CN101225445A - Molecule labeling method for rice stripe disease resistant gene Stvb-i - Google Patents

Abstract

The invention relates to a molecule marker method of the rice strip disease resistance gene Stvb-I, belonging to the agricultural biological engineering technical field, which is characterized in that: based on the positioning results of the strip disease resistance gene obtained by previous researchers, thirteen couples of SSR markers tightly linked with the rice strip disease resistance gene Stvb-I are designed based on molecule biology and biological information; wherein, one couple of the markers RM11-8 appear polymorphism between the resistant and allelopathic breeding parents Guandong No.194 (carrying the Stvb-I gene) and the Wujing No.13. Evaluation of the resistance selection effect is carried out on the marker by utilizing the known resistant allelopathic gene type combination advanced generation plot and the coincidence rate is 90.74 percent. The molecule marker method of the rice strip disease resistance gene Stvb-I has the advantages that: RM11-8 can be used as assistant selection molecule marker of the resistance rice strip disease of the combination and can predict the rice strip disease resistance gene; thus the selection efficiency and identification efficiency of the types of the rice strip disease resistance are enhanced greatly.

Description

The molecule marking method of rice stripe disease resistant gene Stvb-i

One, technical field

The present invention relates to the molecule marking method of rice stripe disease resistant gene Stvb-i, belong to the agro-biological engineering technical field, the seed selection and the purity that are exclusively used in the stripe disease resistant variety are identified.

Two, background technology

Stripe disease is that (it passes virus mediator mainly is small brown rice planthopper (Laodelphax striatellus Fallen.) for Rice Stripe Virus, the virus disease that RSV) causes by the stripe virus disease poison.This disease occurred in the areas such as group horse, manger's wood in the Japanese Northeast the earliest in 1897, and China this disease takes place the earliest is in 1964.In recent years, along with climatope and pattern of farming adjustment, stripe disease morbidity scale had the trend of continuous expansion.Jiangsu from 1964～nineteen sixty-five first since, just exist in southern area of Jiangsu Province always, indivedual times harm are heavier.After 1998, stripe virus disease is in fierce ascendant trend of being of Jiangsu Province, broke out in North Jiangsu Area first in 2000, to 2007 continuous 8 years in Jiangsu Province's scope popular and disaster area all more than ten million mu, becoming influences the No.1 killer (Wang Cailin that Jiangsu japonica rice produces, the Jiangsu agricultural sciences, 2006, (3): 1-5).

Although as far back as 1960's, Japanese paddy rice geneticist has just carried out a large amount of screenings, evaluation and genetic analysis work to stripe disease resistance resource, still has only the genetic mechanism of two kinds of main virus resistance genes to be illustrated so far.A kind of is representative with Japanese dryland rice kind, and resistance is by two couples of dominance complementary gene Stva (Stv1) and the common control of Stvb (Stv2); Another kind of is representative with some non-Japanese rice varieties, and resistance is by a pair of incomplete dominant gene Stvb-i (Stv3) control (Chen Tao etc., Jiangsu agricultural sciences, 2006, (2): 1-4).Along with the development of molecular marking technique, become possibility to analyzing in conjunction with the heredity of heredity of controlling and minor-polygene control by key-gene and minor-polygene.Up to the present, utilize different genetic group Primary Location 27 QTLs (Sun Daizhen etc., China's agronomy circular, 2006,22 (12): 318-321), if but remove among these QTLs outside above-mentioned three main sites, the effect value in other site is all not too big, is difficult in the actual production to be applied.

Analyze the anti-stripe virus disease cultivation japonica rice pedigree of breeding at present both at home and abroad, find that its resistant gene derives from two rice variety Modan and Mudgo at first, the resistant gene that further studies confirm that these two resistant varieties is Stvb-i, is most economical, the effective means of control stripe disease harm so seed selection contains the rice varieties of Stvb-i resistant gene.Resistant gene effectively utilizes to studying clearly, can shorten breeding cycle, satisfies pressing for of domestic present antagonism stripe virus disease high-grade rice kind.Yet, utilize traditional field or the indoor method that connects the worm evaluation that the Stvb-i gene is carried out offspring's tracking and not only take time and effort, and have many uncertain factors, utilize molecular marker-assisted selection method can effectively solve this difficult problem.Hayano-Saito Y (Hayano-Saito Y, et al.TheorAppl Genet.2000,101 (1): 59-63) utilize RFLP or CAPs mark the Stvb-i resistant gene to be limited in the zone of two about 286Kb of cloned sequence eclipsed of the 11st karyomit(e).Yet the information of these marks is still unexposed, is difficult to use in assisted selection, and therefore screening and the closely linked SSR mark of Stvb-i can be quickened the utilization of marker assisted selection technology in stripe virus disease resistant variety seed selection process undoubtedly.

Three, summary of the invention

Technical problem: The present invention be directed to above-mentioned situation, utilizing the method for molecular biology and information biology is material with the Japanese water rice varieties Northeast 194 that contains the Stvb-i gene, screening and seek stable existence with the closely linked SSR molecule marker of rice stripe disease resistant gene Stvb-i, and be used for assistant breeding.

Technical scheme: the molecule marking method of rice stripe disease resistant gene Stvb-i is characterized in that:

With dominance SSR mark RM11-8 primer

The forward sequence is TAGCCATGCTCATGCGTCAT

Reverse sequence is CGCGGTTTGCAGTAGTTGC

Amplifying rice stripe virus disease resistant variety or breeding material DNA if can amplify the single band of 157bp, show that then anti-stripe virus disease gene Stvb-i exists, and this gene is positioned on paddy rice the 11st karyomit(e).

The beneficial effect stripe disease is to influence a kind of serious virus disease that japonica rice produces.The present invention utilizes the method for molecular biology and information biology to screen one and the closely linked SSR mark of rice stripe disease resistant gene Stvb-i, and the application of this mark can be quickened the seed selection of stripe virus disease resistant variety.Its advantage specifically is summarized as follows:

(1) and affected by environment bigger stripe disease resistance site (QTLs) less with some effects compared, Stvb-i is with its stable, really up to the mark resistance and mainly imitate, simple mode of inheritance and the traditional breeding method that is widely used.The Stvb-i gene is carried out molecular marker assisted selection, can go out stable rice strain of a large amount of resistances or kind by quickly breeding.

(2) traditional breeding method is to utilize the parent who contains resistant gene to go up kind commonly used with production to carry out a series of hybridization, then the stripe virus disease resistance is carried out individual plant and selects.Because this sick resistance is subjected to the influence of envrionment conditions very big, phenotypic evaluation result's reliability is on the low side, therefore identifies by field resistance or indoorly connects worm and identify and judge stripe virus disease resistant gene type, not only waste time and energy, and difficulty is big the cost height.By the banding pattern of its resistant gene close linkage mark is detected, measurable its resistant gene type, and then can identify high anti-individual plant in seedling stage, so not only save cost of expert testimony, and improve the efficiency of selection of anti-stripe virus disease rice varieties greatly.

(3) the present invention obtain with the closely linked SSR mark of stripe disease resistant gene Stvb-i, it detects quick, simple, the result is stable, reliable, be fit at short notice a large amount of breeding materials are carried out the detection of marker gene type, to judge whether it has the stripe disease resistance, the row filter of going forward side by side.

Four, description of drawings

The pedigree of Fig. 1 stripe disease resistant variety " Northeast 194 ".

Fig. 2 develops the related chromosome segment of stripe disease resistance assisted Selection mark

Fig. 3 SSR primer RM11-8 is anti-to the field, the screening electrophoretogram of sense sub-district

(a) RM11-8 is to the screening (PR: the Northeast 194 of disease-resistant sub-district, field; PS: military round-grained rice 13; F ₁: military round-grained rice 13/ Northeast 194; 1～8: the consistent individual plant of field resistance with Molecular Identification; 9～10: the inconsistent individual plant of field resistance and Molecular Identification)

(b) RM11-8 is to the screening (PR: the Northeast 194 of susceptible sub-district, field; PS: military round-grained rice 13; F ₁: military round-grained rice 13/ Northeast 194; 1～9: the consistent individual plant of field resistance with Molecular Identification; 10: the inconsistent individual plant of field resistance and Molecular Identification)

Fig. 4 SSR mark RM11-8 is to the electrophoresis screening collection of illustrative plates of 39 stripe virus disease resistant strains

(PR: the Northeast 194; PS: military round-grained rice 13; F ₁: military round-grained rice 13/ Northeast 194; 1～8: the strain that field resistance is consistent with Molecular Identification; 9～10: the inconsistent strain of field resistance and Molecular Identification)

Five, embodiment (specifying in conjunction with the accompanying drawings)

(1) material:

The disease-resistant variety Northeast 194: (Japan introduces the high quality japonica kind of anti-stripe virus disease, contains the Stvb-i resistant gene of " Modan ", and Fig. 1), the Ibaraki, Japan is bred, Agriculture, Forestry and Fisheries Ministry login in 2003, No. 387, login agricultural by name.Anti-stripe virus disease, genotype are Stvb-iStvb-i, 130～135 days time of infertility of this kind, plant height 85～95cm, 6～8 of the effective fringes of every strain, several 95～105 of the real grain of every fringe, setting percentage 93%～95%, thousand seed weight 24～25g.

The military round-grained rice 13 of susceptible variety: Jiangsu high yield japonica rice kind, Jiangsu Province's Wujin District rice wheat breeding station is bred, and names in 2003.Stripe virus disease resistant gene type is stvb-istvb-i.The 156 days time of infertility of this kind, plant height 97～102cm, 8～10 of the effective fringes of every strain, several 115～125 of the real grain of every fringe, setting percentage 92%～93%, thousand seed weight 27～28g.

By the disease-resistant and susceptible sub-district of advanced lines anti-, that the military round-grained rice of sense combination 13/ Northeast 194 produces.

Selected military round-grained rice 13 (force educates 5021) (the susceptible parent of Jiangsu high yield japonica rice kind in 1999 for use in Hainan, stripe virus disease resistant gene type is stvb-istvb-i) for the high quality japonica kind Northeast 194 (resistance parent, genotype is Stvb-iStvb-i) of maternal (♀) and the anti-stripe virus disease of introducing be male parent

The hybridization combo.2000 at Nanjing plantation F ₁Combination, the winter in the same year is planted F in Hainan ₂, receipts are mixed in ripe back all individual plant, and calendar year 2001 is planted F in Nanjing ₃, receipts are mixed in ripe back all individual plant.F ₂For the menu strain F that derives ₃The sub-district, individual plant of each sub-district continuation results adds for being derivatized to respective cell later on.(F in 2002 ₄) begin to select individual plant, after this (2003～2005 years) are annual at each generation (F of Nanjing plantation ₅～F ₇) strain system.Individual plant selects material just to plant in season in Cereal Crops Research Inst., Jiangsu Agricultural Science Academy experimental plot (Nanjing) every year, sowing on May 15～18, and the rice seedling bed is arranged on abundant wheat paddock limit, small brown rice planthopper worm source.June 15～18 transplanted.Each strain system plantation 40～50 strain, 2 row or 4 row districts, distance between rows and hills 17cm * 17cm, empty 1 row in minizone.Field management is carried out according to a conventional method, and nursery period and transplanting do not prevent and treat small brown rice planthopper in back 30 days.

(2) with the choosing of Stvb-i close linkage SSR mark, exploitation and polymorphism screening

Utilize Hayano-Saito Y (Hayano-Saito Y, et al.Theor Appl Genet.1998,96 (8): 1044-1049) to the positioning result of rice stripe disease resistant gene Stvb-i, and the data of the 11st chromosomal integration collection of illustrative plates of having announced in conjunction with Japanese rice genome website (www.rpg.dna.affrc.go.jp/IRGSP), discovery is being integrated in the collection of illustrative plates at a RFLP mark C1172 at 3.0cM place above the target gene (the 11st karyomit(e) one 80.2cM) and is being existed equally, finds 10 cloned sequences (Fig. 2) in the section of totally 4.1 cM from this mark down to another RFLP mark E1126S (the 11st karyomit(e) one 84.3 cM).Utilize the microsatellite marker of having announced also to inquire about, screen, and design, synthesized 13 pairs of SSR primers with the SSR site that may exist in SSR search software-2.0 pairs of 10 cloned sequences of SSR HUNTER.Utilize above-mentioned 13 pairs of primers to carry out the polymorphism screening in the resistance parent Northeast 194 and military 13 of the round-grained rice of susceptible parent, the result has only a pair of primer RM11-8 (table 1) to present polymorphism in resistance parent and susceptible parental combination, polymorphic frequency minimum (7.69%), this may be to resist, feel the parent to be japonica rice, the cause that hereditary difference is less.The banding pattern of RM11-8 is a dominance, its F ₁Banding pattern consistent with susceptible parent.

Table 1 shows polymorphic SSR mark RM11-8 between two parents

Mark	Forward sequence (5 '-3 ')	Reverse sequence (5 '-3 ')	The place clone	Annealing temperature	Clip size
						RM11-8	TAGCCATGCTCATGCGTCAT	CGCGGTTTGCAGTAGTTGC	SJNBa0038B22	59 ℃	157bp

(3) identify in the field

Just since 2004 the stripe disease resistance of these sub-districts is carried out the land for growing field crops when season, economical character was basicly stable and identify.Transplant the natural occurrence situation of 30 days " Invest, Then Investigate " stripe virus diseases, educating round-grained rice with sense stripe virus disease kind force is for No. 3 contrast, utilize the natural condition of the big generation of stripe virus disease to carry out resistance screening, the resistance standard of perfection that the sick level of morbidity individual plant is formulated with reference to (1968) such as Washio, be the A level: growing way is very poor, sick leaf full wafer or part are wilted leaf rolling, withered; The B level: growing way is very poor, but sick leaf do not wilt, and bottom yellowtop spot is continuous, and upper leaf has the chlorisis symptom; The Bt level: symptom is similar to B, but growing way is relatively poor; The Cr level: growing way a little less than, sick leaf slightly curls, sick portion is slightly yellow, is fragmentary point-like or striated, sick strong portion has a common boundary obviously; The C level: a little less than growing way was omited, fragmentary point-like was slightly yellow, and the sick portion that is good for has at interval; The D level: growing way is fine, and the very little scab of initial stage visible is covered up with the growth of seedling.With A, B and Bt as susceptible, Cr, C, D and the conduct of symptom not occur disease-resistant, the ratio of disease plant is a sickness rate in the calculation plot.Sickness rate is divided into one-level (＜4.9%), secondary (5%～9.9%), three grades (10%～19.9%), level Four (20%～39.9%) and 5 grades of Pyatyi (〉=40%).Add up the ratio that individual plants at different levels appear in different onset rate grade individual plant offspring according to genealogical relationship, estimate the effect of resistance screening.

Reliability in order to ensure qualification result, the sub-district seedling all is chosen in around the wheat paddock of Cereal Crops Research Inst., Jiangsu Agricultural Science Academy experimental plot (Nanjing), and any sterilant is not sprayed in these sub-districts, and to guarantee moving into of sufficient worm amount, annual individual plant connects the worm amount and all guarantees more than 5.Paddy rice state of an illness investigation divides 3 times, carry out at the stripe disease onset peak period for preceding twice, after once carry out in the rice tillering Sheng phase, occurring degree is represented with sub-district sickness rate (susceptible individual plant accounts for the per-cent of 48 individual plants in sub-district).Be accredited as high 108 anti-sub-districts (not having typical case's morbidity strain) in continuous 3 years, looking its resistant gene type is Stvb-i Stvb-i, and to being accredited as 68 sub-districts (sickness rate 〉=susceptible parent) of high sense in 3 years continuously, looking its susceptible genotype is stvb-i stvb-i.After positive season, state of an illness investigation finished in 2006, adopt the SDS method to extract anti-sense parent, F ₁And represent the isozygoty genotypic resistance individual plant in resistance sub-district and represent the isozygoty blade extraction DNA of the genotypic susceptible individual plant in susceptible sub-district of advanced lines of advanced lines.(Chen X et al.Theor Appl Genet, 1997,95 (4): 553-567.) report, reaction product is electrophoresis on 4% sepharose, observes record down through ethidium bromide staining and in gel imaging system according to Chen for pcr amplification reaction.

(4) the mark efficiency of selection is estimated: in the advanced lines sub-district in the military round-grained rice of fine combination 13/ Northeast 194, resistance individual plant (the disease-resistant gene type is Stvb-i Stvb-i) and the high susceptible individual plant (susceptible genotype is stvb-i stvb-i) of feeling the sub-district selecting to be accredited as high anti-sub-district in 3 years continuously carry out the screening (Fig. 3) of mark RM11-8.The result shows: when the screening of RM11-8 was carried out in the sub-district that the field is accredited as the disease-resistant gene type that isozygotys, the sub-district number of the resistance of isozygotying parent banding pattern and field were accredited as the disease-resistant sub-district of isozygotying to count its identical rate are 90.74%; The field is accredited as the susceptible sub-district of isozygotying when carrying out the screening of RM11-8, and susceptible parent's banding pattern and anti-ly feel the heterozygosis banding pattern because RM11-8 isozygotys for the dominant marker can't distinguish is so can't do accurate differentiation (table 2) to the identical rate of its susceptible sub-district.Therefore, the antagonism genotype sub-district identical rate that screening produced 90.74% of carrying out SSR mark RM11-8 is more suitable for as this test stripe disease resistant gene assisted Selection Evaluation on effect index.

Identify and RM11-8 label screening result contrast in table 2 field

Field identified gene type	Number	Molecule marker banding pattern and number		Identical rate (%)
					Stvb-i Stvb-i	108	The resistance of isozygotying parent banding pattern	Susceptible parent's banding pattern or F isozygoty 1Banding pattern	90.74
98	10
		stvb-i stvb-i	68	The resistance of isozygotying parent banding pattern			Susceptible parent's banding pattern or F isozygoty 1Banding pattern	-
1	67

(5) application of SSR mark RM11-8 in actual breeding

Transplant and taked single-strain blade in the stable sub-district of economical character in back 30 days, extract DNA (DellaportaSL, Wood J, Hicks JB. A plant DNA minipreparation:Version II.Plant Mol Biol Rep with the SDS method, 1983,1 (1): 19～21).Carry out pcr amplification according to primer RM11-8 sequence.The forward sequence is TAGCCATGCTCATGCGTCAT, and reverse sequence is CGCGGTTTGCAGTAGTTGC.Amplification system 10 μ l, dna profiling 1 μ l, 94 ℃ of pre-sex change 5min, 94 ℃ of sex change 0.5min, 59 ℃ of renaturation 0.5min, 72 ℃ are extended 1min, and after 35 circulations, 72 ℃ are extended 7min again.Reaction product is electrophoresis on 3.5% sepharose, observes down through ethidium bromide staining and in gel imaging system, judges the resistant gene type of each individual plant according to banding pattern, obtains the disease-resistant strain system of the resistant gene type that the is defined as Stvb-iStvb-i of the single band of 157bp.According to from generation to generation the resistance performance up and down of molecular marker assisted selection, the effect of evaluation mark assisted Selection.We utilize mark RM11-8 that the offspring in military round-grained rice 13/ Northeast 194 individual plant of choosing seeds is screened in a large number, eliminate isozygoty susceptible parent or F ₁The individual plant of banding pattern (extremely indivedual economical character elite plants kept) keeps the individual plant of the resistance parent banding pattern that isozygotys.To 2007, this 39 high yields, high-quality, anti-bar strain (wherein 4 strains have entered all kinds of interim tests in Jiangsu Province) that is combined into seminar's variety comparative test marker detection and field incidence investigation (be high resisting, sickness rate is lower than 2%) have been carried out once more.The result shows that the banding pattern that removes JD7033 and JD7301 is susceptible parent or the F of isozygotying ₁Banding pattern and show high anti-outside, the Molecular Detection result of other 37 strains is isozygoty resistance parent banding pattern and land for growing field crops qualification result and also shows as high anti-(Fig. 4).Therefore, identify the Stvb-i genotype and screen the disease resisting rice plant, can improve the breeding process of China's stripe disease resistant variety rapidly by above-mentioned SSR molecule marker.In conjunction with stripe virus disease natural occurrence condition survey result, be the sub-district selection individual plant that Stvb-iStvb-i, resistance rank reach I and II only in genotype.Stable, consistent high-quality, the high yield new lines " peaceful 5055 " of economical character of acquisition stripe virus disease resistance in 2006, its plant height 98～102cm, every strain 8～10 fringes, spike length 16cm, the fringe type is upright partially, several 140～150 of every total grain panicle, setting percentage 90%～92%, thousand seed weight 26～27g.

Sequence table

＜110〉Jiangsu Province Agriculture Science Institute

＜120〉molecule marking method of rice stripe disease resistant gene Stvb-i

＜130〉specification sheets

<140>00

<141>2008-01-03

<160>2

<170>PatentIn version 3.1

<210>1

<211>20

<212>DNA

＜213〉synthetic

<220>

＜221〉RM11-8 primer forward sequence

<222>(1)..(20)

<223>

<400>1

tagccatgct catgcgtcat 20

<210>2

<211>19

<212>DNA

＜213〉synthetic

<220>

＜221〉RM11-8 primer reverse sequence

<222>(1)..(19)

<223>

<400>2

cgcggtttgc agtagttgc 19

Claims (1)

1. the molecule marking method of rice stripe disease resistant gene Stvb-i is characterized in that:

With dominance SSR mark RM11-8 primer

The forward sequence is TAGCCATGCTCATGCGTCAT

Reverse sequence is CGCGGTTTGCAGTAGTTGC

Amplifying rice stripe virus disease resistant variety or breeding material DNA if can amplify the single band of 157bp, show that then anti-stripe virus disease gene Stvb-i exists, and this gene is positioned on paddy rice the 11st karyomit(e).

Images