CN101492733A - Reagent kit and method for detection of artificial tuberculosis yersinia genus with ring mediated isothermality amplification method - Google Patents
Reagent kit and method for detection of artificial tuberculosis yersinia genus with ring mediated isothermality amplification method Download PDFInfo
- Publication number
- CN101492733A CN101492733A CNA2008101870092A CN200810187009A CN101492733A CN 101492733 A CN101492733 A CN 101492733A CN A2008101870092 A CNA2008101870092 A CN A2008101870092A CN 200810187009 A CN200810187009 A CN 200810187009A CN 101492733 A CN101492733 A CN 101492733A
- Authority
- CN
- China
- Prior art keywords
- primer
- primer sequence
- loop
- sample
- mediated isothermal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention discloses a method for detecting food origin Yersinia pseudotuberculosis by using loop-mediated constant temperature PCR technology, belonging to the food sanitation field. The technical proposal is as follows: Yersinia pseudotuberculosis 16S-23S regions are used as target detection sequences, and four specific primers containing the whole region sequences are designed. The method comprises extraction of four specific primers of Yersinia pseudotuberculosis 16S-23S regions and food origin Yersinia pseudotuberculosis, detection method for loop-mediated constant temperature PCR amplification. The method fills the gap of a method for detecting food origin Yersinia pseudotuberculosis by using loop-mediated constant temperature PCR amplification technology, and is used for checking Yersinia pseudotuberculosis in import and export foods. The method has the characteristics of low cost, high efficiency, simple operation and convenience.
Description
Technical field
The present invention relates to the bacteriologic test technology, specifically use loop-mediated isothermal amplification to react and detect artificial tuberculosis yersinia genus, the detection method of particularly eating source property artificial tuberculosis yersinia genus.
Background technology
The biology form of artificial tuberculosis yersinia genus is that great majority disperse to exist in the pure culture, can become double row in host body fluids.Be in new isolated strains and animal body fluid that the two poles of the earth are dense dyes.In chronic lesion, outmoded culture or 3～4% salt nutrient agars, be obviously polymorphic, visible sphere, rod, yeast shape and dumb-bell shape etc. not of uniform size.In host, form the surperficial slime layer of similar pod membrane, have antiphagocytosis.Growth temperature is with 25～30 ℃ of the bests.Appropriate pH is 6.9～7.2.After cultivating 48 hours on the ordinary culture medium, the center that grows is thick and fine and close, thin, the irregular water white transparency in edge, tiny, circular, rough colony on every side.Dynamic in the time of 18～22 ℃ especially, still can grow in the time of 4 ℃.Decomposing urea, the fermentation rhamnosyl grows up to big and opaque bacterium colony on the deoxycholate-citrate agar substratum.It is different with flagellar antigen to press thalline, can be divided into 6 serotypes at least.Mainly cause the rodent disease, cavy is susceptible particularly.Pathology is that similar cheesy swelling lungy and tubercle appear in the multiple internal organs at infection animal.The natural propagation approach may be a digestive tube.The human infection has report by chance, and sick rabbit may be a contagium.The mankind mostly are the intestinal tract infections symptom greatly, as gastro-enteritis, with mesenteric lymphadenitis, mesenteric lymph nodes granuloma, like acute appendicitis, distal ileitis etc., also can cause life-threatening systemic infection, as septicemia, Sepsis.
Because artificial tuberculosis yersinia genus is the common bacteria in the food, can cause very serious foodborne illness incident, and can cause multiple disease to take place, people's health in serious threat, so, for various countries customs must examine one of microorganism.
At present, the detection method of general detection method and yersinia entero-colitica is similar: (detection mode is seen Figure of description four)
Through after the detection of a series of Yersinia, do not have the Yersinia of urease activity, again after Api identifies, formal conclusion.Not only need at least 7 days time to carry out the bacterium colony cultivation, more will consume great amount of manpower and material resources, more and more can't satisfy the growing present situation of cargoes imported and exported now.
Therefore, along with development of molecular biology, the method for determining bacteria in the food test quarantine on traditional simple biochemical test level to the development of molecular biological method such as technology such as PCR, probe hybridization.The up-to-date loop-mediated isothermal amplification technology that develops is a kind of molecular detecting method more efficiently, by the approval of a lot of countries, and greatly develops.Time that it not only needs is short, as long as through simply increasing bacterium, and because the equipment of its requirement is simple, hot piece or water-bath can be finished check, and outstanding more is loop-mediated isothermal amplification technique is 10 to the requirement of initial masterplate amount
0Individual bacterium is 10 times of regular-PCR sensitivity.Therefore how to use loop-mediated isothermal amplification technology to detect food source property artificial tuberculosis yersinia genus and become the important topic of tackling key problems in the food test quarantine.
Summary of the invention
In order to improve food inspection efficient, save time, can't satisfy the growing present situation of cargoes imported and exported to solve traditional detection method, the present invention detects through experiment many times, finally explore a kind of method of using loop-mediated isothermal amplification technology to detect artificial tuberculosis yersinia genus, this method has characteristics such as detection is quick, convenient, low cost.
The present invention is achieved by the following technical solutions:
(1) design specific oligonucleotide primer is used for the loop-mediated isothermal amplification technology detection;
(2) integrate each primer and make it non-interference.
(3) with the primer sequence group, amplification testing sample template is carried out the specific amplification of goal gene;
(4) can be after amplification finishes by of short duration centrifugal direct range estimation white precipitate detected result, or pass through electrophoresis band conformal analysis detected result.
The present invention reacts back visual observation and electrophoresis result and does not all find false positive and false-negative result with specific primer sets amplification artificial tuberculosis yersinia genus.
This method comprises: use this method and detect food source employed primer sets of property artificial tuberculosis yersinia genus and supporting with it amplification reaction condition.Wherein employed primer sets sequence is as follows:
Primer sequence one: GCAAGGCGTAGTGTATTGTGAA
Primer sequence two: CTCTATTACAGGTTACTCTGGAACAAGCCGAAAACTGAA
Primer sequence three: TCATCGCCTCTGACTGCCTA
Primer sequence four: TCAAATAATCGCAACACAGCTCAACCTCACAACCCGAA
Each component composition is as follows in the loop-mediated isothermal amplification reaction system:
Constituent concentration application of sample amount
Amplification system premixture 2 * 12.5 μ L
Primer sequence one 10 μ mol/L 0.2 μ L
Primer sequence 2 10 μ mol/L 1.6 μ L
Primer sequence 3 10 μ mol/L 0.2 μ L
Primer sequence 4 10 μ mol/L 1.6 μ L
DNA sample 2 μ L
Distilled water 6.9 μ L
Cumulative volume 25 μ L
The loop-mediated isothermal amplification amplification program is:
(1) .61 ℃ 1 hour;
(2) .80 ℃ 10 minutes.
Loop-mediated isothermal amplification product detection method comprises:
(1) .10,000 * g, 5 minutes, room temperature can be seen white precipitate in the test tube bottom;
(2). add developer, reaction solution presents green;
(3) .1.5% agarose gel electrophoresis, the promising stepped electrophoretic band of result;
Select any one method in above three kinds of loop-mediated isothermal amplification product detection methods to detect.
Loop-mediated isothermal amplification product etection theory foundation
1, positive findings can produce white precipitate: in the loop-mediated isothermal amplification process, dNTP constantly interpolation advances new synthetic nucleotide chain, can generate a large amount of by products---magnesium pyrophosphate simultaneously.Magnesium pyrophosphate is a kind of white depositions, because whole amplification experiment all is to carry out at 61 ℃, so the magnesium pyrophosphate precipitation can't be dissolved, final, along with the increase of positive nucleotide chain, the magnesium pyrophosphate precipitation is constantly accumulation also.Thereby, after reaction finishes, can directly determine positive reaction by observing white precipitate.
2, positive findings is after adding SYBR Green dyestuff, and solution becomes green: the male loop-mediated isothermal amplification can synthesize a large amount of nucleotide chains.After the reaction, behind the adding SYBR Green dyestuff, SYBR Green molecule can embed in the nucleotide chains in a large number, thereby makes SYBR Green molecule produce green fluorescence in the heliotropism reaction product.And negative findings owing to there is not target gene fragment, can't amplify nucleotide chain, and SYBR Green also just can't be with the nucleotide chain combination, and the result can only be pale brown look.
3, positive findings shows as stepped electrophoretic band in electrophoresis: the design of primers of loop-mediated isothermal amplification has a vital link, and promptly 5 ' end at normal amplimer combines pairing region in one section chain.Its purpose is that when amplification was carried out, the collochore can be matched with certain zone in the nucleotide chain of amplification newly in the chain, thereby forms ring texture at an end of new amplification chain.In like manner, the other end at new amplification chain also can form identical ring texture.And in the amplification procedure afterwards, the primer template of this section two ends Cheng Huan that can constantly increase, thus the number of this ring-type unit constantly accumulated, and making new synthesizing ribonucleotide chain molecule is radix with a ring texture, constantly synthetic, constantly accumulation.And the accumulation of this molecular weight is reflected in the electrophoresis, then shows as to form stepped electrophoretic band.
As other result occurs and show that then check failure this time can not determine whether there is artificial tuberculosis yersinia genus, needs check again.
Compared with prior art, the invention has the beneficial effects as follows: compare traditional Physiology and biochemistry detection method, authentication method based on loop-mediated isothermal amplification is applicable to directly amplified target gene from clinical samples such as patient's mycetome liquid, food and body fluid culture, only need a loop-mediated isothermal amplification reaction just can detect artificial tuberculosis yersinia genus and whether exist, improved efficient greatly and saved the time.Other PCR method of comparing, present method only needs simple equipment---and a constant temperature waters case, a whizzer or common electrophoresis equipment (electrophoresis apparatus) get final product, and have improved cost performance greatly and have saved cost.Method of loop-mediated isothermal amplification have detect accurately, high specificity, highly sensitive characteristics, can identify special purpose bacterium quickly and accurately.The loop-mediated isothermal amplification authentication method is not subjected to the influence of culture condition and bacterium physiological status, and is more accurate than the Physiology and biochemistry authentication method.
Description of drawings
Fig. 1 fresh chicken meat sample loop to be measured mediated isothermal amplification technology detects testing sample DNA, centrifugal rear range estimation precipitation result: to be measured The visible obviously white precipitate in sample tube (right side) bottom; Negative control (left side) is precipitation not.
Fig. 2 fresh chicken meat sample loop to be measured mediated isothermal amplification technology detects testing sample DNA, SYBR Green coloration result: treat Test sample product solution (right side) presents green; Negative control (left side) is brown color.
Fig. 3 fresh chicken meat sample loop to be measured mediated isothermal amplification technology detects testing sample DNA, and 1.5% agarose gel electrophoresis detects knot Really: stepped band appears in testing sample (the 3rd road); Negative control (the 2nd road) does not have band; The 1st road is Marker.
Fig. 4 sterile working takes by weighing the sample 25g that shreds after (or homogeneous), places the 500ml of the phosphate buffer that the 225ml improvement is housed In the wide-mouth vial, fully vibration is cultivated 48 ± 2h in 25 ℃ then. It is hot to 25 in advance to draw this nutrient solution 1ml culture transferring ℃ the test tube of the 5g/L potassium hydroxide solution that 9ml is housed in, make it fully to mix 0.5min. Draw immediately this mixed liquor 2ml In the test tube of the yeast decoction of culture transferring in heat in advance to 25 ℃ the improvement that 8ml is housed-rose-bengal meat soup, fully mix, in Cultivate 4-6h for 25 ℃.
The nutrient solution that above-mentioned yeast decoction through improvement-rose-bengal meat soup is increased bacterium shakes up, and chooses respectively with the oese of diameter 3mm Get one and encircle the bismuth sulfite agar flat board of the tween 80 that lines the no solidified water in surface and the maconkey agar flat board of tween 80 Each one, be incubated at 25 ℃, the dull and stereotyped 3-4h that cultivates of the bismuth sulfite agar of tween 80, the maconkey agar of tween 80 is flat Plate is cultivated 48 ± 2h. Observe each agar plate, have or not typical case or suspicious Yersinia ruckeri bacterium colony.
Every kind of agar plate is answered two typical cases of picking or suspicious bacterium colony at least, respectively with the puncture of smooth transfer needle and densely covered the inoculation In each pipe of kligler iron agar of improvement, cultivate 24 ± 2h in 25 ℃. Observe flat board and carry out result's judgement.
The typical case of scraping one full ring (diameter 3mm) or the improvement kligler iron agar slant culture of suspicious Yersinia ruckeri, Be inoculated in the test tube of 10mm * 100mm that 1ml RustigianShi urea medium (improved method) is housed, hand or electronic Jolting 5-6s on the flash mixer then in 25 ℃ of cultivations, observes once every half an hour, cultivates and observes to 4h. With urea The improvement kligler iron agar slant culture of the enzyme test positive carries out biochemical test, and (the ornithine decarboxylase lysine decarboxylase is real Test 24～30h; Sucrose, sorbierite, rhamnose, arabinose, citrate test, 1～4 day), be incubated at 25 ℃.
Observe the biochemical reaction result, with not meeting the yersinia enterocolitica characteristic, carry out Api and detect.
Report the result.
Embodiment
Below in conjunction with accompanying drawing and embodiment the present invention is described in further detail.
Sample: somewhere outlet fresh chicken meat.
Detect artificial tuberculosis yersinia genus with conventional physiology, biochemical method and fall, carry out following loop-mediated isothermal amplification technology then and detect:
1. sample preparation
(1) gets 100 grams sample to be checked, pulverize.
(2) sample is put in the Erlenmeyer flask that 1 liter of nutrient broth is housed, cultivated 8 hours for 37 ℃ in the incubator.
2.DNA extracting
Get nutrient broth 1mL after the cultivation with dropper, in ice bath, left standstill 5 minutes, at room temperature 3000 rev/mins then, centrifugal 10 minutes, get supernatant liquor, following 10000 rev/mins of room temperature, centrifugal 5 minutes, discard supernatant liquor, in precipitation, add 50 μ l bacterial lysates, boiling water bath 10 minutes, following 10000 rev/mins of room temperature, centrifugal 5 minutes, get supernatant liquor and put-20 ℃ of preservations.
3. loop-mediated isothermal amplification
Each component composition is as follows in the amplification reaction system:
Constituent concentration application of sample amount
Amplification system premixture 2 * 12.5 μ L
Primer sequence one 10 μ mol/L 0.2 μ L
Primer sequence 2 10 μ mol/L 1.6 μ L
Primer sequence 3 10 μ mol/L 0.2 μ L
Primer sequence 4 10 μ mol/L 1.6 μ L
DNA sample 2 μ L
Distilled water 6.9 μ L
Cumulative volume 25 μ L
The ring mediated isothermal amplification program is:
(1) 61 ℃ 1 hour;
(2) 80 ℃ 10 minutes.
Be reflected in the constant water bath box and carry out.
Loop-mediated isothermal amplification carries out 2 tube reactions altogether, wherein adds sample DNA in the pipe; Another pipe is for the reaction system of no sample DNA, as negative control.
4. detected sample result is observed
(1) the loop-mediated isothermal amplification product centrifugal after, obvious white precipitate is arranged at testing sample test tube bottom, negative control is precipitation not then, result such as Fig. 1.
(2) after the loop-mediated isothermal amplification product added SYBR Green dyeing, testing sample solution presented green, and negative control is pale brown look, result such as Fig. 2.
(3) the loop-mediated isothermal amplification product is behind 1.5% agarose gel electrophoresis, and testing sample has stepped electrophoretic band, and negative control does not have electrophoretic band, result such as Fig. 3.
Can select any one method in above three kinds of loop-mediated isothermal amplification product detection methods to detect.
Experiment shows and contains artificial tuberculosis yersinia genus in the sample.
After 3 days, prove that the purpose bacterium colony of being checked is an artificial tuberculosis yersinia genus by conventional microorganism culturing and biochemistry detection.The loop-mediated isothermal amplification assay is consistent with the biochemistry detection result.
The sequence table of artificial tuberculosis yersinia genus LAMP specificity amplification primer
cgtagggaac?ctgcggttgg?atcacctcct?tacctaacga?tacgcattgc?gcagtgccca
cacagattgt?ctgatgaatg?taaacgagca?agagcacctg?ttgatgttat?gagtttcgac
tcatgctgat?acgaaacggt?tgaatttcgg?tttgatcggt?attttcgtgt?ccccatcgtc
tagaggccta?ggacactgcc?ctttcacggc?tgtaacaggg?gttcgaatcc?ccttggggac
gccaatccga?taatgagtga?aagacattat?caccggttct?ttatgaactg?aaaaataacg
taaagatgac?tttaccaagt?cgtgtttacg?atattgctct?ttaacaatct?ggaacaagct
gaaaattgaa?acattacagc?tgaaatttac?cccgccgtag?atgtattggg?gtaaagagta
acctgtaata?gagtctctca?aataatcgca?a
Claims (10)
1. primer of checking artificial tuberculosis yersinia genus in the food, it is characterized in that: the 3 ' end of forward primer F3 is positioned at about 50bp place, gene coding region upstream, district between 16S-23S shown in aligning primer sequence one, forward becomes the 3 ' end of ring primers F IP to be positioned at 35bp place, district between 16S-23S shown in aligning primer sequence two, oppositely become the 3 ' end of ring primer BIP to be positioned at 204bp place, district between 16S-23S shown in aligning primer sequence four, the 3 ' end of reverse primer B3 is positioned between 16S-23S shown in aligning primer sequence three distinguishes 50bp place, downstream.Forward primer sequence F3, forward become the length range of ring primers F IP and reverse primer sequence B 3, the reverse ring primer BIP of one-tenth at 16-40bp, and can increase fully and distinguish encoding sequence between artificial tuberculosis yersinia genus 16S-23S.
2. primer according to claim 1, wherein forward primer F3 is selected from the primer sequence that has shown in primer sequence one; Forward becomes ring primers F IP to be selected from the primer sequence that has shown in primer sequence two; Reverse primer B3 is selected from the primer sequence that has shown in primer sequence three; Oppositely become ring primer BIP to be selected from the primer sequence that has shown in primer sequence four.
3. claim 1 or 2 described primers are used for checking application in the test kit of food artificial tuberculosis yersinia genus in preparation.
4. test kit that is used for checking the food artificial tuberculosis yersinia genus comprises:
(1) loop-mediated isothermal pcr amplification reaction reagent comprises 2 * amplification system premixture, tri-distilled water;
(2) according to 1: 8: 1: the claim 1 of 8 mixed or 2 described forward primer F3, forward become ring primers F IP, reverse primer B3 and oppositely become ring primer BIP;
(3) positive sample contrast, the contrast of negative sample; If desired, also comprise
(4) working instructions.
5. test kit according to claim 4 wherein also comprises being used to handle the bacterial lysate of sample and the developer of display result.
6. utilize the primer of claim 1-2 or the test kit of claim 4-5 to carry out loop-mediated isothermal PCR detection food source property artificial tuberculosis yersinia genus method, comprising:
(1) testing sample adds in the nutrient broth liquid nutrient medium, cultivates 8 hours the muddy liquid of sample nutritive medium to be analyzed in the incubator for 37 ℃, following 3000 rev/mins of room temperature centrifugal 10 minutes, is got supernatant liquor, following 10000 rev/mins of room temperature, centrifugal 5 minutes, discard supernatant liquor, in precipitation, add 50 μ l bacterial lysates, boiling water bath 10 minutes, following 10000 rev/mins of room temperature centrifugal 5 minutes, is got supernatant liquor.
(2) according to each component ratio preparation reaction solution in the amplification reaction solution, as follows:
Constituent concentration application of sample amount
Amplification system premixture 2 * 12.5 μ L
Primer sequence one 10 μ mol/L 0.2 μ L
Primer sequence 2 10 μ mol/L 1.6 μ L
Primer sequence 3 10 μ mol/L 0.2 μ L
Primer sequence 4 10 μ mol/L 1.6 μ L
DNA sample 2 μ L
Distilled water 6.9 μ L
Cumulative volume 25 μ L
(3) adjust the amplification temperature, water bath with thermostatic control or the amplification of hot piece 1 hour.
(4) 80 ℃, ten minutes stopped reaction.
(5) according to the described a kind of method of using the loop-mediated isothermal round pcr to detect artificial tuberculosis yersinia genus in the food of claim 1-5, it is characterized in that the loop-mediated isothermal pcr amplification product detects and decision method is:
1. 10,000 * g, 5 minutes, room temperature can be seen white precipitate in the test tube bottom.
2. add SYBR Green, reaction solution presents green.
3. 1.5% agarose gel electrophoresis, the promising stepped electrophoretic band of result.
Select any one method in above three kinds of loop-mediated isothermal amplification product detection methods to detect.
7. the described method of claim 6, wherein testing sample can be life, the cooked or work in-process of various foods such as meat, milk, fish, shrimp, crab, vegetables, fruit, grain.
8.. the described method of claim 6, wherein the temperature of loop-mediated isothermal amplification is 60-65 ℃.
9. claim 1 or 6 described methods, four kinds of primer sequences wherein comprise:
(1) primer sequence one: GCAAGGCGTAGTGTATTGTGAA
(2) primer sequence two: CTCTATTACAGGTTACTCTGGAACAAGCCGAAAACTGAA
(3) primer sequence three: TCATCGCCTCTGACTGCCTA
(4) primer sequence four: TCAAATAATCGCAACACAGCTCAACCTCACAACCCGAA
In the claim 1 to 5 each described test kit in the purposes that detects aspect the property artificial tuberculosis yersinia genus of food source.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008101870092A CN101492733A (en) | 2008-12-15 | 2008-12-15 | Reagent kit and method for detection of artificial tuberculosis yersinia genus with ring mediated isothermality amplification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008101870092A CN101492733A (en) | 2008-12-15 | 2008-12-15 | Reagent kit and method for detection of artificial tuberculosis yersinia genus with ring mediated isothermality amplification method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101492733A true CN101492733A (en) | 2009-07-29 |
Family
ID=40923522
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008101870092A Pending CN101492733A (en) | 2008-12-15 | 2008-12-15 | Reagent kit and method for detection of artificial tuberculosis yersinia genus with ring mediated isothermality amplification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101492733A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434890A (en) * | 2016-08-30 | 2017-02-22 | 上海生物信息技术研究中心 | Method, primers and kit for quickly detecting yersinia enterocolitica in constant-temperature manner |
| CN106434898A (en) * | 2015-09-02 | 2017-02-22 | 上海产业技术研究院 | Method, primers and kit for quickly detecting yersinia pseudotuberculosis at constant temperature |
| CN107663545A (en) * | 2017-09-19 | 2018-02-06 | 温和心 | Detect primer sets and the application of yersinia enterocolitica |
-
2008
- 2008-12-15 CN CNA2008101870092A patent/CN101492733A/en active Pending
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434898A (en) * | 2015-09-02 | 2017-02-22 | 上海产业技术研究院 | Method, primers and kit for quickly detecting yersinia pseudotuberculosis at constant temperature |
| CN106434898B (en) * | 2015-09-02 | 2020-02-21 | 上海产业技术研究院 | Method, primer and kit for rapidly detecting yersinia pseudotuberculosis at constant temperature |
| CN110938676A (en) * | 2015-09-02 | 2020-03-31 | 上海旺旺食品集团有限公司 | Method, primer group and kit for rapidly detecting yersinia pseudotuberculosis at constant temperature |
| CN110938677A (en) * | 2015-09-02 | 2020-03-31 | 上海旺旺食品集团有限公司 | Quick constant-temperature detection method for yersinia pseudotuberculosis nucleic acid and application |
| CN111020046A (en) * | 2015-09-02 | 2020-04-17 | 上海产业技术研究院 | Nucleic acid rapid constant temperature detection method for yersinia pseudotuberculosis and application |
| CN110938677B (en) * | 2015-09-02 | 2022-07-22 | 上海旺旺食品集团有限公司 | Quick constant-temperature detection method for yersinia pseudotuberculosis nucleic acid and application |
| CN110938676B (en) * | 2015-09-02 | 2022-07-26 | 上海旺旺食品集团有限公司 | Method, primer group and kit for rapidly detecting yersinia pseudotuberculosis at constant temperature |
| CN106434890A (en) * | 2016-08-30 | 2017-02-22 | 上海生物信息技术研究中心 | Method, primers and kit for quickly detecting yersinia enterocolitica in constant-temperature manner |
| CN106434890B (en) * | 2016-08-30 | 2020-02-21 | 上海生物信息技术研究中心 | Method, primer and kit for rapidly detecting yersinia enterocolitica at constant temperature |
| CN107663545A (en) * | 2017-09-19 | 2018-02-06 | 温和心 | Detect primer sets and the application of yersinia enterocolitica |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Robert-Pillot et al. | Total and pathogenic Vibrio parahaemolyticus in shrimp: fast and reliable quantification by real-time PCR | |
| CN107022644A (en) | Six kinds of multiple LAMP detection primers of food-borne pathogens, detection kit and detection method in fruits and vegetables | |
| CN103498000B (en) | Primer group, kit and method for detecting rice quarantine pathogenic bacteria by multiplex PCR (polymerase chain reaction) method | |
| Elliott et al. | Bench‐top validation testing of selected immunological and molecular R enibacterium salmoninarum diagnostic assays by comparison with quantitative bacteriological culture | |
| Hatha et al. | Distribution, extracellular virulence factors and drug resistance of motile aeromonads in fresh water ornamental fishes and associated carriage water | |
| CN101113473A (en) | Method for detecting food-derived pathogenic vibrio bacteria by composite fluorescence PCR technique | |
| CN101613743A (en) | Enterorrhagia Bacillus coil 0157 based on loop-mediated isothermal amplification technique: H7 nucleic acid screening method | |
| CN101942505A (en) | Pathogenic aeromonas hydrophila assay kit | |
| CN101402997B (en) | Reagent kit and method for detecting bacillus cereus with loop mediated isothermality amplification method | |
| CN101492732A (en) | Reagent kit and method for detection of enterocolitis yersinia genus with ring mediated isothermality amplification method | |
| CN101113471A (en) | Method for detecting food-derived pathogenic enterobacteria by composite fluorescence PCR technique | |
| CN101182574B (en) | Method for detecting food-borne enterocolitisyersinia genus by loop-mediated isothermal amplification | |
| CN101970682A (en) | Method for detecting and/or identifying clostridium difficile | |
| CN101492733A (en) | Reagent kit and method for detection of artificial tuberculosis yersinia genus with ring mediated isothermality amplification method | |
| CN101260423A (en) | Method for checking monocyte hyperplasia Listeria | |
| Carson et al. | Miniaturized tests for computer‐assisted identification of motile Aeromonas species with an improved probability matrix | |
| CN111154901B (en) | Specific new molecular target of vibrio parahaemolyticus and rapid detection method thereof | |
| CN102747148B (en) | Vibrio parahaemolyticus detection primer set and detection method | |
| Abulreesh et al. | Recovery of thermophilic campylobacters from pond water and sediment and the problem of interference by background bacteria in enrichment culture | |
| CN101555514A (en) | Vibrio mimicus chromogenic culture medium | |
| CN103146827B (en) | Multiplex PCR (Polymerase Chain Reaction) primer for simultaneously detecting salmonella, citrobacter, proteus and Edwardsiellas and design method thereof | |
| CN108707682A (en) | One kind is for detecting the active fluorescence RAA primers of salmonella, probe and detection method | |
| CN105463056A (en) | Culture medium for rapid culture and developing of candida albicans and detection method | |
| CN112458191A (en) | Kit for identifying MCR genotyping, identification method and application thereof | |
| Johari et al. | Prevalence of escherichia coli and salmonella in fish and blood clam (anadara granosa) from wet markets and hypermarkets in Kuala Pilah |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20090729 |