CN103215380B - Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting mouse adenoviruses and application - Google Patents
Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting mouse adenoviruses and application Download PDFInfo
- Publication number
- CN103215380B CN103215380B CN201310131591.1A CN201310131591A CN103215380B CN 103215380 B CN103215380 B CN 103215380B CN 201310131591 A CN201310131591 A CN 201310131591A CN 103215380 B CN103215380 B CN 103215380B
- Authority
- CN
- China
- Prior art keywords
- primer
- dna
- kit
- pcr
- quantitative pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting mouse adenoviruses and an application. The kit comprises (a) a DNA (Deoxyribonucleic Acid) extracted solution, (b) a primer, (c) a standard positive template and (d) a real-time SYBR Green I fluorescent quantitative PCR reaction solution, and is characterized in that DNAs are extracted from a cell sample to carry out fluorescent quantitative PCR reaction; meanwhile, the standard positive template is led in; primer sequences comprise a positive primer: 5'-ATAAGAAAGGATGCGGAAAAGGAC-3', and a negative primer: 5'-CCCAAAACAGAAGCAACAGAGTAA-3'; the amplicon is 170bp; the standard positive DNA template is connected with a pTA2 carrier of a protein encoding region 170bp through a conservative virus DNA inserted into the mouse adenoviruses to transform bacillus coli DH5alpha; and proliferation is carried out and then plasmids are extracted, and an ultraviolet spectrophotometer measures A260 to quantify and 10 times of gradient dilution is carried out. The result is accurate and reliable; the stability is good; and the repeatability is good. The sensitivity is high, the quantification is rapid and accurate and the detection range is wide. The fluorescent quantitative PCR kit can carry out epidemiological survey caused by the mouse adenoviruses and can provide technical support for a relative basic research; and an application prospect is very wide.
Description
Technical field
The present invention relates to biological technical field, more specifically relate to a kind of SYBR Green I real-time fluorescence quantitative PCR test kit detecting murine adenovirus, also relate to the application of SYBR Green I real-time fluorescence quantitative PCR test kit simultaneously, this SYBR Green I real-time fluorescence quantitative PCR test kit efficiently can carry out detection by quantitative and quality monitoring to the mouse source adenovirus of various biomaterial easily, also the epidemiology survey of murine adenovirus can be carried out, can also provide technical support for related basic research, application prospect is very extensive.
Background technology
Murine adenovirus (Murine adenovirus1, MAdV-1) belongs to Adenoviridae (Adenoviridae) Mammals and belongs to (Mastadenovirus).Adenovirus is without cyst membrane, and virus particle is icosahedron, and diameter is 80 ~ 110nm, is made up of 252 capsomeres.The mammiferous adenovirus relative molecular mass of nonspecific infection is 20 ~ 25 × 10
6, G+C content is 48% ~ 61%.Adenovirus is widely distributed, and does not generally have carinogenicity for human body, but adenovirus easily causes respiratory tract infection, as acute febrile pharyngolaryngitis, pharyngo-conjunctival fever and pneumonia etc.Murine adenovirus can damage human cardiovascular's tissue, is suspect to be a kind of cause of disease of human heart infringement.Therefore, to murine chronic persistence murine adenovirus Infect And Diagnose, control murine adenovirus is spread, prevents and treats and have positive effect.In general current detection technique has serodiagnosis, biological test, diagnostic technique in molecular biology three class:
1, serodiagnosis comprises immunofluorescence technique (IFA), double-antibody sandwich elisa detection etc.But because antiserum(antisera) and antigen immune reaction are all used in all experiments, so long reaction time, material are many, the preparatory period is long, and detection has obvious hysteresis quality, can only qualitative can not be quantitative, and poor repeatability.
2, biological test comprises experimentation on animals, egg inoculation and cell cultures.There is insensitive problem in this detection method, and some sample exists anticomplementary activity, affects Detection results.Experimentation on animals cost is higher, sense cycle is long, at substantial Biological resources and manpower and materials.
3, diagnostic technique in molecular biology, namely applies round pcr and detects murine adenovirus persistent infection.By contrast, PCR method specificity is good, and detection sensitivity is high, not only can detect live virus nucleic acid, also can the accounting fragment of direct-detection deactivation.But the end product of what common PCR detection method measured is all PCR, instead of initial DNA or RNA copy number.Owing to there is no linear relationship, so DNA or RNA copy number that cannot be quantitatively initial between the end product amount of PCR and starting template amount.The fluorescent quantitative PCR technique (Fluorogenetic Quantitative PCR, FQ-PCR) that developed recently gets up has the advantages such as highly sensitive, speed is fast, specificity is good.What current use was many is SYBR Green I fluorescent dye determination and Taqman method.Two kinds of methods all have highly sensitive, that detection speed is fast, specificity is good advantage.At gene expression dose analysis (Nellemann C, Vinggaard AM, Dalagaard M, et al.Quantification of Antiandrogen Effect Determined by Light Cycler Technology [J] .Toxicology, 2001, 163:29-38), qualitative (the Bhudevi B of pathogenic agent, Weinstock D.Fluorogenic RT-PCR assay (TaqMan) for Detection and Classification of Bovine Viral Diarrhea Virus [J] .Vet.Microbiol., 2001, 83:1-10.) with detection by quantitative (Kathy F.J.Tang, Jun Wang, Donald V.Lightner.Quantitation of Taura syndrome virus by real-timeRT-PCR with a TaqMan assay [J] .J.Virol.Methods, 115 (2004) 109-114., Birgit Liss.Improved quantitative real-time RT-PCR for expression profiling of individual cells [J] .Nucleic Acids Res., 2002, Vol.30No.17e89.Florence KP, Glaucia PB, Mireille S, et al.Quantitation of HCV RNA using real-time PCR and fluorimetry [J] .J.Virol.Methods, 2001,95:111-119.) etc. be used widely in aspect, and become the quantitative main method of current viral nucleic acid.The many fluorescence quantifying PCR method of current use has SYBR Green I fluorescent dye determination and TaqMan method, and these two kinds of methods all have highly sensitive, that detection speed is fast, specificity is good advantage.Its design of primers of fluorescent quantitative PCR detection method based on SYBR Green I fluorescence dye technology of the present invention, synthesis easier.
Summary of the invention
The object of the invention is to there are provided a kind of PCR kit for fluorescence quantitative detecting murine adenovirus, this test kit is applicable to all types fluorescence quantitative gene extender in the market, result more accurately, reliable, good stability, reproducible.Highly sensitive, quantitatively quick and precisely, sensing range is wide.
Another object of the present invention is that the PCR kit for fluorescence quantitative that there are provided a kind of murine adenovirus is detecting the application in (resisting) murine adenovirus drug research, detection by quantitative and quality monitoring can be carried out to mouse, rat cell goods, also the epidemiology survey that murine adenovirus causes can be carried out, can also provide technical support for related basic research, application prospect is very extensive.
To achieve these goals, the present invention adopts following technical measures:
Detect a SYBR Green I real-time fluorescence quantitative PCR test kit for murine adenovirus, this test kit contains:
A) DNA extraction liquid, b) primer, c) standard positive template, d) SYBR Green I real-time fluorescence quantitative PCR reaction solution, it is characterized in that: from cell sample, extract DNA, carry out quantitative fluorescent PCR reaction, introduce standard positive template, detection by quantitative unknown sample simultaneously.Primer sequence is respectively sense primer:
5 '-ATAAGAAAGGATGCGGAAAAGGAC-3 ', antisense primer: 5 '-CCCAAAACAGAAGCAACAGAGTAA-3 ', amplicon size is 170bp.Standard positive DNA profiling by the pTA2 vector bacillus coli DH 5 alpha inserting the nucleoid DNA connection protein-coding region 170bp that murine adenovirus is guarded, (preserve, and bacillus coli DH 5 alpha is the coli strain being most commonly used to conventional clone's application by this laboratory.Except supporting blue/white screening, recA1 and the endA1 sudden change of DH5 α can strengthen embedding stability and also improve the plasmid DNA quality prepared from minipreps), extract plasmid after propagation, and survey A in ultraviolet spectrophotometer
26 0quantitative also 10 times of gradient dilutions.
Described DNA extraction liquid is made up of the distilled water of 5mL100mM Tris-HCl (pH=8.5), 0.5mL0.5M EDTA, 1mL10%SDS, 2mL5M NaCl, 0.25mL0.2mg/mL Proteinase K and 41.25mL sterilizing.
Described SYBR Green I real-time fluorescence quantitative PCR reaction solution is made up of 2 × iTaq SYBR Green Supermix (with ROX), the sense primer of 10 μMs and the distilled water of antisense primer and sterilizing.
Described standard positive DNA profiling nucleotides sequence is classified as:
Ataagaaaggatgcggaaaaggaccgcatcgttgaagacataacaaattagtaaaaggtacaacataggatgtaaaatagccaatgaccatatgatcaccgcgcggacatgccgctcggagggttttgtgagctttttgcagaactttactctgttgcttctgttttggg。
In a preferred version of the present invention, standard positive DNA profiling is by containing the pTA2(of insertion object fragment purchased from TOYOBO company) vector bacillus coli DH 5 alpha, extracts plasmid after propagation, and surveys A in ultraviolet spectrophotometer
260quantitative also 10 times of gradient dilutions.Testing standard substance preparation process used is: after PCR reaction, get appropriate product gel electrophoresis detection, amplified band is single, can mix with 10 × A-attachment Mix, in 60 DEG C of reaction 30min; Be connected with pTA2 carrier again.Transformed competence colibacillus cell, and converted product is coated with slat chain conveyor, picking hickie PCR identifies that positive Hou Song Sangon Biotech (Shanghai) Co., Ltd. checks order.The positive colony bacterium of screening is inoculated into the LB substratum incubated overnight containing ammonia benzyl resistance according to sequencing result.Next day extracts plasmid DNA, surveys A in ultraviolet spectrophotometer
260quantitatively, and be diluted to gradient 10
8-10
2copy/μ L ,-70 DEG C of preservations.
Murine adenovirus (Murine adenovirus1, MAdV-1), belongs to Adenoviridae mastadenovirus.Without cyst membrane, virus particle is icosahedron, and diameter is 80 ~ 110nm, is made up of 252 capsomeres.Whole virus particle contains albumen 87%, nucleic acid 13%.Viral nucleic acid is unit molecule wire double-stranded DNA, and size is 30 ~ 38kb about.Murine adenovirus is thermo-labile, and 50 ~ 56 DEG C are easy to deactivation, and less than 36 DEG C viruses are more stable.Mouse is the natural reservoir (of bird flu viruses) of murine adenovirus, and experiment mice is mainly propagated through ight soil and urine contact in cage.Different strain MAdV, its Virulence Difference is very large, and MAdV is not identical to the susceptibility of different ages mouse yet, and clinical manifestation is varied.Naturally popularly many to cause owing to infecting FL strain, sick mouse performance be hunchbacked, coarse by hair, degradation symptom under appetite, Neonatal Mouse can death.K87 strain is infected Neonatal Mouse and adult rats and is not all fallen ill, just through ight soil constantly outside toxin expelling produce the antibody of high titre.Nude mice also can infect by naturally-occurring MAdV, but plant type is uncertain.Inoculate newborn nude mice with FL strain, duodenal hemorrhage and lethality wasting diseases can be caused.The infection of MAdV has potential threat to laboratory mice and mouse cell bioengineering product, and therefore Pharmacopoeia of the People's Republic of China regulation must detect murine adenovirus to mouse biological products.
A kind ofly detect in the PCR kit for fluorescence quantitative of murine adenovirus, have non-specific fluorescence dyestuff SYBR Green I.SYBR Green I be a kind of can with the dyestuff of double-stranded DNA minor groove binding.Not with double-stranded DNA in conjunction with time, its fluorescent signal is very weak, and after it is combined with double-stranded DNA, fluorescent signal greatly strengthens and also can be detected by instrument.This feature of SYBR Green I is utilized to detect pcr amplification product.The maximum absorption wavelength of SYBR Green I is about 497nm, and emission wavelength is maximum is about 520nm.SYBR Green I has many good qualities in the real-time context of detection of nucleic acid.It can combine with double-stranded DNAs all in system, and without the need to being different template specific customization, therefore price is relatively low.In addition, because a PCR primer can combine with multiple SYBR Green I dyestuff, therefore sensitivity is very high.To murine adenovirus quantitative, by the cycle threshold (Ct, Threshold Cycle) with standard substance, comparing draws.Ct value is in PCR process, the accumulation of fluorescence volume exceedes the cycle number of substrate fluorescence volume, the denary logarithm of Ct value and starting template number is linear (log (starting template number)=Ct value/slope+X-axis intercept), Ct value is less, starting template number is more, on the contrary, Ct value is larger, and starting template number is fewer.Utilize the Ct value of positive gradient standard form to make typical curve, more accurately can measure the starting copy number of this sample according to the Ct value of testing sample.
A kind ofly detect in the PCR kit for fluorescence quantitative of murine adenovirus, for the singularity of the genomic target fragment base arrangement of murine adenovirus, reflection system (primer concentration, amplification program etc.) is optimized, and Q-PCR technology and quantitative detection system are combined, use it for the detection by quantitative of the murine adenovirus sample in various source.Pass through prioritization scheme, establish the method for detection by quantitative murine adenovirus, and develop murine adenovirus immue quantitative detection reagent box, the sensitivity of this test kit can detect the virogene copy number of less than 1000 in each reaction system, and sensing range can reach seven orders of magnitude.
In another aspect of the present invention, the PCR kit for fluorescence quantitative that present invention also offers a kind of murine adenovirus is detecting the application in murine adenovirus drug research, and its application process comprises the following steps:
A. use c) standard positive DNA profiling by inserting the pTA2(of object fragment purchased from TOYOBO company) vector bacillus coli DH 5 alpha, extract plasmid after propagation, and quantitative with ultraviolet spectrophotometer;
B. a) DNA extraction liquid is used to extract DNA from sample to be measured;
C. quantitative fluorescent PCR is by b) primer, d) SYBR Green I real-time fluorescence quantitative PCR reaction solution, c) standard positive DNA profiling or extract specimen dna composition, machine in the fluorescent quantitation reaction solution PCR reaction system having added standard substance and product to be tested, carries out PCR detection with fluorescent quantitative detector;
D. by comparing the cycle threshold of testing sample and standard substance, calculate the starting copy number of testing sample according to the typical curve of matching gained, and whether judge in testing sample containing murine adenovirus with this.
The PCR kit for fluorescence quantitative of the detection murine adenovirus provided in the present invention can carry out accurate quantitative analysis detection to the murine adenovirus sample in various source, and detection by quantitative and quality monitoring can be carried out to mouse goods and mouse cell, also the epidemiology survey that murine adenovirus causes can be carried out, can also provide technical support for related basic research, application prospect is very extensive.
The present invention compared with prior art has the following advantages and effect:
1. compared with traditional quantitative methods, this real-time fluorescence quantitative PCR has the feature of high sensitivity, high specific and high accuracy, directly just data are collected to the every circulation primary of PCR, constitution and implementation amplification curve, determine Ct value accurately, thus determine initiate dna copy number according to Ct value, accomplish that accounting is truly quantitative.
2., compared with Taqman method, this experiment adopts SYBR Green I dyestuff, can distinguish single primer, primer dimer, non-specific amplification etc., make result more reliable by the analysis of melt curve analysis.SYBR Green I dyestuff also greatly reduces experimental cost.
3. sensing range is wide, 10
8-10
2have good linear relationship (R=0.998) in copies/reaction concentration range, sensing range can reach seven orders of magnitude, and its sensitivity can detect below 1000copies.
4. this real-time fluorescence quantitative PCR utilizes outer typical curve, be up to now quantitatively the most accurately, the best quantivative approach of circulation ratio, obtained global generally acknowledged, be widely used in the numerous areas such as gene expression research, curative effect of medication examination, pathogen detection.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.Be to be understood that, these embodiments are only not used in restriction the scope of protection of present invention for illustration of the present invention, not marked specific experiment condition and method in the following example, usually conveniently condition as: J. Pehanorm Brooker is edited, Science Press, 2002, Molecular Cloning: A Laboratory guide (third edition); D.L. the chief editor such as Spector, Science Press, 2001, cell experiment guide; F.M. the chief editor such as Ao Sibai, Science Press, 2005, fine works molecular biology experiment guide, or according to the condition of manufacturer's suggestion.
Embodiment 1:
Detect a PCR kit for fluorescence quantitative for murine adenovirus, this test kit composition and reaction conditions thereof are:
A) test kit is composed as follows: (10 secondary responses detect 10 parts of testing samples)
DNA extraction liquid (10mL/ pipe) strong positive standard substance (50 μ L/ manage) PCR reaction tubes (aseptic)
Negative standards's product (50 μ L/ manage) critical positive criteria product (50 μ L/ manage);
Strong positive standard substance, namely copy number is 10
8the standard positive DNA profiling of c/r;
Negative standards's product, i.e. L929 cell (host cell of the murine adenovirus) DNA of non-infected mice adenovirus;
Critical positive criteria product, namely copy number is 10
2the standard positive DNA profiling of c/r.
SYBR Green I real-time fluorescence quantitative PCR reaction solution (110 μ L/ manage) (d) SYBR Green I real-time fluorescence quantitative PCR reaction solution, purchased from Bio-rad company)
Described DNA extraction liquid (50mL) is made up of the distilled water of 5mL100mM Tris-HCl (pH=8.5), 0.5mL0.5M EDTA, 1mL10%SDS, 2mL5M NaCl, 0.25mL0.2mg/mL Proteinase K and 41.25mL sterilizing.
B) fluorescent quantitation reaction solution (reaction cumulative volume is 20 μ L): 2 × iTaq SYBR Green Supermix with ROX, sense primer FP and antisense primer RT each 1 μ L, testing sample DNA or standard substance 1 μ L, sterilizing distilled water 8 μ L.
C) reaction conditions is as follows: FQ-PCR:95 DEG C, 3min
95℃，15s
60℃，45s
40cycles
Fluoroscopic examination is carried out at the end of the second step of each circulation.Quantitative by comparing with the cycle threshold (Ct, Threshold Cycle) of standard substance and calculate the starting copy number of testing sample according to typical curve to murine adenovirus.
D) PCR kit for fluorescence quantitative detects the sensitivity of murine adenovirus, sensing range and stability:
Get c) standard positive template and be diluted to 10
8-10
2c/r, totally 8 concentration gradients, each concentration three repetition, add SYBRGreen I real-time fluorescence quantitative PCR reaction solution 2 × iTaq SYBR Green Supermix with ROX10 μ L, the each 1 μ L of sense primer FP and antisense primer RT, testing sample DNA or standard substance 1 μ L, sterilizing distilled water 7 μ L.Add the PCR reaction tubes of reference numeral respectively, on fluorescent quantitative detector, the parallel PCR that is detects.Cycling condition is: 95 DEG C of 3min, 95 DEG C of 15s, 60 DEG C of 45s, 40 circulations of increasing.The programming of fluoroscopic examination is carried out at the end of the second step of each circulation, and determined wavelength is 518nm.
After loop ends, use the analysis software that instrument carries, read measuring samples copy number.Result is:
| Sequence number | Title | Type | Threshold value (Ct) | Setting concentration | Variation coefficient % |
| 1 | A1 | Standard | 9.18 | 100000000 | 0.43 |
| 2 | A2 | Standard | 9.26 | 100000000 | 0.43 |
| 3 | A3 | Standard | 9.23 | 100000000 | 0.11 |
| 4 | B1 | Standard | 12.67 | 10000000 | 0.56 |
| 5 | B2 | Standard | 12.54 | 10000000 | 0.48 |
| 6 | B3 | Standard | 12.58 | 10000000 | 0.16 |
| 7 | C1 | Standard | 15.51 | 1000000 | 0.00 |
| 8 | C2 | Standard | 15.57 | 1000000 | 0.39 |
| 9 | C3 | Standard | 15.44 | 1000000 | 0.45 |
| 10 | D1 | Standard | 19.18 | 100000 | 0.00 |
| 11 | D2 | Standard | 19.22 | 100000 | 0.21 |
| 12 | D3 | Standard | 19.14 | 100000 | 0.21 |
| 13 | E1 | Standard | 22.95 | 10000 | 0.09 |
| 14 | E2 | Standard | 23 | 10000 | 0.13 |
| 15 | E3 | Standard | 22.97 | 10000 | 0.00 |
| 16 | F1 | Standard | 26.8 | 1000 | 0.64 |
| 17 | F2 | Standard | 26.42 | 1000 | 0.79 |
| 18 | F3 | Standard | 26.68 | 1000 | 0.19 |
| 19 | G1 | Standard | 30.98 | 100 | 0.49 |
| 20 | G2 | Standard | 31.4 | 100 | 1.85 |
| 21 | G3 | Standard | 30.12 | 100 | 2.30 |
Above result shows: this test kit sensing range is wide, 10
8-10
2good linear relationship (R=0.998) is had in copies/reaction concentration range, sensing range can reach seven orders of magnitude, its sensitivity can detect below 1000copies, and good stability, once in experiment, three corresponding variation coefficient of repeat samples (CV) are less than 2.5%, and its higher repeatability is described.
Embodiment 2:
The PCR kit for fluorescence quantitative of murine adenovirus is detecting the application in L929 cell infection murine adenovirus drug research, and its application process is:
A) test kit is composed as follows: (10 secondary response)
DNA extraction liquid (10mL/ pipe);
Strong positive standard substance (50 μ L/ manage);
PCR reaction tubes (aseptic);
Negative standards's product (50 μ L/ manage);
Critical positive criteria product (50 μ L/ manage);
SYBR Green I real-time fluorescence quantitative PCR reaction solution (110 μ L/ manage) (d) SYBR Green I real-time fluorescence quantitative PCR reaction solution, purchased from Bio-rad company).
B) viral process is extracted in L929 cell: will infect or not infect the L929 cell cultures of murine adenovirus in T25 Tissue Culture Flask, and added 500 μ L a) DNA extract, in 37 DEG C of digestion 3h; In cell dissociation buffer, add isopyknic Virahol, mix gently, in the centrifugal 10min of 10000 × g; Abandoning supernatant, will be precipitated and dissolved in the aseptic H of 40 μ L
2o.
C) reaction conditions is as follows: FQ-PCR:95 DEG C, 3min
95℃，15s
60℃，45s
40cycles
Fluoroscopic examination is carried out at the end of the second step of each circulation.Quantitative by comparing with the cycle threshold (Ct, Threshold Cycle) of standard substance and calculate the starting copy number of testing sample according to typical curve to murine adenovirus.
D) PCR kit for fluorescence quantitative detects the murine adenovirus in L929 cell:
Get measuring samples and negative control (the L929 cell DNA of non-infected mice adenovirus), all do three repetitions, add SYBR Green I real-time fluorescence quantitative PCR reaction solution 2 × iTaq SYBR Green Supermix with ROX10 μ L, the each 1 μ L of sense primer FP and antisense primer RT, testing sample DNA or standard substance 1 μ L, sterilizing distilled water 7 μ L.Add the PCR reaction tubes of reference numeral respectively, on fluorescent quantitative detector, the parallel PCR that is detects.Cycling condition is: 95 DEG C of 3min, 95 DEG C of 15s, 60 DEG C of 45s, 40 circulations of increasing.The programming of fluoroscopic examination is carried out at the end of the second step of each circulation, and determined wavelength is 518nm.
E) after loop ends, use the analysis software that instrument carries, read measuring samples copy number.Result is:
| Sample number into spectrum | Ct value | Murine adenovirus-copise/ml | Variation coefficient % |
| 1 | 17.37 | 4.09×10 5 | 0.52 |
| 2 | 17.46 | 3.86×10 5 | 0.00 |
| 3 | 17.54 | 3.67×10 5 | 0.46 |
| 4 | - | - | |
| 5 | - | - | |
| 6 | - | - |
Above result shows, is numbered in the sample of 1,2,3 and contains murine adenovirus, confirms that murine adenovirus PCR kit for fluorescence quantitative can be successfully applied to the plasmic DNA of murine adenovirus infection, and reproducible, and the variation coefficient is less than 1%.
Claims (4)
1. one kind is detected the PCR kit for fluorescence quantitative of murine adenovirus, this test kit contains: a) DNA extraction liquid, b) primer, c) standard positive template, d) SYBR Green I real-time fluorescence quantitative PCR reaction solution, it is characterized in that: from cell sample, extract DNA, carry out quantitative fluorescent PCR reaction, introduce standard positive template, primer sequence is respectively sense primer simultaneously:
5 '-ATAAGAAAGGATGCGGAAAAGGAC-3 ', antisense primer: 5 '-CCCAAAACAGAAGCAACAGAGTAA-3 ', amplicon size is 170bp, standard positive DNA profiling is by the pTA2 vector bacillus coli DH 5 alpha inserting the viral DNA connection protein-coding region 170bp that murine adenovirus is guarded, extract plasmid after propagation, and survey A in ultraviolet spectrophotometer
260quantitative also 10 times of gradient dilutions;
Described standard positive DNA profiling nucleotides sequence is classified as:
ataagaaaggatgcggaaaaggaccgcatcgttgaagacataacaaattagtaaaaggtacaacataggatgtaaaatagccaatgaccatatgatcaccgcgcggacatgccgctcggagggttttgtgagctttttgcagaactttactctgttgcttctgttttggg。
2. a kind of PCR kit for fluorescence quantitative detecting murine adenovirus according to claim 1, is characterized in that: described DNA extraction liquid is made up of the distilled water of 5mL 100mM Tris-HClpH=8.5,0.5mL 0.5M EDTA, 1mL 10%SDS, 2mL5MNaCl, 0.25mL 0.2mg/mL Proteinase K and 41.25mL sterilizing.
3. a kind of PCR kit for fluorescence quantitative detecting murine adenovirus according to claim 1, is characterized in that: described SYBR Green I real-time fluorescence quantitative PCR reaction solution is made up of 2 × iTaq SYBR Green Supermix, the sense primer of 10 μMs and the distilled water of antisense primer and sterilizing.
4. the PCR kit for fluorescence quantitative of a kind of murine adenovirus according to claim 1 detects the application in murine adenovirus medicine in preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310131591.1A CN103215380B (en) | 2013-04-16 | 2013-04-16 | Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting mouse adenoviruses and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310131591.1A CN103215380B (en) | 2013-04-16 | 2013-04-16 | Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting mouse adenoviruses and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103215380A CN103215380A (en) | 2013-07-24 |
| CN103215380B true CN103215380B (en) | 2015-03-25 |
Family
ID=48813528
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310131591.1A Active CN103215380B (en) | 2013-04-16 | 2013-04-16 | Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting mouse adenoviruses and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103215380B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104131006A (en) * | 2014-08-18 | 2014-11-05 | 南京农业大学 | Rapid detection kit for human adenoviruses |
| CN106811551A (en) * | 2017-03-22 | 2017-06-09 | 中国农业科学院上海兽医研究所 | The primer pair of the type aviadenovirus of fluorescence quantitative PCR detection FAdV 4, probe, kit and method |
-
2013
- 2013-04-16 CN CN201310131591.1A patent/CN103215380B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| Adeno-associated virus infection of murine fibroblasts with help provided by mouse adenovirus;Bhrigu V et al;《Virology》;20090521;第390卷(第1期);22-30 * |
| Polymerase chain reaction for detection of guinea pig adenovirus;pring-akerblom p et al;《J Vet Diagn Invest》;19971231;第9卷;232-236 * |
| 腺病毒荧光定量PCR快速检测方法建立;茅海燕等;《中国公共卫生》;20101231;第26卷(第1期);95-96 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103215380A (en) | 2013-07-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113502352B (en) | EMA-ddPCR primer and probe for detecting infectious ASFV and application | |
| Wang et al. | Rapid visual detection of cyprinid herpesvirus 2 by recombinase polymerase amplification combined with a lateral flow dipstick | |
| Xie et al. | Reverse transcription loop-mediated isothermal amplification assay for rapid detection of Bovine Rotavirus | |
| CN107828914A (en) | Infectious subcutaneous and haematopoietic necrosis virus（IHHNV）RAA constant temperature fluorescence detection method and reagent | |
| Zhang et al. | An isothermal molecular point of care testing for African swine fever virus using recombinase-aided amplification and lateral flow assay without the need to extract nucleic acids in blood | |
| CN105886663A (en) | Locked nucleic acid sensitivity-enhanced fluorescent quantitative PCR (polymerase chain reaction) detection reagent kit for wild strains of porcine pseudorabies viruses | |
| CN103215380B (en) | Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting mouse adenoviruses and application | |
| CN110305975A (en) | A kind of RPA kit and application thereof of quick detection chicken Mycoplasma synoviae | |
| Milne et al. | A reliable RT-PCR–ELISA method for the detection of infectious pancreatic necrosis virus (IPNV) in farmed rainbow trout | |
| Soliman et al. | Immunocapture and direct binding loop mediated isothermal amplification simplify molecular diagnosis of Cyprinid herpesvirus-3 | |
| CN101565757B (en) | Reovirus-detecting fluorescence quantitative PCR kit and application thereof | |
| CN101565758B (en) | Rabies virus detecting fluorescence quantitative PCR kit and application thereof | |
| Jack et al. | Microarray-based detection of viruses causing vesicular or vesicular-like lesions in livestock animals | |
| CN109136396A (en) | A kind of specific detection primer and detection kit of clostridium welchii disease | |
| CN102329890B (en) | Primer, probe and method for detecting mouse adenovirus | |
| Qi et al. | Development and application of a TaqMan-based real-time PCR method for the detection of the ASFV MGF505-7R gene | |
| CN103215382A (en) | Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting ectromelia virus and application | |
| CN103215381B (en) | Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting Sendai virus and application | |
| CN101560572B (en) | Fluorescence quantitative PCR kit for detecting calf diarrhea virus and application | |
| Kaffashi et al. | Development of TaqMan real-time polymerase chain reaction assay for detection of chicken anemia virus in Newcastle disease vaccines | |
| CN102329889B (en) | Primer and probe and method for detecting poxvirus muris | |
| CN101565760B (en) | Bovine parainfluenza type-3 virus detecting fluorescence quantitative PCR kit and application thereof | |
| Roh et al. | Simultaneous detection of five major serotypes of Avian coronavirus by a multiplex microsphere-based assay | |
| Chen et al. | Development and application of a fiber2 protein-based indirect ELISA for detection of duck adenovirus 3 | |
| CN105861751A (en) | Primer pair and fluorescent quantitative PCR kit for detecting mouse adenovirus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 430000 Hubei Province, Wuhan East Lake Development Zone high-tech road No. 666 Wuhan national biological industry base project B, C, D & B1 building area Patentee after: Canvest (Wuhan) Biotechnology Co., Ltd. Address before: 430000 East Lake, Hubei Province Development Zone, high tech Avenue, No. 666 Wuhan national biological industry base project B, C, D District R & D building B1 building Patentee before: Wuhan Canvest Biotechnology Co., Ltd. |