CN103243179A - Shell-type PCR (polymerase chain reaction) amplification primer of porcine epidemic diarrhea virus and application thereof - Google Patents

Abstract

The invention discloses a shell-type PCR (polymerase chain reaction) amplification primer of a porcine epidemic diarrhea virus and an application thereof, and belongs to the technical fields of animal virology and molecular biology. According to the shell-type PCR amplification primer of the porcine epidemic diarrhea virus disclosed by the invention, a nucleotide sequence is shown in SEQ ID NO:1-4. The primer can be used for preparing a kit for detecting the porcine epidemic diarrhea virus. Not only can classical PEDV (porcine epidemic diarrhea virus) be detected, but also a novel variant strain can be detected; the detection sensitivity is high; the shell-type PCR amplification primer can conveniently and rapidly detect samples such as clinical waste and intestinal contents; formulation of targeted prevention and control measures is facilitated; and the shell-type PCR amplification primer has a great effect on improvement of the PEDV prevention and control effect, and guarantee of stable pig-raising production.

Description

Sleeve type PCR amplimer and the application thereof of Porcine epidemic diarrhea virus

Technical field

The present invention relates to animal virology and technical field of molecular biology, be specifically related to sleeve type PCR amplimer and the application thereof of a kind of Porcine epidemic diarrhea virus.

Background technology

Porcine epizootic diarrhea (Porcine epidemic diarrhea, PED) be by Porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus, PEDV) a kind of acute contact infectious intestinal disease that causes, principal character is diarrhoea, vomiting, dehydration and high mortality (Pensaert et al., A new coronavirus-like particle associated with diarrhea in swine. Arch Virol. 1978,58 (3): 243～247.; Ducatelle et al., Pathology of experimental CV777 coronavirus enteritis in piglets. I. Histological and histochemical study. Vet Pathol. 1982,19 (1): 46～56.).PEDV is a member of coronavirus genus, the susceptible of weanling pig not, and the lethality rate of this section age in days swinery can reach 95%.

PEDV belongs to coronavirus genus I group, is RNA virus, and genome is sub-thread normal chain, non-segmented negative.Genome comprises 6 open reading frame (ORF), from 5 ' be followed successively by ORF1(20346 nt to 3 ' order); S gene (4152 nt); ORF3 gene (675 nt); E gene (231 nt); M gene (681 nt) and N gene (1326 nt) (Kocherhans et al., Completion of the porcine epidemic diarrhoea coronavirus (PEDV) genome sequence[J] .Virus Genes. 2001,23 (2): 137～144.; Brian et al., Coronavirus genome structure and replication. Curr Top Microbiol Immunol. 2005,287:1 ~ 30.).

Since 2010, a large-scale PEDV is popular in the China's Mainland generation, has caused tremendous loss to pig industry.There is document that this popular PEDV strain and gene thereof have been carried out careful analysis (Pan Y et al., Isolation and characterization of a variant porcine epidemic diarrhea virus in China[J]. Virol J. 2012, Sep 12; 9:195.), found comparing the S gene with classical strains in the early time some different gene expression characteristicses being arranged of variation strain.

Differentiate the quick method of distinguishing but also not having at present to make a variation with classical Porcine epidemic diarrhea virus.

Summary of the invention

The objective of the invention is at the problems referred to above of the prior art, by the analysis to Porcine epidemic diarrhea virus S gene, design two pairs of primers, and set up the sleeve type PCR method, can differentiate differentiation efficiently to variation and classical Porcine epidemic diarrhea virus.

The present invention is achieved through the following technical solutions above-mentioned purpose:

The invention provides the sleeve type PCR amplimer of Porcine epidemic diarrhea virus, nucleotide sequence is as follows:

F1：CACTTAGCCTACCACAAGATGTCA（SEQ ID NO:1），

R1：TCATTATCCCATGTTATGCCGA（SEQ ID NO:2）；

F2：GGTGAAAACCAGGGTGTCAA（SEQ ID NO:3），

R2：TCGCGCAGTAGCATTAGTGTTA（SEQ ID NO:4）。

The Porcine epidemic diarrhea virus genome sequence that lands according to NCBI, the accession number: (JN825712 of variation strain, JX088695, JX188454, JX489155, JX261936, JX112709, JX524137, JQ282909) and classical strains (AF353511, EF185992, Z25483, JQ023161, the information that JN547228) provides, through compare of analysis, design the primer of above sleeve type PCR, used above-mentioned primer to carry out the sleeve type PCR amplification, can differentiate classical strain and variant by electrophoresis, save the step of order-checking, saved time and cost.

Extract the RNA in the detected sample, after reverse transcription, use primers F 1 and R1 to carry out first round PCR earlier, product stays a part to carry out agarose gel electrophoresis, another part continues as template, be that primer carries out second and takes turns PCR with F2 and R2, amplified production is observed band behind agarose gel electrophoresis, if first round PCR product only has the band of 458 bp, second takes turns and does not have, and then shows and contains classical PEDV in the sample to be checked; If first round PCR product only has the band of a 467bp, second takes turns the band that a 201bp is only arranged, and then shows the PEDV that contains variation in the sample to be checked; If two-wheeled PCR product does not all have band, show not contain PEDV in the sample to be checked.

The present invention also provides the application of sleeve type PCR amplimer in the reagent of the preparation classical Porcine epidemic diarrhea virus of detection and/or novel Porcine epidemic diarrhea virus of above-mentioned Porcine epidemic diarrhea virus.

The present invention also provides a kind of test kit that detects Porcine epidemic diarrhea virus, it is characterized in that, comprises following component:

(1) reverse transcription part:

RT premixed liquid 1: random primer and dNTP mix;

2:5 times of reverse transcription damping fluid of RT premixed liquid, the RNA enzyme inhibitors, ThermoScript II does not contain the distilled water of RNA enzyme;

(2) PCR part:

Overcoat PCR premixed liquid: archaeal dna polymerase, primers F 1 and R1, aseptic double-distilled water;

Interior cover PCR premixed liquid: archaeal dna polymerase, primers F 2 and R2, aseptic double-distilled water.

Compared with prior art, the present invention has following beneficial effect:

The invention provides the amplimer of a combined type PCR, this primer specificity and sensitivity are all higher, and can detect the PEDV of variation, can detect, differentiate various clinical samples, thereby can distinguish popular PEDV strain efficiently, simple to operate, practical.

Description of drawings

Fig. 1: sample detection electrophorogram, swimming lane 1,2,3,4,5 are respectively the classical strain cell culture fluid of PEDV, PEDV variant cell culture fluid, enteron aisle pathological material of disease, ight soil pathological material of disease, DMEM.

Fig. 2: the PCR specificity check electrophorogram of distinguishing variation and classical Porcine epidemic diarrhea virus, A is first round pcr amplification product electrophoresis result, B second takes turns the pcr amplification product electrophoresis result, swimming lane 1 is the PEDV classical strains, swimming lane 2 is PEDV variation strain, and swimming lane 3-8 is respectively transmissible gastro-enteritis virus, porcine rotavirus, pig breeding and disordered breathing syndrome virus, pig circular ring virus, Pestivirus suis, PRV (Pseudorabies virus).

Fig. 3: the PCR method susceptibility check electrophorogram of distinguishing novel and classical Porcine epidemic diarrhea virus, be first round pcr amplification product electrophoresis result shown in the figure, wherein swimming lane 1,2,3,4,5,6,7 represents that respectively cDNA content is 1.58 μ g, 0.158 μ g, 0.0158 μ g, 1.58ng, 0.158ng, 0.0158ng, 1.58pg in the sample to be checked.

Embodiment

Embodiment 1

(1) sample RNA to be checked extracts: 200 μ L cell culture fluids (infect autonomous isolated strain CHGD-01, this strain is through being accredited as the PEDV of variation), 200 μ L cell culture fluids (infect autonomous isolated strain ShQT, this strain is through being accredited as classical PEDV), enteron aisle pathological material of disease and 100mg ight soil (whether pathological material of disease and ight soil the unknown infect virus) and the DMEM(cell culture medium of 100mg, do not contain PEDV) as sample to be checked, carry out following operation respectively:

Add 1mL PBS damping fluid and fully grind ,-20 ℃ of multigelations 3 times, centrifugal 10 min of 8000 rpm, get supernatant liquor 200 μ L, add the 0.2mL chloroform, after at room temperature (15 ℃～30 ℃) place 2～3min behind the concussion mixing 15s, 12000g(2 ℃～8 ℃) centrifugal 15min; Get the upper strata water and place new EP pipe, add the 0.5mL Virahol, at room temperature (15 ℃～30 ℃) place 10min, 12000g(2 ℃～8 ℃) centrifugal 10min; Abandon supernatant, add 1mL 75% ethanol and wash vortex mixed, 7500g(2 ℃～8 ℃) centrifugal 5min, abandon supernatant; Allow and add 20 μ L Rnase-Free H after the RNA seasoning at room temperature of precipitation ₂The O dissolving is the RNA template.The RNA that extracts is put in-80 ℃ of preservations.

(2) RNA of Ti Quing joins in the reverse transcription premix reaction solution and carries out reverse transcription, obtains the cDNA template.

Reverse transcription system and process: the RNA of 8 μ L and 2 μ L RT premixed liquids, 1 mixing, 65 ℃ of reaction 5min place 2min on ice then rapidly.This reaction mixture joins in the RT premixed liquid 2 again, and mixing is placed on the PCR instrument, presses following conditioned response: 30 ℃ of 10min; 42 ℃ of 60min; 70 ℃ of 15min(do not have circulation).

Wherein, RT premixed liquid 1:Ramdom 9 mer(50 μ M) and dNTP mix(10mM) each 1 μ L; RT premixed liquid 2:5 * PrimeScirpt Buffer 4 μ L, Rnase Inhibitor (40U/ μ L) 0.5 μ L, PrimeScript Reverse Transcriptase(200U/ μ L) 1 μ L, Rnase free H ₂O 4.5 μ L are all available from Dalian TaKaRa company.

(3) 2 μ L cDNA templates are joined in the overcoat PCR premixed liquid, prepare 25 μ L reaction systems, and mix.Wherein, overcoat PCR premixed liquid: Premix Taq(comprises DNA Polymerase1.25U/25 μ L; Buffer Tris-HCl, pH8.3 20mM, KCl 100mM, MgCl ₂3mM; Each 0.4mM of dNTP Mixture) 12.5 μ L, F1 and R1(are 20pmol) each 0.5 μ L, aseptic double-distilled water 9.5 μ L are all available from Dalian TaKaRa company.

(4) the PCR pipe of step (3) is placed carry out first round cyclic amplification reaction on the PCR instrument.Amplification condition is: 98 ℃ of pre-sex change 30s; 98 ℃ of 10s then, 55 ℃ of 30s, 72 ℃ of 1min carry out 35 circulations altogether; Last 72 ℃ are extended 10min.

(5) get 2 μ L first round PCR products as template, in the cover PCR premixed liquid, prepare 25 μ L reaction systems in joining, mix.Interior cover PCR premixed liquid: Premix Taq(comprises DNA Polymerase1.25U/25 μ L; Buffer Tris-HCl, pH8.3 20mM, KCl 100mM, MgCl ₂3mM; Each 0.4mM of dNTP Mixture) 12.5 μ L, F2 and R2(are 20pmol) each 0.5 μ L, aseptic double-distilled water 9.5 μ L are all available from Dalian TaKaRa company.

Amplification condition is: 98 ℃ of pre-sex change 30s; 98 ℃ of 10s then, 55 ℃ of 30s, 72 ℃ of 1min carry out 35 circulations altogether; Last 72 ℃ are extended 10min.

(6) two-wheeled PCR respectively gets 5 μ L reaction product at the 1%(mass ratio) sepharose carry out electrophoresis and identify.

(7) result judges: the classical strain of first round PCR product size 458bp() or the 467bp(variant), second takes turns PCR product size 201bp.Two-wheeled PCR product electrophoresis has simultaneously that two product 467 bp and 201bp band occur is the variant epidemic diarrhea virus, and the classical Porcine epidemic diarrhea virus that is that 458 bp bands occur is arranged, no band appearance negative.Detected result is seen Fig. 1 and table 1.

Table 1 sample detection result to be checked

Sample to be checked	Electrophoretic band	The amplification Sequence Identification
			Cell culture fluid (infecting strain CHGD-01)	467bp and 201bp	Variant
Cell culture fluid (infecting strain ShQT)	458bp	Classical strain
			The enteron aisle pathological material of disease	467bp and 201bp	Variant
Ight soil	467bp and 201bp	Variant
			The DMEM cell culture medium	No amplified band	Do not have

The check of embodiment 2 specificitys

With the pathological material of disease of the classical strain (strain ShQT) that has epidemic diarrhea virus, variant (strain CHGD-01) as positive control, the nutrient solution of transmissible gastro-enteritis virus, porcine rotavirus, pig breeding and disordered breathing syndrome virus, pig circular ring virus, Pestivirus suis, PRV (Pseudorabies virus) carries out specific detection, use method and the primer of embodiment 1, the result all fails to expand any band except positive control, positive pathological material of disease expands respectively through two-wheeled PCR and two bands and a band, sees Fig. 2.Its sequence is respectively SEQ ID NO:5(variant first round pcr amplification product), the classical strain first round pcr amplification product of SEQ ID NO:6() and SEQ ID NO:7(variant second take turns pcr amplification product).

Embodiment 3 sensitivity tests

Extract the cDNA that obtains with classical strain among the embodiment 1 (strain ShQT) and make 10 times gradient dilution of the sterilization distilled water, cDNA content is respectively 1.58 μ g, 0.158 μ g, 0.0158 μ g, 1.58ng, 0.158ng, 0.0158ng, 1.58pg as template, each extent of dilution is respectively got 2 μ L as template, detect by embodiment 1 method, observe positive band, calculate its susceptibility with the high dilution that the template used amount of positive expection band occurs, the result shows that minimum detectable activity is 0.16 ng, sees Fig. 3.

SEQUENCE LISTING

＜110〉Guangdong Wen Shi food Group Plc

＜120〉sleeve type PCR amplimer and the application thereof of Porcine epidemic diarrhea virus

<130>

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 24

<212> DNA

＜213〉artificial sequence

<400> 1

cacttagcct accacaagat gtca 24

<210> 2

<211> 22

<212> DNA

＜213〉artificial sequence

<400> 2

tcattatccc atgttatgcc ga 22

<210> 3

<211> 20

<212> DNA

＜213〉artificial sequence

<400> 3

ggtgaaaacc agggtgtcaa 20

<210> 4

<211> 22

<212> DNA

＜213〉artificial sequence

<400> 4

tcgcgcagta gcattagtgt ta 22

<210> 5

<211> 467

<212> DNA

＜213〉artificial sequence

<400> 5

cacttagcct accacaagat gtcaccaggt gctcagctaa cactaatttt aggcggttct 60

tttcaaaatt taatgttcag gcgcctgcag ttgttgtact gggcggttat ctacctattg 120

gtgaaaacca gggtgtcaat tcaacttggt actgtgctgg ccaacatcca actgctagtg 180

gcgttcatgg tatctttctt agccatatta gaggtggtca tggctttgag attggcattt 240

cgcaagagcc ttttgaccct agtggttacc agctttattt acataaggct actaacggta 300

acactaatgc tactgcgcga ctgcgcattt gccagtttcc cagcattaaa acattgggcc 360

ccactgctaa taatgatgtt acaacaggtc gtaactgcct atttaacaaa gccatcccag 420

ctcatatgag tgaacatagt gttgtcggca taacatggga taatgat 467

<210> 6

<211> 458

<212> DNA

＜213〉artificial sequence

<400> 6

cactcagcct accacaagat gtcactaggt gccagtctac tactaacttt aggcggttct 60

tttcaaaatt taatgttcag gcacctgccg tcgtcgtttt gggtggttac ctacctagta 120

tgaactcttc tagctggtac tgtggcacag gcattgaaac tgctagtggc gttcatggta 180

tttttctcag ctacatcgat tctggtcagg gctttgagat tggcatttcg caagagccgt 240

ttgatcctag tggttaccag ctttatttac ataaggccac taatggtaac actaatgcta 300

ttgcacgact gcgcatttgc cagtttcccg ataataaaac attgggccct actgttaatg 360

atgttacaac aggtcgtaac tgcctattca acaaagccat tccagcttat atgcgtgatg 420

gaaaagatat tgttgtcggc ataacatggg ataatgat 458

<210> 7

<211> 201

<212> DNA

＜213〉artificial sequence

<400> 7

ggtgaaaacc agggtgtcaa ttcaacttgg tactgtgctg gccaacatcc aactgctagt 60

ggcgttcatg gtatctttct tagccatatt agaggtggtc atggctttga gattggcatt 120

tcgcaagagc cttttgaccc tagtggttac cagctttatt tacataaggc tactaacggt 180

aacactaatg ctactgcgcg a 201

Claims (3)

1. the sleeve type PCR amplimer of Porcine epidemic diarrhea virus is characterized in that nucleotide sequence is as follows:

F1：CACTTAGCCTACCACAAGATGTCA，

R1：TCATTATCCCATGTTATGCCGA；

F2：GGTGAAAACCAGGGTGTCAA，

R2：TCGCGCAGTAGCATTAGTGTTA。

2. the application of the sleeve type PCR amplimer of the described Porcine epidemic diarrhea virus of claim 1 in the reagent of the preparation classical Porcine epidemic diarrhea virus of detection and/or variation Porcine epidemic diarrhea virus.

3. a test kit that detects Porcine epidemic diarrhea virus is characterized in that, comprises following component:

(1) reverse transcription part:

RT premixed liquid 1: random primer and dNTP mix;

2:5 times of reverse transcription damping fluid of RT premixed liquid, the RNA enzyme inhibitors, ThermoScript II does not contain the distilled water of RNA enzyme;

(2) PCR part:

Overcoat PCR premixed liquid: archaeal dna polymerase, the described primers F 1 of claim 1 and R1, aseptic double-distilled water;

Interior cover PCR premixed liquid: archaeal dna polymerase, the described primers F 2 of claim 1 and R2, aseptic double-distilled water.

Images