg acctccaatt ccccctatca tttttggttt ccacatcctt 60 tcctggcaaa ctc 73 <210> 76 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> codon 50 PCR product F <400> 76 ttgccaggaa aatggggatg aaccaaaaat gataggggga attggaggtt ttatcatcca 60 aagtaagaca gtat 74 <210> 77 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> codon 50 PCR product R <400> 77 atactgtctt actttggatg ataaaacctc caattccccc tatcattttt ggttcatccc 60 cattttcctg gcaa 74 <210> 78 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> codon 54 PCR product F <400> 78 caaaaatgat agaaggggat gattggaggt attatcaaag tacctcagta tgatccatcc 60 atactcatg 69 <210> 79 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> codon 54 PCR product R <400> 79 catgagtatg gatggatcat actgaggtac tttgataata cctccaatca tccccttcta 60 tcatttttg 69 <210> 80 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> codon 82 PCR product F <400> 80 taggtacagt attagtggat gggagctaca gctgtcaaca gaattccaag aaatctcatc 60 cttgactca 69 <210> 81 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> codon 82 PCR product R <400> 81 tgagtcaagg atgagatttc ttggaattct gttgacagct gtagctccca tccactaata 60 ctgtaccta 69 <210> 82 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> codon 84 PCR product F <400> 82 cagtattaat aggaccggat gacacctgtc aacataattg caatctctct gttgaccatc 60 ccagattgg 69 <210> 83 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> codon 84 PCR product R <400> 83 ccaatctggg atggtcaaca gagagattgc aattatgttg acaggtgtca tccggtccta 60 ttaatactg 69 <210> 84 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> codon 90 PCR product F <400> 84 taggacctac acctgggatg caacataatt ggaagaaatc tgttgactca gattggcatc 60 ctgcacttta aatttt 76 <210> 85 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> codon 90 PCR product R <400> 85 aaaatttaaa gtgcaggatg ccaatctgag tcaacagatt tcttccaatt atgttgcatc 60 ccaggtgtag gtccta 76

Claims

Using a forward primer and a reverse primer to amplify a polynucleotide template comprising a mutant base of a reverse transcriptase gene or a protease gene present in the HIV pol gene,
Cutting the amplified polynucleotide with a restriction enzyme to generate two or more single-stranded polynucleotide fragments containing a mutated position base while the number of bases of the fragments after the cleavage is within a limited range;
And analyzing the drug resistance gene mutation in the reverse transcriptase gene or protease gene by measuring the molecular weight of the cleaved fragment, and analyzing the drug resistance gene mutation type.

The method of claim 1,
HIV drug resistance gene mutation detection method characterized in that the type of drug resistance gene mutations can be analyzed by analyzing the occurrence of a double mutation in which two nucleotides are changed in one codon in the reverse transcriptase gene or protease gene .

3. The method according to claim 1 or 2,
Codon 65, codon 69, codon 74, codon 103, codon 106, codon 151, codon 181, codon 184 and codon 215 located within the reverse transcriptase gene, codon 30, codon 46 located within the protease gene, A method for detecting HIV drug resistance gene mutation, characterized in that for analyzing the mutation of at least one codon selected from the group consisting of codon 48, codon 50, codon 54, codon 82, codon 84 and codon 90.

The method of claim 3,
Primer pairs of SEQ ID NO: 10 and SEQ ID NO: 11, primer pairs of SEQ ID NO: 12 and SEQ ID NO: 13, primer pairs of SEQ ID NO: 14 and SEQ ID NO: 15, primer pairs of SEQ ID NO: 16 and SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: The primer pair of 19, the primer pair of SEQ ID NO: 20 and SEQ ID NO: 21, the primer pair of SEQ ID NO: 22 and SEQ ID NO: 23, the primer pair of SEQ ID NO: 24 and SEQ ID NO: 25, and the primer pair of SEQ ID NO: 26 and SEQ ID NO: 27 And amplifying a template comprising gene mutations of codon 65, codon 69, codon 74, codon 103, codon 106, codon 151, codon 181, codon 184 and codon 215, respectively, located in the reverse transcriptase gene. HIV drug resistance gene mutation detection method.

The method of claim 3,
Primer pairs of SEQ ID NO: 54 and SEQ ID NO: 55, primer pairs of SEQ ID NO: 56 and SEQ ID NO: 57, primer pairs of SEQ ID NO: 58 and SEQ ID NO: 59, primer pairs of SEQ ID NO: 60 and SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO: The primer pair of 63, the primer pair of SEQ ID NO: 64 and SEQ ID NO: 65, the primer pair of SEQ ID NO: 66 and SEQ ID NO: 67, and the primer pair of SEQ ID NO: 68 and SEQ ID NO: 69 are each codon located in the protease gene An HIV drug resistance gene mutation detection method comprising amplifying a template comprising a gene mutation of 30, codon 46, codon 48, codon 50, codon 54, codon 82, codon 84, and codon 90.

3. The method according to claim 1 or 2,
The fragment after restriction enzyme cleavage comprises a mutation position base, and the number of bases of the fragment is 2 to 14 HIV drug resistance gene mutation detection method, characterized in that.

Amplify the polynucleotide template including the reverse transcriptase gene or the mutated base of the protease gene present in the HIV pol gene, but within a limited range of the number of bases of the fragment after cleaving the amplified polynucleotide with a restriction enzyme. And a primer for generating two or more single-stranded polynucleotide fragments containing mutagenic bases,
Primer pairs of SEQ ID NO: 10 and SEQ ID NO: 11, primer pairs of SEQ ID NO: 12 and SEQ ID NO: 13, primer pairs of SEQ ID NO: 14 and SEQ ID NO: 15, primer pairs of SEQ ID NO: 16 and SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: Consisting of a primer pair of 19, a primer pair of SEQ ID NO: 20 and SEQ ID NO: 21, a primer pair of SEQ ID NO: 22 and SEQ ID NO: 23, a primer pair of SEQ ID NO: 24 and SEQ ID NO: 25, and a primer pair of SEQ ID NO: 26 and SEQ ID NO: 27 At least one primer pair selected from the group, or primer pairs of SEQ ID NO: 54 and SEQ ID NO: 55, primer pairs of SEQ ID NO: 56 and SEQ ID NO: 57, primer pairs of SEQ ID NO: 58, and SEQ ID NO: 59, SEQ ID NO: 60, and SEQ ID NO: 61 Primer pairs of SEQ ID NO: 62, primer pairs of SEQ ID NO: 62 and SEQ ID NO: 63, primer pairs of SEQ ID NO: 64 and SEQ ID NO: 65, primer pairs of SEQ ID NO: 66, and SEQ ID NO: 67 Hitting HIV drug resistance gene mutation detection primer comprising at least one pair of primers selected in the group consisting of a pair of primers of SEQ ID NO: 68 and SEQ ID NO: 69.

The method of claim 7, wherein
Primer pairs of SEQ ID NO: 10 and SEQ ID NO: 11, primer pairs of SEQ ID NO: 12 and SEQ ID NO: 13, primer pairs of SEQ ID NO: 14 and SEQ ID NO: 15, primer pairs of SEQ ID NO: 16 and SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: The primer pair of 19, the primer pair of SEQ ID NO: 20 and SEQ ID NO: 21, the primer pair of SEQ ID NO: 22 and SEQ ID NO: 23, the primer pair of SEQ ID NO: 24 and SEQ ID NO: 25, and the primer pair of SEQ ID NO: 26 and SEQ ID NO: 27 And amplifying a template comprising gene mutations of codon 65, codon 69, codon 74, codon 103, codon 106, codon 151, codon 181, codon 184 and codon 215, respectively, located in the reverse transcriptase gene. Primer for detecting HIV drug resistance gene mutations.

The method of claim 7, wherein
Primer pairs of SEQ ID NO: 54 and SEQ ID NO: 55, primer pairs of SEQ ID NO: 56 and SEQ ID NO: 57, primer pairs of SEQ ID NO: 58 and SEQ ID NO: 59, primer pairs of SEQ ID NO: 60 and SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO: The primer pair of 63, the primer pair of SEQ ID NO: 64 and SEQ ID NO: 65, the primer pair of SEQ ID NO: 66 and SEQ ID NO: 67, and the primer pair of SEQ ID NO: 68 and SEQ ID NO: 69 are each codon located in the protease gene A primer for detecting HIV drug resistance gene mutation, characterized by amplifying a template comprising a gene mutation of 30, codon 46, codon 48, codon 50, codon 54, codon 82, codon 84, and codon 90.

Primer pairs of SEQ ID NO: 10 and SEQ ID NO: 11, primer pairs of SEQ ID NO: 12 and SEQ ID NO: 13, primer pairs of SEQ ID NO: 14 and SEQ ID NO: 15, primer pairs of SEQ ID NO: 16 and SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: Consisting of a primer pair of 19, a primer pair of SEQ ID NO: 20 and SEQ ID NO: 21, a primer pair of SEQ ID NO: 22 and SEQ ID NO: 23, a primer pair of SEQ ID NO: 24 and SEQ ID NO: 25, and a primer pair of SEQ ID NO: 26 and SEQ ID NO: 27 At least one primer pair selected from the group, or primer pairs of SEQ ID NO: 54 and SEQ ID NO: 55, primer pairs of SEQ ID NO: 56 and SEQ ID NO: 57, primer pairs of SEQ ID NO: 58, and SEQ ID NO: 59, SEQ ID NO: 60, and SEQ ID NO: 61 Primer pairs of SEQ ID NO: 62, primer pairs of SEQ ID NO: 62 and SEQ ID NO: 63, primer pairs of SEQ ID NO: 64 and SEQ ID NO: 65, primer pairs of SEQ ID NO: 66, and SEQ ID NO: 67 Hitting SEQ ID NO: 68 and SEQ ID NO: 69 at least one pair of primers selected in the group consisting of primer pair and,
HIV drug resistance comprising a polynucleotide template comprising a mutation base of a reverse transcriptase gene or a protease gene amplified by the primer pair and present in the HIV pol gene, DNA polymerase, dNTPs, and a buffer solution Gene mutation kit.

The method of claim 10,
Primer pairs of SEQ ID NO: 10 and SEQ ID NO: 11, primer pairs of SEQ ID NO: 12 and SEQ ID NO: 13, primer pairs of SEQ ID NO: 14 and SEQ ID NO: 15, primer pairs of SEQ ID NO: 16 and SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: The primer pair of 19, the primer pair of SEQ ID NO: 20 and SEQ ID NO: 21, the primer pair of SEQ ID NO: 22 and SEQ ID NO: 23, the primer pair of SEQ ID NO: 24 and SEQ ID NO: 25, and the primer pair of SEQ ID NO: 26 and SEQ ID NO: 27 And amplifying a template comprising gene mutations of codon 65, codon 69, codon 74, codon 103, codon 106, codon 151, codon 181, codon 184 and codon 215, respectively, located in the reverse transcriptase gene. Kit for detecting HIV drug resistance gene mutations.

The method of claim 10,
Primer pairs of SEQ ID NO: 54 and SEQ ID NO: 55, primer pairs of SEQ ID NO: 56 and SEQ ID NO: 57, primer pairs of SEQ ID NO: 58 and SEQ ID NO: 59, primer pairs of SEQ ID NO: 60 and SEQ ID NO: 61, SEQ ID NO: 62, and SEQ ID NO: The primer pair of 63, the primer pair of SEQ ID NO: 64 and SEQ ID NO: 65, the primer pair of SEQ ID NO: 66 and SEQ ID NO: 67, and the primer pair of SEQ ID NO: 68 and SEQ ID NO: 69 are each codon located in the protease gene A kit for detecting HIV drug resistance gene mutations comprising amplifying a template comprising a gene mutation of 30, codon 46, codon 48, codon 50, codon 54, codon 82, codon 84, and codon 90.