CN101565758B - Rabies virus detecting fluorescence quantitative PCR kit and application thereof - Google Patents
Rabies virus detecting fluorescence quantitative PCR kit and application thereof Download PDFInfo
- Publication number
- CN101565758B CN101565758B CN2009100623976A CN200910062397A CN101565758B CN 101565758 B CN101565758 B CN 101565758B CN 2009100623976 A CN2009100623976 A CN 2009100623976A CN 200910062397 A CN200910062397 A CN 200910062397A CN 101565758 B CN101565758 B CN 101565758B
- Authority
- CN
- China
- Prior art keywords
- rabies virus
- pcr
- fluorescence quantitative
- primer
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a rabies virus detecting fluorescence quantitative PCR kit and an application thereof. The kit comprises: a) an RNA extraction solution, b) a reverse transcriptase reaction solution, c) reverse transcriptase, d) an RNA enzyme inhibitor, e) a primer and a TaqMan probe, f) a standard positive DNA template, and g) a PCR fluorescence quantitative reaction solution. The kit is characterized in that: primer sequence is a sense primer: 5'-TAGGATGCTATATGGGTCAAGTCAGA-3', and an antisense primer: 5'-TTCAAATGTCCCTTTCCCGAAGAA-3', and the size of an amplicon is 125 bp; the sequence of a fluorescence probe is: 5'-FAM-CAACGGTTATTGCTGCATGTGCTCCTGA-TAMRA-3', the 5' end of the probe is marked with a fluorescence emission group FAM, the 3' end is marked with a fluorescence quenching group TAMRA, the standard positive DNA template transforms a colon bacillus DH5 alpha by a pGEM-T carrier inserted with rabies virus N protein zone 391 bp segment, plasmid is extracted after proliferation, an A260 ration is measured in an ultraviolet spectrophotometer, and the plasmid is diluted by 10 times of gradient. The kit can efficiently and conveniently monitor the rabies virus pollution inserum products in real time, and can provide technical support for relevant fundamental researches, thus having quite broad application prospect.
Description
Technical field:
The present invention relates to biological technical field, more specifically relate to a kind of PCR kit for fluorescence quantitative that detects rabies virus, the purposes that also relates to PCR kit for fluorescence quantitative simultaneously, be applicable to that pollution is monitored in real time to the rabies virus in the serum product, provide technical support for related basic research simultaneously.
Background technology
Lyssavirus Rhabdoviridae (Rhabdoviridae), Lyssavirus (Lyssavirus), its nucleic acid are the sub-thread strand RNA molecule of non-segmented negative, and rabies are a kind of acute infectious diseases that caused by rabies virus, the people beast can infect, and claims rabies, mad dog disease etc. again.Rabies virus is mainly propagated between animal, this disease mainly be by animal bite when stinging on the tooth with saliva in rabies virus invade human or animal body and infected.Rabies are in case morbidity, its advance rate is very fast, and is most at 3-5 days, seldom have to surpass 10 days, and case fatality rate is 100%.Among milk cow and the beef cattle group, during acute attack, mortality ratio is very high, brings serious problem for livestock industry, international trade outlet and food safety etc.Because the tissue culture host range of Rabies is quite wide, often cause the Rabies of culturing cell pollution, and usually be difficult for arousing attention from serum, bring certain problem for cell cultures and related basic research.The rapid detection of rabies virus is control and eliminates this sick prerequisite, but its conventional sense method has the some shortcomings part, and in general detection technique has serodiagnosis technology, biological test, diagnosis of molecular biology technology three classes:
1. serodiagnosis technology comprises complement fixation test, neutralization experiment, aggegation experiment, immunodiffusion(ID), precipitation experiment, immuno-electrophoresis, immunofluorescence dyeing, double-antibody sandwich elisa and immunoelectronmicroscopy etc.In these methods, obtain having of common recognition and widespread use: complement fixation test, indirect hemagglutination test, agar diffusion experiment, neutralization experiment.But because the reaction of antiserum(antisera) and antigen immune is all used in all experiments, long reaction time, material is many, the preparatory period is long, detection has tangible hysteresis quality, can only be qualitative can not be quantitative, and poor repeatability.
2. biological test comprises experimentation on animals, egg inoculation and cell cultures.There is insensitive problem in this detection method, and has anticomplementary activity in some sample, and influence detects effect.Experimentation on animals cost height, the cycle is long, waste Biological resources and manpower and materials.
3. the diagnosis of molecular biology technology comprises nucleic acid hybridization experiment, polyacrylamide gel electrophoresis, polymerase chain reaction, the detection of negative staining Electronic Speculum etc.Detection method such as nucleic acid hybridization, polyacrylamide gel electrophoresis is more suitable in virus characteristic is carried out more deep research, because the total system complicated operation, process is various, and the cost height is not suitable for carrying out simultaneously mass detection, thereby is very limited.By contrast, common RT-PCR method specificity is good, and the detection sensitivity height not only can detect live virus nucleic acid, also can directly detect the nucleic acid fragment of deactivation.Sample can be the Rabies in organ, tissue, the cell, and can distinguish mutually with different Rabies strain and rotavirus, border disease virus, and this is that immunological method is irreplaceable.But what this traditional quantivative approach was measured all is the end product of PCR, rather than initiate dna or RNA copy number.Owing to do not have linear relationship between the end product amount of PCR and the starting template amount, so can not calculate initiate dna or RNA copy number according to final PCR product amount.Therefore, measuring rabies virus how fast, accurately is one of main difficult problem that faces.
The quantitative fluorescent PCR that development in recent years is got up (Fluorogenetic Quantitative PCR, FQ-PCR) technology is highly sensitive with it, speed is fast, advantages such as high specificity are at gene expression dose analysis (Nellemann C, Vinggaard AM, Dalgaard M, et al.Quantification of Antiandrogen Effect Determinedby LightCycler Technology[J] .Toxicology, 2001,163:29-38), qualitative (the Bhudevi B of pathogenic agent, Weinstock D.Fluorogenic RT-PCR assay (TaqMan) for Detection andClassification of Bovine Viral Diarrhea Virus[J] .Vet.Microbiol., 2001,83:1-10.) and detection by quantitative (Kathy F.J.Tang, Jun Wang, Donald V.Lightner.Quantitation of Taurasyndrome virus by real-time RT-PCR with a TaqMan assay[J] .J.Virol.Methods, 115 (2004) 109-114.; Birgit Liss.Improved quantitative real-time RT-PCR forexpression profiling of individual cells[J] .Nucleic Acids Res., 2002, Vol.30No.17e89.; Franck Housseau a, limberly R.Lindsey a, et al.Quantitative real-time RT-PCRas a method for monitoring T lymphocyte reactivity to full-length tyrosinase proteinin vaccinated melanoma patients[J] .J.Immunol.Methods 266 (2002) 87-103.; DesireN, Dehee A, Schneider V, et al.Quantification of Human Immunodeficiency VirusType 1Proviral Load by a TaqMan Real-Time PCR Assay[J] .J.Clin.Microbiol, 2001,39:1303-1310; Martell M, Gomez J, Esteban JI, et al.High-ThroughputReal-Time Reverse Transcription-PCR Quantitation of Hepatitis C Virus RNA[J] .J.Clin.Microbiol, 1999,37:327-332; Kang B, Oh J, Lee C, Park BK, Park Y, Hong K, Lee K, Cho B, Song D.Evaluation of a rapid mmunodiagnostic test kit for rabiesvirus[J] .J.Virol.Methods, 2007,145 (1): 30-36; Florence KP, Glaucia PB, Mireille S, et al.Quantitation of HCV RNA using real-time PCR and fluorimetry[J] .J.Virol.Methods, 2001,95:111-119.) etc. the aspect be used widely, and become the quantitative main method of current viral nucleic acid, domestic also existing at present test kit listing about third liver, hepatitis B, mycoplasma, AIDS, tuberculosis detection by quantitative.
Summary of the invention
The objective of the invention is to be to provide a kind of PCR kit for fluorescence quantitative that detects rabies virus, this test kit is applicable to all types fluorescence quantitative gene extender in the market, highly sensitive, quantitatively quick and precisely, wide, the good stability of sensing range.
Another object of the present invention is to be to provide the application of a kind of PCR kit for fluorescence quantitative in milk cattle infected rabies virus detects, can pollute the rabies virus in the serum product efficiently and easily and monitor in real time, provide technical support for related basic research simultaneously.
To achieve these goals, the present invention adopts following technical measures:
A kind of PCR kit for fluorescence quantitative that detects rabies virus: it comprises a) RNA extract, b) reverse transcription reaction liquid, c) RNA enzyme inhibitors, d) reversed transcriptive enzyme, e) primer and fluorescent probe (TaqMan), f) standard positive dna profiling, g) fluorescence quantitative PCR reaction solution, it is characterized in that: adopt traditional two-step approach amplification (Two-Step RT-PCR), be that the first step is carried out reverse transcription reaction, RNA sample reverse transcription is become cDNA, second step was carried out the quantitative fluorescent PCR reaction, introduced standard positive DNA sample detection by quantitative unknown sample simultaneously.As standard substance, make that the quantitative reaction result is more reliable and more stable with DNA, and increased the repeatability of experiment greatly, reduce error.Reverse transcription reaction liquid contains reverse transcriptase reaction liquid, the RNA enzyme inhibitors, the fluorescent quantitation reaction solution contains primer and fluorescent probe, primer sequence is respectively sense primer: (FP) 5 '-TAGGATGCTATATGGGTCAAGTCAGA-3 ' (SEQ ID NO:1), antisense primer (RT): 5 '-TTCAAATGTCCCTTTCCCGAAGAA-3 ' (SEQ ID NO:2), amplicon size 125bp.The fluorescent probe sequence is 5 '-FAM-CAACGGTTATTGCTGCATGTGCTCCTCA-TAMRA-3 ' (SEQ ID NO:3), 5 ' end mark fluorescent emission group FAM (6-Fluoresceincarboxylic acid) of probe, 3 ' end is marked with fluorescent quenching group TAMRA.The standard positive dna profiling is the segmental pGEM-T carrier of N protein region 391bp (available from Promega company) transformed into escherichia coli DH5 α (available from Invitrogen company) by inserting rabies virus, and plasmid is extracted in the propagation back, and surveys A in ultraviolet spectrophotometer
260Quantitative also 10 times of gradient dilutions.Described reverse transcription reaction liquid is by 5 * buffer, the antisense primer of 10 μ mol/L, and reversed transcriptive enzyme, the RNA enzyme inhibitors, the sterilization distilled water of 10mM dNTPs and no RNA enzyme is formed; Fluorescence quantitative PCR reaction solution is by 2 * Premix, the sense primer of 10 μ mol/L and antisense primer, and 10 μ mol/L fluorescent probes and aseptic double-distilled water are formed.Described standard positive template dna nucleotide sequence is:
TAGGATGCTATATGGGTCAAGTCAGATCCCTAAATGCAACGGTTATTGCTGCATGTGCTCCTCATGAAATGTCTGTTCTAGGGGGCTATCTGGGAGAGGA
In a preferred version of the present invention, adopt traditional two-step approach amplification (Two-Step RT-PCR), promptly the first step is carried out reverse transcription reaction, and RNA sample reverse transcription is become cDNA, second step was carried out the quantitative fluorescent PCR reaction, introduced standard positive DNA sample detection by quantitative unknown sample simultaneously.As standard substance, make that the quantitative reaction result is more reliable and more stable with DNA, and increased the repeatability of experiment greatly, reduce error.In a concrete scheme of the present invention, reverse transcription reaction liquid is by antisense primer (RT), reversed transcriptive enzyme, RNA enzyme inhibitors, 5 * buffer solution, the two compositions that steam of the sterilization of 10mM dNTPs and no RNA enzyme; Fluorescence quantitative PCR reaction solution is by sense primer (FP), antisense primer (RT), and fluorescent probe (TaqMan), 2 * buffer solution and sterilization distilled water are formed; In a concrete scheme of the present invention, reverse transcription reaction liquid is by 5 * buffer solution, 5 μ l, the antisense of 10 μ mol/L (RT) primer 2 .5 μ l, 10mM dNTPs1.5 μ l, each 1 μ l of reversed transcriptive enzyme and RNA enzyme inhibitors, the sterilization distilled water 9 μ l of no RNA enzyme form; The fluorescent quantitation reaction solution is by 2 * buffer solution, 12.5 μ l, and 10 μ mol/L justice (FP), antisense (RT) primer be 3 μ l respectively, 10 μ mol/L fluorescent probes, 0.75 μ l, and sterilization distilled water 0.75 μ l forms.Wherein fluorescent probe is the nucleotide sequence shown in (SEQ ID NO:3), and the fluorescence report group of fluorescent probe 5 ' end mark is FAM, 3 ' end mark fluorescent quenching group TAMRA.
In a preferred version of the present invention, the standard positive dna profiling inserts the segmental pGEM-T of purpose (available from Promega company) carrier transformed into escherichia coli DH5 α by containing, and plasmid is extracted in the propagation back, and surveys A in ultraviolet spectrophotometer
260Quantitative also 10 times of gradient dilutions.Testing used standard substance preparation process is: downcut behind the PCR product electrophoresis and contain the segmental gel of purpose, gel-purified test kit purifying with Omega company, spend the night for 4 ℃ with pGEM-T carrier (available from Promega company) and to be connected, the transformed competence colibacillus cell, converted product is coated with dull and stereotyped the cultivation, picking hickie PCR identifies and to send the order-checking of rich inferior biotechnology company limited after the positive, according to sequencing result the positive colony bacterium of screening is inoculated into the LB substratum incubated overnight that contains the ammonia Bian, prepare plasmid DNA with the SDS alkaline lysis, behind the gel-purified test kit purifying of Omega company, survey A in ultraviolet spectrophotometer
260Quantitatively, and be diluted to gradient 10
9-10
2Copy/10 μ l ,-70 ℃ of preservations.
In the invention provides the PCR kit for fluorescence quantitative that detects rabies virus, there is one one end to be marked with the specificity fluorescent probe that the fluorescence report group the other end is marked with the fluorescent quenching group, when probe is complete, two groups distance on space structure is close mutually, the fluorescence that 5 ' end reporter group produces is because FRET (fluorescence resonance energy transfer) (FRET) and by the group cancellation of going out of 3 ' end quenching, so there is not the variation of fluorescent signal in the system.In PCR annealing and extension process, probe combines with template specificity, extension along with primer, the Taq archaeal dna polymerase utilizes its 5 '-3 ' circumscribed activity that probe cutting is discharged reporter group, destroyed the FRET between two groups like this, the fluorescent probe that the fluorescence that reporter group discharged can be built in the detection by quantitative instrument detects, and template is whenever duplicated once, just there is a probe to be cut off, follows the release of a fluorescent signal.Because d/d fluorophor number and PCR product quantity are man-to-man relations, so the accumulation volume of the increase of fluorescence volume and PCR product is proportionlity.To rabies virus quantitatively can comparing draws by the circulation thresholding (Ct, Threshold Cycle) with standard substance.The Ct value is in the PCR process, and the accumulation of fluorescence volume surpasses the cycle number of substrate fluorescence volume, and Ct value and initial modulus are the certain proportion relation, and the Ct value is more little, and the starting template number is many more, and on the contrary, the Ct value is big more, and the starting template number is few more.Utilize the Ct value of positive gradient standard form to make typical curve, can accurately measure the initial copy number of this sample again according to the Ct value of testing sample.
In the invention provides the PCR kit for fluorescence quantitative that detects rabies virus, at the singularity of Nucleotide arrangement in the genomic target fragment of rabies virus, with reaction system (primer and concentration and probe concentration, Mg
2+Concentration, amplification program etc.) optimization, and Q-PCR technology and detection by quantitative system (comprised the LigthCycler system, Roche, ABI Prism system, PEApplied Biosystems) combines, use it for the detection by quantitative of the rabies virus sample in various sources.Pass through prioritization scheme, experiment repeatedly, and compare with traditional detection method, set up the method for detection by quantitative rabies virus, and develop the detection by quantitative test kit of rabies virus, the sensitivity of this test kit can detect the virogene copy number below 100 in each reaction system, sensing range can reach eight orders of magnitude.
In another aspect of the present invention, the method that the present invention also provides a kind of PCR kit for fluorescence quantitative that rabies virus is detected, this method comprises the following steps:
A) use f) the standard positive dna profiling is by inserting the segmental pGEM-T of purpose (available from promega company) carrier transformed into escherichia coli DH5 α, and plasmid is extracted in the propagation back, and quantitative with ultraviolet spectrophotometer;
B) use a) that the RNA extract extracts RNA from sample to be measured, add b then) reverse transcription reaction liquid, c) RNA enzyme inhibitors, d) reversed transcriptive enzyme, e) antisense primer carries out reverse transcription;
C) quantitative fluorescent PCR is by e) primer and fluorescent probe (TaqMan), g) PCR fluorescent quantitation reaction solution, f) standard positive dna profiling or reverse transcription reaction product are formed, added machine on the fluorescent quantitation reaction solution PCR reaction system of standard substance and testing sample, carried out PCR with the fluorescent quantitation detector and detect;
D) calculate the initial copy number of testing sample according to typical curve by the circulation thresholding of testing sample and standard substance relatively.
The PCR kit for fluorescence quantitative of the detection rabies virus that provides in the present invention can carry out accurate detection by quantitative to the rabies virus sample in various sources, and can carry out detection by quantitative and quality monitoring to bovine blood goods and bovine serum, provide technical support for related basic research simultaneously.
The present invention compared with prior art has the following advantages and effect:
1. compare with traditional quantivative approach, this real-time fluorescence quantitative PCR has high sensitivity, the characteristics of high specific and high accuracy, directly the every circulation primary of PCR is just collected data, set up real-time amplification curve, determine the Ct value exactly, thereby determine initial RNA copy number, accomplished truly nucleic acid quantification according to the Ct value.
2. compare with single stage method, the two-step approach amplification (Two-Step RT-PCR) that this experiment is adopted makes that with the DNA standard substance of concentration known the quantitative reaction result is more reliable and more stable, and has increased the repeatability of experiment greatly, the minimizing error.
3. sensing range is wide, 10
9-10
2Fabulous linear relationship (R=0.999) is arranged in the copies/reaction concentration range, and sensing range can reach eight orders of magnitude, reaches advanced world standards, and its sensitivity can detect below the 100copies, is that other any method is incomparable.
4. be applicable to the fluorescent quantitation amplification instrument of various models, once three corresponding variation coefficient of repeat samples (CV) illustrate repeatability that it is high and stable less than 2% in the experiment.
5. the outer typical curve of this real-time fluorescence quantitative PCR utilization is quantitatively the most accurate up to now, and the quantivative approach that circulation ratio is best has obtained globally generally acknowledging, is widely used in numerous areas such as gene expression research, curative effect of medication examination, pathogen detection.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Be to be understood that, these embodiment only are used to the present invention is described and are not used in restriction the scope of protection of present invention, unreceipted concrete experiment condition and method in the following example, usually according to normal condition as chief editors such as J. Sa nurse Brookers, Science Press, 2002, molecular cloning experiment guide (third edition); D.L. chief editor such as Spector, Science Press, 2001, cell experiment guide; F.M. chief editor such as Ao Sibai, Science Press, 2005, fine works molecular biology experiment guide, or according to the condition of manufacturer's suggestion.
The PCR kit for fluorescence quantitative of embodiment 1 rabies virus is formed and reaction conditions
A). test kit is formed:
A) test kit is composed as follows: (10 secondary response)
RNA extracting solution A (4ml/ pipe) RNA extracting solution B (800 μ l/ pipe)
Reverse transcription reaction liquid (90 μ l/ pipe) reversed transcriptive enzyme (10 μ l/ pipe)
RNA enzyme inhibitors (400U/ pipe)
Strong positive standard substance (100 times of accurate product 20 μ l/ pipes of dilution definite value, totally four pipes)
PCR reaction tubes (aseptic, no RNA enzyme and DNA enzyme) DEPC H
2O (2ml/ pipe)
The negative critical positive criteria product of standard substance (50 μ l/ pipe) (50 μ l/ pipe)
Fluorescence quantitative PCR reaction solution (125 μ l/ pipe)
(RNA extracting solution A is an Invitrogen company product.B) reverse transcription reaction liquid, d) reversed transcriptive enzyme is available from Promega company, and g) fluorescence quantitative PCR reaction solution and RNA enzyme inhibitors (40U/ μ l) are available from TAKARA company.)
B). reverse transcription reaction liquid (the reaction cumulative volume is 25 μ l): by 5 * buffer solution, 5 μ l, the antisense primer RT of 10 μ mol/L (SEQ ID NO:2), 2.5 μ l, 10mM dNTPs1.5 μ l, each 1 μ l of reversed transcriptive enzyme and RNA enzyme inhibitors, the sterilization distilled water 9 μ l of no RNA enzyme and testing sample 5 μ l form; The fluorescent quantitation reaction solution is by 2 * buffer solution, 12.5 μ l, each 3 μ l of 10 μ mol/L sense primer FP (SEQ ID NO:1), antisense primer RT, 10 μ mol/L fluorescent probes, 0.75 μ l, sterilization distilled water 0.75 μ l, the cDNA of testing sample or standard substance are formed.Wherein fluorescent probe is the nucleotide sequence shown in (SEQ ID NO:3), and the fluorescence report group of fluorescent probe 5 ' end mark is FAM, 3 ' end mark fluorescent quenching group TAMRA.
C). reaction conditions is as follows: (employing two-step approach)
cDNA?synthesis：70℃ 10min
0℃ 2min
0℃ pause
42℃ 50min
70℃ 10min
PCR： 95℃， 2min
94℃， 30s
60℃， 90s
40cycles
When each round-robin second EOS, carry out fluoroscopic examination.To Rabies quantitatively can be by comparing with the circulation thresholding (Ct, Threshold Cycle) of standard substance and calculating the initial copy number of testing sample according to typical curve.
D). PCR kit for fluorescence quantitative detects sensitivity, sensing range and the stability of rabies virus
Get the standard substance RNA10 that transcribes
9-10
2The c/r concentration range, three repetitions of each concentration, add the abundant mixing of RNA lysate 400 μ l, room temperature (20-25 ℃, below identical) left standstill 10 minutes, added 80 μ l chloroforms, room temperature left standstill 3 minutes, in centrifugal 10 minutes of 4 ℃ of 12000g/min, supernatant liquor was transferred to another centrifuge tube, adds 200 μ l Virahols, precipitation at room temperature 10 minutes, centrifugal 10 minutes of 4 ℃ of 12000g/min decant supernatant, add 1ml 75% (volume ratio) ethanol and fully dispel, in centrifugal 5 minutes of 4 ℃ of 7500g/min, abandon supernatant, RNA precipitates seasoning at room temperature, adds 60 ℃ of 10min dissolvings of no RNA enzyme water 25 μ l.
E). get D) the step RNA that carries 5 μ l, add reverse transcription reaction liquid 5 * buffer 5 μ l then, antisense primer RT (SEQ ID NO:2) 2.5 μ l (10 μ mol/L), 10mM dNTPs 1.5 μ l, RNA enzyme inhibitors (40U/ μ l), reversed transcriptive enzyme 1 μ l adds the PCR reaction tubes of reference numeral respectively, carries out the reverse transcription experiment on the PCR instrument.Reaction conditions is: 70 ℃ of 10min, 0 ℃ of 2min, 42 ℃ of 50min, 70 ℃ of 10min.Fluorescence quantitative PCR reaction solution 12.5 μ l, each 3 μ l of 10 μ mol/L sense primer FP (SEQ ID NO:1), antisense primer RT (SEQ IDNO:2), fluorescent probe 0.75 μ l (10 μ mol/L), testing sample cDNA or standard substance DNA 5 μ l, the PCR reaction tubes that adds reference numeral respectively, the parallel PCR that is detects on the fluorescent quantitation detector.Cycling condition is: 95 ℃ of pre-sex change 2min; 94 ℃ of 30s, 60 ℃ of 90s, 40 circulations of increasing.Carry out when the program of fluoroscopic examination is arranged on each round-robin second EOS, the detection wavelength is 518nm.
After the loop ends, the utilization instrument carries analysis software (Eppendorf quantitative real time PCR Instrument, model: Mastercyler ep realplex, software: realplex), read sample copy number to be checked.The result is:
| Sequence number | Title | Type | Threshold value (Ct) | Set concentration | Variation coefficient % |
| 1 | A1 | Standard | 13.84 | 1000000000 | 0.31 |
| 2 | A2 | Standard | 13.54 | 1000000000 | 0.87 |
| 3 | A3 | Standard | 13.60 | 1000000000 | 0.44 |
| 4 | B1 | Standard | 16.81 | 100000000 | 0.40 |
| 5 | B2 | Standard | 16.65 | 100000000 | 0.29 |
| 6 | B3 | Standard | 16.77 | 100000000 | 0.42 |
| 7 | C1 | Standard | 19.89 | 10000000 | 0.65 |
| 8 | C2 | Standard | 20.13 | 10000000 | 0.55 |
| 9 | C3 | Standard | 20.04 | 10000000 | 0.09 |
| 10 | D1 | Standard | 23.42 | 1000000 | 0.42 |
| 11 | D2 | Standard | 23.23 | 1000000 | 0.39 |
| 12 | D3 | Standard | 23.32 | 1000000 | 0 |
| 13 | E1 | Standard | 26.77 | 100000 | 0.60 |
| 14 | E2 | Standard | 26.56 | 100000 | 0.19 |
| 15 | E3 | Standard | 26.51 | 100000 | 0.38 |
| 16 | F1 | Standard | 29.70 | 10000 | 0.46 |
| 17 | F2 | Standard | 29.95 | 10000 | 0.37 |
| 18 | F3 | Standard | 29.86 | 10000 | 0.07 |
| 19 | G1 | Standard | 33.06 | 1000 | 0 |
| 20 | G2 | Standard | 33.12 | 1000 | 0.18 |
| 21 | G3 | Standard | 33.01 | 1000 | 0.16 |
| 22 | H1 | Standard | 36.45 | 100 | 0.53 |
| 23 | H2 | Standard | 36.62 | 100 | 0.05 |
| 24 | H3 | Standard | 36.86 | 100 | 0.60 |
| 25 | CK- | NTC | - |
Above result shows: this test kit sensing range is wide, 10
9-10
2Fabulous linear relationship is arranged in the c/r concentration range, its sensing range of coefficient R=0.999 can reach nine orders of magnitude, its sensitivity can detect below the 100copies, and good stability, three corresponding variation coefficient of repeat samples (CV) are less than 1% in once testing, the repeatability that it is high being described, being applicable to the fluorescent quantitation amplification instrument of various models, is that other any method is incomparable.
Embodiment 2: the application of rabies virus PCR kit for fluorescence quantitative in milk cattle infected rabies virus detects
A). test kit is formed:
A) test kit is composed as follows: (10 secondary response)
RNA extracting solution A (5ml/ pipe) RNA extracting solution B (5ml/ pipe)
RNA extracting solution C (10ml/ pipe)
Filter column A and adsorption column B (aseptic, no RNA enzyme and DNA enzyme)
Reverse transcription reaction liquid (90 μ l/ pipe) reversed transcriptive enzyme (10 μ l/ pipe)
RNA enzyme inhibitors (400U/ pipe)
Strong positive standard substance (100 times of accurate product 20 μ l/ pipes of dilution definite value, totally four pipes)
PCR reaction tubes (aseptic, no RNA enzyme and DNA enzyme) DEPC H
2O (2ml/ pipe)
The negative critical positive criteria product of standard substance (50 μ l/ pipe) (50 μ l/ pipe)
Fluorescence quantitative PCR reaction solution (125 μ l/ pipe)
(RNA extracting solution A, B, C and Filter column adsorption column are a day root company product.B) reverse transcription reaction liquid, d) reversed transcriptive enzyme is available from Promega company, g) fluorescence quantitative PCR reaction solution and RNA enzyme inhibitors (40U/ μ l) are available from TAKARA company)
B). extract viral process in the cow serum: get 200 μ l serum sample to be measured or add viral positive serum sample, add 500 μ l RNA extracting solution A and (add beta-mercaptoethanol, final concentration 1% (volume ratio) before using; Above-mentioned solution is transferred to Filter column CS, and the centrifugal 2min of 12000rpm collects filtrate; 70% ethanol that in filtrate, adds 1 times of volume, solution that obtains and precipitation change among the adsorption column B together, and the centrifugal 1min of 12000rpm abandons waste liquid; Add 350 μ l RNA extracting solution B among the adsorption column B, the centrifugal 1min of 12000rpm abandons waste liquid, repeats once; Add 700 μ l RNA extracting solution C (adding dehydrated alcohol before using) among the adsorption column B, room temperature is placed 2min, and the centrifugal 1min of 12000rpm repeats once; Empty from adsorption column, the centrifugal 2min of 12000rpm; 30 μ l RNase-free ddH
2O adds adsorption column B, room temperature 2-5min, the centrifugal 2min of 12000rpm; The RNA that obtains is used for the reverse transcription experiment in downstream.
C). reverse transcription reaction liquid (the reaction cumulative volume is 25 μ l): by 5 * buffer solution, 5 μ l, the antisense primer RT of 10 μ mol/L (SEQ ID NO:2), 2.5 μ l, 10mM dNTPs1.5 μ l, each 1 μ l of reversed transcriptive enzyme and RNA enzyme inhibitors, the sterilization distilled water 9 μ l of no RNA enzyme and testing sample 5 μ l form; The fluorescent quantitation reaction solution is by 2 * buffer solution, 12.5 μ l, each 3 μ l of 10 μ mol/L sense primer FP (SEQ ID NO:1), antisense primer RT, 10 μ mol/L fluorescent probes, 0.75 μ l, sterilization distilled water 0.75 μ l, the cDNA of testing sample or standard substance are formed.Wherein fluorescent probe is the nucleotide sequence shown in (SEQ ID NO:3), and the fluorescence report group of fluorescent probe 5 ' end mark is FAM, 3 ' end mark fluorescent quenching group TAMRA.
D). reaction conditions is as follows: (employing two-step approach)
cDNA?synthesis：70℃ 10min
0℃ 2min
0℃ pause
42℃ 50min
70℃ 10min
PCR：95℃， 2min
94℃， 30s
60℃， 90s
40cycles
When each round-robin second EOS, carry out fluoroscopic examination.To BVDV quantitatively can be by comparing with the circulation thresholding (Ct, Threshold Cycle) of standard substance and calculating the initial copy number of testing sample according to typical curve.
E). the detection of rabies virus in the cow serum
25 parts of cow serums of different sources are pressed B) shown in treatment process extract viral RNA, carry out reverse transcription and quantitative fluorescent PCR reaction (pressing C) respectively, D) carry out shown in the step, carry out once successively, carry out the quantitative fluorescent PCR reaction behind the reverse transcription), each sample repeats twice, after the loop ends, the utilization instrument carries analysis software (Eppendorf quantitative real time PCR Instrument, model: Mastercyler ep realplex, software: realplex), read sample copy number to be checked.The result is:
| The milk cow numbering | The serum sample numbering | Rabies-copies/ml | Variation coefficient % |
| 2-149 | A1 | - | |
| 5-177 | A2 | - | |
| 6-312 | A3 | - | |
| 6-248 | A4 | - | |
| 5-188 | A5 | (2.81±0.11)×10 4 | 0.26 |
| 106 | A6 | - | |
| 2-257 | A7 | - | |
| 6-256 | A8 | - | |
| 03-6116 | A9 | - | |
| 5-148 | A10 | - | |
| 7-134 | A11 | - | |
| 601 | A12 | - | |
| 114 | A13 | - | |
| 2-067 | A14 | ?- | |
| 7-021 | A15 | ?- | |
| 2-034 | A16 | ?- | |
| 6-065 | A17 | ?- | |
| 2-009 | A18 | ?- | |
| 5-189 | A19 | ?- | |
| 6-237 | A20 | ?- | |
| 2-147 | A21 | ?- | |
| 6-730 | A22 | ?- | |
| 2-082 | A23 | ?- | |
| 4-042 | A24 | ?- | |
| 6-905 | A25 | ?- |
Above result shows, milk cow is numbered in the bovine serum of 5-188 and contains rabies virus, showing in the milk cows exists a spot of milk cow to carry Rabies, confirmed that simultaneously the rabies virus PCR kit for fluorescence quantitative can be successfully applied to the detection of Rabies in the bovine serum, the monitoring of bovine serum and bovine blood goods, good reproducibility, the CV value is all less than 1%.
Embodiment 3: the application of rabies virus PCR kit for fluorescence quantitative in commercially available ox serum detection
A). test kit is formed:
A) test kit is composed as follows: (10 secondary response)
RNA extracting solution A (4ml/ pipe) RNA extracting solution B (800 μ l/ pipe)
Reverse transcription reaction liquid (90 μ l/ pipe) reversed transcriptive enzyme (10 μ l/ pipe)
RNA enzyme inhibitors (400U/ pipe)
Strong positive standard substance (100 times of accurate product 20 μ l/ pipes of dilution definite value, totally four pipes)
PCR reaction tubes (aseptic, no RNA enzyme and DNA enzyme) DEPC H
2O (2ml/ pipe)
The negative critical positive criteria product of standard substance (50 μ l/ pipe) (50 μ l/ pipe)
Fluorescence quantitative PCR reaction solution (125 μ l/ pipe)
(RNA extracting solution A is an Invitrogen company product.B) reverse transcription reaction liquid, d) reversed transcriptive enzyme is available from Promega company, and g) fluorescence quantitative PCR reaction solution and RNA enzyme inhibitors (40U/ μ l) are available from TAKARA company.)
B). reverse transcription reaction liquid (the reaction cumulative volume is 25 μ l): by 5 * buffer solution, 5 μ l, the antisense primer RT of 10 μ mol/L (SEQ ID NO:2), 2.5 μ l, 10mM dNTPs1.5 μ l, each 1 μ l of reversed transcriptive enzyme and RNA enzyme inhibitors, the sterilization distilled water 9 μ l of no RNA enzyme and testing sample 5 μ l form; The fluorescent quantitation reaction solution is by 2 * buffer solution, 12.5 μ l, each 3 μ l of 10 μ mol/L sense primer FP (SEQ ID NO:1), antisense primer RT, 10 μ mol/L fluorescent probes, 0.75 μ l, sterilization distilled water 0.75 μ l, the cDNA of testing sample or standard substance are formed.Wherein fluorescent probe is the nucleotide sequence shown in (SEQ ID NO:3), and the fluorescence report group of fluorescent probe 5 ' end mark is FAM, 3 ' end mark fluorescent quenching group TAMRA.
C). reaction conditions is as follows: (employing two-step approach)
cDNA?synthesis：70℃ 10min
0℃ 2min
0℃ pause
42℃ 50min
70℃ 10min
PCR：95℃，2min
94℃， 30s
60℃， 90s
40cycles
When each round-robin second EOS, carry out fluoroscopic examination.To Rabies quantitatively can be by comparing with the circulation thresholding (Ct, Threshold Cycle) of standard substance and calculating the initial copy number of testing sample according to typical curve.
D) experimental technique
1. cell cultures
1) Syria hamster kidney cell line (BHK-21) shop system 12 orifice plates of cultivating, 1ml/ hole, 50% degree of converging;
2) serum to be checked is formulated as 5% (volume ratio) concentration with MEM;
3) behind the cell attachment, be replaced by the substratum of serum preparation to be checked, the 1ml/ hole;
4) establish feminine gender and positive control simultaneously, positive control adds 5% (volume ratio) FBS MEM that contains RABIES;
5) 37 ℃, 5% (volume ratio) CO
2Cultivate in the incubator, and observe the generation whether CPE is arranged.
6) behind the 72h, collecting cell, 2000rpm is centrifugal 5min is temporary in-80 ℃.All the other samples are handled with quadrat method.Extract total RNA of cell, as the template of RT.
2. the extraction of total RNA in the cell
Each sample adds RNA extracting solution A 400 μ l, and room temperature is placed 10min, adds RNA extracting solution B80 μ l, concuss 15s, and room temperature (20-25 ℃) is placed 2～3min; 4 ℃, the centrifugal 15min of 12000rpm gets supernatant 200 μ l, moves into a new EP pipe, adds Virahol 200 μ l again, leaves standstill 10min under the room temperature; 4 ℃, the centrifugal 15min of 12000rpm; Abandon supernatant, precipitation adds the cold ethanol 400 μ l of 75% (volume ratio), vortex, and 4 ℃, the centrifugal 5min of 7500rpm abandons supernatant and stays precipitation, leaves standstill 5～10min in room temperature and dries ethanol, adds 25 μ l DEPC water dissolution precipitation.
3. B is pressed in the reaction of reverse transcription reaction and quantitative fluorescent PCR), C) carry out shown in the step.(carry out once successively, carry out the quantitative fluorescent PCR reaction behind the reverse transcription).
E). experimental result
Above result shows that the serum of above lot number to be checked all shows as the rabies virus feminine gender, shows that simultaneously this test kit can be used for detecting the virus of cell sample.
SEQUENCE?LISTING
＜110〉Wuhan Sanli Bio-Technology Co., Ltd.
＜120〉a kind of PCR kit for fluorescence quantitative and application that detects rabies virus
＜130〉a kind of PCR kit for fluorescence quantitative and application that detects rabies virus
<160>3
<170>PatentIn?version?3.3
<210>1
<211>25
<212>DNA
＜213〉synthetic
<400>1
TAGGATGCTATATGGGTCAAGTCAGA 26
<210>2
<211>21
<212>DNA
＜213〉synthetic
<400>2
TTCAAATGTCCCTTTCCCGAAGAA 24
<210>3
<211>23
<212>DNA
＜213〉synthetic
<400>3
CAACGGTTATTGCTGCATGTGCTCCTCA 28
Claims (4)
1. PCR kit for fluorescence quantitative that detects rabies virus, this test kit contains: a) RNA extract, b) reverse transcriptase reaction liquid, c) reversed transcriptive enzyme, d) RNA enzyme inhibitors, e) primer and TaqMan probe, f) standard positive dna profiling, g) fluorescence quantitative PCR reaction solution, it is characterized in that: primer sequence is respectively sense primer: 5 '-TAGGATGCTATATGGGTCAAGTCAGA-3 ', antisense primer: 5 '-TTCAAATGTCCCTTTCCCGAAGAA-3 ', the amplicon size is 125bp, the fluorescent probe sequence is: 5 '-FAM-CAACGGTTATTGCTGCATGTGCTCCTCA-3 ', 5 ' end mark fluorescent emission group FAM of probe, 3 ' end mark fluorescent quenching group TAMRA, the standard positive dna profiling is by inserting the segmental pGEM-T carrier of rabies virus nucleoprotein district 391bp transformed into escherichia coli DH5 α, plasmid is extracted in the propagation back, and surveys A in ultraviolet spectrophotometer
260Quantitative also 10 times of gradient dilutions.
2. a kind of PCR kit for fluorescence quantitative that detects rabies virus according to claim 1, it is characterized in that: described reverse transcription reaction liquid is by 5 * buffer, and the antisense primer of 10 μ mol/L, reversed transcriptive enzyme, RNA enzyme inhibitors, 10mM dNTPs and the sterilization distilled water that does not have a RNA enzyme are formed.
3. a kind of PCR kit for fluorescence quantitative that detects rabies virus according to claim 1 is characterized in that: described fluorescence quantitative PCR reaction solution is made up of sense primer and antisense primer, 10 μ mol/L fluorescent probes and the aseptic double-distilled water of 2 * Premix, 10 μ mol/L.
4. a kind of PCR kit for fluorescence quantitative that detects rabies virus according to claim 1 is characterized in that: described standard positive template dna nucleotide sequence is:
TAGGATGCTATATGGGTCAAGTCAGATCCCTAAATGCAACGGTTATTGCT
GCATGTGCTCCTCATGAAATGTCTGTTCTAGGGGGCTATCTGGGAGAGGA
ATTCTTCGGGAAAGGGACATTTGAA。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100623976A CN101565758B (en) | 2009-06-02 | 2009-06-02 | Rabies virus detecting fluorescence quantitative PCR kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100623976A CN101565758B (en) | 2009-06-02 | 2009-06-02 | Rabies virus detecting fluorescence quantitative PCR kit and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101565758A CN101565758A (en) | 2009-10-28 |
| CN101565758B true CN101565758B (en) | 2011-08-24 |
Family
ID=41282119
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100623976A Active CN101565758B (en) | 2009-06-02 | 2009-06-02 | Rabies virus detecting fluorescence quantitative PCR kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101565758B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2811995C1 (en) * | 2023-08-18 | 2024-01-22 | Федеральное государственное бюджетное учреждение "Федеральный центр охраны здоровья животных" (ФГБУ "ВНИИЗЖ") | METHOD OF INDIRECT DETERMINING TITER OF INFECTIOUS ACTIVITY OF RABIES VIRUS IN RAW MATERIALS FOR PRODUCTION OF ATTENUATED RABIES VACCINE USING TECHNOLOGY OF ALGEBRAIC ANALYSIS OF SECOND-ORDER DIFFERENTIAL OF MAXIMUM POINT d CPmax OF PCR LOGISTIC CURVE |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643929A (en) * | 2012-04-05 | 2012-08-22 | 中华人民共和国大榭出入境检验检疫局 | Consensus-degenerate hybridoligonucleotide primer (CODEHOP) reverse transcription-polymerase chain reaction (RT-PCR) reagent and method for detecting lyssavirus viruses |
| CN106957926A (en) * | 2017-04-14 | 2017-07-18 | 北京出入境检验检疫局检验检疫技术中心 | A kind of detection kit and primer and probe that can simultaneously detect and differentiate classic swine fever, African swine fever and swine pox |
| CN108315478A (en) * | 2018-02-13 | 2018-07-24 | 吴斌 | The probe and kit of RAA Fluorometric assay hydrophobins |
| CN109439803A (en) * | 2018-12-20 | 2019-03-08 | 湖北金雀医学检验实验室有限公司 | Rabies viruses fluorescence PCR detection reagent kit |
| CN112301028B (en) * | 2020-10-27 | 2021-06-08 | 武汉珈创生物技术股份有限公司 | SCAR marker for identifying CHO cells and construction method and application thereof |
-
2009
- 2009-06-02 CN CN2009100623976A patent/CN101565758B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| 张强等.《狂犬病毒Taqman PCR检测方法的建立》.《中华流行病学杂志》.2006,第27卷(第10期),889－893. * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2812859C1 (en) * | 2023-08-14 | 2024-02-05 | Федеральное государственное бюджетное учреждение "Федеральный центр охраны здоровья животных" (ФГБУ "ВНИИЗЖ") | Method of differentiating arriah-g333 genome of genetically modified strain from pb-97 vaccine strain of rabies virus using real-time polymerase chain reaction with high-resolution peak analysis |
| RU2811995C1 (en) * | 2023-08-18 | 2024-01-22 | Федеральное государственное бюджетное учреждение "Федеральный центр охраны здоровья животных" (ФГБУ "ВНИИЗЖ") | METHOD OF INDIRECT DETERMINING TITER OF INFECTIOUS ACTIVITY OF RABIES VIRUS IN RAW MATERIALS FOR PRODUCTION OF ATTENUATED RABIES VACCINE USING TECHNOLOGY OF ALGEBRAIC ANALYSIS OF SECOND-ORDER DIFFERENTIAL OF MAXIMUM POINT d CPmax OF PCR LOGISTIC CURVE |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101565758A (en) | 2009-10-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101565758B (en) | Rabies virus detecting fluorescence quantitative PCR kit and application thereof | |
| CN101565757B (en) | Reovirus-detecting fluorescence quantitative PCR kit and application thereof | |
| CN102260749A (en) | H5, H7 and H9 subtype avian influenza virus detection kit | |
| CN103160615B (en) | Multiple PCR primer used for simultaneously detecting infectious Bovine Rhinotracheitis virus and akabane virus as well as its design method | |
| CN105018628B (en) | Differentiate the kit of brucella A19 vaccine strains and street strain | |
| CN101560572B (en) | Fluorescence quantitative PCR kit for detecting calf diarrhea virus and application | |
| CN1308461C (en) | Fluorescence quantitative PCR kit for detecting virus of aftosa and application | |
| CN101565760B (en) | Bovine parainfluenza type-3 virus detecting fluorescence quantitative PCR kit and application thereof | |
| Zhang et al. | A novel, rapid, and simple PMA-qPCR method for detection and counting of viable Brucella organisms | |
| CN108048600A (en) | A kind of fluorescent quantitative PCR detection method of infectious bovine rhinotrachetis virus | |
| CN101560573B (en) | Fluorescence quantitative PCR kit for detecting type-3 cow adenovirus | |
| KR20200060178A (en) | Primers and probes for detection of avian influenza, newcastle disease and avian infectious bronchitis viruses, and detecting method of avian influenza, newcastle disease and avian infectious bronchitis viruses using the same | |
| CN102634605A (en) | Method for detecting egg drop syndrome viruses and kit for method | |
| CN108411014A (en) | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida | |
| Lunt et al. | Cultured skin fibroblast cells derived from bluetongue virus-inoculated sheep and field-infected cattle are not a source of late and protracted recoverable virus | |
| CN102311994A (en) | Fluorescence quantitative PCR (polymerase chain reaction) detection method of aspergillus fumigatus | |
| CN101935696B (en) | Fluorescent quantization PCR (Polymerase Chain Reaction) method for detecting dog-cat leptospira as well as primer and detection kit thereof | |
| CN101565759B (en) | Bovine parvovirus detecting fluorescence quantitative PCR kit and application thereof | |
| CN103215381B (en) | Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting Sendai virus and application | |
| CN103215380B (en) | Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting mouse adenoviruses and application | |
| NL2024510B1 (en) | Multiplex real-time fluorescence pcr detection primer composition and detection method for identifying streptococcus suis and swine pasteurella multocida | |
| CN110358850B (en) | Primer group and kit for detecting serotype of streptococcus Parauberis | |
| CN104685068B (en) | The detection method of mycobacterium avium subspecies mycobacterium paratuberculosis | |
| CN107488741B (en) | A kind of method and its application of double nest-type PRC detections Pseudorabies virus street strain and gene-deleted vaccine strain | |
| Hou et al. | Development and application of a TaqMan-MGB real-time RT-PCR assay for the detection of porcine epidemic diarrhoea virus strains in China |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |