CN101792756A - Method for extracting genomic deoxyribonucleic acid - Google Patents
Method for extracting genomic deoxyribonucleic acid Download PDFInfo
- Publication number
- CN101792756A CN101792756A CN 201010129818 CN201010129818A CN101792756A CN 101792756 A CN101792756 A CN 101792756A CN 201010129818 CN201010129818 CN 201010129818 CN 201010129818 A CN201010129818 A CN 201010129818A CN 101792756 A CN101792756 A CN 101792756A
- Authority
- CN
- China
- Prior art keywords
- dna
- muddy liquid
- obtains
- bacterium
- mixing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for extracting genomic deoxyribonucleic acid, belonging to the technical field of nucleic acid application in biology. The method comprises the following steps: adding cracking buffer into any one material of plant tissue, animal tissue or bacterium, crushing the material, mixing the material uniformly in vortex to prepare first dirty solution; adding protease K into the first dirty solution, mixing the solution uniformly, and incubating the solution to prepare second dirty solution; and centrifugalizing the second dirty solution to prepare centrifugalized supernate which contains deoxyribonucleic acid. The method does not use liquid nitrogen grinding, does not need enzymolysis or long-term incubation, uses the disposal cracking material which has wide material range, is applicable to plant tissue, animal tissue and bacterium, has short operation time, is directly applied to gene testing, has the advantages of quickness and convenience, high sensitivity, strong specificity, good stability and the like, and can furthest reduce human errors.
Description
Technical field
The present invention relates to a kind of method of extracting genomic deoxyribonucleic acid, belong to biological amplifying nucleic acid applied technical field.
Background technology
Detect at traditional gene type, transgenosis, in the strain test experience, people relatively customary way are, adopt manual extracting or buy general genomic deoxyribonucleic acid (hereinafter to be referred as DNA) and extract test kit and carry out.But, no matter be that manual extracting of employing or purchase test kit extract, whole leaching process all will be got a certain amount of material, process liquid nitrogen grinding → lysate cracking → hatch → centrifugal → organic extracting (perhaps crossing post) → rinsing several → dry → dissolve (perhaps wash-out) such flow process finally obtains DNA.And often these DNA only are polymerase chain reaction (the polymerase chain reaction that is used as gene identification, hereinafter to be referred as PCR) template, used once back DNA just to throw away, certainly, those negative mouselets and those negative Arabidopis thalianas have also been thrown away simultaneously.Perhaps DNA purity that this operation obtains and yield all are high, even but risk that may the frostbite operator when not considering to use liquid nitrogen grinding, whole leaching process is because complex steps, and the instrument of use is numerous, and the waiting time is very long.
Summary of the invention
The objective of the invention is to propose a kind of method of extracting genomic deoxyribonucleic acid, adopted special technique, be intended to set up mature and stable, single stage method and directly from various materials, extract DNA, be used for the PCR detection architecture of range gene.
The method of the extraction genomic deoxyribonucleic acid that the present invention proposes may further comprise the steps:
(1-1) lysis buffer is joined in any material in plant tissue, animal tissues or the bacterium, material is ground, and vortex mixing, obtain the first muddy liquid, the mass volume ratio of adding is: any in vegetable material, animal material or the bacterium: lysis buffer=10 milligram: 200 microlitres;
(1-2) adding mass volume ratio concentration in the above-mentioned first muddy liquid is the Proteinase K of 10-20 mg/ml, and the volume of adding is the 5-20 microlitre, and mixing was hatched 5-30 minute under 55-65 ℃, and 80-95 ℃ of heating 3-10 minute obtains the second muddy liquid;
(1-3) the above-mentioned second muddy liquid is carried out centrifugation, centrifugal rotational speed is 8000-13000 rev/min, and centrifugation time is 3-5 minute, obtains the supernatant liquor of centrifugation, contains thymus nucleic acid in the supernatant liquor.
In the aforesaid method, consisting of of lysis buffer: the pH value is 8.0, volumetric molar concentration is the 20-50 mmole/liter Tutofusin tris. hydrochloric acid, volumetric molar concentration be the 2.0-4.0 mmole/liter ethylenediamine tetraacetic acid (EDTA) and volumetric molar concentration be the 20-50 mmole/liter sodium-chlor.
The method of the extraction genomic deoxyribonucleic acid that the present invention proposes, its advantage is:
1, the most important condition of gene test is to obtain enough DNA, and so-called enough DNA does not need too high to the requirement of its quality and quantity, as long as satisfy the PCR condition.The inventive method has proposed single stage method and has directly extracted DNA and be used for pcr amplification, as the term suggests adopt the single stage method cracking material, results DNA is used for pcr amplification, simple to operate fast, the accurate good reproducibility of result.The benefit of present method is: single stage method is extracted DNA, promptly without liquid nitrogen grinding, do not need enzymolysis and hatch for a long time, disposable cracking material, material ranges is wide, and plant tissue, animal tissues, bacterium all are suitable for, operating time is short, directly apply to gene test etc., have advantages such as fast and convenient, highly sensitive, high specificity, good stability, can reduce personal errors to greatest extent.
2, directly PCR is applicable to that purity and yield requirement to DNA are not high experiments, as gene test etc., the operator only needs a step that material is mixed with lysate, in case of necessity with material fragmentation, the centrifugal DNA that obtains, get 1 microlitre and be used for the PCR reaction system of 20 microlitres, just can determine having or not of goal gene as template.Such as in the transgenosis screening, adopt the method for direct PCR, can instantaneously obtain dna profiling and be used for the PCR evaluation, determine whether fast to be the transgenosis individuality, need not spend a lot of time and energy and look after the negative seedling or the young, saved ample resources.In addition, the inventive method also is applicable to experiments such as strain detection, seed purity detection and molecule marker.
The present invention proposes single stage method, DNA extraction method fast, be used for PCR and detect, quick, convenient, safety, efficient height, good stability are fit to comprise that the PCR of plant tissue, seed, bacterium and animal tissues detects.
Description of drawings
Fig. 1 is the detected result of the DNA that the embodiment of the invention 1 obtains being carried out the ubiquitin gene pcr amplification.
Fig. 2 obtains the detected result that DNA carries out the agglutinin gene pcr amplification to the embodiment of the invention 2.
Fig. 3 obtains the detected result that DNA carries out the internal control gene pcr amplification to the embodiment of the invention 3.
Fig. 4 obtains the detected result that DNA carries out the universal primer PCR amplification to the embodiment of the invention 4.
Fig. 5 obtains the detected result that DNA carries out the internal control gene pcr amplification to the embodiment of the invention 5.
Embodiment
The method of the extraction genomic deoxyribonucleic acid that the present invention proposes may further comprise the steps:
(1-1) lysis buffer is joined in any material in plant tissue, animal tissues or the bacterium, material is ground, and vortex mixing, obtain the first muddy liquid, the mass volume ratio of adding is: any in vegetable material, animal material or the bacterium: lysis buffer=10 milligram: 200 microlitres;
(1-2) adding mass volume ratio concentration in the above-mentioned first muddy liquid is the Proteinase K of 10-20 mg/ml, and the volume of adding is the 5-20 microlitre, and mixing was hatched 5-30 minute under 55-65 ℃, and 80-95 ℃ of heating 3-10 minute obtains the second muddy liquid;
(1-3) the above-mentioned second muddy liquid is carried out centrifugation, centrifugal rotational speed is 8000-13000 rev/min, and centrifugation time is 3-5 minute, obtains the supernatant liquor of centrifugation, contains thymus nucleic acid in the supernatant liquor.
In the aforesaid method, consisting of of lysis buffer: the pH value is 8.0, volumetric molar concentration is the 20-50 mmole/liter Tutofusin tris. hydrochloric acid, volumetric molar concentration be the 2.0-4.0 mmole/liter ethylenediamine tetraacetic acid (EDTA) and volumetric molar concentration be the 20-50 mmole/liter sodium-chlor.
Below be the embodiment of the inventive method:
Some reagent sources that adopted in an embodiment: 2x PCRReagent, Proteinase K that TIANGEN Biotech (Beijing) Co., Ltd. produces, and aqua sterilisa.
Embodiment 1:
1,200 μ l lysis buffers are joined in the 10mg Arabidopsis leaf, material is ground, and the vortex mixing, the first muddy liquid obtained;
2, adding concentration in the above-mentioned first muddy liquid is the Proteinase K of 20mg/ml, and the volume of adding is 10 μ l, and mixing was hatched 10 minutes under 55 ℃, and 85 ℃ of heating 5 minutes obtain the second muddy liquid;
3, the above-mentioned second muddy liquid is carried out centrifugation, centrifugal rotational speed is 13000 rev/mins, and centrifugation time is 3 minutes, obtains the supernatant liquor of centrifugation, contains thymus nucleic acid in the supernatant liquor.
Embodiment 2:
1,200 μ l lysis buffers are joined in the 10mg soybean leaves, material is ground, and the vortex mixing, the first muddy liquid obtained;
2, adding concentration in the above-mentioned first muddy liquid is the Proteinase K of 20mg/ml, and the volume of adding is 10 μ l, and mixing was hatched 10 minutes under 55 ℃, and 85 ℃ of heating 5 minutes obtain the second muddy liquid;
3, the above-mentioned second muddy liquid is carried out centrifugation, centrifugal rotational speed is 13000 rev/mins, and centrifugation time is 3 minutes, obtains the supernatant liquor of centrifugation, contains thymus nucleic acid in the supernatant liquor.
Embodiment 3:
1,200 μ l lysis buffers are joined in the 10mg rice leaf, material is ground, and the vortex mixing, the first muddy liquid obtained;
2, adding mass volume ratio concentration in the above-mentioned first muddy liquid is the Proteinase K of 20mg/ml, and the volume of adding is 10 μ l, and mixing was hatched 10 minutes under 55 ℃, and 85 ℃ of heating 5 minutes obtain the second muddy liquid;
3, the above-mentioned second muddy liquid is carried out centrifugation, centrifugal rotational speed is 13000 rev/mins, and centrifugation time is 3 minutes, obtains the supernatant liquor of centrifugation, contains thymus nucleic acid in the supernatant liquor.
Embodiment 4:
1, in 200 μ l lysis buffers being joined in the thalline that 800 μ l bacterium liquid collect, and the vortex mixing, the first muddy liquid obtained;
2, adding mass volume ratio concentration in the above-mentioned first muddy liquid is the Proteinase K of 20mg/ml, and the volume of adding is 10 μ l, and mixing was hatched 10 minutes under 55 ℃, and 85 ℃ of heating 5 minutes obtain the second muddy liquid;
3, the above-mentioned second muddy liquid is carried out centrifugation, centrifugal rotational speed is 13000 rev/mins, and centrifugation time is 3 minutes, obtains the supernatant liquor of centrifugation, contains thymus nucleic acid in the supernatant liquor.
Embodiment 5:
1,200 μ l lysis buffers are joined in the 10mg mouse tissue, material is ground, and the vortex mixing, the first muddy liquid obtained;
2, adding mass volume ratio concentration in the above-mentioned first muddy liquid is the Proteinase K of 20mg/ml, and the volume of adding is 10 μ l, and mixing was hatched 30 minutes under 55 ℃, and 85 ℃ of heating 5 minutes obtain the second muddy liquid;
3, the above-mentioned second muddy liquid is carried out centrifugation, centrifugal rotational speed is 13000 rev/mins, and centrifugation time is 3 minutes, obtains the supernatant liquor of centrifugation, contains thymus nucleic acid in the supernatant liquor.
Below be the example that the DNA that extracts with the inventive method is detected:
Detect example 1: the DNA that embodiment 1 is obtained detects:
With the DNA that obtains among the embodiment 1 is template, Arabidopis thaliana UBQ gene specific primer UBQ1-F 5 ' CAGGACAAAGAGGGAATACC 3 ', R 5 ' GTTGAACAGGAGGGATACC 3 ', UBQ2-F 5 ' ATGTTTTTCGATGGATACCA 3 ', R 5 ' GATTGCGTTAGCAGGCTTTG 3 ', UBQ3-F 5 ' ATGTTTTTCGATGGATACCA 3 ', R 5 ' TCAACCCCTCAATGAATAC 3 ' carries out 258bp fragment, 1160bp fragment and the segmental pcr amplification of 1610bp, and the PCR reaction is:
2x?PCR?Reagent 10μl
Forward primer (every liter of 10 micromole are called for short μ M) 0.5 μ l
Reverse primer (every liter of 10 micromole are called for short μ M) 0.5 μ l
Aqua sterilisa is mended to 20 μ l
After reagent all adds well, instantaneous centrifugal, all reagent are collected the pipe end.
The setting of PCR reaction cycle:
94 ℃ of 3min, 1 circulation
94 ℃ 30 seconds (second is hereinafter to be referred as sec), 55 ℃ of 30sec, 72 ℃ of 1min 35 circulations;
72 ℃ of 5min, 1 circulation
The result detects: reaction is got 8 μ l reaction product after finishing, and agarose gel electrophoresis detects.Deposition condition is: with the sepharose of 0.5 * TBE electrophoretic buffer preparation 2% (W/V), it is the bromination second pyridine of 0.5/ml that gel melts back adding content.With PCR reaction product and the sample-loading buffer uniform mixing of 8 μ l, join then in the gel pore in proportion, carry out electrophoresis with the voltage of 5V/cm, electrophoresis time is 40-60 minute.After electrophoresis finishes gel placed and observe on the gel imaging instrument and take a picture.
The results are shown in Figure 1: point sample is in proper order: 1.DNA marker; 2,3.258bp fragment; 4,5.1160bp fragment; 6,7.1610bp fragment.As seen from Figure 1, adopt the Arabidopsis leaf DNA of the inventive method extraction, carry out the pcr amplification of special primer, the amplified fragments that obtains is consistent with the amplified fragments of expection size, so can satisfy the requirement of gene test fully with the DNA of present method extraction.
Detect example 2: the DNA that embodiment 2 is obtained detects:
With the DNA that obtains among the embodiment 2 is template, soybean lectin gene specific primer lectin-F:5 ' GCCCTCTACTCCACCCCCATCC 3 ', R:5 ' GCCCATCTGCAAGCCTTTTTGTG 3 ', lectin-F5 ' ATGGCCACCTCCAACTTCTCTA 3 ', R 5 ' AGTTCACGTCAATGCCGAT 3 ', carry out the segmental pcr amplification of 118bp fragment and 600bp, the PCR reaction is:
2x?PCR?Reagent 10μl
Forward primer (10 μ M) 0.5 μ l
Reverse primer (10 μ M) 0.5 μ l
Aqua sterilisa is mended to 20 μ l
After reagent all adds well, instantaneous centrifugal, all reagent are collected the pipe end.
The setting of PCR reaction cycle:
94 ℃ of 3min, 1 circulation
94 ℃ 30 seconds (second is hereinafter to be referred as sec), 55 ℃ of 30sec, 72 ℃ of 1min 35 circulations;
72 ℃ of 5min, 1 circulation
The result detects: reaction is got 8 μ l reaction product after finishing, and agarose gel electrophoresis detects.Deposition condition is: with the sepharose of 0.5 * TBE electrophoretic buffer preparation 2% (W/V), it is the bromination second pyridine of 0.5/ml that gel melts back adding content.With PCR reaction product and the sample-loading buffer uniform mixing of 8 μ l, join then in the gel pore in proportion, carry out electrophoresis with the voltage of 5V/cm, electrophoresis time is 40-60 minute.After electrophoresis finishes gel placed and observe on the gel imaging instrument and take a picture.
The results are shown in Figure 2, point sample is in proper order: 1.DNA Marker; 2,3.118bp fragment; 4. positive control; 5,6.600bp fragment; 7. positive control.As seen from Figure 2, adopt the soybean leaves DNA of the inventive method extraction, carry out the pcr amplification of special primer, the amplified fragments that obtains is consistent with the amplified fragments of positive control size, so can satisfy the requirement of gene test fully with the DNA of present method extraction.
Detect example 3: the DNA that embodiment 3 is obtained detects: with the DNA that obtains among the embodiment 3 is template, paddy rice native gene primers F 5 ' CGATGTCAAGCGTTACTCTA 3 ', R 5 ' AGGTGGTGGTGGCTCAATAT 3 ' and F 5 ' CGATGTCAAGCGTTACTCTA 3 ', R 5 ' CAGACATTATCAGCTGGTAC 3 ', carry out the segmental pcr amplification of 272bp fragment and 694bp, the PCR reaction is:
2x?PCR?Reagent 10μl
Forward primer (10 μ M) 0.5 μ l
Reverse primer (10 μ M) 0.5 μ l
Aqua sterilisa is mended to 20 μ l
After reagent all adds well, instantaneous centrifugal, all reagent are collected the pipe end.
The setting of PCR reaction cycle:
94 ℃ of 3min, 1 circulation
94 ℃ 30 seconds (second is hereinafter to be referred as sec), 55 ℃ of 30sec, 72 ℃ of 1min 35 circulations;
72 ℃ of 5min, 1 circulation
The result detects: reaction is got 8 μ l reaction product after finishing, and agarose gel electrophoresis detects.Deposition condition is: with the sepharose of 0.5 * TBE electrophoretic buffer preparation 2% (W/V), it is the bromination second pyridine of 0.5/ml that gel melts back adding content.With PCR reaction product and the sample-loading buffer uniform mixing of 8 μ l, join then in the gel pore in proportion, carry out electrophoresis with the voltage of 5V/cm, electrophoresis time is 40-60 minute.After electrophoresis finishes gel placed and observe on the gel imaging instrument and take a picture.
The results are shown in Figure 3, point sample is in proper order: 1.DNA Marker; 2,3. leaf DNA 272bp fragment; 4,5. rice DNA272bp fragment; 6. positive control; 7,8. leaf DNA 694bp fragment; 9,10. rice DNA694bp fragment; 11. positive control.As seen from Figure 3, adopt the rice leaf DNA of the inventive method extraction, carry out the pcr amplification of special primer, the amplified fragments that obtains is consistent with the amplified fragments of positive control size, so can satisfy the requirement of gene test fully with the DNA of present method extraction.
Detect example 4: the DNA that embodiment 4 is obtained detects:
With the DNA that obtains among the embodiment 4 is template, bacterium universal primer 16srDNA-F 5 ' TAGCTGGTCTGAGAGGATGA 3 ', and R 5 ' CTTGCCAGTATCAGATGCAGT ' 3 carries out the segmental pcr amplification of 297bp, and the PCR reaction is:
2x?PCR?Reagent 10μl
Forward primer (every liter of 10 micromole are called for short μ M) 0.5 μ l
Reverse primer (every liter of 10 micromole are called for short μ M) 0.5 μ l
Aqua sterilisa is mended to 20 μ l
After reagent all adds well, instantaneous centrifugal, all reagent are collected the pipe end.
The setting of PCR reaction cycle:
94 ℃ of 3min, 1 circulation
94 ℃ 30 seconds (second is hereinafter to be referred as sec), 55 ℃ of 30sec, 72 ℃ of 1min 35 circulations;
72 ℃ of 5min, 1 circulation
The result detects: reaction is got 8 μ l reaction product after finishing, and agarose gel electrophoresis detects.Deposition condition is: with the sepharose of 0.5 * TBE electrophoretic buffer preparation 2% (W/V), it is the bromination second pyridine of 0.5/ml that gel melts back adding content.With PCR reaction product and the sample-loading buffer uniform mixing of 8 μ l, join then in the gel pore in proportion, carry out electrophoresis with the voltage of 5V/cm, electrophoresis time is 40-60 minute.After electrophoresis finishes gel placed and observe on the gel imaging instrument and take a picture.
The results are shown in Figure 4, point sample is in proper order: 1.DNA Marker; 2-5. negative bacterium DNA cloning; 6-9. positive bacteria DNA cloning.As seen from Figure 4, adopt the DNA of bacteria of the inventive method extraction, carry out the pcr amplification of special primer, the amplified fragments that obtains is consistent with the amplified fragments of expection size, so can satisfy the requirement of gene test fully with the DNA of present method extraction.
Detect example 5: the DNA that embodiment 5 is obtained detects: with the DNA that obtains among the embodiment 5 is template, mouse MILGFMAR2 gene specific primer MILGFMAR2-F5 ' ATCCTCCTTCTATAGTCTGTCCAAGAGTAG3 ', R5 ' CCTCCAGAAAAAGCTAGATACTAACCTT 3 ' carries out the segmental pcr amplification of 332bp, and the PCR reaction is:
2x?PCR?Reagent 10μl
Forward primer (every liter of 10 micromole are called for short μ M) 0.5 μ l
Reverse primer (every liter of 10 micromole are called for short μ M) 0.5 μ l
Aqua sterilisa is mended to 20 μ l
After reagent all adds well, instantaneous centrifugal, all reagent are collected the pipe end.
The setting of PCR reaction cycle:
94 ℃ of 3min, 1 circulation
94 ℃ 30 seconds (second is hereinafter to be referred as sec), 55 ℃ of 30sec, 72 ℃ of 1min 35 circulations;
72 ℃ of 5min, 1 circulation
The result detects: reaction is got 8 μ l reaction product after finishing, and agarose gel electrophoresis detects.Deposition condition is: with the sepharose of 0.5 * TBE electrophoretic buffer preparation 2% (W/V), it is the bromination second pyridine of 0.5/ml that gel melts back adding content.With PCR reaction product and the sample-loading buffer uniform mixing of 8 μ l, join then in the gel pore in proportion, carry out electrophoresis with the voltage of 5V/cm, electrophoresis time is 40-60 minute.After electrophoresis finishes gel placed and observe on the gel imaging instrument and take a picture.
The results are shown in Figure 5, point sample is in proper order: 1.DNA Marker; 2. negative control; 3. positive control; 4,5. mouse liver DNA cloning; 6,7. mouse heart DNA cloning.As seen from Figure 5, adopt the mouse tissue DNA of the inventive method extraction, carry out the pcr amplification of special primer, the amplified fragments that obtains is consistent with the amplified fragments of positive control size, and negative control there is no amplification, so can satisfy the requirement of gene test fully with the DNA of present method extraction.
Claims (2)
1. method of extracting genomic deoxyribonucleic acid is characterized in that this method may further comprise the steps:
(1-1) lysis buffer is joined in any material in plant tissue, animal tissues or the bacterium, material is ground, and vortex mixing, obtain the first muddy liquid, the mass volume ratio of adding is: any in vegetable material, animal material or the bacterium: lysis buffer=10 milligram: 200 microlitres;
(1-2) adding mass volume ratio concentration in the above-mentioned first muddy liquid is the Proteinase K of 10-20 mg/ml, and the volume of adding is the 5-20 microlitre, and mixing was hatched 5-30 minute under 55-65 ℃, and 80-95 ℃ of heating 3-10 minute obtains the second muddy liquid;
(1-3) the above-mentioned second muddy liquid is carried out centrifugation, centrifugal rotational speed is 8000-13000 rev/min, and centrifugation time is 3-5 minute, obtains the supernatant liquor of centrifugation, contains thymus nucleic acid in the supernatant liquor.
2. the method for claim 1, it is characterized in that consisting of of wherein said lysis buffer: the pH value is 8.0, volumetric molar concentration is the 20-50 mmole/liter Tutofusin tris. hydrochloric acid, volumetric molar concentration be the 2.0-4.0 mmole/liter ethylenediamine tetraacetic acid (EDTA) and volumetric molar concentration be the 20-50 mmole/liter sodium-chlor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101298185A CN101792756B (en) | 2010-03-19 | 2010-03-19 | Method for extracting genomic deoxyribonucleic acid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101298185A CN101792756B (en) | 2010-03-19 | 2010-03-19 | Method for extracting genomic deoxyribonucleic acid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101792756A true CN101792756A (en) | 2010-08-04 |
| CN101792756B CN101792756B (en) | 2012-01-04 |
Family
ID=42585669
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101298185A Active CN101792756B (en) | 2010-03-19 | 2010-03-19 | Method for extracting genomic deoxyribonucleic acid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101792756B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102033010A (en) * | 2010-11-26 | 2011-04-27 | 四川农业大学 | Double marking method for gel sample application sequence and gelation sequence in vertical plate electrophoresis |
| CN102586231A (en) * | 2012-03-07 | 2012-07-18 | 天根生化科技（北京）有限公司 | Rapid large-segment genome desoxyribonucleic acid extraction method |
| CN112094840A (en) * | 2019-06-17 | 2020-12-18 | 南京尧顺禹生物科技有限公司 | Rapid preparation method of trace animal sample genome DNA template for genome segment amplification |
| CN113151255A (en) * | 2021-05-26 | 2021-07-23 | 中国科学院植物研究所 | Method for rapidly extracting plant leaf genome DNA |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101173274A (en) * | 2006-10-30 | 2008-05-07 | 张伟 | Bacterium and blood genome DNA extracting reagent kit |
| CN101343631A (en) * | 2007-07-13 | 2009-01-14 | 中国科学院海洋研究所 | Jellyfish genome DNA extracting method |
-
2010
- 2010-03-19 CN CN2010101298185A patent/CN101792756B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101173274A (en) * | 2006-10-30 | 2008-05-07 | 张伟 | Bacterium and blood genome DNA extracting reagent kit |
| CN101343631A (en) * | 2007-07-13 | 2009-01-14 | 中国科学院海洋研究所 | Jellyfish genome DNA extracting method |
Non-Patent Citations (1)
| Title |
|---|
| 《安徽农业科学》 20081231 孙伟生等 蛋黄果基因组DNA提取方法的研究 157-158 1-2 第36卷, 第1期 2 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102033010A (en) * | 2010-11-26 | 2011-04-27 | 四川农业大学 | Double marking method for gel sample application sequence and gelation sequence in vertical plate electrophoresis |
| CN102586231A (en) * | 2012-03-07 | 2012-07-18 | 天根生化科技（北京）有限公司 | Rapid large-segment genome desoxyribonucleic acid extraction method |
| CN102586231B (en) * | 2012-03-07 | 2013-12-18 | 天根生化科技（北京）有限公司 | Rapid large-segment genome desoxyribonucleic acid extraction method |
| CN112094840A (en) * | 2019-06-17 | 2020-12-18 | 南京尧顺禹生物科技有限公司 | Rapid preparation method of trace animal sample genome DNA template for genome segment amplification |
| CN113151255A (en) * | 2021-05-26 | 2021-07-23 | 中国科学院植物研究所 | Method for rapidly extracting plant leaf genome DNA |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101792756B (en) | 2012-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105420412B (en) | Pig Delta coronavirus and Porcine epidemic diarrhea virus multiple RT-PCR detection primer and detection method | |
| CN111254223A (en) | Reaction system and kit for detecting African swine fever virus nucleic acid and application of reaction system and kit | |
| CN101775440A (en) | Plasmid control molecule for detection of transgenic soybean and building method thereof | |
| CN101792756B (en) | Method for extracting genomic deoxyribonucleic acid | |
| CN110567951A (en) | Apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof | |
| CN102634593A (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize EVENT98140 and derived varieties thereof | |
| CN103243179A (en) | Shell-type PCR (polymerase chain reaction) amplification primer of porcine epidemic diarrhea virus and application thereof | |
| CN107119048B (en) | Pseudocercospora mori rDNA and application thereof in molecular detection of pseudocercospora mori | |
| CN111534603B (en) | Method for identifying aedes albopictus by using fluorescent RPA | |
| CN101020902B (en) | Flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application | |
| CN101864489B (en) | Method for gathering foreign DNA in transgenosis product | |
| CN104830984A (en) | Fluorescence PCR detection method of Colletetrichum orbicalare, and primers and probes used for method | |
| CN109097454B (en) | Detection method for residual quantity of HEK293gDNA | |
| CN101016554B (en) | Transgene rape Rf3 event exogenesis insertion carrier side sequence and application thereof | |
| CN107236812A (en) | Detection kit, detection method and application for bacillus cereus | |
| CN104404173B (en) | A kind of NASBA method for detecting tomato spotted wilf virus | |
| CN102796826A (en) | Kit capable of quickly detecting real properties of leather and detecting method of kit | |
| CN101792814B (en) | PCR method for detecting specificity of transformant of transgenic pest-resistant cotton GK12 | |
| CN104561270B (en) | The molecular biology differentiating method of two kinds of rice leaf folder larvas | |
| CN100529089C (en) | Flanking sequence of exogenous event inserting vector for transgenic rape Topas-19/2 and its application | |
| CN110734998B (en) | Primers, method and kit for identifying NFC orange juice and FC orange juice | |
| CN101020903B (en) | Left boundary flanking sequence of exogenous event inserting vector for transgenic rape Oxy-235 and its application | |
| CN116814848B (en) | Primer, probe and method for detecting mouse parvovirus based on fluorescence RAA | |
| CN109628632A (en) | A kind of primer combination, probe, kit and method for transgenic corns MON87419 event-specific detection | |
| CN102912039B (en) | RT-HDA (Reverse Transcription-Helicase-Dependent Isothermal Amplification) kit and primer for detecting foot-and-mouth disease virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |