CN101831498A - Method for selecting fragrant rice and primer for molecular marker - Google Patents
Method for selecting fragrant rice and primer for molecular marker Download PDFInfo
- Publication number
- CN101831498A CN101831498A CN 201010181087 CN201010181087A CN101831498A CN 101831498 A CN101831498 A CN 101831498A CN 201010181087 CN201010181087 CN 201010181087 CN 201010181087 A CN201010181087 A CN 201010181087A CN 101831498 A CN101831498 A CN 101831498A
- Authority
- CN
- China
- Prior art keywords
- rice
- fragrant
- fragrant rice
- gene
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a method for selecting fragrant rice and a primer for amplifying a betaine acetaldehyde dehydrogenase-2 gene (Badh2/badh2) molecular marker which is directly related to the formation of rice fragrance. The method comprises the following steps of: (1) extracting the total DNA of rice as a template and adding four primers for the molecular marker to perform PCR amplification; and (2) taking a PCR product for detecting gel electrophoresis. The method and the primer can assist in selecting fragrant genes-containing plants and contributes to improving selection effect. Simultaneously, the homozygotic state of a self-progeny fragrant gene formed in a later stage of a breeding process can be identified so as to rapidly and effectively fulfill the aim of breeding.
Description
Technical field
The present invention relates to molecular biology and genetics field, be specially the method for screening fragrant rice and the primer of molecule marker, be used for auxiliary conventional breeding seed selection fragrant rice.
Background technology
Scented rice can produce special fragrance thereby be subjected to human consumer's favor in boiling.Odor type rice price is more high than non-odor type rice, makes it occupy the status of particularly important in international rice trade.Along with the raising of people's living standard, existing market increases day by day to the scented rice demand, has also promoted the heredity and the breeding research of fragrant rice thus.
Although there is difference in the past people for rice aroma genetic research result, but most scholars think rice aroma, and (Min Shao wipes etc. by a recessive key-gene control, rice breeding is learned, Chinese agriculture press, 1996,322-353), and be positioned at (Aha etc. on No. 8 karyomit(e), TheorAppl Genet, 1992,84:825-828; Garland etc., Theor Appl Genet, 2000,101:364-371; Jin etc., P1ant Sci, 2003,165:359-364; Cordeiro etc., Mol Breed, 2002,9 (4): 245-250; Chen etc., Plant Sci 2006,171:505-514; Li etc., Mol Plant Breed, 2006,4:54-58).Also have report to show, rice scent and a kind of fragrance matter 2-acetyl-1-pyrroline (2-Acetyl-1-pyrroline is called for short 2-AP) closely related (Lorieux etc., Theor Appl Genet, 1996,93:1145-1151; Yoshihashi etc., J Food Sci, 2002,67:619-622; Chen etc., P1ant cell, 2008,20:1850-1861).
It is all lower to produce the general output of fragrant rice that goes up use at present, and disease resistance is also relatively poor.Combining if high yield, disease-resistant and rice can be had these proterties of fragrance, is the breeding objective that many rice breeding men pursue always.At present for new fragrant rice conventional breeding, mostly all earlier with fragrant rice and non-fragrant rice hybridization with multiple favourable proterties, in order in the new fragrant rice of cultivating, to contain the genetic composition of the favourable proterties of more non-fragrant rice, the non-fragrant rice filial generation of fragrant rice and high yield need be continued and non-fragrant rice be backcrossed several generations toward contact, and then carry out selfing and isozygotied in different genes site such as scent gene.In this process, how fast, accurately, simply to backcross and whether the self progeny paddy rice has scent gene and scent gene and whether isozygoty to identify it is a difficult problem in the scented rice breeding always.
Although the method for more existing evaluation scent genes is used in the scented rice breeding in the past, yet all there is very big deficiency in these methods when handling a large amount of samples, as judge whether fragrant gene of target individual plant according to traditional grain of rice method of chewing, not only predispose to damage because of tasting tongue continuously, and can produce erroneous judgement because of degree of having a sharp sense of taste descends, cause the good heterozygous individual that contains scent gene in the polybasic chosen process, to be eliminated, finally cause losing of scent gene; Chemical process is that the KOH infusion method often is utilized (Dong Yanjun etc., seed, 1992 (3) 24-27; Sood etc., Indian J Genet Plant Breeding, 1978,38:268-271), still this method has very big infringement to people's olfactory system; (gas chromatography-mass spectrometry GC-MS) directly measures 2-AP content and also is utilized (Niu etc., BMC Plant Biology, 2008,8:100-130 with the method that detects scented rice to utilize gas chromatograph-mass spectrometer in recent years; Fitzgerald etc., Plant Science, 2008,175:539-546).Though it is a kind of very direct and objective measuring method, the time-consuming and costliness very of this method.
In recent years,, make the fragrant rice of molecular marking supplementary breeding become possibility along with the development of Protocols in Molecular Biology.People such as Ahn found one and the close chain RFLP mark RG28 of rice scent on No. 8 karyomit(e) in 1992.Lorieux etc. (Theor Appl Genet, 1996,93:1145-1151) confirm that by the method for genetic mapping RG28 is closely related with rice scent, and the genetic distance that calculates between them is 5.8cM.Garland etc. (Theor ApplGenet, 2000,101:364-371) on the basis of previous work, set up the linksystem molecule marker RG28 of PCR-based technology, they utilize RG28 to carry out fragrant rice assistant breeding simultaneously.Also there are other investigators once to utilize the mark with scented rice gene linkage that scented rice is carried out assisted Selection (Cordeiro etc., Mol Breed, 2002,9 (4): 245-250; Li Jinhua etc., Molecular Plant Breeding, 2006,4 (1): 54-58).Utilize the screening method of scented rice gene linkage mark to improve the speed of selecting to a certain extent, and simple to operate.But these marks all are the linked marker with the scented rice gene, also has certain genetic distance each other, in screening to filial generation, also might exchange, cause having certain error in offspring's screening because of there being certain genetic distance between purpose scent gene and the mark.For the scented rice molecular markers for identification, the most desirable and effective means is directly to detect the scented rice gene.
People such as the Bradbury trimethyl-glycine aldehyde dehydrogenase 2 gene (Badh2/badh2) of encoding on be the material reported first with Kyeema paddy rice (a kind of long grain jasmine fragrance Australia rice varieties) No. 8 karyomit(e) in 2005 is directly related with rice scent.People such as Bradbury find at badh2 the 7th exon the disappearance of 8 bases and the polymorphism of 3 Nucleotide (Bradbury etc., Plant Biotechnol J, 2005,3 (3): 363-370) are arranged.Have the scholar to think, the trimethyl-glycine aldehyde dehydrogenase 2 that is positioned at the Badh2 coding on No. 8 karyomit(e) of non-fragrant rice causes the paddy rice British plain spirits by consuming GABald (precursor of fragrance matter 2-AP).When Badh2 undergos mutation, produce incomplete trimethyl-glycine aldehyde dehydrogenase 2, this enzyme loses original function, can't consume GABald, thereby has increased the accumulation of 2-AP, makes rice fragrance (Chen etc., Plant cell, 2008,20:1850-1861 occur; Bradbury etc., Plant Mol Biol, 2008,68:439-449).Because rice scent and the transgenation of trimethyl-glycine aldehyde dehydrogenase 2 are directly related, so trimethyl-glycine aldehyde dehydrogenase 2 gene can be called as scent gene again.
Existing bibliographical information shows, rice scent is directly related with paddy rice trimethyl-glycine aldehyde dehydrogenase 2 gene (Badh2/badh2) exons coding chain-ordering, (badh2) causes the trimethyl-glycine aldehyde dehydrogenase 2 to lose original function behind normal trimethyl-glycine aldehyde dehydrogenase 2 gene (Badh2) the exon base mutation, make the precursor substance accumulation of fragrance matter 2-AP, cause that fragrance matter 2-AP content sharply increases, make paddy rice performance fragrance.
In people such as Bradbury reported in 2005, also according to trimethyl-glycine aldehyde dehydrogenase 2 gene (Badh2/badh2) nucleotide difference between non-fragrant rice and fragrant rice the 7th exon, two pairs of primers have been designed, be used for assistant breeding (Bradbury etc., Plant Biotechnol J, 2005,3 (3): 363-370).After people such as Bradbury, people such as Wang Feng relatively lack 8 nucleotide sequence characteristics according to scent gene and non-scent gene on the 7th exons coding chain, a pair of primer has been designed at the two ends that occur 8 sequential nucleotide deletions at trimethyl-glycine aldehyde dehydrogenase 2 gene, be used for the scent gene type and identify (Wang Feng etc., the rice in China science, 2008,22 (4): 347-352).The same year, physiognomy mentalities of designing together such as people such as Wang Jun employing and Wang Feng, the two ends that 7 or 8 sequential nucleotide deletions also on trimethyl-glycine aldehyde dehydrogenase 2 genes encoding chain, occur, two couples of primer (Wang Jun etc. that can identify the scent gene type have been designed, Molecular Plant Breeding, 2008,6 (6): 1209-1212).Because people such as people such as Wang Feng and Wang Jun design primers according to 7 or 8 nucleotide sequences of disappearance on scent gene and the non-scent gene coding strand, for having only 7 or 8 nucleotide sequence differences between corresponding scent gene that produces of pcr amplification and the non-scent gene product length, therefore when carrying out electrophoresis detection PCR product, all be to use than agarose gel electrophoresis detecting operation is complicated and detect with the many polyacrylamide gel electrophoresises of trouble.And forefathers have only paid attention to the otherness between fragrant rice and the non-fragrant rice scent gene exon is screened when the design primer, promptly only distinguish fragrant and non-fragrant rice according to the otherness between the coding strand.
For eukaryotic gene, except exon, also have non-coding sequences such as intron sequences, 3 ' and 5 ' UTR district, promoter region as coding strand.Since 1977 find intron, the research as the main member's of eukaryotic gene group intron function more and more has been subjected to people's attention.People propose many new opinions to the function of intron in recent years, and a wherein most important aspect is that intron plays an important role in gene expression regulation.Comprehensive forefathers studies show that, intron as enhanser, attenuator, tranquillization etc. to genetic expression have enhancing, inhibition, two-way (positive and negative) regulate, like different regulating effect (Qiu Xiaoyun etc. such as sense-rnas, foreign medical science genetics fascicle, 1996,19 (1): 44-48).
Nearly 30 fragrant rice varieties have been collected in nearest 2 years of this laboratory from the U.S., Japan, Thailand and China different areas.When identifying scent gene (badh2) the coding mutation position of collected fragrant rice, find, the sudden change of some fragrant rice varieties trimethyl-glycine aldehyde dehydrogenase 2 gene occurs in the 7th exon, and the sudden change of some fragrant rice varieties trimethyl-glycine aldehyde dehydrogenase 2 gene occurs in the 2nd exon; Found also that simultaneously a kind of exons coding district, 3 ' and 5 ' UTR district do not have sudden change, and the essentially identical fragrant rice varieties of fragrant rice (South Sea 318) of sudden change has been arranged at the 2nd intron and the 4th intron nucleotide sequence sudden change situation and coding strand.Handle the analysis of the grain of rice by trial test and KOH and find that the South Sea 318 grain of rices also have fragrance, but lighter slightly than general fragrant rice.Carried out sequencing analysis after having cloned about 1.3kb South Sea 318 paddy rice trimethyl-glycine aldehyde dehydrogenase 2 gene promoter sequences, the result shows that the conserved sequence that influences promoter function is also Japanese fine identical with non-fragrant rice.In conjunction with forefathers' report (Chen etc., Plant cell, 2008,20:1850-1861) with this laboratory studies show that to multiple fragrant rice sequential analysis, no matter occurring in which exon or the coding region exon of coding region, sudden change do not have sudden change, the variation phenomenon that all respectively has the nucleotide sequence in a zone to show disappearance respectively in the 2nd intron of fragrant rice badh2 and the 4th intron and insert has general character in fragrant rice, especially all can relate to the disappearance of two base sequence TT and all can relate in the 4th intron and insert one section long TA tumor-necrosis factor glycoproteins in the 2nd intron.Show thus, be present in the sequence of obviously suddenling change in the fragrant rice trimethyl-glycine aldehyde dehydrogenase 2 gene intron at present and in evolution, have certain conservative property.
In further research back confirmation, the South Sea 318 paddy rice grain of rices have fragrance and exist the trimethyl-glycine aldehyde dehydrogenase 2 gene (badh2) of variation relevant with the 2nd and the 4th intron.Show that thus the badh2 intron also may have important effect in the fragrance forming process.Therefore in utilizing the breeding of molecule marker assisting sifting fragrant rice, design of primers for the amplifier molecule mark, should consider trimethyl-glycine aldehyde dehydrogenase 2 gene extron encoding sequence, also should consider between fragrant rice, to have simultaneously the intron mutational site of common sudden change.
Summary of the invention
Purpose of the present invention provides a kind of primer that screens the fragrant rice molecule marker.
The present invention also provides a kind of method of screening fragrant rice, identifies scent gene fast and accurately.
The primer M7 of one group of screening fragrant rice molecule marker is used to identify scent gene, comprises the primer of following four sequences:
(1) with the fragrance allelotrope sense primer sequence (FS) of the 4th intron antisense strand autosyndetic pairing of fragrant rice badh2: aggaatatatatatatatatatatatataatg; (SEQ ID No.1)
(2) with the fragrance allelotrope antisense primer sequence (FN) of the 7th exon positive-sense strand autosyndetic pairing of fragrant rice badh2: accataggagcagctgaaatatatac; (SEQ ID No.2)
(3) with the non-fragrance allelotrope sense primer sequence (nFS) of the 2nd intron antisense strand autosyndetic pairing of non-fragrant rice Badh2: gcgcaacaacaagtgtatattgttt; (SEQ ID No.3)
(4) with the non-fragrance allelotrope antisense primer sequence (nFN) of the 7th exon positive-sense strand autosyndetic pairing of non-fragrant rice Badh2: gcagctgaagccataatctttttac; (SEQ ID No.4).
A kind of method of screening fragrant rice may further comprise the steps:
(1) extracts rice total dna as template (can adopt CTAB method or SDS method), add four kinds of above-mentioned primers and carry out pcr amplification;
(2) get the PCR product and carry out detected through gel electrophoresis.
The method of pcr amplification is: 93 ℃～95 ℃ pre-sex change 4～6 minutes; 93 ℃～95 ℃ sex change 20～40 seconds, 54 ℃～56 ℃ annealing 20～40 seconds, 71 ℃～73 ℃ were extended totally 36～40 circulations 20～40 seconds; Last 71 ℃～73 ℃ were extended 8～12 minutes.
Described fragrant rice is the fragrant rice that trimethyl-glycine aldehyde dehydrogenase 2 gene the 7th exon has mutation type.
The allelic PCR product of the corresponding fragrance of about 780bp band, the corresponding non-fragrant allelotrope PCR product of about 2100bp band.
Aforesaid method can be used for the fragrant rice of Screening and Identification trimethyl-glycine aldehyde dehydrogenase 2 gene the 7th exons mutation and non-fragrant rice filial generation, the fragrant rice of trimethyl-glycine aldehyde dehydrogenase 2 gene the 7th exons mutation and the self progeny after the hybridization of non-fragrant rice, the offspring who backcrosses with non-fragrant rice again after perhaps the fragrant rice of trimethyl-glycine aldehyde dehydrogenase 2 gene the 7th exons mutation and non-fragrant rice are hybridized.
Extract the amplified production 780bp band of only having an appointment by the fragrant rice that isozygotys as the total DNA of template.
Total DNA is extracted by non-fragrant rice as template, the amplified production 2100bp band of only having an appointment.
Extracted by the heterozygote paddy rice of odor type and non-fragrant rice filial generation as the total DNA of template, two kinds of amplified productions of about 780bp band and 2100bp band all have.
Extract as the offspring paddy rice that the total DNA of template backcrosses with non-fragrant rice again after by the hybridization of fragrant rice and non-fragrant rice, the 2100bp band of only having an appointment be British plain spirits gene pure plant; What have 780bp and two bands of 2100bp simultaneously is scent gene heterozygosis type plant.
Extract as the self progeny paddy rice of the total DNA of template after by the hybridization of fragrant rice and non-fragrant rice, the 780bp band of only having an appointment be the scent gene homozygous plants; What only have an appointment the 2100bp band is non-scent gene homozygous plants; What have 780bp and two bands of 2100bp simultaneously is scent gene heterozygosis type plant.
Primer of the present invention is according to the design of the sequence difference of fragrant rice and non-fragrant rice scent gene itself, this group primer can obtain the PCR product from the dna sequence dna amplification of clear and definite function, be different from general linksystem molecule marker, and the primer of the present invention's design, the exons coding sequence that had both related to the fragrant rice scent gene has also related to the intron site that has common sudden change between the fragrant rice scent gene simultaneously.The use of this group primer only is fit to following two kinds of situations: as fragrant source paddy rice, in carrying out fragrant rice rearing new variety process, obtain to carry out the molecule marker of assisting sifting with the fragrant rice varieties of badh2 the 7th exons mutation type; The fragrant rice varieties of difference is carried out the evaluation whether badh2 belongs to the fragrant rice of the 7th exons mutation type.
Also there was the scholar to utilize sequence difference design functionality primer between fragrant rice and the non-fragrant rice trimethyl-glycine aldehyde dehydrogenase 2 gene (badh2/Badh2) in the past, but they only pay attention to badh2/Badh2 encoding sequence differences and carry out design of primers, do not consider the otherness of scent gene and non-scent gene intron sequences.Gene intron also has significant effects to expression of gene, so the molecule marker of the present invention's design has been considered exon and two aspects of intron simultaneously.The functional molecular marker of the present invention's design lays respectively at both discrepant sequences in scent gene and non-scent gene coding strand and the intron, and the accuracy rate that screening contains scent gene can reach 100%.
To being that cultivate in the novel fragrant rice process in fragrant source with the fragrant rice of the 7th exons mutation type, the primer that utilizes the present invention to design carries out the plant that assisted Selection contains scent gene, help improving the selection effect, whether self progeny's scent gene that the while can also form the later stage of breeding process is homozygotic state is identified, thereby fast and effeciently realizes breeding objective.
Carry out in the novel fragrant rice seed selection in that the primer that utilizes the present invention to design is auxiliary, can get any one position as material in any one period of rice plant growth to be measured, extract a small amount of total DNA as blade or stem or root etc., four primers of 7FS/7FN/7nFS/7nFN are placed in the PCR pipe simultaneously carry out amplified reaction, and then utilize agarose gel electrophoresis easy and simple to handle to detect and just can soon needed individual plant be picked out.
The present invention has overcome selection error and the deviation of using the trial test method in the present fragrant rice breeding or may existing with the screening of scent gene linked marker, or handle back rice and may people's sense of smell be damaged when whether savory by smelling KOH, or utilize the Equipment Inspection meeting to need expensive equipment purchasing and testing cost, or utilization is as selecting primer with the otherness between coding strand nucleotide sequence and the non-fragrant rice on the fragrant rice trimethyl-glycine aldehyde dehydrogenase 2 gene extron, and do not consider simultaneously that difference between this gene extron coding strand and intron nucleotide sequence and the non-fragrant rice is as the primer of selecting, might cause because of ignoring the effect of trimethyl-glycine aldehyde dehydrogenase 2 gene intron in the performance of decision rice aroma, thereby might cause offspring's fragrance degree of occurring filtering out to reduce and the deficiency of aspect such as deviation, realization is to containing the easy of scent gene screening, fast and validity, whether self progeny's scent gene that can also form the later stage of breeding process is homozygotic state and identifies simultaneously.
Description of drawings
Fig. 1 is that three kinds of paddy rice trimethyl-glycine aldehyde dehydrogenase 2 genes are respectively at the 2nd, the 4th intron and the main diversity sequence comparison diagram of the 7th exon.Wherein W fragrant 99075 is a fragrant rice, and 261S and Japan are fine to be non-fragrant rice.Arrow locations show 2 pairs of primers respectively with fragrant rice W fragrant 99075 and non-fragrant rice trimethyl-glycine aldehyde dehydrogenase 2 gene binding site and pcr amplification direction, shadow representation difference site, the position of this Nucleotide of numeral in trimethyl-glycine aldehyde dehydrogenase 2 gene, first Nucleotide of initiator codon is decided to be+1bp.
Fig. 2 is embodiment 1 fragrant rice varieties W fragrant 99075 and non-fragrant rice varieties and W fragrant 99075 and non-perfume rice hybridization F
1The plant scent gene is identified figure.Wherein first swimming lane is standard molecular weight DNA; The 2nd swimming lane is the fragrant 99075 plant pcr amplification products of fragrant rice varieties W, the about 780bp of molecular weight; The 3rd swimming lane is non-fragrant rice varieties 261S plant pcr amplification product, the about 2100bp of molecular weight; Swimming lane 4 is fragrant rice varieties W fragrant 99075 and non-perfume rice hybridization F
1Plant pcr amplification product, molecular weight are respectively about 780bp and 2100bp.
Fig. 3 is non-perfume rice varieties and the fragrant 99075 fragrant rice varieties filial generation F of W among the embodiment 2
1Plant and non-perfume rice first backcross generation plant PCR check and analysis figure.Wherein M is standard molecular weight DNA; 1～24 is the first backcross generation plant.Only have an appointment 2100bp one band corresponding to the non-fragrant homozygous plants PCR product of backcross progeny, have about 780bp and 2100bp two bands corresponding to backcross progeny scent gene heterozygous plant PCR product.
Fig. 4 is fragrant 99075 fragrant rice varieties of W and non-fragrant rice varieties hybridization F among the embodiment 2
1The F that the plant selfing obtains
2Offspring plant scent gene compartment analysis figure.Among the figure: M is standard molecular weight DNA; 1～46 is non-fragrant rice varieties and fragrant rice varieties filial generation F
2Plant, only have an appointment 780bp one band corresponding to self progeny's odor type homozygous plants PCR product, only have an appointment 2100bp one band corresponding to the non-fragrant homozygous plants PCR product of self progeny, have about 780bp and 2100bp two bands corresponding to self progeny's scent gene heterozygous plant PCR product.
Embodiment
Scent gene is the trimethyl-glycine aldehyde dehydrogenase 2 gene (badh2) of the fragrant rice of the 7th exons mutation type, and the trimethyl-glycine aldehyde dehydrogenase 2 gene (Badh2) that described non-scent gene is all non-fragrant rices forms directly relevant with rice aroma.
Can adopt CTAB method or SDS method to extract total DNA.
The pcr amplification reaction program is: 94 ℃ of pre-sex change 5 minutes; 94 ℃ of sex change 30 seconds, 55 ℃ of annealing 30 seconds, 72 ℃ were extended totally 38 circulations 30 seconds; Last 72 ℃ were extended 10 minutes.
The clone and the analysis of the trimethyl-glycine aldehyde dehydrogenase 2 gene (badh2/Badh2) of fragrant 99075 fragrant rices of embodiment 1W and 261S, the fine non-fragrant rice of Japan and hybrid rice
At first adopt the molecular biology ordinary method, be example with W fragrant 99075 and 261S as odor type and non-fragrant rice respectively, cloned the trimethyl-glycine aldehyde dehydrogenase 2 gene (badh2/Badh2) of these two kinds of paddy rice, and carried out sequencing analysis, checked simultaneously to be published in the fine trimethyl-glycine aldehyde dehydrogenase 2 gene order (AP004463) of non-fragrant rice Japan among the Genbank.
Compare fragrant rice W fragrant 99075 and the fine badh2/Badh2 sequence of non-fragrant rice 261S and Japan, difference between W fragrant 99075 and the non-fragrant rice mainly is positioned at three sections, except variant, also there are differences at the 2nd intron and the 4th intron as the 7th exon of coding strand.W perfume (or spice) 99075 mainly exists discontinuous 8 base deletions and a nucleotide difference with respect to non-fragrant rice at the 7th exon, the single nucleotide alteration that mainly has two TT disappearances of successive and T-C at the 2nd intron, main one section TATATATA insertion and the A-T Nucleotide of existing changes in the 4th intron, as shown in Figure 1, arrow locations show 2 pairs of primers respectively with fragrant rice W fragrant 99075 and non-fragrant rice trimethyl-glycine aldehyde dehydrogenase 2 gene binding site and pcr amplification direction, shadow representation difference site, the position of this Nucleotide of numeral in trimethyl-glycine aldehyde dehydrogenase 2 gene, first Nucleotide of initiator codon is decided to be+1bp.
Find when further analyzing other fragrant rice trimethyl-glycine aldehyde dehydrogenase 2 genes, the coding strand base mutation of some fragrant rice varieties occurs in the 7th exon, also the sudden change of some fragrant rice varieties trimethyl-glycine aldehyde dehydrogenase 2 gene occurs in the 2nd exon, the no base jumping phenomenon in coding strand that also has but has general character but the disappearance of the TT in the 2nd intron and one section long TA tumor-necrosis factor glycoproteins in the 4th intron insert variation phenomenon in fragrant rice.
According to the difference of trimethyl-glycine aldehyde dehydrogenase 2 gene order between fragrant rice and non-fragrant rice, we are at the fragrant rice that belongs to the 7th exons mutation and non-fragrant rice badh2/Badh2 the 2nd intron, the 4th intron and the 7th exon place, two pairs of primers have been designed, primer (being M7:7FS/7FN/7nFS/7nFN) as fragrant rice breeding discriminating scent gene or non-scent gene functional molecular marker is following sequence:
(1) fragrance allelotrope sense primer sequence (FS) is with the 4th intron antisense strand autosyndetic pairing: the aggaatatatatatatatatatatatataatg of fragrant rice badh2
(2) fragrance allelotrope antisense primer sequence (FN) is with the 7th exon positive-sense strand autosyndetic pairing: the accataggagcagctgaaatatatac of fragrant rice badh2
(3) non-fragrance allelotrope sense primer sequence (nFS) is with the 2nd intron antisense strand autosyndetic pairing: the gcgcaacaacaagtgtatattgttt of non-fragrant rice Badh2
(4) non-fragrance allelotrope antisense primer sequence (nFN) is with the 7th exon positive-sense strand autosyndetic pairing: the gcagctgaagccataatctttttac of non-fragrant rice Badh2
With above-mentioned two pairs of primers, respectively with the F of fragrant rice W perfume (or spice) 99075, non-fragrant rice 261S and W fragrant 99075 with 261S hybridization acquisition
1The total DNA of plant is a template, carries out pcr amplification, and electrophoretic analysis is identified then, is extracted the amplified production 780bp band of only having an appointment by the fragrant rice that isozygotys as the total DNA of template; Total DNA is extracted by non-fragrant rice as template, the amplified production 2100bp band of only having an appointment; Extracted by the heterozygote paddy rice that odor type and the hybridization of non-fragrant rice obtain as the total DNA of template, two kinds of amplified productions of about 780bp band and 2100bp band all have.Result such as Fig. 2: among the figure: first swimming lane is standard molecular weight DNA; The 2nd swimming lane is the fragrant 99075 plant pcr amplification products of fragrant rice varieties W, the about 780bp of molecular weight; The 3rd swimming lane is non-fragrant rice varieties 261S plant pcr amplification product, the about 2100bp of molecular weight; Swimming lane 4 is fragrant rice varieties W fragrant 99075 and non-perfume rice hybridization F
1Plant pcr amplification product, molecular weight are respectively about 780bp and 2100bp.
Increase with the PCR ordinary method, the PCR pipe after sterilization adds following composition and consumption (totally be 50 μ l, carry out the preparation of PCR system on ice):
Get 8 μ l PCR products after amplification is finished and on 1% sepharose, carry out electrophoresis detection.
Found that these two pairs of primers can be distinguished the F of fragrant rice W perfume (or spice) 99075, non-fragrant rice and W fragrant 99075 and non-fragrant rice hybridization acquisition well
1Plant and F
1The backcross composition of the offspring plant scent gene that obtains of plant and non-fragrant rice also can be hybridized F from fragrant 99075 fragrant rice varieties of W and non-fragrant rice varieties
1The F that the plant selfing obtains
2Identify scent gene in the offspring plant effectively and whether also exist, and whether be and isozygoty or the state of heterozygosis.
Two pairs of primers with the present invention's design carry out pcr amplification reaction to the total DNA of the fragrant rice plants of kind more than 20 respectively.The result shows, can be identified out fast to the fragrant rice that belongs to trimethyl-glycine aldehyde dehydrogenase 2 gene the 7th exons mutation type.
Therefore prove absolutely that two pairs of primers of the present invention's design can be used for the assist-breeding of fragrant rice new variety quickly and efficiently.
It is the late round-grained rice of hybridization " the fragrant round-grained rice of Min You " hybridisation rice that the Shanghai City Minhang District institute of agricultural sciences utilized 261S and W fragrant 99075 to hybridize successfully to cultivate two in 2000.This kind has the characteristics of the fertile high and stable yields of province, general every mu of effective fringe 18-19 ten thousand, several about 145 of every total grain panicle, setting percentage 90%, grain ovalize, thousand seed weight is up to 28.5g, rice has faint scent, output come out at the top in rice belt, Shanghai City in 2001 and 2002 examination (Lu Yuqi etc., Shanghai Agricultural science and technology, 2004, (3): 38).
It mainly is that its male parent " W perfume (or spice) 99075 " is a fragrant rice of routine that " the fragrant round-grained rice of Min You " rice has faint scent.Because therefore maternal 261S rice British plain spirits, according to scented rice gene genetic characteristics, has only 1/4 paddy to have fragrance in " the fragrant round-grained rice of Min You " hybridisation rice, so the faint scent of " the fragrant round-grained rice of Min You " rice is lighter.Relatively " the fragrant round-grained rice of Min You " two parent: 261S of hybridisation rice and the fragrant 99075 individual plant tiller numbers of W on average are respectively 9 and 11, although 261S lacks slightly than W perfume (or spice) 99075,261S fringe type is obviously greater than W perfume (or spice) 99075, and the every fringe grain husk of 261S spends number approximately than W perfume (or spice) more than 99,075 50%.We were once suitable with W fragrant 99075 with 261S and a plurality of tiller number, the F of the bigger conventional rice hybridization of fringe type, and observation simultaneously
1The hybrid vigour phenomenon of plant.Although it is all better that the result shows 261S and a lot of conventional rice hybridization combining ability, some combination output is apparently higher than " the fragrant round-grained rice of Min You ", because male parent is not fragrant rice, these combinations offspring rice is British plain spirits also.And observe existing fragrant rice varieties, all be the less relatively types of some fringe types mainly.Therefore,, can't obtain the light odor type two-line hybrid rice that output is higher than " the fragrant round-grained rice of Min You " fast from present existing status analysis, also can't quickly breeding paddy whole spice type two be hybridisation rice.But,, will lay a good foundation for finishing the as above cultivation of two kinds of hybridisation rices if can successfully cultivate large spike odor type two-line sterile line.
The fragrant rice genetic composition of isozygotying can represent that normal non-odor type two-line sterile line 261S rice genetic is formed available AA and represented with aa.Large spike odor type two-line sterile line rice cultivating process is mainly: be female parent with non-odor type two-line sterile line 261S paddy rice (AA) earlier, fragrant rice (aa) is hybridized for male parent, the F after the hybridization
1Plant genetic composition is Aa, again with F
1Plant is a male parent, backcrosses with two-line sterile line 261S (AA), and the site genetic composition of first backcross generation plant scent gene is respectively: AA and Aa.In the first backcross generation plant, choose all similar individual plant of proterties such as plant height, tiller number and get blade to two-line sterile line 261S paddy rice, two pairs of primers that utilize the present invention to design carry out pcr amplification to the first backcross generation plant of selecting, the agarose gel electrophoresis detected result shows, contain scent gene heterozygosis offspring and present about 780bp and two bands of 2100bp, the British plain spirits gene pure offspring band of 2100bp of only having an appointment, (M is standard molecular weight DNA as shown in Figure 3; 1～24 is the first backcross generation plant.The allelic PCR product of the corresponding fragrance of about 780bp band, the corresponding non-fragrant allelotrope PCR product of about 2100bp band.The 2100bp band of only having an appointment is British plain spirits gene pure plant; Have two bands of 780bp and 2100bp simultaneously, be scent gene heterozygosis type plant).
Therefrom choose and contain two pcr amplification bands, the also plant alike with the 261S paddy rice as far as possible of economical character simultaneously, continue to backcross with non-odor type two-line sterile line 261S paddy rice (AA), the site genetic composition of the s-generation of backcrossing plant scent gene is AA and Aa equally.Two pairs of primers that utilize the present invention to design again carry out pcr amplification to the s-generation plant of backcrossing, and will contain the alike heterozygote paddy rice of scent gene and economical character and 261S paddy rice equally and backcross with non-odor type two-line sterile line 261S paddy rice and obtain to backcross third generation plant.Same operation reentry backcross the 4th generation plant.
261S belongs to the two-line sterile line paddy rice, and sowing plantation before and after May 20 is contained flower greatly at the beginning of by the end of August to 9 months in Shanghai, and performance male sterile.Sowing plantation before and after July 10 is contained flower about September 22 to September 28 greatly in Shanghai, and the male recovery fertility of part can self-fertility.Therefore, when cultivating large spike odor type two-line sterile line paddy rice, the parent's plantation that obtains the 1st hybridization and backcross plant can be in Shanghai mid or late May sowing plantation.The parent of other cultivating seeds of backcrossing is all sowing plantations before and after July 10 in Shanghai, or plant in Hainan Province at the beginning of 12 months winter.
Sowing plantation on Shanghai May 20 backcross the 4th generation plant between planting season, get blade and carry out scent gene and identify.Before blooming, carry out bagging to containing scent gene individual plant tassel.After the paddy rice maturation, 5 individual plants of each picked at random carry out plant height, tiller number, bagging setting percentage and number scale record of average every fringe grain husk flower and statistical study from contain scent gene plant and 261S adjoining tree.Analyze to show by statistics, backcross four generation individual plant and 261S paddy rice plant height difference not remarkable; Two class plant baggings all do not have seed.This explanation, contain scent gene backcross four generation plant identical with the 261S paddy rice, in sowing plantation on Shanghai May 20, can show the male sterile phenomenon; Two class plant tillering numbers and average every fringe grain husk spend several statistical study demonstrations also not have significant difference (table 1).
Sowing plantation on Shanghai July 10 backcross the 4th generation plant between planting season, also get blade and carry out scent gene and identify.When paddy rice is ripe, field observation contain scent gene backcross four generation plant, big multiple characters is also all closely similar with the 261S contrast.Sowing plantation on picked at random July 10 and contain scent gene backcross four generation individual plant and 261S contrast individual plant, calculate self-fruitful rate.Analyze by statistics, two class plant self-fruitful rates do not have significant difference (table 1) yet.To contain again scent gene backcross the 4th generation plant carry out 2 generations of selfing, two pairs of primers that utilize the present invention to design carry out pcr amplification to the selfing plant, therefrom obtaining the scent gene site is the large spike odor type two-line sterile line paddy rice of isozygotying.
Table 1 contains scent gene two-line sterile line strain system and 261S adjoining tree Other Main Agronomic Characters compares
Also available present method is from fragrant 99075 fragrant rice varieties of W and non-fragrant rice varieties hybridization F
1The F that the plant selfing obtains
2Identify scent gene in the offspring plant effectively and whether also exist, and whether be and isozygoty or the state of heterozygosis, as shown in Figure 4.Among Fig. 4: M is standard molecular weight DNA; 1～46 is non-fragrant rice varieties and fragrant rice varieties filial generation F
2Plant, the allelic PCR product of the corresponding fragrance of about 780bp band, the corresponding non-fragrant allelotrope PCR product of about 2100bp band.Observed three types of amplified productions can be inferred F from the gel electrophoresis images
2The state of plant scent gene: the 780bp band of only having an appointment is the scent gene homozygous plants; The 2100bp band of only having an appointment is non-scent gene homozygous plants; Have two bands of 780bp and 2100bp simultaneously, be scent gene heterozygosis type.
Existing report shows, breeding units such as Jiangsu successfully cultivated anti-stripe virus disease high yield conventional rice (magnify friend etc., the Jiangsu agricultural sciences, 2009,5:121-122), but the report of not anti-stripe virus disease fragrant rice also at present.Utilize seed selection that the present invention designs, can also assist anti-stripe virus disease high yield fragrant rice as two pairs of primers of primer (M7:7FS/7FN/7nFS/7nFN) of amplification functional molecular marker.
Earlier with the anti-stripe virus disease high yield of non-odor type conventional rice (AA) and fragrant rice (aa) hybridization, again with F
1Plant (Aa) continues to backcross with the anti-stripe virus disease high-yield rice of non-odor type (AA).Two pairs of primers that utilize the present invention to design carry out pcr amplification to the first backcross generation plant, the agarose gel electrophoresis detected result shows equally, contain scent gene heterozygosis offspring and present about 780bp and two bands of 2100bp, the British plain spirits gene pure offspring band of 2100bp of only having an appointment.Therefrom choose contain two pcr amplification bands, simultaneously economical character preferably plant continue to backcross with the anti-stripe virus disease high-yield rice of non-odor type (AA), the site genetic composition of the s-generation of backcrossing plant scent gene is AA and Aa equally.Two pairs of primers that utilize the present invention to design again carry out pcr amplification to the s-generation plant of backcrossing, and the heterozygote paddy rice that will contain scent gene is equally backcrossed with the non-fragrant rice of high yield and obtains to backcross third generation plant.Adopt as above same method obtain the 4th generation backcross plant.The backcross plant that will contain scent gene equally carries out 2 generations of selfing, two pairs of primers that utilize the present invention to design carry out pcr amplification to the selfing plant, select the plant of isozygotying in the scent gene site, carry out the stripe virus disease resistance again and identify, obtain anti-stripe virus disease high yield fragrant rice offspring.
SEQUENCE?LISTING
＜110〉Shanghai Normal University
＜120〉a kind of method of fragrant rice and primer of molecule marker of screening
<130>none
<160>4
<170>PatentIn?version?3.3
<210>1
<211>32
<212>DNA
＜213〉paddy rice
<400>1
aggaatatat?atatatatat?atatatataa?tg 32
<210>2
<211>26
<212>DNA
＜213〉paddy rice
<400>2
accataggag?cagctgaaat?atatac 26
<210>3
<211>25
<212>DNA
＜213〉paddy rice
<400>3
gcgcaacaac?aagtgtatat?tgttt 25
<210>4
<211>25
<212>DNA
＜213〉paddy rice
<400>4
gcagctgaag?ccataatctt?tttac 25
Claims (4)
1. the primer M7 of one group of screening fragrant rice molecule marker is characterized in that, comprises the primer of following four sequences:
(1) with the fragrance equipotential base of the 4th intron antisense strand autosyndetic pairing of fragrant rice badh2
Because of the sense primer sequence, shown in the SEQ ID No.1: aggaatatatatatatatatatatatataatg;
(2) with the fragrance equipotential base of the 7th exon positive-sense strand autosyndetic pairing of fragrant rice badh2
Because of the antisense primer sequence, shown in the SEQ ID No.2: accataggagcagctgaaatatatac;
(3) with the non-fragrance allelotrope sense primer sequence of the 2nd intron antisense strand autosyndetic pairing of non-fragrant rice Badh2, shown in the SEQ ID No.3: gcgcaacaacaagtgtatattgttt;
(4) with the non-fragrance allelotrope antisense primer sequence of the 7th exon positive-sense strand autosyndetic pairing of non-fragrant rice Badh2, shown in the SEQ ID No.4: gcagctgaagccataatctttttac.
2. a method of screening fragrant rice is characterized in that, may further comprise the steps:
(1) extracts rice total dna as template, add the described four kinds of primers of claim 1 and carry out pcr amplification;
(2) get the PCR product and carry out detected through gel electrophoresis.
3. the method for the described screening fragrant rice of claim 2, it is characterized in that, described paddy rice is the fragrant rice of trimethyl-glycine aldehyde dehydrogenase 2 gene the 7th exons mutation and non-fragrant rice filial generation, the fragrant rice of trimethyl-glycine aldehyde dehydrogenase 2 gene the 7th exons mutation and the self progeny after the hybridization of non-fragrant rice, the offspring who backcrosses with non-fragrant rice again after perhaps the fragrant rice of trimethyl-glycine aldehyde dehydrogenase 2 gene the 7th exons mutation and non-fragrant rice are hybridized.
4. the method for the described screening fragrant rice of claim 2 is characterized in that, the method for pcr amplification is: 93 ℃～95 ℃ pre-sex change 4～6 minutes; 93 ℃～95 ℃ sex change 20～40 seconds, 54 ℃～56 ℃ annealing 20～40 seconds, 71 ℃～73 ℃ were extended totally 36～40 circulations 20～40 seconds; Last 71 ℃～73 ℃ were extended 8～12 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101810879A CN101831498B (en) | 2010-05-25 | 2010-05-25 | Method for selecting fragrant rice and primer for molecular marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101810879A CN101831498B (en) | 2010-05-25 | 2010-05-25 | Method for selecting fragrant rice and primer for molecular marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101831498A true CN101831498A (en) | 2010-09-15 |
| CN101831498B CN101831498B (en) | 2012-06-06 |
Family
ID=42715716
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101810879A Expired - Fee Related CN101831498B (en) | 2010-05-25 | 2010-05-25 | Method for selecting fragrant rice and primer for molecular marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101831498B (en) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102433323A (en) * | 2011-12-22 | 2012-05-02 | 江苏省农业科学院 | Extraction method of high-quality genome DNA from endosperm of single rice grains |
| CN103525840A (en) * | 2013-10-12 | 2014-01-22 | 上海师范大学 | Betaine aldehyde dehydrogenase 2 fragrance gene in paddy rice, primer of molecular marker and screening method |
| CN106381333A (en) * | 2016-08-31 | 2017-02-08 | 云南农业大学 | Method for identifying aromatic gene single-primer molecules of aromatic rice variety Diantun 502 |
| KR101802585B1 (en) * | 2015-06-29 | 2017-11-28 | 공주대학교 산학협력단 | Primer set for Discrimination of Aromatic Rice and Use Thereof |
| KR101914275B1 (en) * | 2017-11-22 | 2018-11-01 | 공주대학교 산학협력단 | Primer set for Discrimination of Aromatic Rice and Use Thereof |
| KR20180121443A (en) * | 2018-10-26 | 2018-11-07 | 공주대학교 산학협력단 | Primer set for Discrimination of Aromatic Rice and Use Thereof |
| CN109541137A (en) * | 2018-11-21 | 2019-03-29 | 广东海洋大学 | A kind of Rice Cropping cultivation detection rice scent rapid detection method |
| KR20190086427A (en) * | 2019-07-12 | 2019-07-22 | 공주대학교 산학협력단 | Primer set for Discrimination of Aromatic Rice and Use Thereof |
| KR20190086426A (en) * | 2019-07-12 | 2019-07-22 | 공주대학교 산학협력단 | Primer set for Discrimination of Aromatic Rice and Use Thereof |
| CN114027176A (en) * | 2021-12-03 | 2022-02-11 | 安徽袁粮水稻产业有限公司 | Breeding method of rice with aroma gene |
| CN114561486A (en) * | 2022-03-22 | 2022-05-31 | 海南大学三亚南繁研究院 | Primer, kit and method for detecting rice aroma gene badh2 through functional marker |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2005287882A1 (en) * | 2004-09-22 | 2006-03-30 | Grain Foods Innovations Pty Ltd | Method of producing fragrance by inactivation or reduction of a functional protein with Betaine Aldehyde Dehydrogenase (BADH) activity |
| CN101363060A (en) * | 2008-10-09 | 2009-02-11 | 江苏省农业科学院 | Two gene makers for identifying rice and fragrant rice gene fgr |
-
2010
- 2010-05-25 CN CN2010101810879A patent/CN101831498B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2005287882A1 (en) * | 2004-09-22 | 2006-03-30 | Grain Foods Innovations Pty Ltd | Method of producing fragrance by inactivation or reduction of a functional protein with Betaine Aldehyde Dehydrogenase (BADH) activity |
| CN101363060A (en) * | 2008-10-09 | 2009-02-11 | 江苏省农业科学院 | Two gene makers for identifying rice and fragrant rice gene fgr |
Non-Patent Citations (1)
| Title |
|---|
| 《安徽农业科学》 20071231 杨占烈 BADH引物检测水稻香味基因的研究 11390-11391 1-4 第35卷, 第35期 2 * |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102433323A (en) * | 2011-12-22 | 2012-05-02 | 江苏省农业科学院 | Extraction method of high-quality genome DNA from endosperm of single rice grains |
| CN103525840A (en) * | 2013-10-12 | 2014-01-22 | 上海师范大学 | Betaine aldehyde dehydrogenase 2 fragrance gene in paddy rice, primer of molecular marker and screening method |
| CN103525840B (en) * | 2013-10-12 | 2016-07-06 | 上海师范大学 | Betaine-aldehyde dehydrogenase 2 scent gene, the primer of molecular marker and the screening technique of a kind of Oryza sativa L. |
| KR101802585B1 (en) * | 2015-06-29 | 2017-11-28 | 공주대학교 산학협력단 | Primer set for Discrimination of Aromatic Rice and Use Thereof |
| CN106381333A (en) * | 2016-08-31 | 2017-02-08 | 云南农业大学 | Method for identifying aromatic gene single-primer molecules of aromatic rice variety Diantun 502 |
| KR101914275B1 (en) * | 2017-11-22 | 2018-11-01 | 공주대학교 산학협력단 | Primer set for Discrimination of Aromatic Rice and Use Thereof |
| KR20180121443A (en) * | 2018-10-26 | 2018-11-07 | 공주대학교 산학협력단 | Primer set for Discrimination of Aromatic Rice and Use Thereof |
| KR102001786B1 (en) * | 2018-10-26 | 2019-07-18 | 공주대학교 산학협력단 | Primer set for Discrimination of Aromatic Rice and Use Thereof |
| CN109541137A (en) * | 2018-11-21 | 2019-03-29 | 广东海洋大学 | A kind of Rice Cropping cultivation detection rice scent rapid detection method |
| KR20190086427A (en) * | 2019-07-12 | 2019-07-22 | 공주대학교 산학협력단 | Primer set for Discrimination of Aromatic Rice and Use Thereof |
| KR20190086426A (en) * | 2019-07-12 | 2019-07-22 | 공주대학교 산학협력단 | Primer set for Discrimination of Aromatic Rice and Use Thereof |
| KR102077962B1 (en) * | 2019-07-12 | 2020-02-14 | 공주대학교 산학협력단 | Primer set for Discrimination of Aromatic Rice and Use Thereof |
| KR102077963B1 (en) * | 2019-07-12 | 2020-02-14 | 공주대학교 산학협력단 | Primer set for Discrimination of Aromatic Rice and Use Thereof |
| CN114027176A (en) * | 2021-12-03 | 2022-02-11 | 安徽袁粮水稻产业有限公司 | Breeding method of rice with aroma gene |
| CN114561486A (en) * | 2022-03-22 | 2022-05-31 | 海南大学三亚南繁研究院 | Primer, kit and method for detecting rice aroma gene badh2 through functional marker |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101831498B (en) | 2012-06-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101831498B (en) | Method for selecting fragrant rice and primer for molecular marker | |
| US20230037341A1 (en) | Transgenic maize event mon 87427 and the relative development scale | |
| CN103484556B (en) | Primer and method for detecting molecular marker of rice aroma allele | |
| Yi et al. | Marker assisted backcross breeding to improve cooking quality traits in Myanmar rice cultivar Manawthukha | |
| AU2017204024A1 (en) | Brassica oleracea plants with improved nutritional value | |
| CN107201404B (en) | Molecular biological identification method for sex of asparagus hermaphrodite plants and application thereof | |
| Assefa et al. | Tef, eragrostis tef (Zucc.) trotter | |
| Colney et al. | Morphological and molecular characterization of two distinct chilli cultivars from North Eastern India with special reference to pungency related genes | |
| CN111903500B (en) | Breeding method of fragrant rice blast resistant restorer cinnamon 5886 with high harvest index | |
| US8030561B2 (en) | Rice plant and method for producing the same | |
| CN113179945A (en) | Breeding method of high-yield lodging-resistant disease-resistant new wheat variety | |
| NL2002357C2 (en) | Methods for improving the yield of cucumber plants. | |
| CN104109713B (en) | With the multilocus assisted selection method that wheat conventional breeding whole process is combined | |
| CN103429073B (en) | The breeding method of new varieties, the discrimination method of plant variety and the method making paddy rice individuality precocious | |
| CN103429074B (en) | The breeding method of new varieties, the discrimination method of plant variety and the method making paddy rice individuality precocious | |
| Abedi et al. | Genetic analysis for some of morphological traits in bread wheat under drought stress condition using generations mean analysis | |
| US20180220609A1 (en) | Carrot plants with a high anthocyanin level | |
| CN101225445A (en) | Molecule labeling method for rice stripe disease resistant gene Stvb-i | |
| Lapitan et al. | Molecular characterization and agronomic performance of DH lines from the F1 of indica and japonica cultivars of rice (Oryza sativa L.) | |
| US9131650B2 (en) | Hybrid carrot variety trooper | |
| US9012724B2 (en) | Hybrid carrot variety PURPLE SNAX | |
| Munji | Genetic studies of quantitative and quality traits in rice under low and high soil nitrogen and phosphorous conditions, and a survey of farmer preferences for varieties. | |
| Sauca et al. | Scientific results regarding the gene (S) introgression of drought-resistance to Helianthus annuus species, using embryo rescue | |
| US20140182006A1 (en) | Hybrid carrot varity NUN 89201 | |
| Wu | Classic genetics and breeding of bioenergy related traits in switchgrass |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120606 Termination date: 20150525 |
|
| EXPY | Termination of patent right or utility model |