CN101402997B - Reagent kit and method for detecting bacillus cereus with loop mediated isothermality amplification method - Google Patents
Reagent kit and method for detecting bacillus cereus with loop mediated isothermality amplification method Download PDFInfo
- Publication number
- CN101402997B CN101402997B CN2008101528508A CN200810152850A CN101402997B CN 101402997 B CN101402997 B CN 101402997B CN 2008101528508 A CN2008101528508 A CN 2008101528508A CN 200810152850 A CN200810152850 A CN 200810152850A CN 101402997 B CN101402997 B CN 101402997B
- Authority
- CN
- China
- Prior art keywords
- bacillus cereus
- loop
- primer sequence
- food
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for detecting food-borne bacillus cereus by making use of a loop-mediated constant-temperature PRC technology, which belongs to the field of food hygiene and more particularly relates to a method which detects the food-borne bacillus cereus by making use of the loop-mediated constant-temperature PRC technology. The method has the technical proposal that an intermediate zone 16S-23S of the bacillus cereus is adopted as the target detection sequence and the design contains four specific primers of the whole sequence of the intermediate zone. The method includes the extraction of the specific primers of the intermediate zone 16S-23S of the bacillus cereus and the food-borne bacillus cereus, and the judgment of the detection method of the loop-mediated constant-temperature PRC amplification and the result. The invention fills the gap of the detection method of the loop-mediated constant-temperature PRC amplification technology of the food-borne bacillus cereus and is used for detecting the bacillus cereus in imported and exported food. The method is characterized by low cost, high efficiency, simple operation, high speed and convenience.
Description
Technical field
The present invention relates to the bacteriologic test technology, specifically use loop-mediated isothermal amplification to react and detect Bacillus cereus, the detection method of particularly eating source property Bacillus cereus.
Background technology
Bacillus cereus is extensive in distributed in nature, often is present in soil, dust and the sewage, and is common in plant and the many living cooked products.From numerous food, isolate this bacterium, comprised meat, milk-product, vegetables, fish, potato, paste, soy sauce, pudding, parched rice meal and various desserts etc.In the U.S., the parched rice meal is the major cause that causes Bacillus cereus vomiting type food poisoning; Mostly cause in Europe by dessert, meat pie, salad and milk, meat-based food; Main relevant in China with contaminated rice or starch based goods.
Bacillus cereus is more as a kind of report of food origin disease, and the recall rate in various food is also higher, as nineteen eighty-two dog raise etc. Japan Nagoya adopted in 1641 parts of food samples, have 193 parts detected this bacterium, positive rate is 11.8%; China units concerned adopted in 211 parts of food samples Nanjing in 1984, had 81 parts to detect this bacterium, and positive rate is 38.4%.
Bacillus cereus food poisoning is the highest with summer and autumn (the 6-10 month) usually.The food that causes poisoning often before food because storage temperature is improper, storage period long or food through heating and remaining brood cell with the condition of growth and breeding, thereby cause poisoning.The sickness rate of poisoning is higher, is generally 60-100%.But the situation that can not find Bacillus cereus and cause food poisoning in suspect food is also arranged, be commonly considered as because due to the heat-stable toxin that the candlestick bacillus produces.In September, 1985, the healthy office of maine state of u.s.a has reported the gastro-enteritis incident that in a tame Japanese restaurant food poisoning has taken place and caused, through investigating its processing of all food and storing all is standard, only the fried rice of making of leftovers its be that refrigeration is stored or placed in room temperature and can hardly be explained, though in fried rice, can not find Bacillus cereus alive, may have the possibility of having eliminated viable bacteria in the process of reheating and not destroyed heat-stable toxin fully.
When its Bacillus cereus quantity of food of taking in reaches〉10
6/ gram can cause food poisoning often.Bacillus cereus food poisoning can be divided into vomiting type and diarrhea-type two classes clinically.Be 0.5-6 hour the latent period of vomiting type, and toxicity symptom has symptoms such as abdomen spasm or diarrhoea occasionally to feel sick, to vomit, and the course of disease is no more than 24 hours, and such symptom is similar to the food poisoning that is caused by streptococcus aureus.Be 6-15 hour the latent period of diarrhea-type, and symptom has symptoms such as nauseating sometimes based on watery diarrhea, abdomen spasm, stomachache, about 24 hours of the course of disease, and such symptom is similar to the food poisoning that clostridium perfringens causes.
Based on above pathogenic, Bacillus cereus is that various countries customs must examine one of microorganism.Traditional detection method according to " the Bacillus cereus method of inspection in People's Republic of China's specialized standard---the export food " testing procedures is:
1 specimen preparation
1.1 with aseptic technique sterilization cutter, cut sample is shredded.Taking by weighing 50g is put in the aseptic homogeneous cup.
1.2 add 450ml sterile phosphate buffer diluent in the homogeneous cup with 18000-20000rpm homogeneous 2min.Make the 1:10 sample diluting liquid.
Be added in the dilution bottle that contains 90ml sterile phosphate damping fluid 1.3 get 1:10 diluent 10ml, fully mixing is made the diluent of 1:100.
1.4 each extent of dilution is used 1 10ml aseptic straw instead, is undertaken 10 times by the aforesaid operations program and increases progressively dilution until 10
-6
2 checking procedures
2.1 colony counting method
2.1.1 getting each diluent 0.1ml is inoculated on the MYP agar plate.Evenly coat whole agar surface with aseptic L shaped glass stick.Two MYP agar plates of every extent of dilution inoculation.
2.1.2 place 30 ℃ to cultivate 24h flat board.
2.1.3 choose flat board, count with 15-150 typical cases or suspicious Bacillus cereus bacterium colony.And calculate the average colony number of two flat boards of same extent of dilution.
The bacterium colony that Bacillus cereus generates on the MYP agar plate is the micro mist redness, around producing the lecithinase precipitation ring.Be not true to type as reaction, can continue to cultivate 24h and count again.
2.1.4 behind the counting, choose 5 bacterium colonies of having counted at least from each flat board and be inoculated in the nutrient agar medium inclined-plane respectively,, and in 3, carry out confirmatory test in 30 ℃ of cultivation 24h.
2.1.5 be defined as the colony number of Bacillus cereus according to confirmatory test, pro rata is calculated the Bacillus cereus colony number in this ware, takes advantage of its extension rate to multiply by 10 more then, promptly obtains the contained Bacillus cereus number of every gram sample and makes report.
2.2 optimal approximate value (MPN) method
Be applicable to that polluting the Bacillus cereus number is not more than 10
3The food of individual/g.
2.2.1 select three pipe method MPN series for use.Get 10-1,10-2, three kinds of diluents of 10-3, every kind of diluent inoculation 3 pipe trypticase soybean polymyxin meat soups, every pipe inoculation 1ml.
2.2.2 place 30 ℃ to cultivate 48 ± 2h.
2.2.3 get the culture streak inoculation on the MYP agar plate from the test tube of long bacterium.
Cultivate 24-48h 2.2.4 put 30 ℃.
2.2.5 the picking pink is wound with the single bacterium colony of precipitation ring from the MYP agar plate, inoculation nutrient agar medium inclined-plane is put 30 ℃ and is cultivated 24h, is made for confirmatory test.
2.2.6 be defined as the pipe number of Bacillus cereus according to confirmatory test, find the MPN value/g of Bacillus cereus by the MPN table, and make report.
3 confirmatory tests
3.1 morphologic observation
Get the nutrient agar medium slant culture, make gram stain microscopy.Bacillus cereus is the Gram-positive escherichia coli, is short chain or long-chain, and the gemma ovalize is positioned at thalline central authorities or holds partially, and thalline is swollen.
3.2 biochemical proterties
3.2.1 glucose fermentation test
Be inoculated in the phenol red dextrose bouillon, cultivate 24h for following 35 ℃ in anaerobic condition.Substratum should become yellow (showing the decomposition glucose product acid under anaerobic of this bacterium) by redness.
3.2.2 nitrate reduction test
Be inoculated in 35 ℃ of cultivation 24h in the nitrate broth.Positive reaction (orange) should appear after adding nitrate reagent.
3.2.3 V-P test
Be inoculated in the improvement V-P substratum, cultivate 48h for 35 ℃.Add V-P reagent and creatine numerical digit, static 1h.Should be positive reaction (Yihong look occurring).
3.2.4 L-tyrosine decomposition run
Be inoculated on the L-tyrosine nutrient agar, cultivate 48h for 35 ℃, clear district (expression produces casease) should appear in the periphery of bacterial colonies substratum.Should continue to cultivate 72h when negative observes again.
3.2.5 N,O-Diacetylmuramidase test
Get pure bacteria suspension one ring with diameter 2mm transfering loop, in the inoculation N,O-Diacetylmuramidase meat soup, cultivate 24h for 35 ℃.This bacterium can grow in basal culture medium (containing 0.001% N,O-Diacetylmuramidase).As negative reaction appears, should continue to cultivate 24h.
3.2.6 Nagler's reaction
Be inoculated on the MYP agar plate, cultivate 24h for 35 ℃.Precipitation ring (expression produces lecithinase) should appear in periphery of bacterial colonies.
Bacteria Identification still utilizes traditional Physiology and biochemistry method to detect usually at present; utilize the Bacillus cereus in traditional method detection food; not only need at least 3 days time to carry out the bacterium colony cultivation; more to consume great amount of manpower and material resources, more and more can't satisfy the growing present situation of cargoes imported and exported now.
From the above description as can be seen, detect the various existing method of Bacillus cereus in the food, exist process complexity, the time is long, accuracy is low deficiency, have the reagent costliness exactly, be unfavorable for the shortcoming of quick test.
Therefore, along with development of molecular biology, the method for determining bacteria in the makeup inspection and quarantine work on traditional simple biochemical test level to the development of molecular biological method such as technology such as PCR, probe hybridization.The up-to-date loop-mediated isothermal amplification technology that develops is a kind of molecular detecting method more efficiently, by the approval of a lot of countries, and greatly develops.Time that it not only needs is short, as long as through simply increasing bacterium, and because the equipment of its requirement is simple, hot piece or water-bath can be finished check, and outstanding more is loop-mediated isothermal amplification technique is 10 to the requirement of initial masterplate amount
0Individual bacterium is 10 times of regular-PCR sensitivity.Therefore the Bacillus cereus that how to use loop-mediated isothermal amplification technology to detect in the food has become the important topic of tackling key problems in the food test quarantine.
Summary of the invention
In order to improve food inspection efficient, save time, can't satisfy the growing present situation of cargoes imported and exported to solve traditional detection method, the present invention detects through experiment many times, finally explore a kind of method of using loop-mediated isothermal amplification technology to detect Bacillus cereus, this method has characteristics such as detection is quick, convenient, low cost.
The present invention is achieved by the following technical solutions:
(1) design specific oligonucleotide primer is used for the loop-mediated isothermal amplification technology detection;
(2) integrate each primer and make it non-interference.
(3) with the primer sequence group, amplification testing sample template is carried out the specific amplification of goal gene;
(4) can be after amplification finishes by of short duration centrifugal direct range estimation white precipitate detected result, or pass through electrophoresis band conformal analysis detected result.
The present invention reacts back visual observation and electrophoresis result and does not all find false positive and false-negative result with specific primer sets amplification Bacillus cereus.
This method comprises: use this method and detect food source employed primer sets of property Bacillus cereus and supporting with it amplification reaction condition.Wherein employed primer sets sequence is as follows:
Primer sequence one: GCAAGGCGTAGTGTATTGTGAA
Primer sequence two: CTCTATTACAGGTTACTCTGGAACAAGCCGAAAACTGAA
Primer sequence three: TCATCGCCTCTGACTGCCTA
Primer sequence four: TCAAATAATCGCAACACAGCTCAACCTCACAACCCGAA
Each component composition is as follows in the loop-mediated isothermal amplification reaction system:
Constituent concentration application of sample amount
Amplification system premixture 2 * 12.5 μ L
Primer sequence one 10 μ mol/L 0.2 μ L
Primer sequence 2 10 μ mol/L 1.6 μ L
Primer sequence 3 10 μ mol/L 0.2 μ L
Primer sequence 4 10 μ mol/L 1.6 μ L
DNA sample 2 μ L
Distilled water 6.9 μ L
Cumulative volume 25 μ L
The loop-mediated isothermal amplification amplification program is:
(1) .61 ℃ 1 hour;
(2) .80 ℃ 10 minutes.
Loop-mediated isothermal amplification product detection method comprises:
(1) .10,000 * g, 5 minutes, room temperature can be seen white precipitate in the test tube bottom;
(2). add developer, reaction solution presents green;
(3) .1.5% agarose gel electrophoresis, the promising stepped electrophoretic band of result;
Select any one method in above three kinds of loop-mediated isothermal amplification product detection methods to detect.
Loop-mediated isothermal amplification product etection theory foundation
1, positive findings can produce white precipitate: in the loop-mediated isothermal amplification process, dNTP constantly interpolation advances new synthetic nucleotide chain, can generate a large amount of by products---magnesium pyrophosphate simultaneously.Magnesium pyrophosphate is a kind of white depositions, because whole amplification experiment all is to carry out at 61 ℃, so the magnesium pyrophosphate precipitation can't be dissolved, final, along with the increase of positive nucleotide chain, the magnesium pyrophosphate precipitation is constantly accumulation also.Thereby, after reaction finishes, can directly determine positive reaction by observing white precipitate.
2, positive findings is after adding SYBR Green dyestuff, and solution becomes green: the male loop-mediated isothermal amplification can synthesize a large amount of nucleotide chains.After the reaction, behind the adding SYBR Green dyestuff, SYBR Green molecule can embed in the nucleotide chains in a large number, thereby makes SYBR Green molecule produce green fluorescence in the heliotropism reaction product.And negative findings owing to there is not target gene fragment, can't amplify nucleotide chain, and SYBR Green also just can't be with the nucleotide chain combination, and the result can only be pale brown look.
3, positive findings shows as stepped electrophoretic band in electrophoresis: the design of primers of loop-mediated isothermal amplification has a vital link, and promptly 5 ' end at normal amplimer combines pairing region in one section chain.Its purpose is that when amplification was carried out, the collochore can be matched with certain zone in the nucleotide chain of amplification newly in the chain, thereby forms ring texture at an end of new amplification chain.In like manner, the other end at new amplification chain also can form identical ring texture.And in the amplification procedure afterwards, the primer template of this section two ends Cheng Huan that can constantly increase, thus the number of this ring-type unit constantly accumulated, and making new synthesizing ribonucleotide chain molecule is radix with a ring texture, constantly synthetic, constantly accumulation.And the accumulation of this molecular weight is reflected in the electrophoresis, then shows as to form stepped electrophoretic band.
As other result occurs and show that then check failure this time can not determine whether there is Bacillus cereus, needs check again.
Compared with prior art, the invention has the beneficial effects as follows: compare traditional Physiology and biochemistry detection method, authentication method based on loop-mediated isothermal amplification is applicable to directly amplified target gene from clinical samples such as patient's mycetome liquid, food and body fluid culture, only need a loop-mediated isothermal amplification reaction just can detect Bacillus cereus and whether exist, improved efficient greatly and saved the time.Other PCR method of comparing, present method only needs simple equipment---and a constant temperature waters case, a whizzer or common electrophoresis equipment (electrophoresis apparatus) get final product, and have improved cost performance greatly and have saved cost.Method of loop-mediated isothermal amplification have detect accurately, high specificity, highly sensitive characteristics, can identify special purpose bacterium quickly and accurately.The loop-mediated isothermal amplification authentication method is not subjected to the influence of culture condition and bacterium physiological status, and is more accurate than the Physiology and biochemistry authentication method.
Description of drawings
Fig. 1 fresh chicken meat sample loop to be measured mediated isothermal amplification technology detects testing sample DNA, centrifugal back range estimation precipitation result: the visible obviously white precipitate in testing sample test tube (right side) bottom; Negative control (left side) is precipitation not.
Fig. 2 fresh chicken meat sample loop to be measured mediated isothermal amplification technology detects testing sample DNA, and SYBR Green coloration result: testing sample solution (right side) presents green; Negative control (left side) is pale brown look.
Fig. 3 fresh chicken meat sample loop to be measured mediated isothermal amplification technology detects testing sample DNA, and 1.5% agarose gel electrophoresis detected result: stepped band appears in testing sample (the 3rd road); Negative control (the 2nd road) does not have band; The 1st road is Marker.
Embodiment
Below in conjunction with accompanying drawing and embodiment the present invention is described in further detail.
Sample: somewhere outlet fresh chicken meat.
Detect Bacillus cereus with conventional physiology, biochemical method and fall, carry out following loop-mediated isothermal amplification technology then and detect:
1. sample preparation
(1) gets 100 grams sample to be checked, pulverize.
(2) sample is put in the Erlenmeyer flask that 1 liter of nutrient broth is housed, cultivated 8 hours for 37 ℃ in the incubator.
2.DNA extracting
Get nutrient broth 1mL after the cultivation with dropper, in ice bath, left standstill 5 minutes, at room temperature 3000 rev/mins then, centrifugal 10 minutes, get supernatant liquor, following 10000 rev/mins of room temperature, centrifugal 5 minutes, discard supernatant liquor, in precipitation, add 50 μ l bacterial lysates, boiling water bath 10 minutes, following 10000 rev/mins of room temperature, centrifugal 5 minutes, get supernatant liquor and put-20 ℃ of preservations.
3. loop-mediated isothermal amplification
Each component composition is as follows in the amplification reaction system:
Constituent concentration application of sample amount
Amplification system premixture 2 * 12.5 μ L
Primer sequence one 10 μ mol/L 0.2 μ L
Primer sequence 2 10 μ mol/L 1.6 μ L
Primer sequence 3 10 μ mol/L 0.2 μ L
Primer sequence 4 10 μ mol/L 1.6 μ L
DNA sample 2 μ L
Distilled water 6.9 μ L
Cumulative volume 25 μ L
The ring mediated isothermal amplification program is:
(1) 61 ℃ 1 hour;
(2) 80 ℃ 10 minutes.
Be reflected in the constant water bath box and carry out.
Loop-mediated isothermal amplification carries out 2 tube reactions altogether, wherein adds sample DNA in the pipe; Another pipe is for the reaction system of no sample DNA, as negative control.
4. detected sample result is observed
(1) the loop-mediated isothermal amplification product centrifugal after, obvious white precipitate is arranged at testing sample test tube bottom, negative control is precipitation not then, result such as Fig. 1.
(2) after the loop-mediated isothermal amplification product added SYBR Green dyeing, testing sample solution presented green, and negative control is pale brown look, result such as Fig. 2.
(3) the loop-mediated isothermal amplification product is behind 1.5% agarose gel electrophoresis, and testing sample has stepped electrophoretic band, and negative control does not have electrophoretic band, result such as Fig. 3.
Can select any one method in above three kinds of loop-mediated isothermal amplification product detection methods to detect.
Experiment shows and contains Bacillus cereus in the sample.
After 3 days, prove that the purpose bacterium colony of being checked is a Bacillus cereus by conventional microorganism culturing and biochemistry detection.The loop-mediated isothermal amplification assay is consistent with the biochemistry detection result.
Claims (7)
1. primer of checking Bacillus cereus in the food is characterized in that: it is for detecting the primer sets of Bacillus cereus by the loop-mediated isothermal pcr amplification, sequence is:
(1) primer sequence one: GCAAGGCGTAGTGTATTGTGAA
(2) primer sequence two: CTCTATTACAGGTTACTCTGGAACAAGCCGAAAACTGAA
(3) primer sequence three: TCATCGCCTCTGACTGCCTA
(4) primer sequence four: TCAAATAATCGCAACACAGCTCAACCTCACAACCCGAA.
2. the described primer of claim 1 is used for checking application in the test kit of food Bacillus cereus in preparation.
3. test kit that is used for checking the food Bacillus cereus comprises:
(1) loop-mediated isothermal pcr amplification reaction reagent comprises 2 * amplification system premixture, tri-distilled water;
(2) according to 1: 8: 1: the described primer sequence one of the claim 1 of 8 mixed, primer sequence two, primer sequence three and primer sequence four;
(3) positive sample contrast, the contrast of negative sample; If desired, also comprise
(4) working instructions.
4. test kit according to claim 3 wherein also comprises being used to handle the bacterial lysate of sample and the developer of display result.
5. utilize the primer of claim 1 or the test kit of claim 3 to carry out Bacillus cereus method in the loop-mediated isothermal PCR detection food, comprising:
(1) testing sample adds in the nutrient broth liquid nutrient medium, cultivates 8 hours the muddy liquid of sample nutritive medium to be analyzed in the incubator for 30 ℃, following 3000 rev/mins of room temperature centrifugal 10 minutes, is got supernatant liquor, following 10000 rev/mins of room temperature, centrifugal 5 minutes, discard supernatant liquor, in precipitation, add 50 μ l bacterial lysates, boiling water bath 10 minutes, following 10000 rev/mins of room temperature centrifugal 5 minutes, is got supernatant liquor;
(2) according to each component ratio preparation reaction solution in the amplification reaction solution, as follows:
Constituent concentration application of sample amount
Amplification system premixture 2 * 12.5 μ L
Primer sequence one 10 μ mol/L 0.2 μ L
Primer sequence 2 10 μ mol/L 1.6 μ L
Primer sequence 3 10 μ mol/L 0.2 μ L
Primer sequence 4 10 μ mol/L 1.6 μ L
DNA sample 2 μ L
Distilled water 6.9 μ L
Cumulative volume 25 μ L
(3) adjust the amplification temperature, water bath with thermostatic control or the amplification of hot piece 1 hour;
(4) 80 ℃, ten minutes stopped reaction;
(5) any one detects the loop-mediated isothermal pcr amplification product in the following three kinds of modes of selection:
1. 10,000 * g, 5 minutes, room temperature can be seen white precipitate in the test tube bottom;
2. add SYBR Green, reaction solution presents green;
3. 1.5% agarose gel electrophoresis, the result is for there being stepped electrophoretic band.
6. the described method of claim 5, wherein testing sample is the life of various foods, cooked or work in-process.
7. the described method of claim 5, wherein the temperature of loop-mediated isothermal amplification is 60-65 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101528508A CN101402997B (en) | 2008-11-06 | 2008-11-06 | Reagent kit and method for detecting bacillus cereus with loop mediated isothermality amplification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101528508A CN101402997B (en) | 2008-11-06 | 2008-11-06 | Reagent kit and method for detecting bacillus cereus with loop mediated isothermality amplification method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101402997A CN101402997A (en) | 2009-04-08 |
| CN101402997B true CN101402997B (en) | 2010-08-11 |
Family
ID=40537156
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008101528508A Expired - Fee Related CN101402997B (en) | 2008-11-06 | 2008-11-06 | Reagent kit and method for detecting bacillus cereus with loop mediated isothermality amplification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101402997B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101831493B (en) * | 2009-11-06 | 2012-05-23 | 武汉工业学院 | Loop-mediated isothermal amplification primer pair and detection method of pathogenic bacillus cereus |
| CN104805213A (en) * | 2015-05-10 | 2015-07-29 | 西华大学 | Specific primer for identifying food-borne pathogenic bacteria and application method thereof |
| CN106434898B (en) * | 2015-09-02 | 2020-02-21 | 上海产业技术研究院 | Method, primer and kit for rapidly detecting yersinia pseudotuberculosis at constant temperature |
| CN107475401B (en) * | 2017-09-08 | 2021-03-19 | 江苏农林职业技术学院 | Method and primer for detecting food-borne bacillus cereus by using loop-mediated isothermal amplification technology |
| CN108950024B (en) * | 2017-11-14 | 2022-04-01 | 浙江省淡水水产研究所 | LAMP (loop-mediated isothermal amplification) detection kit and detection primers for bacterial parotitis pathogenic bacteria of Chinese softshell turtles |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101082581A (en) * | 2006-05-30 | 2007-12-05 | 广州华峰生物科技有限公司 | Colon bacillus 0157 gene rapid diagnosis reagent kit of annular mediated isothermal amplification technology |
-
2008
- 2008-11-06 CN CN2008101528508A patent/CN101402997B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101082581A (en) * | 2006-05-30 | 2007-12-05 | 广州华峰生物科技有限公司 | Colon bacillus 0157 gene rapid diagnosis reagent kit of annular mediated isothermal amplification technology |
Non-Patent Citations (1)
| Title |
|---|
| 蔡哲钧，冯杰雄.环介导等温扩增技术及在传染性疾病检测中的应用.国际流行病学传染病学杂志.2006,33(5),343-345,358. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101402997A (en) | 2009-04-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rodríguez-Lázaro et al. | Trends in analytical methodology in food safety and quality: monitoring microorganisms and genetically modified organisms | |
| CN102424832B (en) | Chromogenic medium used for detecting esherichia coli O157:H7 | |
| CN101402997B (en) | Reagent kit and method for detecting bacillus cereus with loop mediated isothermality amplification method | |
| CN103764838A (en) | Method for detecting the presence of carbapenemase-producing bacteria in a sample | |
| CN101831493A (en) | Loop-mediated isothermal amplification (LAMP) primer pair of bacillus cereus and detection method | |
| CN101613743A (en) | Enterorrhagia Bacillus coil 0157 based on loop-mediated isothermal amplification technique: H7 nucleic acid screening method | |
| JPS59192099A (en) | Measurement of number of microorganism | |
| CN101970682B (en) | Method for detecting and/or identifying clostridium difficile | |
| CN102094080A (en) | Quick molecular detection method for simultaneously detecting three kinds of fusarium toxins and application thereof | |
| KR101747347B1 (en) | Method for identifying bacteria from the bacillus cereus group | |
| CN101182574B (en) | Method for detecting food-borne enterocolitisyersinia genus by loop-mediated isothermal amplification | |
| CN102286606A (en) | Cronobacter spp. broth medium and detection method | |
| CN100463971C (en) | Color developing culture medium, detecting kit and detecting method for vibrio parahaemolyticus | |
| CN102676664A (en) | Fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and detection method | |
| CN101492732A (en) | Reagent kit and method for detection of enterocolitis yersinia genus with ring mediated isothermality amplification method | |
| CN104152546A (en) | Kit and method for simultaneously detecting salmonella, listeria monocytogenes and staphylococcus aureus | |
| CN103642929B (en) | Real-time fluorescent PCR (polymerase chain reaction) kit and oligonucleotides for identifying zygosaccharomyces rouxii | |
| Niskanen et al. | Comparison of selective media for coagulase-positive enterotoxigenic Staphylococcus aureus | |
| Pandey et al. | Screening and molecular identification of Streptomyces species isolated from high altitude soil of Nepal | |
| EP1352083B1 (en) | Compositions and methods for detecting target microorganisms in a sample | |
| CN101492733A (en) | Reagent kit and method for detection of artificial tuberculosis yersinia genus with ring mediated isothermality amplification method | |
| CN108018364A (en) | A kind of kit and detection method of absolute quantitation detection vibrio parahemolyticus | |
| CN101591704B (en) | Detection kit for detecting three spore production bacteria in food and detection method thereof | |
| CN105861623A (en) | Chromogenic culture medium for detecting Enterobacter sakazakii | |
| CN101182575B (en) | Method for detecting food-borne pseudotuberculosis yersinia genus by loop-mediated isothermal amplification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zheng Wenjie Inventor after: Zhang Hongwei Inventor after: Liu Wei Inventor after: Zhang Xia Inventor after: Zhao Liangjuan Inventor after: Zhang Haibin Inventor after: Zhang Haiying Inventor after: Yan Yu Inventor before: Zhang Hongwei Inventor before: Zhao Yulong Inventor before: Zhao Liangjuan Inventor before: Liu Wei Inventor before: Zheng Wenjie Inventor before: Yan Yu Inventor before: Hou Liping Inventor before: Zhao Hong |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: ZHANG HONGWEI ZHAO YULONG ZHAO LIANGJUAN LIU WEI ZHENG WENJIE YAN YU HOU LIPING ZHAO HONG TO: ZHENG WENJIE ZHANG HONGWEI LIU WEI ZHANG XIA ZHAO LIANGJUAN ZHANG HAIBIN ZHANG HAIYING YAN YU |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100811 Termination date: 20101106 |