CN109652594A - One kind is for detecting the PCR kit for fluorescence quantitative and application thereof of Aleutian Mink Disease Parvovirus (AMDV) - Google Patents

One kind is for detecting the PCR kit for fluorescence quantitative and application thereof of Aleutian Mink Disease Parvovirus (AMDV) Download PDF

Info

Publication number
CN109652594A
CN109652594A CN201910021149.0A CN201910021149A CN109652594A CN 109652594 A CN109652594 A CN 109652594A CN 201910021149 A CN201910021149 A CN 201910021149A CN 109652594 A CN109652594 A CN 109652594A
Authority
CN
China
Prior art keywords
pcr
amdv
primer
copy
kit
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910021149.0A
Other languages
Chinese (zh)
Inventor
胡哲
王晓钧
李俚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Harbin Customs District P R China
Harbin Weike Biotechnology Development Co
Harbin Veterinary Research Institute of CAAS
Original Assignee
Harbin Customs District P R China
Harbin Weike Biotechnology Development Co
Harbin Veterinary Research Institute of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Harbin Customs District P R China, Harbin Weike Biotechnology Development Co, Harbin Veterinary Research Institute of CAAS filed Critical Harbin Customs District P R China
Priority to CN201910021149.0A priority Critical patent/CN109652594A/en
Publication of CN109652594A publication Critical patent/CN109652594A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of for detecting the PCR kit for fluorescence quantitative and application thereof of Aleutian Mink Disease Parvovirus (AMDV).Contain quantitative fluorescent PCR reaction reagent and primer in the kit, wherein, contain EvaGreen dyestuff in the quantitative fluorescent PCR reaction reagent, the primer is made of upstream primer and downstream primer, the nucleotide sequence of upstream primer is as shown in SEQ ID NO.1, and the nucleotide sequence of downstream primer is as shown in SEQ ID NO.2.Experiments have shown that detecting AMDV using kit of the invention, specificity is high, reproducible, and DNA detection limitation is 1 copy/μ L or 3pg/ μ L, and can identify and infect product from domestic and international whole AMDV.It is found in the detection application to 45 parts of clinical blood samples, the AMDV recall rate of EG PCR method of the present invention is 91.11%, higher than existing TaqMan method and the AMDV recall rate of conventional PCR method.Therefore, proposition of the invention provides a kind of quick, sensitive pathogeny detection method for the detection of Aleutian Mink Disease Parvovirus (AMDV).

Description

One kind is for detecting the PCR kit for fluorescence quantitative of Aleutian Mink Disease Parvovirus (AMDV) And application thereof
Technical field
The present invention relates to a kind of virus detection kits and application thereof, in particular to a kind of for detecting Aleutian disease The PCR kit for fluorescence quantitative and application thereof of malicious (AMDV).The invention belongs to field of biotechnology.
Background technique
Aleutian disease (Aleutian Disease of Mink, AMD) is also known as plasmacytosis It (Plasmacytosis), is that three classes animal epidemic in Ministry of Agriculture's animal epidemic disease list, China-Denmark mink that enters the territory are agreed The disease project that must quarantine in book, the disease are caused by Aleutian Mink Disease Parvovirus (Aleutian Mink Disease Virus, AMDV) , it can infect the mink of any age bracket, and illness shows the form of expression of multiplicity.To the new life for suffering from acute pneumonia For young ermine, aleutian disease virus can almost lead to its 100% death rate；And to adult mink, which usually causes mink Persistent infection, and it is scorching and induced by virus-antibody complexes to show as lifelong viremia virusemia, hyperproteinemia, arteries Glomerulonephritis and hepatitis etc..Aleutian disease virus is sub-thread linear DNA, and Parvoviridae is belonged in classification (Parvoviridae), parvovirus subfamily (Parvovirinae) ranks the first in aleutian disease virus category (Amdovirus) Member, i.e. Aleutian Mink Disease Parvovirus (Carnivore amdoparvovirus 1).The whole gene group of Aleutian Mink Disease Parvovirus Overall length is about 4.8kb, is made of two open reading frame (ORF).The L-ORF in left side encodes non-structural protein (NS), and participates in Nucleic acid replication and the adjusting that structural proteins are synthesized；The R-ORF coding structure albumen (VP) on right side, i.e. capsid protein, it is the same as disease Malicious is pathogenic and related to host's selection.Epidemiological study shows that different AMDV strains is presented in NS and VP gene The changeability of higher level out.
Due to the method that AMD is not treated, can also be prevented without vaccine.The control of the disease is mainly taken " really Examine-reject " method.Domestic mink farming enterprise uses the Serologic detection side mentioned in " middle pellet agreement " substantially at present Method --- counter immunoelectrophoresis (CIEP) detects aleutian disease, however this method only can be dynamic to the infection for generating antibody Object is detected, and can not but find that early infection does not generate enough antibody levels or carries the mink that virus is not fallen ill in time.To the greatest extent Managing such mink is negative on Serologic detection, but still toxin expelling and can infect other susceptible minks outward, can not be from root Aleutian disease viral disease is cut off in sheet to propagate.And in this case, if AMDV will be easier quilt with pathogen detection method It identifies.
The main molecules detection method applied in world wide at present is Standard PCR.1996, Oie et al. was being studied During AMDV is broadcast to mink by racoon, pair of primers is devised according to VP2 gene.Henceforth, at home and abroad very Use this to primer in the detection research of more AMDV.Jensen et al. is for one section of 374bp piece on AMDV NS1 gene Section establishes PCR method, and between 2008~2010 years, has carried out the difference of testing result to mink tissue sample with CIEP method The opposite sex relatively, as a result confirms that CIEP method has the possibility of " false negative ".Domestic scholars are permitted autumn et al. for AMDV-NS1 base The viral nucleic acid content of 2.53ng/ μ L is able to detect that because the PCR method of foundation is minimum.Shao Xiqun utilizes CIEP and PCR method Detection comparison is carried out to the popularity of the AMD of the ermine of natural infection 2 years, discovery infects early stage in mink and do not generate antibody AMDV carrier in, CIEP is easy to make result to generate false negative, and then explains and utilize CIEP method to eradicate AMDV plan to lose The reason of losing.In addition, colloid gold particle is added to the nano PCR detection method that AMDV is established in PCR system by Yang Ruimei etc., This method can detect AMDV in the low fecaluria sample of toxic amount.
However so far, the fluorescence quantitative PCR detection of few research concern AMD.Up to now, the pass of external report In there are two types of the AMDV fluorescent quantitation methods for detection.One is Bowman in 2014 et al. in the otter to Ontario area When the case where infecting AMDV is detected, the quantitative fluorescent PCR system based on SYBRGreen dyestuff is used, but what is used draws Object is the fragment length for designing a kind of quantitative fluorescent PCR system based on SYBRGreen dyestuff in 1996 by Oie, and expanding About 500bp.Another kind is Prieto et al. when investigating the distribution situation of AMDV in the environment, has been used based on NS gene The quantitative fluorescent PCR of commercialization TaqMan probe, however the information of the primer and probe sequence of the fluorescent quantitative PCR gene Do not provide.Domestic aspect, Chinese scholar Zhang Xiuli establish the quantitative fluorescent PCR side of dye method with SYBR Green I dyestuff Method；Subsequent , Jia Yun establishes TaqMan quantitative fluorescent PCR for AMD-VP2 gene according to MGB probe.Both fluorescence The sensibility of quantifying PCR method is detected and is each about 10 copies/μ L.
Quantitative fluorescent PCR is compared with Standard PCR has very high sensibility, and can be to PCR product real-time quantitative. EvaGreen dyestuff (EG) in sensibility and is not influenced aspect by PCR mortifier and is far superior in addition to price relatively economical SYBRGreen, and compared with TaqMan probe quantitative fluorescent PCR, it can reduce sample DNA sequence and may produce in probe location Raw mispairing, to reduce the generation of false negative.
The present invention is EvaGreen dyestuff applying in AMDV fluorescent quantitative PCR detection method for the first time.Verified The sensibility and specificity that established method (EG PCR) has height is invented, can be used as quickly detection mink AMDV and diagnosis The reliable method of mink disease.In addition, the report in relation to AMDV quantitative fluorescent PCR is used to local AMD prevalence both at home and abroad at present The investigation of situation is not mentioned because AMDV gene in different regions is there may be difference, so as to cause positive mink leakage occurs The possibility of inspection.And the present invention is compared by the experimental data to different AMDV strains, further demonstrating EG PCR has AMDV Wider adaptability, can not only detect the U.S. strain AMDV, it is the same for the AMDV of China's most area can Detection obtains.Thus EG PCR is more suitable for the detection and prevention and control of AMDV in world wide.
Summary of the invention
The object of the present invention is to provide one kind for detecting Aleutian Mink Disease Parvovirus (Aleutian Mink Disease Virus, AMDV) PCR kit for fluorescence quantitative and application thereof.
In order to achieve the above object, present invention employs following technological means:
The present invention is a kind of for detecting Aleutian Mink Disease Parvovirus (Aleutian Mink Disease Virus, AMDV) PCR kit for fluorescence quantitative, quantitative fluorescent PCR reaction reagent and primer are contained in the kit, wherein described Contain EvaGreen dyestuff in quantitative fluorescent PCR reaction reagent, the primer is made of upstream primer and downstream primer, upstream The nucleotide sequence of primer is as shown in SEQ ID NO.1, and the nucleotide sequence of downstream primer is as shown in SEQ ID NO.2.
Wherein, it is preferred that the quantitative fluorescent PCR reaction reagent is 2 × SsoFastTMEvaGreenSupermix。
Wherein, it is preferred that the reaction system of quantitative fluorescent PCR is 20 μ L, wherein comprising 1 μ L of DNA profiling, 2 × SsoFastTMEvaGreenSupermix 10 μ L, each 0.5 μ L of 10 μM of upstream and downstream primers；Response procedures are as follows: 95 DEG C of initial denaturations 3min；95 DEG C of denaturation 25s, 58 DEG C of annealing 30s, 72 DEG C of extension 20s, 40 recycle；The analysis of solubility curve are as follows: 95 DEG C, 15s； 60 DEG C, 20s and 95 DEG C, 15s.
Further, the invention also provides the PCR kit for fluorescence quantitative detects Aleutian disease in preparation Purposes in poison.
Wherein, it is preferred that the Aleutian Mink Disease Parvovirus is present in blood and tissue sample.
Compared to the prior art, the beneficial effects of the present invention are:
The present invention establishes the EvaGreen fluorescence quantifying PCR method (EG PCR) and its reagent for capableing of quantitative detection AMDV Box.Experiment shows that EG PCR method is special to AMDV, there is good repeatability, and the CV value for organizing interior Tm is 0%, Tm between group CV value is respectively less than 0.15%；DNA detection limitation is 1 copy or 3pg/ μ L.
In addition, either detecting to Chinese strain AMDV-HLJ and U.S. strain P-ADV-G, EG PCR is not found There are the generations of false negative result.Distinguish with two kinds of fluorescence quantifying PCR methods of EG PCR and existing TaqMan kit Discovery when testing to Chinese strain AMDV-HLJ and U.S. strain P-ADV-G, using EG PCR, result is expanded Increase production object；And be only capable of detecting the P-ADV-G of U.S.'s strain using existing TaqMan kit, and AMDV-HLJ is failed to generate Amplification.And for P-ADV-G, the sensibility (detection limitation=10 copies/μ L) of EG PCR is significantly larger than existing The sensibility (detection limitation=100 copies/μ L) of TaqMan detection kit.Conclusions show existing TaqMan PCR simultaneously Not applicable Strain of the detection from China, and in contrast, the EG PCR that the present invention establishes is more suitable for detection from the country Outer AMDV.
In the result detected using TaqMan PCR, in addition to the CT value of positive control is shown as 26.56, remaining inspection Sample result is illustrated as feminine gender.In order to know that these TaqMan PCR testing results are negative and EG PCR testing result is in It whether there is AMDV in positive sample, on the one hand We conducted the sequencings of EG pcr amplification product；On the other hand we are sharp The quantitative fluorescent PCR test of a new EvaGreen dye method has been carried out with the primer in TaqMan kit, and has been named as TaqMan/EG PCR.EG PCR positive amplification product sequencing result confirms strictly AMDV after BLAST；41 EG PCR inspections Survey result and be that positive sample is detected through TaqMan/EG PCR, the results show that wherein 39 be positive and have the molten of specificity Solution curve generates, and the result of other two sample still shows feminine gender.This shows in experiment before this, in TaqMan kit Probe fail with these CHINA virus formed base pairing, to fail to amplified reaction.In addition, by TaqMan/ EG pcr amplification product sequence alignment finds that there is the base mutations at a large amount of short intervals in these sequences, this is further confirmed Above inference.It is negative reason as two samples in TaqMan/EG PCR testing result, it is likely to due to Caused by the amplification efficiency of TaqMan PCR primer is low.In contrast, same by the positive amplification Product Sequence of EG PCR In GenBank part AMDV reference sequences comparison as can be seen that the primer portion at its Product Sequence both ends there is only very Few base mutation, and there is no mutation, thus the amplification to AMDV gene in first three base of 3 ' end critical sites The influence of efficiency is smaller.
In clinical sample detection process, it has been found that in the testing result of 45 samples, having 41 samples is EG PCR It is positive；39 are the Standard PCR positives.The positive findings of Standard PCR are less than the reason of EG PCR positive findings, in addition to EvaGreen Other than dyestuff is smaller on the influence of PCR mortifier, it is also possible to have certain limitation related with PCR method itself --- work as design Primer and probe do not have universality, it is more likely that lead to the hyposensitivity and false negative result of this method.
The present invention is EvaGreen dyestuff applying in AMDV fluorescent quantitative PCR detection method for the first time.EG PCR warp It confirms the sensibility and specificity with height, can be used as quickly detection mink AMDV and diagnoses the reliable method of mink disease. In addition, the current report in relation to AMDV quantitative fluorescent PCR both at home and abroad is used to the investigation of local AMD popularity, do not mention Because there may be differences for different regions AMDV gene, so as to cause the possibility that positive mink missing inspection occurs.And the present invention is logical The experimental data comparison to different AMDV strains is crossed, further demonstrating EG PCR has wider adaptability to AMDV, no It is only able to detect that the AMDV of U.S.'s strain, the AMDV of China's most area is equally able to detect to obtain.Thus EG PCR It is more suitable for the detection and prevention and control of AMD in world wide.
Detailed description of the invention
Figure 1A is the standard curve of the P-HJL-rt after diluting 10 times using EG PCR amplification；
Wherein: 1:1 × 107Copy/μ L；2:1×106Copy/μ L；3:1×105Copy/μ L；4:1×104Copy/μ L； 5:1×103Copy/μ L；6:1×102Copy/μ L；NC negative control；
Figure 1B is the amplification curve of the P-HJL-rt after diluting 10 times using EG PCR amplification；
Wherein: 1:1 × 107Copy/μ L；2:1×106Copy/μ L；3:1×105Copy/μ L；4:1×104Copy/μ L； 5:1×103Copy/μ L；6:1×102Copy/μ L；NC negative control；
Fig. 1 C is the solubility curve of the P-HJL-rt after diluting 10 times using EG PCR amplification；
Wherein: 1:1 × 107Copy/μ L；2:1×106Copy/μ L；3:1×105Copy/μ L；4:1×104Copy/μ L； 5:1×103Copy/μ L；6:1×102Copy/μ L；NC negative control；
Fig. 2A is the standard curve of the P-ADV-G after diluting 10 times using EG PCR amplification；
Wherein: 1:1 × 107Copy/μ L；2:1×106Copy/μ L；3:1×105Copy/μ L；4:1×104Copy/μ L； 5:1×103Copy/μ L；6:1×102Copy/μ L；NC negative control；
Fig. 2 B is the amplification curve of the P-ADV-G after diluting 10 times using EG PCR amplification；
Wherein: 1:1 × 107Copy/μ L；2:1×106Copy/μ L；3:1×105Copy/μ L；4:1×104Copy/μ L； 5:1×103Copy/μ L；6:1×102Copy/μ L；NC negative control；
Fig. 2 C is the solubility curve of the P-ADV-G after diluting 10 times using EG PCR amplification；
Wherein: 1:1 × 107Copy/μ L；2:1×106Copy/μ L；3:1×105Copy/μ L；4:1×104Copy/μ L； 5:1×103Copy/μ L；6:1×102Copy/μ L；NC negative control；
Fig. 3 A is the standard curve of the P-ADV-G after diluting 10 times using TaqMan PCR amplification；
Wherein: 1:1 × 107Copy/μ L；2:1×106Copy/μ L；3:1×105Copy/μ L；4:1×104Copy/μ L； 5:1×103Copy/μ L；6:1×102Copy/μ L；NC negative control；
Fig. 3 B is the amplification curve of the P-ADV-G after diluting 10 times using TaqMan PCR amplification；
Wherein: 1:1 × 107Copy/μ L；2:1×106Copy/μ L；3:1×105Copy/μ L；4:1×104Copy/μ L； 5:1×103Copy/μ L；6:1×102Copy/μ L；NC negative control；
Fig. 4 is the specificity of EG PCR method；
Wherein: A: amplification curve；B: solubility curve；Wherein, 1:AMDV；2:CDV；3:MEV；4: negative control；
Fig. 5 is the alignment of part EG pcr amplification product；
Wherein: 9 EG pcr amplification product sequences of HLJ-1~9:A mink；2 EG of SD-1, SD-2:B mink Pcr amplification product sequence；
Fig. 6 is the sequence alignment of part TaqMan/EG pcr amplification product.
Wherein: 9 EG pcr amplification product sequences of HLJ-1~9:A mink；2 EG of SD-1, SD-2:B mink Pcr amplification product sequence.
Specific embodiment
Further describe the present invention below with reference to specific example, the advantages and features of the present invention will be with description and more It is clear.But these examples be only it is exemplary, it is not intended to limit the scope of the present invention in any way.Those skilled in the art answer It should be appreciated that without departing from the spirit and scope of the invention can details to technical solution of the present invention and form repair Change or replace, but these modifications and replacement are fallen within the protection scope of the present invention.
Embodiment 1 detects the fluorescent quantitation of Aleutian Mink Disease Parvovirus (Aleutian Mink Disease Virus, AMDV) The foundation of PCR method
One, material and method
1, virus purification, the acquisition of plasmid, sample acquisition
Isolated spleen tissue in the dead mink of one of the present inventor from Heilongjiangdistrict mink factory, the mink exist Positive serology mink is detected as through CIEP before dead.Spleen DNA is extracted, and passes through Standard PCR (Jensen et al., 2011) Further it is verified as the AMDV positive.The viral DNA extracted in the spleen is named as AMDV-HLJ, and as establishing The positive control of EvaGreen quantitative fluorescent PCR.
ADV-G (GenBank M20036) is the prototype strains of U.S.'s separation strains.P-ADV-G is according to ADV-G full genome The plasmid of sequent synthesis.The concentration of the plasmid is measured with 1000 machine of NanoDrop, and according to formula (Whelan et Al.2003 corresponding copy number) is calculated
The acquisition of clinical blood sample is carried out by " cutting toenail blood taking method ", and sample object is from Chinese Heilungkiang Save 45 minks of (A, B) and Shandong Province (C).Wherein, A are no AMD mink.The appearance of this 45 minks does not have There are AMD clinical symptoms.
2, the extraction of DNA
The DNA of mink spleen and blood sample, using QIAamp DNA Mini kit (QIAGEN, Hilden, Germany it) extracts.DNA (AMDV-HLJ) sample concentration of spleen is measured using 1000 machine of NanoDrop (Wilmington, DE, USA), and calculated using spectrophotometry.
3, design of primers
By the way that the AMDV full genome nucleotide sequence in NCBI reference sequence database is compared.We are in AMDV- Three pairs of primers of the conserved regions design of NS.Primer sequence is shown in Table 1.
Table 1 is used to establish three pairs of primers of EG PCR
aPosition: initial position that primer location represents AMDV inner nucleotide and end position are (referring in GENEBank The sequence location of KU513987).
4, EvaGreen quantitative fluorescent PCR (EG PCR)
The reaction system of quantitative fluorescent PCR is 20 μ L, wherein comprising 1 μ L of DNA profiling, 2 × SsoFastTM10 μ L of EvaGreenSupermix (Bio-Rad, Hercules, CA, USA), each 0.5 μ L (10 μ of upstream and downstream primer M).The instrument for carrying out quantitative fluorescent PCR reaction is STRANTAGENE Mx3005P machine (Foster City, CA, USA).Instead Answering program is 95 DEG C of initial denaturation 3min；95 DEG C of denaturation 25s, 58 DEG C of annealing 30s, 72 DEG C of extension 20s, 40 recycle.Solubility curve Analysis are as follows: 95 DEG C, 15s；60 DEG C, 20s and 95 DEG C, 15s.
The EG PCR product of AMDV-HLJ is chosen target fragment after agarose electrophoretic analysis (shown in SEQ ID NO.7) It carries out cutting glue purification.Product cloning after purification (Takara Bio Inc., Dalian, China) into pMD18-T carrier, will The recombinant plasmid of acquisition is named as P-HLJ-rt.The concentration and copy number of the plasmid are computed immediately.
5, the specificity, sensibility and repeatability of EG PCR
Choose mink canine distemper virus (Mink Distemper Virus, MDV) and cats panleucopenia virus (Mink Enteritis virus, MEV) specificity experiments are carried out, the AMDV DNA (AMDV-HLJ) extracted in sick ermine spleen tissue is as sun Property control.For the correctness of further verification result, we carry out agarose gel electrophoresis identification, target fragment to amplified production It is sent to biotech firm to be sequenced, identification is compared with the AMDV reference sequences on NCBI in sequencing result.
Respectively by the continuous 10 times of dilutions (1:10 of P-HLJ-rt and P-ADV-G4-1:1011Copy/μ L) and AMDV-HLJ Continuous 5 times of (1:1-1:56) dilution, the sensitivity experiments of EG PCR are carried out, while establishing standard curve.
P-HLJ-rt and P-ADV-G are diluted to 1 × 10 respectively9, 1 × 106With 1 × 104Copy/μ L dilution, each Dilution is triplicate, then carries out the repeated experiment in the group of EG PCR between group.Then by Tm value in experimental result Variation coefficient is recorded to calculate repeatability.
6, TaqMan quantitative fluorescent PCR
The kit (Genesig Advanced Real-Time PCR Detection Kit) of TaqMan PCR is purchased from In PrimerDesignTM Ltd., Southampton, UK..The target fragment of this method amplification is located on NS gene.TaqMan Quantitative fluorescent PCR (TaqMan PCR) is for compare the experimental performance of EG PCR.With P-ADV-G and/or AMDV-HLJ Carry out the foundation of the standard curve of TaqMan PCR and the analysis of sensitivity experiments respectively as template.Operating process is referring to reagent The subsidiary specification of box.
7, Standard PCR
Using Jensen et al.2011 publish an article in the primer mentioned: AMDV-F-7-H-PN1 (5 ' CATATTCACTGTTGCTTAGGTTA 3 ') and AMDV-R-7-HPN2 (5 ' CGTTCTTTGTTAGTTAGG TTGTC 3 ').Instead Answering program is 94 DEG C of initial denaturation, 5min；Amplified reaction is 94 DEG C, 30s, 55 DEG C, 30s, 72 DEG C, 30s, totally 40 circulations；72℃ Extend 7min.Amplified production detects the band of about 374bp size on agarose gel electrophoresis, can regard as positive knot Fruit.
8, the detection of clinical sample
In order to assess EG PCR to the detection performance of AMDV, EG PCR used simultaneously to 45 clinical samples, Standard PCR and TaqMan PCR is detected.Positive control of the P-HLJ-rt as EG PCR after dilution, sterile DEPC water is as negative right According to.Amplified production through agarose gel electrophoresis, glue return after purification, be cloned into pMD18-T carrier and be sequenced, sequencing result with AMDV reference sequences in GenBank are compared, the versatility detected to evaluate EG PCR to different regions AMDV, Reference virus strain is shown in Table 2.
AMDV reference virus strain in 2 present invention of table for analyzing fluorescent quantitative PCR Product Sequence
Viral name Time Country and area GenBank accession number
ADV-G 1970 The U.S. M20036
ADV-K 1994 Denmark X77084
Utah-I 1994 The U.S. X77083
M195 2014 Canada KT878959
ADV-LN1 2009 China, Dalian GU108231
ADV-LN2 2009 China, Dalian GU108232
ADV-LN3 2009 China, Dalian GU269892
Beijing 2015 China, Beijing KT329428
HLJ1 2013 China, Heilungkiang KU295517
HLJ-LM 2014 China, Heilungkiang KY680280
Jilin 2013 China, Jilin KU295525
Hebei 2013 China, Hebei KU295513
Two, result
1, the selection of optimal primer
To the EG PCR measurement result analysis that three pairs of primers of design carry out, we are (the SEQ ID of final choice upstream primer 1 NO.1) and downstream primer 1 (SEQ ID NO.2) this to primer as optimal primer.It is same because being compared with other two pairs of primers The Ct value that one reaction result generates is minimum, and generates on melting curve without non-specificity peak.And other two pairs of primers, one Fluorescence signal is weak；One has non-specific melting curve peak to generate.
2, the generation of standard curve
P-HLJ-rt and P-ADV-G is through 10 times of dilutions (1 × 107To 1 × 102Copy/μ L) carry out EG PCR sensibility reality Standard curve is established while testing, as shown in Figure 1A-C and Fig. 2A-C.The standard curve of the corresponding EG PCR of the two plasmids Amplification efficiency be respectively 104.8%, 94.4%, related coefficient (Rsq) is respectively 0.999 and 0.998.
The TaqMan PCR standard curve that P-ADV-G after diluting is established, amplification efficiency 85.3%, related coefficient (Rsq) it is 0.998, sees Fig. 3 A-B.
3, the specificity of EG PCR
EG PCR can be identified to the specificity of AMDV by the analysis to melting curve data.EG PCR identifies AMDV's Average Tm value is 82.8 DEG C.And in specificity experiments, we do not have found canine distemper virus, mink enteritis virus and blank pair According to amplification curve and Tm value is generated, as shown in figures 4 a-b.The sequencing result of the product of AMDV is analyzed through the BLAST of NCBI, confirmation It is the target gene of AMDV.
4, the sensibility of two kinds of quantitative fluorescent PCRs
In order to determine the sensibility of EG PCR detection, 10 times of dilutions are carried out to P-HLJ-rt, 5 times of AMDV-HLJ progress is dilute It releases, through interpretation of result, shows the lowest detection limitation of EG PCR for 1 copy, the DNA concentration of 3pg/ μ L.10 are carried out to P-ADV-G It is detected after diluting again, lowest detection limitation is 10 copies, is shown in Table 3.
TaqMan PCR is tested and analyzed with the P-ADV-G after 10 times of dilutions, this method is minimum as the result is shown Limitation is 100 copies, and the result is consistent with the limits in kit specification.And for AMDV-HLJ, TaqMan PCR Do not generate amplification.
The sensibility of two kinds of quantitative fluorescent PCRs of 3 difference DNA template of table
Template EvaGreen PCR TaqMan PCR
P-HLJ-rt (plasmid) 1 copy/μ L It is not detected
AMDV-HLJ (viral DNA) 3pg/μL It is not detected
P-ADV-G (plasmid) 10 copies/μ L 100 copies/μ L
5, the repeatability of EG PCR
Respectively by after dilution P-HLJ-rt and P-ADV-G carry out repeated experiment in triplicate, analysis Tm value is simultaneously counted It calculates with between-group variation coefficient (CV) in its group, as shown in table 4, the coefficient of variation is 0% in the group of AMDV, the coefficient of variation between group Respectively less than 0.15%.The result shows that EG PCR detection AMDV's is reproducible.
The repeatability of the EG PCR of the different DNA profilings of table 4
6, clinical test
With EG PCR, Standard PCR and TaqMan PCR method 45 blood samples are carried out with the detection of AMDV.Wherein EG In PCR method testing result, 41 samples are the positive；In conventional PCR method testing result, 39 sample detections are the positive.So And using TaqMan PCR method, no sample is detected to be positive.It the results are shown in Table 5.
Clinical sample testing result of the table 5EG PCR with other detection methods
Through the sequencing comparison to EG PCR product, further demonstrating EG PCR positive amplification product is AMDV.Part The comparison result of reference sequences in the sequencing result and GenBank of EG PCR product is shown in Fig. 5.As shown, primer portion There is only a small amount of base mispairings for sequence.
It may be mistake to verify the result of TaqMan PCR generation, we use PrimerdesignTM AlDV-specific primer/probe mix and EvaGreen in kit (TaqMan PCR kit) 2 × SsoFast in PCRTMEvaGreen Supermix carries out the quantitative fluorescent PCR reaction of dye method, which is named For TaqMan/EG PCR.Response procedures are identical with the response procedures of EG PCR.The results show that 41 EG PCR results are the positive Sample in, 39 sample results are shown as positive, and 2 are as the result is shown feminine gender.All positive products are cloned into pMD18-T It after carrier, is sequenced, is finally obtained one group of sequence that size is 140bp, is analyzed through BLAST, extension increasing sequence is confirmed as AMDV.The sequencing comparison result of portion of product (coming from identical test sample with the amplified production for being used for sequence alignment in Fig. 5) See Fig. 6, there is a large amount of catastrophe points in sequence.
Embodiment 2 is used to detect the assembling and application method of the PCR kit for fluorescence quantitative of Aleutian Mink Disease Parvovirus (AMD)
1, the assembling of kit
The kit contains following component:
1) primer
Upstream primer 1:ATGGCTCAGGCTCAAATTGATGA (SEQ ID NO.1)
Downstream primer 1:GTGTTGCTTTGGTTGGTTTGTTG (SEQ ID NO.2)
2)2×SsoFastTMEvaGreenSupermix(Bio-Rad,Hercules,CA,USA)。
2, application method
The reaction system of quantitative fluorescent PCR is 20 μ L, wherein comprising 1 μ L of DNA profiling, 2 × SsoFastTM10 μ L of EvaGreenSupermix (Bio-Rad, Hercules, CA, USA), each 0.5 μ L (10 μ of upstream and downstream primer M)。
Response procedures are 95 DEG C of initial denaturation 3min；95 DEG C of denaturation 25s, 58 DEG C of annealing 30s, 72 DEG C of extension 20s, 40 are followed Ring.The analysis of solubility curve are as follows: 95 DEG C, 15s；60 DEG C, 20s and 95 DEG C, 15s.
Sequence table
<110>Harbin Veterinary Medicine Inst., China Academy of Agriculture is (in China Animal Health and Epidemiology Center Harbin point The heart)
Harbin Weike Biologic Technology Ltd.
Harbin Customs of People's Republic of China
<120>a kind of for detecting the PCR kit for fluorescence quantitative and application thereof of Aleutian Mink Disease Parvovirus (AMDV)
<130> KLPI180981
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 23
<212> DNA
<213> artificial sequence
<400> 1
atggctcagg ctcaaattga tga 23
<210> 2
<211> 23
<212> DNA
<213> artificial sequence
<400> 2
gtgttgcttt ggttggtttg ttg 23
<210> 3
<211> 23
<212> DNA
<213> artificial sequence
<400> 3
atggctcagg ctcaaattga tga 23
<210> 4
<211> 25
<212> DNA
<213> artificial sequence
<400> 4
gtttgttgtc cttgtcggtg taggt 25
<210> 5
<211> 26
<212> DNA
<213> artificial sequence
<400> 5
actgactgtg gcaatagaaa catcat 26
<210> 6
<211> 27
<212> DNA
<213> artificial sequence
<400> 6
gcctttaata gattgaggtt gcttgtt 27
<210> 7
<211> 148
<212> DNA
<213> AMDV-HLJ
<400> 7
atggctcagg ctcaacttga tgaacagagg agactgcaag acctgtataa gcagttgaag 60
aaagacgttg ctgaaggtga aggacttgct tggctgttcc aacaaaagac ctacaccgac 120
aaggacaaca aaccaaccaa agcaacac 148

Claims (5)

1. one kind is for detecting the fluorescent quantitation of Aleutian Mink Disease Parvovirus (Aleutian Mink Disease Virus, AMDV) PCR kit, which is characterized in that contain quantitative fluorescent PCR reaction reagent and primer in the kit, wherein described Quantitative fluorescent PCR reaction reagent in contain EvaGreen dyestuff, the primer is made of upstream primer and downstream primer, on The nucleotide sequence of primer is swum as shown in SEQ ID NO.1, the nucleotide sequence of downstream primer is as shown in SEQ ID NO.2.
2. PCR kit for fluorescence quantitative as described in claim 1, which is characterized in that the quantitative fluorescent PCR reaction reagent For 2 × SsoFastTMEvaGreenSupermix。
3. PCR kit for fluorescence quantitative as claimed in claim 2, which is characterized in that the reaction system of quantitative fluorescent PCR is 20 μ L, wherein including DNA profiling 1 μ L, 2 × SsoFastTMEvaGreen Supermix10 μ L, each 0.5 μ L of 10 μM of upstream and downstream primers； Response procedures are as follows: 95 DEG C of initial denaturation 3min；95 DEG C of denaturation 25s, 58 DEG C of annealing 30s, 72 DEG C of extension 20s, 40 recycle；Dissolution is bent The analysis of line are as follows: 95 DEG C, 15s；60 DEG C, 20s and 95 DEG C, 15s.
4. use of the described in any item PCR kit for fluorescence quantitative of claim 1-3 in preparation detection Aleutian Mink Disease Parvovirus On the way.
5. purposes as claimed in claim 4, which is characterized in that the Aleutian Mink Disease Parvovirus is present in blood and tissue sample In product.
CN201910021149.0A 2019-01-09 2019-01-09 One kind is for detecting the PCR kit for fluorescence quantitative and application thereof of Aleutian Mink Disease Parvovirus (AMDV) Pending CN109652594A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910021149.0A CN109652594A (en) 2019-01-09 2019-01-09 One kind is for detecting the PCR kit for fluorescence quantitative and application thereof of Aleutian Mink Disease Parvovirus (AMDV)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910021149.0A CN109652594A (en) 2019-01-09 2019-01-09 One kind is for detecting the PCR kit for fluorescence quantitative and application thereof of Aleutian Mink Disease Parvovirus (AMDV)

Publications (1)

Publication Number Publication Date
CN109652594A true CN109652594A (en) 2019-04-19

Family

ID=66119632

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910021149.0A Pending CN109652594A (en) 2019-01-09 2019-01-09 One kind is for detecting the PCR kit for fluorescence quantitative and application thereof of Aleutian Mink Disease Parvovirus (AMDV)

Country Status (1)

Country Link
CN (1) CN109652594A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114250322A (en) * 2021-12-24 2022-03-29 吉林农业大学 Dual fluorescent quantitative PCR kit for detecting mink circovirus and mink Aleutian virus
CN114317817A (en) * 2021-11-23 2022-04-12 吉林农业大学 Fluorescent quantitative PCR primer group and fluorescent quantitative PCR kit for detecting mink circovirus

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103993103A (en) * 2014-04-14 2014-08-20 田国宁 LAMP detection method for aleutian disease parvovirus
CN104450967A (en) * 2014-12-15 2015-03-25 中国农业科学院特产研究所 Specific primer for detecting Aleutian disease virus of minks and application of specific primer in screening healthy minks
CN104531903A (en) * 2015-01-22 2015-04-22 山东农业大学 Duplex polymerase chain reaction (PCR) method for rapid detection of Aleutian mink disease virus
CN104911276A (en) * 2014-03-10 2015-09-16 中国农业科学院特产研究所 Primers, kit and method for rapidly detecting Aleutian mink disease virus

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104911276A (en) * 2014-03-10 2015-09-16 中国农业科学院特产研究所 Primers, kit and method for rapidly detecting Aleutian mink disease virus
CN103993103A (en) * 2014-04-14 2014-08-20 田国宁 LAMP detection method for aleutian disease parvovirus
CN104450967A (en) * 2014-12-15 2015-03-25 中国农业科学院特产研究所 Specific primer for detecting Aleutian disease virus of minks and application of specific primer in screening healthy minks
CN104531903A (en) * 2015-01-22 2015-04-22 山东农业大学 Duplex polymerase chain reaction (PCR) method for rapid detection of Aleutian mink disease virus

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ANNE C EISCHEID: "SYTO dyes and EvaGreen outperform SYBR Green in real-time PCR", 《BMC RESEARCH NOTES》 *
LI LI等: "Development of an EvaGreen-based real-time PCR assay for detection of Aleutian mink disease virus", 《JOURNAL OF VIROLOGICAL METHODS》 *
TRINE H. JENSEN等: "Implementation and validation of a sensitive PCR detection method in the eradication campaign against Aleutian mink disease virus", 《JOURNAL OF VIROLOGICAL METHODS》 *
TRINE HAMMER JENSEN等: "Monitoring chronic infection with a field strain of Aleutian mink disease virus", 《VETERINARY MICROBIOLOGY》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114317817A (en) * 2021-11-23 2022-04-12 吉林农业大学 Fluorescent quantitative PCR primer group and fluorescent quantitative PCR kit for detecting mink circovirus
CN114250322A (en) * 2021-12-24 2022-03-29 吉林农业大学 Dual fluorescent quantitative PCR kit for detecting mink circovirus and mink Aleutian virus
CN114250322B (en) * 2021-12-24 2024-04-30 吉林农业大学 Dual-fluorescence quantitative PCR (polymerase chain reaction) kit for detecting mink circovirus and mink Albikino virus

Similar Documents

Publication Publication Date Title
CN106957927A (en) African swine fever fluorescence PCR detection reagent, African swine fever fluorescence PCR detection reagent kit and its application
CN107299155A (en) A kind of primer and probe of goose astrovirus real-time fluorescence quantitative PCR detection
CN107385111A (en) The real-time fluorescence quantitative PCR detection primer and its kit of a kind of goose astrovirus
CN109536642A (en) A kind of universal pig fourth type coronavirus RT-Nested PCR detection method
CN108624720A (en) The primed probe group and kit of RAA Fluorometric assay Rift Valley fever virus
CN109913591A (en) A type Sai Nika virus fluorescent quantitative RT-PCR detection method and kit based on TaqMan probe method
Huang et al. CRISPR/Cas12a technology combined with RPA for rapid and portable SFTSV detection
CN109652594A (en) One kind is for detecting the PCR kit for fluorescence quantitative and application thereof of Aleutian Mink Disease Parvovirus (AMDV)
CN101831506B (en) Kit for authenticating deletion of vaccine strain and wild strain of PRVgE
CN108165666A (en) Detection CPV2a, CPV2b and CPV2c and the method for differentiating wild type and vaccine type
Chen et al. Development and application of a dual ERA method for the detection of Feline Calicivirus and Feline Herpesvirus Type I
Zhang et al. A TaqMan-based real-time PCR assay for specific detection of novel duck reovirus in China
CN103993102B (en) A kind of detect adenovirus hominis, people&#39;s mycoplasma pneumoniae, the method for human bocavirus and test kit simultaneously
CN105950785A (en) Ternary fluorescence RT-PCR detection kit of avian influenza virus, new castle disease virus and infectious bronchitis virus, primers and probes
CN108588276A (en) D type influenza virus fluorescence quantification PCR primers pair and kit
CN106119421B (en) QYYZ plants of pig blue-ear disease of fluorogenic quantitative detection primer, probe and kit
CN101397592A (en) Biological article for detecting hepatitis b virus covalence closed DNA and use thereof
CN102108420A (en) Fluorescence quantitative polymerase chain reaction (PCR) kit for detecting dengue virus type 1
CN108315479A (en) Ankara real-time fluorescence quantitative PCR primer pair and kit
CN108676922A (en) Primer and probe for detecting Porcine epidemic diarrhea virus street strain and TaqMan real time fluorescence quantifying PCR methods
Liu et al. Development of a droplet digital PCR assay for detection of group A porcine rotavirus
CN109652593A (en) A kind of fluorescence quantification PCR primer and kit detecting A type Senecan virus
CN101514374B (en) PCR method for detecting duck viral enteritis and kit thereof
CN110564892A (en) Fluorescent RT-PCR (reverse transcription-polymerase chain reaction) primer, probe and method for detecting highly pathogenic H7N9 avian influenza virus
CN111961757A (en) Double-gene probe method real-time fluorescence quantitative PCR kit for detecting duck tembusu virus and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20190419

RJ01 Rejection of invention patent application after publication