CN101565759B - Bovine parvovirus detecting fluorescence quantitative PCR kit and application thereof - Google Patents
Bovine parvovirus detecting fluorescence quantitative PCR kit and application thereof Download PDFInfo
- Publication number
- CN101565759B CN101565759B CN2009100623980A CN200910062398A CN101565759B CN 101565759 B CN101565759 B CN 101565759B CN 2009100623980 A CN2009100623980 A CN 2009100623980A CN 200910062398 A CN200910062398 A CN 200910062398A CN 101565759 B CN101565759 B CN 101565759B
- Authority
- CN
- China
- Prior art keywords
- pcr
- primer
- bovine parvovirus
- probe
- fluorescent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a bovine parvovirus detecting fluorescence quantitative PCR kit and an application thereof. The kit comprises: a) a DNA extraction reagent, b) a hot start Taq DNA polymerase, c) a primer and a TaqMan probe, d) a standard positive DNA template, and e) a PCR fluorescence quantitative reaction solution. The kit is characterized in that: primer sequence is a sense primer: 5'-CCAGTACCAGGAAACGGAGAC-3', and an antisense primer: 5'-GCATGTATTCCGGTCTCCAA -3', and the size of an amplicon is 118 bp; the sequence of a fluorescence probe is: 5'-FAM-CCTCAACATCTACGTCACCGGACAA-TAMRA-3',the 5' end of the probe is marked with a fluorescence emission group FAM, the 3' end is marked with a fluorescence quenching group TAMRA, the standard positive DNA template transforms a colon bacillus DH5 alpha by a pGEM-T carrier inserted with bovine parvovirus VP3 protein coding zone 118 bp segment, plasmid is extracted after proliferation, an A260 ration is measured in an ultraviolet spectrophotometer, and the plasmid is diluted by 10 times of gradient. The fluorescence quantitative PCR kit, applied to the epidemiology investigation of cow bovine parvovirus infection, can efficiently and conveniently monitor the bovine parvovirus pollution in serum products in real time, and is widely applicable to the epidemiology investigation of bovine parvovirus infection.
Description
CCTCAACATCTACGTCACCGGACAA?25
The present invention relates to biological technical field, relate to a kind of PCR kit for fluorescence quantitative that detects bovine parvovirus, the purposes that also relates to PCR kit for fluorescence quantitative simultaneously, be applicable to that pollution is monitored in real time to the bovine parvovirus in the serum product, be widely used in the epidemiology survey of this virus infection simultaneously, can also provide technical support for related basic research.
Background technology
(Bovine parvovirus BPV) belongs to the Parvoviridae parvovirus and belongs to bovine parvovirus, and genome is the dna molecular of strand, mainly causes respiratory tract and the intestinal tract disease of ox, and its principal character is to cause ox diarrhoea to cause the cow miscarriage in addition.Artificial per os or vein infect does not eat the newborn calf that does not contain antibody in colostrum, the body, diarrhoea occurs in 24～48 hours, and diarrhoea is simultaneously with viremia.And this virus lays dormant phase is difficult for being realized, its susceptible and latent bring serious economy loss for livestock industry and international trade thereof.Therefore, this disease always is one of transmissible disease of paying close attention to the most of international community.The rapid detection of bovine parvovirus is control and eliminates this sick prerequisite, but the conventional sense method of parvovirus has the some shortcomings part, and in general detection technique has serodiagnosis technology, biological test, diagnosis of molecular biology technology three classes:
1. serodiagnosis technology comprises complement fixation test, neutralization experiment, aggegation experiment, immunodiffusion(ID), precipitation experiment, immuno-electrophoresis, immunofluorescence technique, radioimmunoassay and immunoelectronmicroscopy etc.In these methods, obtain having of common recognition, employing and widespread use: complement fixation test, indirect hemagglutination experiment, agar diffusion experiment, neutralization experiment.But because the reaction of antiserum(antisera) and antigen immune is all used in all experiments, long reaction time, material is many, the preparatory period is long, detection has tangible hysteresis quality, can only be qualitative can not be quantitative, and poor repeatability.
2. biological test comprises experimentation on animals, egg inoculation and cell cultures.There is insensitive problem in this detection method, and has anticomplementary activity in some sample, and influence detects effect.Experimentation on animals cost height, the cycle is long, waste Biological resources and manpower and materials.
3. the diagnosis of molecular biology technology comprises nucleic acid hybridization, isoelectric focusing electrophoresis, oligonucleotide fingerprint map analyzing, polyacrylamide gel electrophoresis, polymerase chain reaction, monoclonal antibody technique etc.
Detection methods such as nucleic acid hybridization, isoelectric focusing electrophoresis, oligonucleotide fingerprint map analyzing, polyacrylamide gel electrophoresis more are applicable to carries out more deep research to virus characteristic, because total system complicated operation, process is various, the cost height, be not suitable for carrying out simultaneously mass detection, thereby be very limited.By contrast, regular-PCR method specificity is good, and the detection sensitivity height not only can detect live virus nucleic acid, also can directly detect the nucleic acid fragment of deactivation.Sample can be a bovine serum, can be tissues such as tonsilla, lymphoglandula, spinal cord, muscle and skin also, and this is that immunological method is irreplaceable.But what this traditional quantivative approach was measured all is the end product of PCR, rather than the initiate dna copy number.Owing to do not have linear relationship between the end product amount of PCR and the starting template amount, so can not calculate the initiate dna copy number according to final PCR product amount.Therefore, measuring cow adenovirus how fast, accurately is one of main difficult problem that faces.
The quantitative fluorescent PCR that development in recent years is got up (Fluorogenetic Quantitative PCR, FQ-PCR) technology is highly sensitive with it, speed is fast, advantages such as high specificity are at gene expression dose analysis (Nellemann C, Vinggaard AM, Dalgaard M, et al.Quantification of Antiandrogen Effect Determinedby LightCycler Technology[J] .Toxicology, 2001,163:29-38), qualitative (the McGoldrick A of pathogenic agent, Lowings JP, Ibata G, et al.A Novel Approach to the Detection ofClassical Swine Fever Virus by RT-PCR with a Fluorogenic Probe (TaqMan) [J] .J.Virol.Methods, 1998,72:125-135.; Bhudevi B, Weinstock D.Fluorogenic RT-PCRassay (TaqMan) for Detection and Classification of Bovine Viral Diarrhea Virus[J] .Vet.Microbiol., 2001,83:1-10.) and detection by quantitative (Kathy F.J.Tang, Jun Wang, DonaldV.Lightner.Quantitation of Taura syndrome virus by real-time RT-PCR with aTaqMan assay[J] .J.Virol.Methods, 115 (2004) 109-114.; Michaela Schwaiger, PascalCassinotti.Development of a quantitative real-time RT-PCR assay with internalcontrol for the laboratory detection of tick borne encephalitis virus (TBEV) RNA[J] .J.Clin.Microbiol., 27 (2003) 136-145.; R.Frank Cook
A, *, S.J.Cook
aEt al.Development of a multiplex real-time reverse transcriptase-polymerase chain reactionfor equine infectious anemia virus (EIAN) [J] .J.Virol.Methods, 105 (2002) 171-179.; Birgit Liss
*.Improved quantitative real-time RT-PCR for expression profiling ofindividual cells[J] .Nucleic Acids Res., 2002, Vol.30 No.17e89.; Franck Housseau
A, 1Imberly R.Lindsey
A, 1, et al.Quantitative real-time RT-PCR as a method formonitoring T lymphocyte reactivity to full-length tyrosinase protein in vaccinatedmelanoma patients[J] and .J.Immunol.Methods 266 (2002) 87-103.; Desire N, Dehee A, Schneider V, et al.Quantification of Human Immunodeficiency Virus Type 1 ProviralLoad by a TaqMan Real-Time PCR Assay[J] .J.Clin.Microbiol, 2001,39:1303-1310.; Martell M, Gomez J, Esteban JI, et al.High-Throughput Real-TimeReverse Transcription-PCR Quantitation of Hepatitis C Virus RNA[J] .J.Clin.Microbiol, 1999,37:327-332.; Kearns AM, Turner AJL, Eltringham GJA, et al.RapidDetection and Quantification of CMV DNA in Urine using Lightcycler-basedReal-time PCR[J] .J.Clin.Virol, 2002,24:131-134; Florence KP, Glaucia PB, MireilleS, et al.Quantitation of HCV RNA using real-time PCR and fluorimetry[J] .J.Virol.Methods, 2001,95:111-119; Zakhartchouk A, Connors W, van Kessel A, et al.Bovineadenovirus type 3 containing heterologous protein in the C-terminus of minor capsidprotein IX.Virology, 2004,320 (2): 291-300.) etc. be used widely in the aspect, and become the quantitative main method of current viral nucleic acid, domestic existing at present test kit listing about third liver, hepatitis B, mycoplasma, acquired immune deficiency syndrome (AIDS), tuberculosis detection by quantitative.
Summary of the invention
The objective of the invention is to be to provide a kind of PCR kit for fluorescence quantitative that detects bovine parvovirus, this PCR test kit is applicable to all types fluorescence quantitative gene extender in the market, highly sensitive, quantitatively quick and precisely, sensing range is wide, good stability.
Another object of the present invention is to be to provide a kind of application of PCR kit for fluorescence quantitative in the epidemiology survey of milk cattle infected parvovirus that detects bovine parvovirus, can pollute the bovine parvovirus in the serum product efficiently and easily and monitor in real time, can also provide technical support for related basic research.
To achieve these goals, the present invention adopts following technical measures, and this PCR kit for fluorescence quantitative comprises:
A) DNA extraction reagent, b) warm start Taq archaeal dna polymerase, c) primer and TaqMan probe, d) standard positive dna profiling, e) PCR fluorescent quantitation reaction solution, it is characterized in that: primer sequence is respectively sense primer (FP): 5 '-CCAGTACCAGGAAACGGAGAC-3 ', antisense primer (RT): 5 '-GCATGTATTCCGGTCTCCAA-3 ', the amplicon size is 118bp, the fluorescent probe sequence is: 5 '-FAM-CCTCAACATCTACGTCACCGGACAA-TAMRA-3 ' (SEQ ID NO:3), 5 ' end mark fluorescent emission group FAM of probe, near 3 ' end mark fluorescent quenching group TAMRA, the standard positive dna profiling is by inserting the segmental pGEM-T carrier of parvovirus VP3 protein-coding region 118bp (available from Promega company) transformed into escherichia coli DH5 α (available from Invitrogen company, Bacillus coli communis DH5 α), the plasmid preparation is extracted in the propagation back, and surveys A in ultraviolet spectrophotometer
260Quantitative also 10 times of gradient dilutions.Described PCR fluorescent quantitation reaction solution is made up of the sterilized water of the fluorescent probe of the sense primer of 10 * buffer, 10 μ M and antisense primer, 10 μ M and warm start Taq archaeal dna polymerase, nuclease free.Described standard positive template dna sequence dna is:
CCAGTACCAGGAAACGGAGACTCGTTCCTCAACATCTACGTCACCGGACAAGTCTCCTGCGAAGTCGTCTGGGAGGTAGAAAAGAGGGGCACCAAAAATTGGAGACCGGAATACATGC。
In a preferred version of the present invention, the fluorescent quantitation reaction solution is by sense primer (FP), antisense primer (RT), and fluorescent probe (TaqMan), 10 * buffer solution, warm start Taq archaeal dna polymerase, the sterilization distilled water of nuclease free is formed; In a concrete scheme of the present invention, the fluorescent quantitation reaction solution is by 10 * buffer solution, 2.5 μ l, and 10 μ mol/L justice (FP), antisense (RP) primer be 3 μ l respectively, 10 μ mol/L fluorescent probes, 0.75 μ l, dNTPs (10mM) 1 μ l, warm start Taq archaeal dna polymerase 0.25 μ l, Mg
2SO
4(50mM) 0.5 μ l, the sterilization distilled water 9 μ l of nuclease free form.Wherein fluorescent probe is the nucleotide sequence shown in (SEQ ID NO:3), and the fluorescence report group of fluorescent probe 5 ' ' end mark is FAM, 3 ' end mark fluorescent quenching group TAMRA.
In a preferred version of the present invention, the standard positive dna profiling inserts the segmental pGEM-T of purpose (available from Promega company) preparing carriers by containing, and surveys A in ultraviolet spectrophotometer
260Quantitative also 10 times of gradient dilutions.Testing used standard substance preparation process is: downcut behind the PCR product electrophoresis and contain the segmental gel of purpose, gel-purified test kit purifying with Omega company, spend the night for 4 ℃ with pGEM-T carrier (available from promega company) and to be connected, the transformed competence colibacillus cell, converted product is coated with dull and stereotyped the cultivation, picking hickie PCR send the order-checking of Ying Jun Bioisystech Co., Ltd after identifying the positive, according to sequencing result the positive colony bacterium of screening is inoculated into the LB substratum incubated overnight that contains the ammonia Bian, prepare plasmid DNA with the SDS alkaline lysis, behind the gel-purified test kit purifying of Omega company, survey A in ultraviolet spectrophotometer
260Quantitatively, and be diluted to gradient 10
9-10
2Copy/μ L ,-70 ℃ of preservations, the equal nuclease free of used all article.
In the invention provides the PCR kit for fluorescence quantitative that detects bovine parvovirus, there is one one end to be marked with the specificity fluorescent probe that the fluorescence report group the other end is marked with the fluorescent quenching group, when probe is complete, two groups distance on space structure is close mutually, the fluorescence that 5 ' end reporter group produces is because FRET (fluorescence resonance energy transfer) (FRET) and by the group cancellation of going out of 3 ' end quenching, so there is not the variation of fluorescent signal in the system.In PCR annealing and extension process, probe combines with template specificity, extension along with primer, the Taq archaeal dna polymerase utilizes its 5 '-3 ' circumscribed activity that probe cutting is discharged reporter group, destroyed the FRET between two groups like this, the fluorescent probe that the fluorescence that reporter group discharged can be built in the detection by quantitative instrument detects, and template is whenever duplicated once, just there is a probe to be cut off, follows the release of a fluorescent signal.Because d/d fluorophor number and PCR product quantity are man-to-man relations, so the accumulation volume of the increase of fluorescence volume and PCR product is proportionlity.To BPV quantitatively can comparing draws by the circulation thresholding (Ct, Threshold Cycle) with standard substance.The Ct value is in the PCR process, and the accumulation of fluorescence volume surpasses the cycle number of substrate fluorescence volume, and Ct value and initial modulus are the certain proportion relation, and the Ct value is more little, and the starting template number is many more, and on the contrary, the Ct value is big more, and the starting template number is few more.Utilize the Ct value of positive gradient standard form to make typical curve, can accurately measure the initial copy number of this sample again according to the Ct value of testing sample.
In the invention provides the PCR kit for fluorescence quantitative that detects bovine parvovirus, the singularity of arranging at the genomic target fragment Nucleotide of bovine parvovirus is with reaction system (primer and concentration and probe concentration, Mg
2+Concentration, amplification program etc.) optimize, and fluorescent quantitative PCR technique and detection by quantitative system (comprised the LigthCycler system, Roche, ABI Prism system, PE Applied Bioasystems) combines, use it for the detection by quantitative of the bovine parvovirus sample in various sources.Pass through prioritization scheme, experiment repeatedly, and compare with traditional detection method, set up the method for detection by quantitative BPV, and develop the detection by quantitative test kit of bovine parvovirus, the sensitivity of this test kit can detect 100 virogene copy numbers in each reaction system, sensing range can reach eight orders of magnitude, is that other any method is incomparable.
In another aspect of the present invention, a kind of application of PCR kit for fluorescence quantitative in the epidemiology survey of milk cattle infected parvovirus that detects bovine parvovirus also is provided, the method that PCR kit for fluorescence quantitative detects bovine parvovirus, this method comprises the following steps:
A) use e) the standard positive dna profiling is by inserting the segmental pGEM-T of purpose (available from Promega company) preparing carriers, and quantitative with ultraviolet spectrophotometer;
B) use a) that the DNA extract extracts DNA from sample regulating YIN and YANG standard substance to be measured, add C then) e) PCR fluorescent quantitation reaction solution and optimize reagent, b) warm start Taq archaeal dna polymerase, c) primer and TaqMan probe;
D) with C) added machine on the fluorescent quantitation reaction solution PCR reaction system of standard substance and testing sample in the step, carry out the PCR detection with the fluorescent quantitation detector;
E) calculate the initial copy number of testing sample according to typical curve by the circulation thresholding of testing sample and standard substance relatively.
The PCR kit for fluorescence quantitative of the detection bovine parvovirus that provides in the present invention can carry out accurate detection by quantitative to the bovine serum sample in various sources, thereby can monitor in real time epidemic situation, can be widely used in the import and export of animal product and the safety detection and the quality monitoring of animal-derived food product, can be related basic research technical support is provided.
The present invention compared with prior art has the following advantages and effect:
1. compare with traditional quantivative approach, this real-time fluorescence quantitative PCR has high sensitivity, the characteristics of high specific and high accuracy, directly the every circulation primary of PCR is just collected data, set up real-time amplification curve, determine the Ct value exactly, thereby determine the initiate dna copy number, accomplished that DNA truly is quantitative according to the Ct value.
2. sensing range is wide, 10
9-10
2Fabulous linear relationship (R=0.999) is arranged in the copies/reaction concentration range, and sensing range can reach eight orders of magnitude, reaches advanced world standards, and its sensitivity can detect the level of 100copies, is that other any method is incomparable.
3. be applicable to the fluorescent quantitation amplification instrument of various models, once three corresponding variation coefficient of repeat samples (CV) illustrate repeatability that it is high and stable less than 2% in the experiment.
4. the outer typical curve of this real-time fluorescence quantitative PCR utilization is quantitatively the most accurate up to now, and the quantivative approach that circulation ratio is best is widely used in the fields such as virus pollution, prevailing disease inspection and fundamental research in the serum product.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Be to be understood that, these embodiment only are used to the present invention is described and are not used in restriction the scope of protection of present invention, not marked concrete experiment condition and method in the following example, usually according to normal condition as fine works molecular biology guide, F.M. chief editor such as Ao Sibai, Science Press, 1995, molecular cloning experiment guide (third edition); D.L. Spector etc., Science Press, 2001, cell experiment guide; Lv Hongsheng, Science Press, 1982, or connect the condition of advising according to manufacturer.
The PCR kit for fluorescence quantitative of embodiment 1 bovine parvovirus is formed and reaction conditions:
A). test kit is formed:
A) test kit is composed as follows: (10 secondary response)
DNA extraction liquid A (4ml/ pipe) DNA extraction liquid B (2ml/ pipe)
DNA extraction liquid C (2.6ml/ pipe) DNA extraction liquid D (2.5ml/ pipe)
RNaseA (40ul/ pipe) Proteinase K solution (2ml/ pipe)
Pcr amplification reaction liquid (220 μ l/ pipe) warm start Taq archaeal dna polymerase (2.75 μ l/ pipe)
Strong positive standard substance (100 times of rare PCR reaction tubess (aseptic, no RNA enzyme and DNA enzyme)
Release the accurate product 20 μ l/ pipe of definite value, totally four pipes) nuclease free H
2O (2ml/ pipe)
The negative critical positive criteria product of standard substance (50 μ l/ pipe) (50 μ l/ pipe)
(DNA extraction liquid A, B, C, D are TIANGEN company product.B) warm start Taq archaeal dna polymerase (2U/ μ l), c) pcr amplification reaction liquid is available from Takara company)
B). fluorescent quantitation reaction solution (the reaction cumulative volume is 25 μ l): 10 * buffer, 2.5 μ l, each 3 μ l (10 μ mol/L) of sense primer FP (SEQ ID NO:1) and antisense primer RP (SEQ ID NO:2), fluorescent probe 0.75 μ l (10 μ mol/L), dNTPs (10mM) 1 μ l, Mg
2SO
4(50mM) 0.5 μ l, warm start Taq archaeal dna polymerase 0.25 μ l, standard substance or testing sample are 5 μ l, and the sterilization distilled water 9 μ l of nuclease free form.Wherein fluorescent probe is the nucleotide sequence shown in (SEQ ID NO:3), and the fluorescence report group of fluorescent probe 5 ' end mark is FAM, 3 ' end mark fluorescent quenching group TAMRA.
C). reaction conditions is as follows: (employing two-step approach)
PCR：94℃ 2min
When each round-robin second EOS, carry out fluoroscopic examination.To BPV quantitatively can be by comparing with the circulation thresholding (Ct, Threshold Cycle) of standard substance and calculating the initial copy number of testing sample according to typical curve.
D). PCR kit for fluorescence quantitative detects sensitivity, sensing range and the stability of parvovirus
Get standard substance DNA10
9-10
2C/ μ l concentration range, three repetitions of each concentration add the PCR reaction tubes of reference numeral respectively, and the parallel PCR that is detects on the fluorescent quantitation detector.Cycling condition is: 94 ℃ of pre-sex change 2min; 94 ℃ of 30s, 60 ℃ of 90s, 40 circulations of increasing.Carry out when the program of fluoroscopic examination is arranged on each round-robin second EOS, the detection wavelength is 518nm.
After the loop ends, the analysis software (Realplex) that the Mastercycler ep Realplex instrument of utilization Eppendorf company carries reads sample copy number to be checked.The result is:
| Sequence number | Title | Type | Threshold value (Ct) | Set concentration | The variation coefficient |
| 1 | A1 | Standard | 11.52 | 1000000000 | 0.32％ |
| 2 | A2 | Standard | 11.60 | 1000000000 | 0.37％ |
| 3 | A3 | Standard | 11.55 | 1000000000 | 0.06％ |
| 4 | B1 | Standard | 14.87 | 100000000 | 0％ |
| 5 | B2 | Standard | 14.89 | 100000000 | 0.13％ |
| 6 | B3 | Standard | 14.85 | 100000000 | 0.13％ |
| 7 | C1 | Standard | 18.19 | 10000000 | 0.09％ |
| 8 | C2 | Standard | 18.23 | 10000000 | 0.13％ |
| 9 | C3 | Standard | 18.20 | 10000000 | 0.04％ |
| 10 | D1 | Standard | 21.55 | 1000000 | 0.09％ |
| 11 | D2 | Standard | 21.51 | 1000000 | 0.09％ |
| 12 | D3 | Standard | 21.53 | 1000000 | 0％ |
| 13 | E1 | Standard | 24.82 | 100000 | 0.04％ |
| 14 | E2 | Standard | 24.84 | 100000 | 0.04％ |
| 15 | E3 | Standard | 24.83 | 100000 | 0％ |
| 16 | F1 | Standard | 28.21 | 10000 | 0.20％ |
| 17 | F2 | Standard | 28.15 | 10000 | 0.10％ |
| 18 | F3 | Standard | 28.17 | 10000 | 0.02％ |
| 19 | G1 | Standard | 31.47 | 1000 | 0.01％ |
| 20 | G2 | Standard | 31.49 | 1000 | 0.07％ |
| 21 | G3 | Standard | 31.44 | 1000 | 0.09％ |
| 22 | H1 | Standard | 34.80 | 100 | 0.01％ |
| 23 | H2 | Standard | 34.79 | 100 | 0.20％ |
| 24 | H3 | Standard | 34.80 | 100 | 0.01％ |
| 25 | CK- | NTC |
Above result shows: this test kit sensing range is wide, 10
9-10
2Fabulous linear relationship is arranged in the c/r concentration range, coefficient R=0.999, its sensing range can reach eight orders of magnitude, its sensitivity can detect 100copies, and good stability, once three corresponding variation coefficient of repeat samples (CV) illustrate the repeatability that it is high less than 2% in the experiment, being applicable to the fluorescent quantitation amplification instrument of various models, is that other any method is incomparable.
The application of embodiment 2 PCR kit for fluorescence quantitative in the epidemiology survey of milk cattle infected parvovirus
A). test kit is formed:
A) test kit is composed as follows: (10 secondary response)
DNA extraction liquid A (4ml/ pipe) DNA extraction liquid B (2ml/ pipe)
DNA extraction liquid C (2.6ml/ pipe) DNA extraction liquid D (2.5ml/ pipe)
RNaseA (40ul/ pipe) Proteinase K solution (2ml/ pipe)
Pcr amplification reaction liquid (220 μ l/ pipe) warm start Taq archaeal dna polymerase (2.75 μ l/ pipe)
Strong positive standard substance (100 times of rare PCR reaction tubess (aseptic, no RNA enzyme and DNA enzyme)
Release the accurate product 20 μ l/ pipe of definite value, totally four pipes) nuclease free H
2O (2ml/ pipe)
The negative critical positive criteria product of standard substance (50 μ l/ pipe) (50 μ l/ pipe)
(DNA extraction liquid A, B, C, D are TIANGEN company product.B) warm start Taq archaeal dna polymerase (2U/ μ l), c) the PCR reaction solution is available from Takara company)
B). fluorescent quantitation reaction solution (the reaction cumulative volume is 25 μ l): 10 * buffer, 2.5 μ l, each 3 μ l (10 μ mol/L) of sense primer FP (SEQ ID NO:1) and antisense primer RP (SEQ ID NO:2), fluorescent probe 0.75 μ l (10 μ mol/L), dNTPs (10mM) 1 μ l, Mg
2SO
4(50mM) 0.5 μ l, warm start Taq archaeal dna polymerase 0.25 μ l, extractive standard substance or testing sample are 5 μ l, and the sterilization distilled water 9 μ l of nuclease free form.Wherein fluorescent probe is the nucleotide sequence shown in (SEQ ID NO:3), and the fluorescence report group of fluorescent probe 5 ' end mark is FAM, 3 ' end mark fluorescent quenching group TAMRA.
C). reaction conditions is as follows: (employing two-step approach)
PCR：94℃ 2min
When each round-robin second EOS, carry out fluoroscopic examination.To BPV quantitatively can be by comparing with the circulation thresholding (Ct, Threshold Cycle) of standard substance and calculating the initial copy number of testing sample according to typical curve.
D). PCR kit for fluorescence quantitative detects parvovirus:
(1) the cow serum raw material sample of different sources, after 0.2 μ M filter filters, be mixed with respectively 5% (volume ratio) cow serum (Fetal Bovine Serum, MEM substratum FBS) (1mlFBS adds 19mlMEM) is numbered A1～A25 respectively;
(2) former generation bovine kidney cells BKC in good condition is inserted 6 orifice plates, degree of converging is about 25%, treats (about 6h) behind the cell attachment, is replaced by 5% (volume ratio) FBS MEM sample to be checked, establishes negative control and positive control simultaneously, in 37 ℃, and 5% (volume ratio) CO
2Cultivate the centrifugal 5min collecting cell of 2000rpm after 4 days in the incubator;
(3) cell that obtains of above-mentioned collection, supernatant to the greatest extent adds 200 μ l DNA extraction liquid A, and vibration adds 4 μ l RNase A (100mg/ml) to thoroughly suspending, vibration 15s, room temperature (20～25 ℃, below identical) is placed 5min;
(4) add 20 μ l Proteinase Ks, mixing (5 to 20 times); Place 10min for 70 ℃, limpid to solution becomes, instantaneous centrifugal, the globule of removal inside pipe wall;
(5) add 200 μ l dehydrated alcohols, fully mixing 15s is instantaneous centrifugal;
(6) previous step solution and flocks are all added in the adsorption column, the centrifugal 30s of 12000rpm abandons waste liquid;
(7) add 500 μ l DNA extraction liquid C (adding the 3.4ml dehydrated alcohol before using) in the adsorption column, the centrifugal 30s of 12000rpm abandons waste liquid;
(8) add 700 μ l DNA extraction liquid D (adding the 10ml dehydrated alcohol before using) in the adsorption column, the centrifugal 30s of 12000rpm abandons waste liquid;
(9) add 500 μ l DNA extraction liquid D in the adsorption column, the centrifugal 30s of 12000rpm abandons waste liquid;
(10) empty from adsorption column, the centrifugal 2min of 12000rpm, room temperature (20～25 ℃) airing;
(11) 20 μ l nuclease free water add adsorption column, and room temperature is placed 2-5min, the centrifugal 2min of 12000rpm;
(12) DNA that obtains is used for the fluorescent quantitative PCR experiment in downstream.
E) get the D step DNA that carries 5 μ l, fluorescent quantitation reaction solution (the reaction cumulative volume is 25 μ l): 10 * buffer2.5 μ l, each 3 μ l (10 μ mol/L) of sense primer FP (SEQ ID NO:1) and antisense primer RP (SEQ ID NO:2), fluorescent probe 0.75 μ l (10 μ mol/L), dNTPs (10mM) 1 μ l, Mg
2SO
4(50mM) 0.5 μ l, warm start Taq archaeal dna polymerase 0.25 μ l, standard substance or testing sample are 5 μ l, and the sterilization distilled water 9 μ l of nuclease free add the PCR reaction tubes of reference numeral respectively, and the parallel PCR that is detects on the fluorescent quantitation detector.Cycling condition is: 94 ℃ of pre-sex change 2min; 94 ℃ of 30s, 60 ℃ of 90s, 40 circulations of increasing.Carry out when the program of fluoroscopic examination is arranged on each round-robin second EOS, the detection wavelength is 518nm.
After the loop ends, the analysis software (Realplex) that the Mastercycler ep Realplex instrument of utilization Eppendorf company carries reads sample copy number to be checked.The result is:
| The serum sample numbering | The milk cow numbering | BPV | Variation coefficient % |
| (copies/ml) | |||
| A1 | 6-905 | - | |
| A2 | 4-042 | - | |
| A3 | 2-082 | - | |
| A4 | 03-6116 | - | |
| A5 | 6-730 | - | |
| A6 | 2-147 | - | |
| A7 | 114 | - | |
| A8 | 2-009 | - | |
| A9 | 6-065 | - | |
| A10 | 2-034 | - |
| A11 | 7-021 | (1.20±0.32)×10 4 | 0.29 |
| A12 | 6-256 | - | |
| A13 | 5-189 | - | |
| A14 | 5-148 | - | |
| A15 | 7-134 | - | |
| A16 | 6-312 | - | |
| A17 | 5-177 | - | |
| A18 | 2-149 | - | |
| A19 | 106 | - | |
| A20 | 5-188 | - | |
| A21 | 6-248 | - | |
| A22 | 2-067 | - | |
| A23 | 6-237 | - | |
| A24 | 2-257 | - | |
| A25 | 601 | - | |
| Negative control | - | ||
| Positive control | (6.06±0.25)×10 9 | 0.06 |
Above result shows, milk cow is numbered in the cow serum of 7-021 and contains BPV, showing in the milk cows exists a spot of milk cow to carry BPV, confirmed that simultaneously the bovine parvovirus PCR kit for fluorescence quantitative can be successfully applied to the BPV epidemiology survey, the monitoring of bovine serum and bovine blood goods, good reproducibility, the CV value is all less than 2%.
The application of embodiment 3 PCR kit for fluorescence quantitative quality monitoring in commercially available bovine serum product
A). test kit is formed:
A) test kit is composed as follows: (10 secondary response)
DNA extraction liquid A (4ml/ pipe) DNA extraction liquid B (2ml/ pipe)
DNA extraction liquid C (2.6ml/ pipe) DNA extraction liquid D (2.5ml/ pipe)
RNaseA (40ul/ pipe) Proteinase K solution (2ml/ pipe)
Pcr amplification reaction liquid (220 μ l/ pipe) warm start Taq archaeal dna polymerase (2.75 μ l/ pipe)
Strong positive standard substance (100 times of rare PCR reaction tubess (aseptic, no RNA enzyme and DNA enzyme)
Release the accurate product 20 μ l/ pipe of definite value, totally four pipes) nuclease free H
2O (2ml/ pipe)
The negative critical positive criteria product of standard substance (50 μ l/ pipe) (50 μ l/ pipe)
(DNA extraction liquid A, B, C, D are TIANGEN company product.B) warm start Taq archaeal dna polymerase (2U/ μ l), c) the PCR reaction solution is available from Takara company)
B). fluorescent quantitation reaction solution (the reaction cumulative volume is 25 μ l): 10 * buffer, 2.5 μ l, each 3 μ l (10 μ mol/L) of sense primer FP (SEQ ID NO:1) and antisense primer RP (SEQ ID NO:2), fluorescent probe 0.75 μ l (10 μ mol/L), dNTPs (10mM) 1 μ l, Mg
2SO
4(50mM) 0.5 μ l, warm start Taq archaeal dna polymerase 0.25 μ l, extractive standard substance or testing sample are 5 μ l, and the sterilization distilled water 9 μ l of nuclease free form.Wherein fluorescent probe is the nucleotide sequence shown in (SEQ IDNO:3), and the fluorescence report group of fluorescent probe 5 ' ' end mark is FAM, 3 ' ' end mark fluorescent quenching group TAMRA.
C). reaction conditions is as follows: (employing two-step approach)
PCR：94℃ 2min
When each round-robin second EOS, carry out fluoroscopic examination.To BPV quantitatively can be by comparing with the circulation thresholding (Ct, Threshold Cycle) of standard substance and calculating the initial copy number of testing sample according to typical curve.
D). whether the serum of PCR kit for fluorescence quantitative inspection Gibco, Hyclone, Hangzhou folium ilicis chinensis, four product men of Wuhan Sanli Bio-Technology Co., Ltd. pollutes bovine parvovirus is arranged:
1) lot number of serum to be checked:
| Business Name | Gibco | Hyclone | The Hangzhou folium ilicis chinensis | Wuhan three profits |
| Numbering/lot number | 1/749154 2/949184 3/719321 4/719351 5/7685959D | 1/NSF0081 2/NSF0071 3/NSF0061 4/NSF0051 5/NSF0021 | 1/080304 2/080504 3/080426 4/080228 5/080408 | 1/20080701 2/060604 3/20080302 4/20070106 5/20070902 |
2) experimental technique:
System 6 orifice plates * 4, bovine kidney cells shop of former generation of (1) cultivating piece, 2ml/ hole, 50% (area than) degree of converging;
(2) serum to be checked is formulated as 5% (volume ratio) working concentration with MEM;
(3) behind the cell attachment, be replaced by the substratum of serum preparation to be checked, the 2ml/ hole;
(4) establish feminine gender and positive control simultaneously, positive control adds 5% (volume ratio) FBS MEM that contains BPV;
(5) 37 ℃, 5% (volume ratio) CO
2Cultivate in the incubator.
(6) behind the cell cultures 72h, collecting cell, 2000rpm is centrifugal 5min is temporary in-80 ℃.All the other samples are handled with quadrat method.Extract total DNA of cell, as the template of quantitative fluorescent PCR.
3) extraction of total DNA in the cell:
(1) cell that obtains of above-mentioned collection, supernatant to the greatest extent adds 200 μ l DNA extraction liquid A, and vibration adds 4 μ l RNase A (100mg/ml) to thoroughly suspending, vibration 15s, room temperature (20～25 ℃) is placed 5min;
(2) add 20 μ l Proteinase Ks, mixing (5 to 20 times); Place 10min for 70 ℃, limpid to solution becomes, instantaneous centrifugal, the globule of removal inside pipe wall;
(4) add 200 μ l dehydrated alcohols, fully mixing 15s is instantaneous centrifugal;
(5) previous step solution and flocks are all added in the adsorption column, the centrifugal 30s of 12000rpm abandons waste liquid;
(6) add 500 μ l DNA extraction liquid C (adding the 3.4ml dehydrated alcohol before using) in the adsorption column, the centrifugal 30s of 12000rpm abandons waste liquid;
(7) add 700 μ l DNA extraction liquid D (adding the 10ml dehydrated alcohol before using) in the adsorption column, the centrifugal 30s of 12000rpm abandons waste liquid;
(8) add 500 μ l DNA extraction liquid D in the adsorption column, the centrifugal 30s of 12000rpm abandons waste liquid;
(9) empty from adsorption column, the centrifugal 2min of 12000rpm, room temperature (20～25 ℃) airing;
(10) 20 μ l nuclease free water add adsorption column, and room temperature is placed 2-5min, the centrifugal 2min of 12000rpm;
(11) DNA that obtains is used for the fluorescent quantitative PCR experiment in downstream.
E) get the D step DNA that carries 5 μ l, fluorescent quantitation reaction solution (the reaction cumulative volume is 25 μ l): 10 * buffer2.5 μ l, each 3 μ l (10 μ mol/L) of sense primer FP (SEQ ID NO:1) and antisense primer RP (SEQ ID NO:2), fluorescent probe 0.75 μ l (10 μ mol/L), dNTPs (10mM) 1 μ l, Mg
2SO
4(50mM) 0.5 μ l, warm start Taq archaeal dna polymerase 0.25 μ l, standard substance or testing sample are 5 μ l, and the sterilization distilled water 9 μ l of nuclease free add the PCR reaction tubes of reference numeral respectively, and the parallel PCR that is detects on the fluorescent quantitation detector.Cycling condition is: 94 ℃ of pre-sex change 2min; 94 ℃ of 30s, 60 ℃ of 90s, 40 circulations of increasing.Carry out when the program of fluoroscopic examination is arranged on each round-robin second EOS, the detection wavelength is 518nm.
After the loop ends, the utilization instrument carries analysis software, reads sample copy number to be checked.The result is:
Above result shows that the serum of four whole lot numbers to be checked of company all shows as the BPV feminine gender, and detects a large amount of BPV in the positive control cell, shows that this test kit can be used for detecting the virus of cell sample.
SEQUENCE?LISTING
＜110〉Wuhan Sanli Bio-Technology Co., Ltd.
＜120〉a kind of PCR kit for fluorescence quantitative and application that detects bovine parvovirus
＜130〉a kind of PCR kit for fluorescence quantitative and application that detects bovine parvovirus
<160>3
<170>PatentIn?version?3.3
<210>1
<211>22
<212>DNA
＜213〉synthetic
<400>1
CCAGTACCAGGAAACGGAGAC 21
<210>2
<211>20
<212>DNA
＜213〉synthetic
<400>2
GCATGTATTCCGGTCTCCAA 20
<210>3
<211>28
<212>DNA
＜213〉synthetic
<400>3
CCTCAACATCTACGTCACCGGACAA?25
Claims (2)
1. PCR kit for fluorescence quantitative that detects bovine parvovirus, this test kit contains: a) DNA extraction reagent, b) warm start Taq archaeal dna polymerase, c) primer and TaqMan probe, d) standard positive dna profiling, e) PCR fluorescent quantitation reaction solution, it is characterized in that: primer sequence is respectively sense primer: 5 '-CCAGTACCAGGAAACGGAGAC-3 ', antisense primer: 5 '-GCATGTATTCCGGTCTCCAA-3 ', the amplicon size is 118bp, the fluorescent probe sequence is: 5 '-FAM-CCTCAACATCTACGTCACCGGACAA-TAMRA-3 ', 5 ' end mark fluorescent emission group FAM of probe, 3 ' end mark fluorescent quenching group TAMRA, the sequence of described standard positive dna profiling is:
CCAGTACCAGGAAACGGAGACTCGTTCCTCAACATCTACGTCACCGGACAAGTCTCCTGCGAAGTCGTCTGGGAGGTAGAAAAGAGGGGCACCAAAAATT
2. a kind of PCR kit for fluorescence quantitative that detects bovine parvovirus according to claim 1 is characterized in that: described PCR fluorescent quantitation reaction solution is made up of the sterilized water of the fluorescent probe of the sense primer of 10 * buffer, 10 μ M and antisense primer, 10 μ M and warm start Taq archaeal dna polymerase, nuclease free.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100623980A CN101565759B (en) | 2009-06-02 | 2009-06-02 | Bovine parvovirus detecting fluorescence quantitative PCR kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100623980A CN101565759B (en) | 2009-06-02 | 2009-06-02 | Bovine parvovirus detecting fluorescence quantitative PCR kit and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101565759A CN101565759A (en) | 2009-10-28 |
| CN101565759B true CN101565759B (en) | 2011-08-17 |
Family
ID=41282120
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100623980A Active CN101565759B (en) | 2009-06-02 | 2009-06-02 | Bovine parvovirus detecting fluorescence quantitative PCR kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101565759B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106957926A (en) * | 2017-04-14 | 2017-07-18 | 北京出入境检验检疫局检验检疫技术中心 | A kind of detection kit and primer and probe that can simultaneously detect and differentiate classic swine fever, African swine fever and swine pox |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1661088A (en) * | 2004-12-24 | 2005-08-31 | 武汉大学 | Fluorescence quantitative PCR kit for detecting virus of aftosa and application |
-
2009
- 2009-06-02 CN CN2009100623980A patent/CN101565759B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1661088A (en) * | 2004-12-24 | 2005-08-31 | 武汉大学 | Fluorescence quantitative PCR kit for detecting virus of aftosa and application |
Non-Patent Citations (3)
| Title |
|---|
| Yuning Sun et al.Molecular Characterization of Infectious Clones of the Minute Virus of Canines Reveals Unique Features of Bocaviruses.《Journal of Virology》.2009,第83卷(第8期),3956-3967. * |
| 牛晖等.应用PCR检测猪细小病毒.《郑州牧业工程高等专科学校学报》.2008,第28卷(第2期),10-11,15. * |
| 赵俊龙等.猪细小病毒PCR检测方法的建立与应用.《中国兽医学报》.2003,第23卷(第2期),142-144. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101565759A (en) | 2009-10-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wright et al. | Interspecies transmission and reassortment of influenza A viruses in pigs and turkeys in the United States | |
| Nowotny et al. | Isolation and characterization of a new subtype of Borna disease virus | |
| Baigent et al. | Absolute quantitation of Marek's disease virus genome copy number in chicken feather and lymphocyte samples using real-time PCR | |
| Diaz-Mendez et al. | Surveillance of equine respiratory viruses in Ontario | |
| Shankar et al. | Rabies in a captive colony of big brown bats (Eptesicus fuscus) | |
| Laor et al. | Detection of FMDV RNA amplified by the polymerase chain reaction (PCR) | |
| CN1710101B (en) | Fluorescent quantitative DCR kit for detecting swine pseudo rabies virus and its use | |
| CN103160615B (en) | Multiple PCR primer used for simultaneously detecting infectious Bovine Rhinotracheitis virus and akabane virus as well as its design method | |
| Maidana et al. | Characterization of BoHV-5 field strains circulation and report of transient specific subtype of bovine herpesvirus 5 in Argentina | |
| CN101565758B (en) | Rabies virus detecting fluorescence quantitative PCR kit and application thereof | |
| CN101565757B (en) | Reovirus-detecting fluorescence quantitative PCR kit and application thereof | |
| CN105603123A (en) | Real-time fluorescence RPA reagent kit and test strip RPA reagent kit for rapidly detecting porcine parvovirus and application of reagent kits | |
| Guionie et al. | Laboratory evaluation of a quantitative real-time reverse transcription PCR assay for the detection and identification of the four subgroups of avian metapneumovirus | |
| CN1308461C (en) | Fluorescence quantitative PCR kit for detecting virus of aftosa and application | |
| CN101560573B (en) | Fluorescence quantitative PCR kit for detecting type-3 cow adenovirus | |
| CN102676694B (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) detecting reagent kit for orf virus | |
| CN101560572B (en) | Fluorescence quantitative PCR kit for detecting calf diarrhea virus and application | |
| CN101565760B (en) | Bovine parainfluenza type-3 virus detecting fluorescence quantitative PCR kit and application thereof | |
| CN101565759B (en) | Bovine parvovirus detecting fluorescence quantitative PCR kit and application thereof | |
| Lunt et al. | Cultured skin fibroblast cells derived from bluetongue virus-inoculated sheep and field-infected cattle are not a source of late and protracted recoverable virus | |
| Kumar et al. | Isolation and characterization of bovine herpes virus 5 (BoHV5) from cattle in India | |
| Qi et al. | Development and application of a TaqMan-based real-time PCR method for the detection of the ASFV MGF505-7R gene | |
| Dangler et al. | Rapid identification of bluetongue virus by nucleic acid hybridization in solution | |
| CN113755565A (en) | Quadruple quantitative fluorescent probe primer combination, kit and identification method for identifying African swine fever wild viruses and vaccine strains | |
| CN103215381B (en) | Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting Sendai virus and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |