CN101487050A - Molecular marker method for rice anti-rice stripe major gene loci qSTV11 - Google Patents

Abstract

The invention relates to a molecular marking method of a major gene locus qSTV11 with rice stripe and leaf blight resistance and belongs to the field of molecular genetics. Hybridization with female plant of rice Nipponbare and male plant of Kasalath, backcross with Nipponbare and derivation are orderly realized, thus obtaining a backcross recombinant inbred system, genetic linkage analysis between genotypes and corresponding disease indexes and ratios in each family is realized, the resistant effects of the major gene locus qSTV11 with rice stripe and leaf blight resistance and allelic genes from Kasalath are detected, and molecular markers R21, R22, R13 and R48 that can be utilized in breeding are obtained through filtering. The four molecular markers are utilized for detecting whether Kasalath and derived varieties thereof contain the major gene locus, and consequently the rice stripe and leaf blight resistant level of the varieties can be predicted, and the selection efficiency of rice varieties with rice stripe and leaf blight resistance can be remarkably raised.

Description

The molecule marking method of rice stripe disease resisting major gene loci qSTV11

One, technical field

The invention provides the molecule marking method of anti-stripe disease major gene loci qSTV11, belong to the molecular genetics field, be exclusively used in the seed selection of stripe disease resistant variety and the screening utilization of germ plasm resource.

Two, background technology

Stripe disease is the virus disease that is caused by rice stripe virus, and it passes virus mediator mainly is small brown rice planthopper.In recent years along with the applying of light cultivation technology such as no-tillage, rice cover wheat, wheat cover rice and susceptible high-yield variety, quickened of expansion and the harm of the media small brown rice planthopper of stripe disease with malicious colony.Thorn suction time of small brown rice planthopper is short, pass characteristic such as poison lastingly, makes that to control the worm diseases prevention very difficult, and the generation of China's stripe disease is increased the weight of year by year.Become rare since the dawn of human civilization great explosive disease especially in Jiangsu Province, the repeating transmission district of the whole province's disease comprises the partial area in area such as Huaian, Lianyun Harbour, Suqian, Yancheng, Taizhou, Yangzhou, Jianhu in northern Suzhou and the Soviet Union and Nantong, and areas such as Zhenjiang, Xuzhou, Nanjing also are and increase the weight of trend.Grave illness district onset area accounts for more than 90% of paddy rice cultivated area, the sick cave of piece, the anti-field of the leakage of severely afflicated area rate up to 90%, diseased plant rate reaches more than 70%, the field piece that has loses receipts substantially, has caused enormous economic loss.Mainly improve in conjunction with cropping system adjustment, cultivation technique on producing at present, optimum period, controlled the worm diseases prevention, but poor effect, and contaminate environment.Most economical effective means is still selects good disease-resistant variety for use, utilizes the resistance of kind self to reach the initiatively purpose of control.Therefore, excavate new resistance source, cultivate high anti-stripe virus disease new rice variety and have important theory and realistic meaning.Because the stripe virus disease phenotypic evaluation is very difficult, the process exception of cultivating anti-stripe virus disease rice varieties is slow, utilizes molecular marker-assisted selection method can effectively solve this difficult problem.

Three, summary of the invention

Technical problem

The objective of the invention is: the molecule marking method that rice stripe disease resisting major gene loci qSTV11 is provided, by detecting and the closely linked molecule marker in this site, can predict the resistance of rice plant, accelerate the seed selection progress of anti-stripe virus disease rice varieties stripe virus disease.

Technical scheme

The molecule marking method of rice stripe disease resisting major gene loci is characterized in that:

Utilize molecule marker primer R21:

Left end sequence: 5 ' CAACGTGGTTGATTGTTC 3 '

Right-hand member sequence: 5 ' TTGCCAGGTTAGTTGTAC 3 '

Perhaps use molecule marker primer R22:

Left end sequence: 5 ' GAGGCAAGCCAATGTCGT 3 '

Right-hand member sequence: 5 ' CACAAATCAGCGAAGAAA 3 '

Perhaps use molecule marker primer R13:

Left end sequence: 5 ' AACATCGGCTACCACCAAAA 3 '

Right-hand member sequence: 5 ' GAATGCTTCGTCGTTCTCAA 3 '

Perhaps use molecule marker primer R48:

Left end sequence: 5 ' GCCTTCATCCGTAAATCCATAAGC3 '

Right-hand member sequence: 5 ' GAGTACCACATGGCATTATGAGAGC3 '

The amplifying rice kind, the DNA of strain or breeding material, if R21 can amplify 150bp with the molecule marker primer, perhaps can amplify 170bp with molecule marker primer R22, perhaps can amplify 242bp with molecule marker primer R13, perhaps with molecule marker primer R48 and the amplified fragments that can amplify 183bp, all indicate the existence of stripe disease resistance site qSTV11, this major gene loci is positioned at paddy rice the 11st karyomit(e), utilize SAS software record with the incoherent probability P value of stripe virus disease resistance be 0.001, be 35.79% to the contribution rate of stripe virus disease resistance.

Beneficial effect

The present invention utilizes the Nipponbare/Kasalath//Nipponbare recombinant inbred lines of backcrossing, adopt group's inoculation, field to identify and force the authentication method of raising poison, interval S2260-G257 all can detect 1 main effect QTL at the 11st chromosomal marker, shows that this QTL can both stably express under different envrionment conditionss.Yet, owing to be the RFLP mark with closely linked S2260 of this QTL and G257, be difficult to use in assisted selection, therefore screening and the closely linked SSR mark in this site can be quickened the utilization of marker assisted selection technology in stripe virus disease resistant variety seed selection process undoubtedly.

But the breeding of stripe disease resistance main effect gene locus qSTV11 provided by the present invention utilizes molecule marking method, has the following advantages:

Obtain to have located the major gene loci of the anti-stripe virus disease of rice varieties Kasalath, soluble 35.79% stripe virus disease resistance in the world first by molecule marker of the present invention.The research of stripe disease resistance is very difficult, and the accurate location work in stripe disease resistance site is occupy the same domain prostatitis;

By the localized major gene loci locality specific of molecule marker of the present invention, it is convenient to identify.By detecting and the closely linked molecule marker in this site, promptly can predict the stripe virus disease resistance of rice plant, the genotype detection that is used for rice varieties or strain, judging whether this kind or strain have anti-stripe virus disease, and then rapid screening disease-resistant variety or strain are used for rice breeding.Major gene loci easy to detect fast, not affected by environment;

The assistant breeding select target is clear and definite, saves cost.In traditional breeding way, at first to collect parent and Cultivar and carry out a series of hybridization, and will carry out individual plant to the stripe virus disease resistance and select with disease-resistant gene.The resistance of stripe virus disease is subjected to the influence of envrionment conditions very big, and the result reliability of phenotypic evaluation is on the low side.Therefore breeding for disease resistance is not only time-consuming, and difficulty is big, the cost height.By detecting stripe virus disease resistance main effect gene locus, just can identify the individual plant of high anti-stripe virus disease in seedling stage, superseded other plant not only saves production cost but also improves the efficiency of selection of anti-stripe virus disease rice varieties greatly.

Four, description of drawings

But Fig. 1 rice anti-leaf drop streak site qSTV11 breeding utilizes the finger printing of molecule marker R21, R22, R13, R48.

Mark R21 swimming lane 1:Marker; 2: disease-resistant parent Kasalath; 3: susceptible parent Japan is fine; 4,9,10,12,13,14,15,19,20,22,24 swimming lanes are that disease-resistant strain is; All the other swimming lanes are that susceptible strain is.

Mark R22 swimming lane 1:Marker; 2: disease-resistant parent Kasalath; 3: susceptible parent Japan is fine; 4,9,10,12,13,14,15,19,20,22,24 swimming lanes are that disease-resistant strain is; All the other swimming lanes are that susceptible strain is.

Mark R13 swimming lane 1:Marker; 2: disease-resistant parent Kasalath; 3: susceptible parent Japan is fine; 4,9,10,12,13,14,15,19,20,22,24 swimming lanes are that disease-resistant strain is; All the other swimming lanes are that susceptible strain is.

Mark R48 swimming lane 1:Marker; 2: disease-resistant parent Kasalath; 3: susceptible parent Japan is fine; 4,10,12,13,14,15,19,20,22,24 swimming lanes are that disease-resistant strain is; All the other swimming lanes are that susceptible strain is.

Five, embodiment

Of the present invention being described in detail as follows:

Studies show that there is the major gene loci of the stably express of a control stripe virus disease resistance in same position on paddy rice the 11st karyomit(e).(Maeda H such as Maeda H, Nemoto H, Yagi T, Fukuta Y.QTLanalysis for rice stripe disease resistance using recombinant inbred lines (RILs) derivedfrom crossing between Milyang and Akihikari.In:China Association of AgriculturalScience Societies, China National Rice Research Institute, China National Hybrid RiceResearch and Development Center, China Foundation Society for Agricultural Science andEducation (eds) .Prospects of rice genetics and breeding for the 21st century-Papercollection of international rice genetics and breeding symposium.Beijing:ChinaAgricultural Science Technology Press, 1999,53～57.) utilize the recombinant inbred lines of close positive 23/ autumn light to detect near the QTL that the XNpb257 between XNpb202 on the 11st karyomit(e)～C1172 mark, has anti-stripe virus disease, contribution rate reaches 17.36%, and its resistant gene effect is from close positive 23; (Hayano-Saito Y such as Hayano-Saito, Tsuji T, Fuji K, K.Saito, M.Iwasaki, A.Saito.Localization of the ricestripe disease resistance gene, Stv-bi, by graphical genotyping and linkage analysis withmolecular markers.Theoretical and Applied Genetics, 1998,96 (8): 1044-1049) utilize the resistance offspring Asanohikari of Modan and the F of susceptible japonica rice Nipponbare hybridization gained ₂Colony will come from the anti-stripe virus disease gene Stv-b of long-grained nonglutinous rice Modan ⁱBe positioned between the XNpb220 and XNpb257 mark on the 11st karyomit(e).This seminar once utilized Kinmaze (round-grained rice)/DV85 (Xian) recombinant inbred lines to detect qStv11, and from resistance parent DV85, contribution rate is up to 30.9% (Ding Xiulan, Jiang Ling, Liu old and well-known family, Wang Chunming, Chen Liangming, Cheng Zhaobang, Fan Yongjian, Zhou Yijun, Wan Jianmin. utilize recombinant inbred lines to detect rice stripe disease resisting resistant gene, Acta Genetica Sinica, 2004,31 (3): 287～292), between mark XNpb202～C1172.Molecular markers development by the anti-stripe virus disease major gene loci of rice varieties Kasalath of the present invention, on the 11st karyomit(e), exist stable main anti-stripe virus disease QTL qStv11 of imitating to can be used to instruct the seed selection work of rice stripe disease resisting kind, screen with chain with it molecule marker R21, R22, R13, R48 enantiopathy kind, realize the molecular marker assisted selection breeding, thereby improve breeding efficiency greatly.

Materials and methods:

(1) (doctor Yano of institute provides (Lin by the Japanese agriculture Biological resources for parent and Nipponbare/Kasalath//Nipponbare, S.Y., T.Sasaki, M.Yano, Mappingquantitat ive trait locicontrollingseed dormancy and heading date in rice.Theor.Appl.Genet.1998,96,997～1003).This colony is by hybridizing gained F by Nipponbare and Kasalath ₁Backcross with Nipponbare again, obtain BC ₁F ₁, then by BC ₁F ₁Obtain by single seed descent.Constituted the recombinant inbred lines of backcrossing (BIL colony) that comprises 98 familys, it carried out phenotypic evaluation:

Identify in the field

Select for use stripe virus disease to retransmit Lou Zhuan town, Jiangyan City, Jiangsu field test ground, district.For guaranteeing to obtain the worm source, material to be identified is planted in the plot for wheatland around selecting for use.The band poison rate of local small brown rice planthopper is 39%.Sowing on May 10th, 2007 (preceding 3 weeks of wheat harvest).Each family is broadcast 50, uniform broadcasting 1 row, the long 18cm of row, line-spacing 10cm.Weak seedling is eliminated in thinning on June 5, and each strain system keeps 30～35 strains, spacing in the rows 5～6cm.Note water and fertilizer management, do not spray any sterilant, to guarantee to move into competent worm source.Repeat for 2 times.(7 weeks after planting on June 29th, 2007,4 weeks after the wheat harvest) with reference to Washio (Washio O., Ezuka A., Toriyama K., Sakurai Y.Testingmethod for Genetic of and Breeding for resistance to rice stripe disease.Bull.Chugoku Agr.Exp.Sta.Series, 1968,16:39～197) resistance standard of perfection, investigation field incidence.

Force and raise poison

With parent and 98 family presoaking and germinatings, be sowed at diameter 5.8cm, high 6.0cm respectively, fill with in the round plastic alms bowl of nutrition soil (aperture is arranged at the bottom of the alms bowl, be convenient to osmotic absorbent).Put the plastic box interior (keeping the about 2cm of water layer) of 65cm * 44cm * 14cm, other adds pest-resistant and the sense worm contrasts respectively 2 alms bowls.20～25 chitting pieces that show money or valuables one carries unintentionally of every alms bowl sowing connect worm thinning in preceding 4 days, eliminate disease, weak seedling, and the strong seedling that every alms bowl keeps 10 neat and consistent is used to connect worm.Repeat for 2 times.

When rice shoot grows to 1.5～2.0 leaves, inoculate small brown rice planthopper and identify.It is about 40% that small brown rice planthopper is with malicious rate.Every alms bowl cover is with translucent cover, and the top gauze seals, and calculating by 5 small brown rice planthoppers of every seedling needs the worm amount, inserts and is with malicious small brown rice planthopper 2～3 ages.Become every day worm 2 times makes tested rice seedling evenly be subjected to poison.Behind the 48h, remove whole small brown rice planthoppers, make the morbidity of under the natural lighting condition, growing of postvaccinal seedling.Note water and fertilizer management.After 3～4 weeks, treat that PD is stable, investigate with reference to the resistance standard of perfection of Washio (1968).

Group's inoculation

Behind the seed presoaking and germinating with two parents (parent Kasalath and Nipponbare) and 98 familys, each kind 1 row is seeded in the plastic box of 65cm * 44cm * 14cm 20 of every row at random; Connect worm and identify when rice shoot grows to the 1.5-2.0 leaf, connect worm thinning in preceding 2 days, eliminate sick and weak seedling, each kind keeps the consistent seedling of growth about 10 strains, is used for disease resistance and identifies, repeats twice.During evaluation, Turnover Box is put into fly net, calculate required worm amount (it is about 40% that small brown rice planthopper is with malicious rate) by 5 2-3 of every strain small brown rice planthopper in age nymph, evenly insert it in Turnover Box, drive worm every day 2 times, spraying insecticide kills the small brown rice planthopper of inserting in the seedling case behind the 72h, observes the rice shoot incidence after 30 days.

By disease generation severity, the resistance standard of perfection according to Washio is divided into each seedling ranks such as A, B, Bt, Cr, C and D, adds up the strain number of different stage in each family, calculates disease index by following formula.

For getting rid of the influence of environment, again the disease index of each strain system is compared with the disease index of susceptible check variety, multiply by 100 again, calculate the disease index ratio.

(2) molecular marker analysis of recombinant inbred lines

Adopt QTL Cartographer 2.0 softwares, utilize the composite interval mapping method to analyze the QTL of anti-strip virus, in whole rice chromosome group, the possibility that QTL exists is scanned every 2cM, with the existence of LOD=2.9 (P=0.05), and analyze explainable phenotypic variation percentage of each QTL and additive effect value as threshold decision QTL.

(3) with the closely linked SSR labeled analysis of QTL

Get (the backcross inbred lines of BIL colony, the recombinant inbred lines of backcrossing) each 20 in 98 familys and parent's seed, be sowed at the little earthen bowl of plastics of a 6 * 10cm behind the presoaking and germinating, all spires of clip during about two leaves, be stored in-80 ℃ of refrigerators, extract DNA according to the method for Dellaporta etc.

2 pairs of SSR primers of Synthetic 2 between the 11st chromosomal marker C1172-G202, screen its polymorphism, to there be the molecular data of polymorphic SSR primer and the molecular data of the 11st chromosomal RFLP mark that doctor Yano provides to join together, utilize MAPMARKER/EXP3.0 software, rebuild the 11st chromosomal linkage map.Utilize this site of QTL Cartographer 2.5 software analysis again.

Utilize SAS GLM program to carry out linkage analysis, further verify its linkage relationship to colony's genotype data of each molecule marker with the disease index ratio of its corresponding each family.

(4) result and analysis:

One-way ANOVA records and the incoherent probability P value of stripe virus disease resistance and the site contribution rate R to the stripe virus disease resistance ²(table 2), the molecule marker of P＜0.05 are promptly chain with a major gene loci.The genotype of gained molecule marker in colony is by the genotype classification of parent Kasalath and Nipponbare, if the strain that genotype is identical with Kasalath is a phenotype is anti-, then the localized disease-resistant major gene loci of this mark is from Kasalath: find in Kasalath, in incoherent probability P=0.001 time, this site is 35.79% to the contribution rate of stripe virus disease resistance, mark R21, R22, R13, R48 mark and stripe virus disease resistance main effect gene locus close linkage promptly obtain the molecule marker of the anti-stripe virus disease major gene loci of paddy rice Kasalath qSTV11.

Predict the rice plant resistance by above-mentioned molecular markers for identification major gene loci, expectation can improve the breeding process of China's stripe disease resistant variety rapidly.

The sequence of table 1. labeled primer and amplified fragments size

Title	Preceding primer sequence	Back primer sequence	Size (bp)
				R21	5′CAACGTGGTTGATTGTTC 3′	5′TTGCCAGGTTAGTTGTAC 3′	150

R22	5′ GAGGCAAGCCAATGTCGT 3′	5′CACAAATCAGCGAAGAAA 3′	170
				R13	5′AACATCGGCTACCACCAAAA 3′	5′GAATGCTTCGTCGTTCTCAA 3′	242
R48	5′GCCTTCATCCGTAAATCCATAAGC3′	5′GAGTACCACATGGCATTATGAGAGC3′	183

The One-way ANOVA of the anti-stripe virus disease major gene loci of table 2. paddy rice Kasalath

P: expression and the incoherent probability of stripe virus disease resistance, P＜0.05 this mark of expression and stripe virus disease resistance close linkage

R ²: the site is to the contribution rate of stripe virus disease resistance, is worth greatly more, shows relevant more with the stripe virus disease resistance

Utilize 4 selective markers to No. 34,300 parts of substitution lines that are derived from light (being the precocious high quality japonica kind that the Prefectura de Fukui, Japan agricultural experiment station was bred the 1950's)/Kasalath more (Rice Genome ResourceCenter.2003.Koshihihari/Kasalatath Chromosome Segment Substitution Lines (CSSLs) 39 lines[on line] .Available at Www.rgrc.dna.affrc.go.jp/index.html.en(accessed 1 April 2006) .National Institute of Agrobiological Science, Tsukuba.) the secondary F that backcrosses with light more _3:4The genotype of colony and single mark efficiency of selection (table 3).The flow process of utilizing mark to select is summarized as follows: at first utilize four selective markers to select F respectively ₃Banding pattern is the individual plant of Kasalath in the colony, gathers in the crops F then _3:4Seed be used for phenotypic evaluation, the phenotypic evaluation method is that the field is identified, group's inoculation and force and raise poison, three kinds of each 2 repetitions of method.The inoculation of three kinds of methods identifies that back phenotypic number morbidity percentage and disease index are labeled as high anti-less than 30% strain system respectively.

4 mark efficiencies of selection of table 3 (%)

Mark	Kasalath type (selecting)	The Nipponbare type	Heterozygous	Middle roguing is the high anti-number of phenotype checking	Select accuracy rate (%)
						R21	88	91	119	86	97.73
R22	91	93	116	90	98.90
						R13	90	99	111	88	97.78
R48	85	101	114	81	95.29

Under the condition that single mark is selected, select accuracy rate all to be higher than 95%, wherein mark R22 efficiency of selection is up to 98.90%.The double-tagging selection condition selects accuracy rate all to be higher than 97% (table 4) down, and wherein mark R22+R22 efficiency of selection is up to 100%; Because single, double mark efficiency of selection all is higher than 95%, so single mark and double-tagging are selected all can reach the requirement that meets marker assisted selection.Because 4 marking paths selecting are very near, so the difference that double-tagging is selected and single mark is selected is little, the generalized case mark that places an order just can select disease-resistant strain to be efficiently.

Table 4 double-tagging efficiency of selection (%)

Mark	R21	R22	R13	R48
					R21
R22	98.90
					R13	98.84	100
R48	98.81	98.84	97.78

Sequence table

＜110〉Agricultural University Of Nanjing

＜120〉molecule marking method of rice stripe disease resisting major gene loci qSTV11

＜130〉specification sheets

<140>00

<141>2009-02-17

<160>8

<170>PatentIn version 3.1

<210>1

<211>18

<212>DNA

＜213〉artificial

<220>

＜221〉molecule marker primer R21 left end sequence

<222>(1)..(18)

<223>

<400>1

<210>2

<211>18

<212>DNA

＜213〉artificial

<220>

＜221〉molecule marker primer R21 right-hand member sequence

<222>(1)..(18)

<223>

<400>2

<210>3

<211>18

<212>DNA

＜213〉synthetic

<220>

＜221〉molecule marker primer R22 left end sequence

<222>(1)..(18)

<223>

<400>3

<210>4

<211>18

<212>DNA

＜213〉synthetic

<220>

＜221〉molecule marker primer R22 right-hand member sequence

<222>(1)..(8)

<223>

<400>4

<210>5

<211>20

<212>DNA

＜213〉artificial

<220>

＜221〉molecule marker primer R13 left end sequence

<222>(1)..(20)

<223>

<400>5

<210>6

<211>20

<212>DNA

＜213〉artificial

<220>

＜221〉molecule marker primer R13 right-hand member sequence

<222>(1)..(20)

<223>

<400>6

<210>7

<211>24

<212>DNA

＜213〉artificial

<220>

＜221〉molecule marker primer R48 left end sequence

<222>(1)..(24)

<223>

<400>7

<210>8

<211>25

<212>DNA

＜213〉artificial

<220>

＜221〉molecule marker primer R48 right-hand member sequence

<222>(1)..(25)

<223>

<400>8

Claims (1)

1, the molecule marking method of stripe disease resistance main effect gene locus qSTV11 is characterized in that:

Utilize molecule marker primer R21:

Left end sequence: 5 ' CAACGTGGTTGATTGTTC3 '

Right-hand member sequence: 5 ' TTGCCAGGTTAGTTGTAC3 '

Perhaps use molecule marker primer R22:

Left end sequence: 5 ' GAGGCAAGCCAATGTCGT3 '

Right-hand member sequence: 5 ' CACAAATCAGCGAAGAAA3 '

Perhaps use molecule marker primer R13:

Left end sequence: 5 ' AACATCGGCTACCACCAAAA3 '

Right-hand member sequence: 5 ' GAATGCTTCGTCGTTCTCAA3 '

Perhaps use molecule marker primer R48:

Left end sequence: 5 ' GCCTTCATCCGTAAATCCATAAGC3 '

Right-hand member sequence: 5 ' GAGTACCACATGGCATTATGAGAGC3 '

The amplifying rice kind, the DNA of strain or breeding material, if R21 can amplify 150bp with the molecule marker primer, perhaps can amplify 170bp with molecule marker primer R22, perhaps can amplify 242bp with molecule marker primer R13, perhaps with molecule marker primer R48 and the amplified fragments that can amplify 183bp, all indicate the existence of stripe disease resistance site qSTV11, this major gene loci is positioned at paddy rice the 11st karyomit(e), utilize SAS software record with the incoherent probability P value of stripe virus disease resistance be 0.001, be 35.79% to the contribution rate of stripe virus disease resistance.

Images