CN101250488A - Use of Paecilomyces javanicus H2 in degradation of formaldehyde - Google Patents
Use of Paecilomyces javanicus H2 in degradation of formaldehyde Download PDFInfo
- Publication number
- CN101250488A CN101250488A CNA2008100274006A CN200810027400A CN101250488A CN 101250488 A CN101250488 A CN 101250488A CN A2008100274006 A CNA2008100274006 A CN A2008100274006A CN 200810027400 A CN200810027400 A CN 200810027400A CN 101250488 A CN101250488 A CN 101250488A
- Authority
- CN
- China
- Prior art keywords
- formaldehyde
- degrading
- degradation
- glucose
- paecilomyces javanicus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides the application of java penicillium H2 in degrading formaldehyde. The research about degrading formaldehyde bacteria is reported long time before, but most reports are about the research for formaldehyde degrading bacterium and formaldehyde degrading microzyme, the research about formaldehyde degrading mould is reported very little, the reports about formaldehyde degrading bacteria are not available at present in China, the invention discloses the application of existing strains-java penicillium H2 in degrading the formaldehyde and simultaneously provides a series of data about the application of the java penicillium H2 in degrading the formaldehyde, such as the pH which is most suitable for growing, a carbon source, the formaldehyde degrading ability and the like, which greatly complements a database about degrading the formaldehyde and furthermore fills up the blank of data about researching for formaldehyde degrading bacteria in China, furthermore, the application of the trichoderma viride H1 in degrading the formaldehyde which is provided by the invention provides forceful help for the biological processing engineering of formaldehyde pollution.
Description
Technical field
The present invention relates to Degradation Formaldehyde bacterium technical field, be specifically related to the application of a kind of Paecilomyces javanicus H 2 in Degradation Formaldehyde.
Background technology
Degradation Formaldehyde Research on ability about the Degradation Formaldehyde bacterium just has report a long time ago, and early stage people get down to the research of lower concentration degradation of formaldehyde, and report is arranged during the high density degradation of formaldehyde in recent years.The isolating Pseudomonas putida of Adroer etc. (1990) A2 can degradation of formaldehyde 250mgL
-1The Halomonas sp.MAC that Azachil etc. (1995) have separated only can tolerate formaldehyde 75-100mgL
-1The isolating Pseudomonas.alcaligenes of Doronina etc. (1997) can degradation of formaldehyde 200mgL
-1, strain Pseudomonas putida J3 can degradation of formaldehyde 450mgL
-1, Methylobacterium extorquens can degradation of formaldehyde 500-1000mgL
-1One strain Pseudomonas alcaligenes cultivates can degradation of formaldehyde 2000mgL after 3 days
-1(NSW OSS) can degradation of formaldehyde 1850mgL for LSW, SSW for Mirdamadi etc. (2005) report Methylobacterium extorquens (ESS and PSS) and four strain Pseudomonas pseudoalcaligenes
-1, wherein strain Pseudomonas pseudoalcaligenes OSS cultivates 24h3700mgL
-1Formaldehyde is consumed by 100%, cultivates 72h and consumes 5920mgL
-1Formaldehyde 70%, Methylobacterium extorquens ESS and Methylobacterium extorquens PSS be degradation of formaldehyde 2960mgL fully
-1It is 2300mgdm that Bonastre etc. (1986) are reported in C formaldehyde
-3Active sludge do in the experiment of matrix can part degradation of formaldehyde, formaldehyde can be degraded by aerobic bacteria under aerobic condition; Degradation of formaldehyde 400mgdm when being carbon source with formaldehyde
-3, complete degradation of formaldehyde 2300mgdm in the wastewater treatment of active sludge factory
-3With phenol 2400mgdm
-3(Zagornaya et al, 1990).Yamazaki etc. (2001) have separated a strain formaldehyde resistant bacteria in seawater, find that it can degradation of formaldehyde 400mgdm in 3% sodium-chlor
-3, in the model of design such as Eiroa (2004), point out that nitrification can degradation of formaldehyde, when be carbon source with formaldehyde, when methyl alcohol is the association carbon source, the concentration that nitrobacteria can degradation of formaldehyde is 30-3890mgdm
-3, 1360mgdm and denitrifying bacterium can be degraded when having formaldehyde and methyl alcohol to exist
-3Formaldehyde (Eiroa et al, 2006).Yet major part is degradation of formaldehyde bacterium and the saccharomycetic research of degradation of formaldehyde, the The research of molds report seldom, Kondo etc. (2002) have separated strain formaldehyde tolerance fungi Aspergillus nomius IRI013 from soil, it can be grown in the highest w (formaldehyde)=0.45% li and its completely consumed fallen.No matter be lower concentration or high density, yet major part is Degradation Formaldehyde bacterium and the saccharomycetic research of Degradation Formaldehyde, The research of molds reports that seldom Kondo etc. (2002) have separated strain formaldehyde tolerance fungi Aspergillus nomius IRI013 from soil, and it can be grown in the highest w
(formaldehyde)=0.45% li and its completely consumed fallen.
The report of relevant Paecilomyces javanicus H 2 sees the Berbee of nineteen ninety-five, M.L. with people such as A.Yoshimura, (Berbee, M.L., A.Yoshimura, J.Sugiyama, and J.W.Taylor.1995.Is Penicillium monophyletic? an evaluation of phylogeny in the family Trichocomaceae from 18S, 5.8S and ITS ribosomal DNA sequence data.Mycologia 87:210-222.).But the research of relevant Paecilomyces javanicus H 2 energy degradation of formaldehyde does not see that report is arranged.
Summary of the invention
The purpose of this invention is to provide the application of a kind of Paecilomyces javanicus H 2 in degradation of formaldehyde, effectively and quickly degradation of formaldehyde.
Above-mentioned purpose of the present invention is achieved through the following technical solutions:
One, the separation of Degradation Formaldehyde bacterium-Paecilomyces javanicus H 2 and evaluation
1, culture medium prescription
The minimum medium prescription is: 1.0% (wv
-1) glucose, 0.2% (wv
-1) NaNO
3, 0.1% (wv
-1) K
2HPO
4, 0.05% (wv
-1) MgSO
47H
2O, 0.05% (wv
-1) KCl, 0.001% (wv
-1) FeSO
47H
2O, 0.01% (wv
-1) yeast extract paste, 0.1% (wv
-1) formaldehyde (formaldehyde with commercially available formaldehyde standardized solution), the substratum final pH is 6.0.(as not specifying, following minimum medium all fill a prescription substratum) for this reason
Czapek's solution prescription: 3.0% (wv
-1) sucrose, 0.3% (wv
-1) NaNO
3, 0.1% (wv
-1) K
2HPO
4, 0.05% (wv
-1) MgSO
47H
2O, 0.05% (wv
-1) KCl, 0.001% (wv
-1) FeSO
47H
2O, 1.5-2.0% (wv
-1) agar.
Malt extract medium prescription: 2.0% (wv
-1) malt extract, 0.1% (wv
-1) peptone, 2.0% (wv
-1) glucose, 1.5-2.0% (wv
-1) agar.
PDA culture medium prescription: 20% (wv
-1) potato (peeling), 2.0% (wv
-1) glucose, 1.5-2.0% (wv
-1) agar.(the potato chopping adds water boil 30min, filters with double gauze, gets its filtrate.)
2, separation and purification
Sample picks up from the mud of untreated Furniture Factory's water outlet, and its formaldehyde odor is strong, and formaldehyde is seriously polluted, thereby has guaranteed the existence of Degradation Formaldehyde purpose bacterium.
Above-mentioned sample is inoculated in the minimum medium 160rmin on the shaking table
-1Cultivate 5d for 30 ℃, the mould that growth is got up is repeatedly used the setting-out of PDA culture medium flat plate again, through purifying repeatedly, is separated to a strain mould, numbering H2.Then this bacterial strain is inoculated in czapek's solution respectively, malt extract medium, on the PDA substratum, cultivate 8d for 25 ℃, when observing its colony characteristics, microscopically is observed microstructure, and write down constitutional features, in conjunction with extracting DNA, detect DNA concentration and purity, a series of Molecular Identification means such as PCR 18S rDNA amplification are reached a conclusion: the 18SrDNA sequence of the degradation of formaldehyde bacterial strain that the present invention is separated to reaches 99.4% with the Paecilomyces javanicus H 2 of having reported (Penicillium javanicum) homology, and its cultural characteristic and microscopic features are also the most similar to Java mould (Penicillium javanicum).
The report document of Paecilomyces javanicus H 2 is:
Berbee，M.L.，A.Yoshimura，J.Sugiyama，and?J.W.Taylor.1995.Is?Penicillium?monophyletic？an?evaluation?of?phylogeny?in?thefamily?Trichocomaceae?from?18S，5.8S?and?ITS?ribosomal?DNA?sequence?data.Mycologia?87：210-222.
This shows that the degradation of formaldehyde bacterium that the present invention screens is a Paecilomyces javanicus H 2, the 18SrDNA sequence length is 1660bp, and uploading GenBank application number is bankit890497.
Two, the optimum growh pH value of Paecilomyces javanicus H 2
The general hobby of Paecilomyces javanicus H 2 is grown in the environment of meta-acid, but its oxyphilous degree difference is very big, therefore understands the pH of its optimum growh, helps it is carried out fast culture and application.
1, first order seed produces
Choose and produce the good Paecilomyces javanicus H 2 of spore, be seeded in the minimum medium shaking table 160rmin
-1, cultivate 2～3d for 30 ℃, when mould enters fast growing period, regularly measure OD
475Value is worked as OD
475During the value fast rise, this bacterium liquid promptly can be used as first order seed.
2, specimen preparation
Choose big mouthful of 150mL triangular flask, preparation pH is respectively 4.0,4.5,5.0,5.5,6.0 the liquid-based basal culture medium, bottleneck with aseptic seal culture membrane seal (the aseptic culture membrane that seals is the duplicature that the triumphant company of ring produces, on have two of the circular holes of diameter 0.6cm, centre have diameter 3cm, the aperture is less than the aseptic filter paper sheet of 0.2 μ, be used for the group training produces more), cultivate first order seed (OD
475Value is 0.168), except that blank, insert first order seed 5mL, put 30 ℃ of 160rmin on the shaking table
-1Cultivate, in the 0th, 24,48 of inoculation, 72,96,120, the 144h sampling, get 2 bottles at every turn and measure the mycelia dry weight, the OD pH-value determination pH TU-1800 of Beijing Puxi General Instrument Co., Ltd type ultraviolet-visible pectrophotometer, the mycelia dry weight is measured with weighting method, and the result gets its mean value mapping.
3, interpretation of result
Paecilomyces javanicus H 2 is cultivated 144h in 5 kinds of different pH substratum, the mycelia dry weight respectively from 0.0026,0.0024,0.0027,0.0024,0.0024mgL
-1Rise to 0.0116,0.0122,0.0152,0.0131,0.0117mgL
-1, mycelia dry weight maximum be pH5.0.So the optimal pH of Paecilomyces javanicus H 2 is pH5.0.
Three, the degradation capability of Paecilomyces javanicus H 2 PARA FORMALDEHYDE PRILLS(91,95)
Choose big mouthful of 150mL triangular flask, preparation minimum medium, C
(formaldehyde)By about 0.1%, 0.15%, 0.2%, 0.25% (wv
-1) add, pH chooses the optimal pH (pH5.0) that has recorded respectively, and bottleneck seals with the aseptic culture membrane that seals, and cultivates first order seed (OD
475Value is 0.172), every bottle graft is gone into 5mL except that blank, puts 30 ℃ of 160rmin on the shaking table
-1Cultivate, and in the 0th, 24,48,72,96,120 of inoculation, the 144h sampling is got 3 bottles at every turn, wherein one bottle is blank, 7000 * centrifugal 15min, filtration, and filtrate is detected C with the AHMT spectrophotometry
(formaldehyde), filter paper and bacterium change over to together and have claimed to survey the mycelia dry weight to the beaker of constant weight, and the mycelia dry weight is measured with weighting method, and the result gets its mean value mapping.
C
(formaldehyde)Detection AHMT spectrophotometry, the result is as the criterion with actual measurement data, and gets the mapping of its mean value.
Paecilomyces javanicus H 2 inoculation back 144h handles 0.1%C
(formaldehyde)From 1059mgL
-1Drop to 317mgL
-1, degradation rate is 70.1%, blank 1102-1134mgL
-1Handle 0.15%C
(formaldehyde)From 1528mgL
-1Drop to 712mgL
-1, degradation rate is 53.4%, blank 1578-1612mgL
-1Handle 0.20%C
(formaldehyde)From 2197mgL
-1Drop to 1069mgL
-1, degradation rate is 51.3%, blank 2209-2243mgL
-1Handle 0.25%C
(formaldehyde)From 3152mgL
-1Drop to 2264mgL
-1, degradation rate is 28.2%, blank 3195-3223mgL
-1The mycelia dry weight respectively from 0.0027,0.0024,0.0026,0.0024gL
-1Rise to 0.0147,0.0115,0.0087,0.0046gL
-1, in 4 various concentrations over control treatment, volatilization loss seldom, C
(formaldehyde)Do not have quick decrement phase, the mycelia dry weight rises also very mild.
When formaldehyde and first order seed almost add when separating minimum medium simultaneously, sampling is added with the C of formaldehyde and 5mL first order seed during 0h
(formaldehyde)All not add the blank of bacterium low by about 4%～10% than only adding formaldehyde, this just explanation have a spot of formaldehyde just to contact just to be absorbed or adsorb by Paecilomyces javanicus H 2 with mycelium.
Four, the carbon source metabolism and the optimum carbon source of Paecilomyces javanicus H 2
Choose 4 kinds of carbon sources commonly used: glucose, sucrose, maltose, Zulkovsky starch, press 10% of culture volume and add (wv
-1), the carbon source of 5 kinds of different treatment is set, be respectively:
0.1% formaldehyde, 0.1% formaldehyde+10% sucrose, 0.1% formaldehyde+10% maltose, 0.1% formaldehyde+10% starch, 0.1% formaldehyde+10% glucose, the same minimum medium of all the other compositions, pH value H1 is 4.5, H2 is 5.0, H4 is 5.5, select the packing of big mouthful of 150mL triangular flask for use, bottleneck seals with the aseptic culture membrane that seals, and inserts first order seed 5mL (OD
475Value is 0.210), put 30 ℃ of 160rmin on the shaking table
-1Cultivate, and in the 0th, 24,48,72,96,120 of inoculation, the 144h sampling is got 2 bottles at every turn, surveys C
(formaldehyde)With mycelia dry weight value, the processing of glucose is arranged in the H4 substratum, add and survey C
(glucose), and band only adds the substratum blank that glucose does not add bacterium.The OD pH-value determination pH TU-1800 of Beijing Puxi General Instrument Co., Ltd type ultraviolet-visible pectrophotometer, sampling back 7000 * centrifugal 15min, filtration, filtrate being used for measured C
(formaldehyde)And C
(glucose), C
(formaldehyde)Detect C with the AHMT spectrophotometry
(glucose)Detect with the anthrone colorimetry, filter paper and bacterium change over to together and have claimed to survey the mycelia dry weight to the beaker of constant weight.The result is as the criterion with actual measurement data, and gets its mean value mapping.
Paecilomyces javanicus H 2 effective degradation of formaldehyde in 5 kinds of different carbon sources, mycelia dry weight respectively from 0.0033,0036,0.0034,0.0035,0.0036gL
-1Rise to 0.0041,0.0164,0.0171,0.0165,0.0172gL
-1, in handling 0.1% formaldehyde+10% sucrose, 0.1% formaldehyde+10% maltose, 0.1% formaldehyde+10% starch, 0.1% formaldehyde+10% glucose, C
(formaldehyde)Respectively from 1213,1204,1257,1141mgL
-1Drop to 282,246,315,248mgL
-1, degradation rate is respectively 76.8,79.6,74.9,78.3%, in the 96h, and C
(formaldehyde)It is very fast to descend, and mycelia increases slower.
In the processing of having only formaldehyde as carbon source, the C of H2 when cultivating 144h
(formaldehyde)From 1214mgL
-1Drop to 436mgL
-1, degradation rate is 64.1%, C behind the 24h
(formaldehyde)Lowering speed is accelerated, so Paecilomyces javanicus H 2 can utilize formaldehyde to be carbon source and degradation of formaldehyde separately, but degraded slowly, and effect is not as adding compounded carbons.
The add-on of glucose is 13926mgL
-1, C
(glucose)Be acceleration and descend, slow slightly before the 48h, the amount that consumes every 24h is 657,1229,3551,3049,2549,2510mgL
-1, to 144h C
(glucose)Be 381mgL
-1Only add the blank that glucose does not add bacterium, C
(glucose)Stable, can ignore this blank when calculating the glucose consumption amount.
Paecilomyces javanicus H 2 with formaldehyde and glucose be carbon source the rule of utilizing be: degradation curve C
(formaldehyde)Descending is close to average rate, C in the 24h
(glucose)Interior decline is slow slightly, and Paecilomyces javanicus H 2 is a carbon source with formaldehyde and glucose earlier simultaneously, and preferentially utilizes formaldehyde; Behind the 24h, C
(glucose)Lowering speed is fast, and it is very fast to rise behind the mycelia dry weight 72h, and the Paecilomyces javanicus H 2 breeding is a carbon source with formaldehyde and glucose rapidly simultaneously; Do not measure C
(formaldehyde)Slow decrement phase.
Compared with prior art, the present invention has following beneficial effect: 1. the present invention discovers that existing bacterial classification Paecilomyces javanicus H 2 has the ability of degradation of formaldehyde, the a series of data of Paecilomyces javanicus H 2 in the application of degradation of formaldehyde are provided simultaneously, as the suitableeest growth pH, carbon source and Degradation Formaldehyde ability etc., greatly replenish the database of degradation of formaldehyde bacterium, and filled up the blank of domestic Degradation Formaldehyde bacterium research; 2. the application of Paecilomyces javanicus H 2 provided by the invention in degradation of formaldehyde, the biological treatment engineering for formaldehyde pollutes provides strong help.
Description of drawings
Fig. 1 be Paecilomyces javanicus H 2 czapek's solution (25 ℃, the 7d) colonial morphology on;
Fig. 2 be Paecilomyces javanicus H 2 malt extract medium (25 ℃, the 7d) colonial morphology on;
Fig. 3 for Paecilomyces javanicus H 2 the PDA substratum (be added with rose-bengal, 25 ℃, the 7d) colonial morphology on;
Fig. 4 is the conidiophore broom shape branch and the spherical conidium of Paecilomyces javanicus H 2
Fig. 5 is the growth curve of Paecilomyces javanicus H 2 when different pH;
Fig. 6 is that Paecilomyces javanicus H 2 is at different C
(formaldehyde)The time degradation curve;
Fig. 7 is that Paecilomyces javanicus H 2 is at different C
FormaldehydeThe time growth curve;
Fig. 8 is the C of Paecilomyces javanicus H 2 in different carbon sources
(formaldehyde)Degradation curve;
Fig. 9 is the growth curve of Paecilomyces javanicus H 2 in the different composite carbon source;
Figure 10 is the C of Paecilomyces javanicus H 2
(glucose)Downcurve;
Figure 11 is Paecilomyces javanicus H 2 C
(formaldehyde)And C
(glucose)Downcurve relatively;
Wherein, 1 is formaldehyde, and 2 is formaldehyde+sucrose, and 3 is formaldehyde+maltose, and 4 is formaldehyde+starch, and 5 is formaldehyde+glucose, and 6 is glucose, and ck is a blank.
By being described in more detail the present invention by following examples.Following examples only are illustrative, and the present invention is not subjected to the restriction of these embodiment.
Embodiment
Separation and the evaluation of embodiment 1 Degradation Formaldehyde bacterium
1, culture medium preparation
Minimum medium prescription: 1.0% (wv
-1) glucose, 0.2% (wv
-1) NaNO
3, 0.1% (wv
-1) K
2HPO
4, 0.05% (wv
-1) MgSO
47H
2O, 0.05% (wv
-1) KCl, 0.001% (wv
-1) FeSO
47H
2O, 0.01% (wv
-1) yeast extract paste, 0.1% (wv
-1) formaldehyde (formaldehyde with commercially available formaldehyde standardized solution), the substratum final pH is 6.0.
Czapek's solution prescription: 3.0% (wv
-1) sucrose, 0.3% (wv
-1) NaNO
3, 0.1% (wv
-1) K
2HPO
4, 0.05% (wv
-1) MgSO
47H
2O, 0.05% (wv
-1) KCl, 0.001% (wv
-1) FeSO
47H
2O, 1.5～2.0% (wv
-1) agar.
Malt extract medium prescription: 2.0% (wv
-1) malt extract, 0.1% (wv
-1) peptone, 2.0% (wv
-1) glucose, 1.5～2.0% (wv
-1) agar.
PDA culture medium prescription: 20% (wv
-1) potato, 2.0% (wv
-1) glucose, 1.5～2.0% (wv
-1) agar.(the potato decortication chopping adds water boil 30, filters with double gauze, gets its filtrate.)
2, separate
Sample picks up from the mud of untreated Furniture Factory's water outlet, and its formaldehyde odor is strong, and formaldehyde is seriously polluted, thereby has guaranteed the existence of Degradation Formaldehyde purpose bacterium.
On Bechtop, get the above-mentioned mud sample of 10g and place the 90mL sterilized water, vibration 15min placed 20 seconds, got the 1mL supernatant liquor and was inoculated in the nutrient solution, 160rmin on shaking table
-1Cultivate 5d for 30 ℃, the fungi that growth is got up is repeatedly used the setting-out of PDA culture medium flat plate again, through purifying repeatedly, is separated to a strain mould, numbering H2.
3, identify
(1) the dull and stereotyped observation
Choose czapek's solution, malt extract medium, PDA substratum, inoculating needle after flame sterilization and cooling, is dipped in the spore of getting minute quantity, point is planted the mid-way in flat board, places 25 ℃ to cultivate 8d flat board, observes the feature and the record of bacterium colony.
(2) microscopic examination
From the bacterium colony of culture dish, a little thalline of picking is put in the water droplet of slide glass, observes its morphological specificity and record in microscopically with dissecting needle.
(3) Molecular Identification
The extraction of DNA is carried out with reference to the CTAB method, and the detection of DNA concentration and purity adopts nucleic acid/protein analyzer to measure under Nucleic Acid program.PCR adopts fungi 18S rDNA amplification universal primer (upstream primer: GATCCTGCCAGTAGTCATATGC; Downstream primer: GCTGCGTTCTTCATCGATGC), reaction conditions is 94 ℃ of 5min, 30 circulations (94 ℃ of 1min, 56 ℃ of 1min, 72 ℃ of 1min), 72 ℃ of reaction 7min.Agarose gel electrophoresis 40min with 1.0% is in UVI gel imaging system analytical results.
The amplified production order-checking is finished by the handsome Bioisystech Co., Ltd in Shanghai, and sequencing result carries out the homologous sequence search in the Genbank database, find out the highest type strain of homology in this bacterial strain and the database.
4, result and analysis
Observe and microscopic examination through flat board, this bacterial strain is colony diameter 20mm on czapek's solution, and is flat thin, be close to matrix, and the fine fleece shape, irregular colour, dibbling place is a yellowish brown, peripheral lavender is to glaucous blue.There are a large amount of tiny yellow to ooze out drop, radiationless line, reverse side reddish yellow (Fig. 1); Colony diameter 24mm on malt extract medium, superfine velvet-like or felted, after be powdery slightly, greyish-green or dusty blue, there is darker rill on the surface, dry no transudate, the nearly mustard yellow of reverse side, matrix has radial rill (Fig. 2); On the PDA substratum, be powdery, green has radial striped, no transudate, reverse side faint yellow (Fig. 3).Conidiophore amacrine, its tip have broom shape branch, and penicillus is generally the single-wheel type, and branch or branch are not irregular, each branch has only the stigma of wheel, and stigma 5-8,5-10*2.3-3.8 μ m, the conidium sphere, 1.8-2.5 μ m, wall is bordering on smooth (Fig. 4).
The 18SrDNA sequence of this bacterial strain reaches 99.4% with sexual generation Java penicillium (Eupenicillium javanicum) homology of the Paecilomyces javanicus H 2 of having reported (Penicilliumjavanicum), and its cultural characteristic and microscopic features are also the most similar to Paecilomyces javanicus H 2 (Penicilliumjavanicum).
In conjunction with above-mentioned flat board observation, microscopic examination and Molecular Identification result, draw as drawing a conclusion: the degradation of formaldehyde bacterium H2 that the present invention screens is the Java mould, and the 18SrDNA sequence length is 1660bp, and uploading GenBank application number is bankit890497.
The optimum growh pH value of embodiment 2 Paecilomyces javanicus H 2s
The general hobby of mould is grown in the environment of meta-acid, but its oxyphilous degree difference is very big, therefore understands the pH of its optimum growh, helps it is carried out fast culture and application.
1, first order seed produces
Choose and produce the good Paecilomyces javanicus H 2 of spore, be seeded in the minimum medium shaking table 160rmin
-1, cultivate 2～3d for 30 ℃, when mould enters fast growing period, regularly measure OD
475Value is worked as OD
475During the value fast rise, this bacterium liquid promptly can be used as first order seed.
2, specimen preparation
Choose big mouthful of 150mL triangular flask, preparation pH is respectively 4.0,4.5,5.0,5.5,6.0 the liquid-based basal culture medium, bottleneck with aseptic seal culture membrane seal (the aseptic culture membrane that seals is the duplicature that the triumphant company of ring produces, on have two of the circular holes of diameter 0.6cm, centre have diameter 3cm, the aperture is less than the aseptic filter paper sheet of 0.2 μ, be used for the group training produces more), cultivate first order seed (OD
475Value is 0.168), except that blank, insert first order seed 5mL, put 30 ℃ of 160rmin on the shaking table
-1Cultivate, in the 0th, 24,48 of inoculation, 72,96,120, the 144h sampling, get 2 bottles at every turn and measure the mycelia dry weight, the OD pH-value determination pH TU-1800 of Beijing Puxi General Instrument Co., Ltd type ultraviolet-visible pectrophotometer, the mycelia dry weight is measured with weighting method, and the result gets its mean value mapping.
3, the measurement of mycelia dry weight
Beaker at 105 ℃ of baking 1h to constant weight, the record weighing result, with bacterium liquid with filter paper filtering after, change over to together with filter paper in the beaker of constant weight, dry to constant weight in 80 ℃, each band is blank more than two.
Mycelia dry weight (gL
-1)=[(weight+paper of beaker+bacterium)-(beaker+paper)] * 1000/ sample size.
The mycelia dry weight is got its mean value mapping.
4, result and analysis
The degradation capability of embodiment 3 Paecilomyces javanicus H 2 PARA FORMALDEHYDE PRILLS(91,95)
1, sample is produced
Choose big mouthful of 150mL triangular flask, preparation minimum medium, C
(formaldehyde)By about 0.1%, 0.15%, 0.2%, 0.25% (wv
-1) add, pH chooses the optimal pH (pH5.0) that has recorded respectively, and bottleneck seals with the aseptic culture membrane that seals, and cultivates first order seed (OD
475Value is 0.172), every bottle graft is gone into 5mL except that blank, puts 30 ℃ of 160rmin on the shaking table
-1Cultivate, and in the 0th, 24,48,72,96,120 of inoculation, the 144h sampling is got 3 bottles at every turn, wherein one bottle is blank, 7000 * centrifugal 15min, filtration, and filtrate is detected C with the AHMT spectrophotometry
(formaldehyde), filter paper and bacterium change over to together and have claimed to survey the mycelia dry weight to the beaker of constant weight, and the mycelia dry weight is measured with weighting method, and the result gets its mean value mapping.
C
(formaldehyde)Detection AHMT spectrophotometry, the result is as the criterion with actual measurement data, and gets the mapping of its mean value.
2, detect
C
(formaldehyde)Detection AHMT spectrophotometry, principle is formaldehyde and 4-amino-3 hydrazines-5-sulfydryl-1,2,4-triazole (being called for short AHMT) condensation under alkaline condition, be oxidized to 6-sulfydryl-5-triazole [4 through potassium periodate then, 3-b]-S-tetrazine red-purple compound, its color and luster depth is directly proportional with formaldehyde content.
Above-mentioned sample through 7000 * centrifugal 15min, and filter after, filter paper and bacterium change over to together and have claimed to survey the mycelia dry weight to the beaker of constant weight, get its mean value mapping; Filtrate is detected C with the AHMT spectrophotometry
(formaldehyde), concrete steps are as follows:
Get the 100ml volumetric flask, absorption 1.0ml has diluted 100 times above-mentioned filtrate, adds 5molL
-1Potassium hydroxide solution 1.0ml, 0.5%AHMT solution 1.0ml covers pipe close, puts upside down mixing three times, places 20min, adds 1.5% potassium periodate 0.3ml, and shake well is placed 5min, is settled to 100ml.Use the 1cm cuvette, wavelength 550nm with sample band blank, measures light absorption value, and formaldehyde mark liquid is available from the lark waffle company limited that learns a skill.The operation steps of formaldehyde graticule is followed the identical of sample, and the production standard curve draws the graticule equation, and samples contg is converted by the graticule equation and draws.
3, result and analysis
Calculate the C of blank and sample
(formaldehyde), and the mean value of getting blank and two samples maps respectively, makes legend and identifies and represent actual C with 0.1%, 0.15%, 0.2%, 0.25%
(formaldehyde)Be as the criterion with measuring result.
Shown in Fig. 6,7, Paecilomyces javanicus H 2 inoculation back 144h handles 0.1% ρ
(formaldehyde)From 1059mgL
-1Drop to 317mgL
-1, degradation rate is 70.1%, blank 1102-1134mgL
-1Handle 0.15% ρ
(formaldehyde)From 1528mgL
-1Drop to 712mgL
-1, degradation rate is 53.4%, blank 1578-1612mgL
-1Handle 0.20% ρ
(formaldehyde)From 2197mgL
-1Drop to 1069mgL
-1, degradation rate is 51.3%, blank 2209-2243mgL
-1Handle 0.25% ρ
(formaldehyde)From 3152mgL
-1Drop to 2264mgL
-1, degradation rate is 28.2%, blank 3195-3223mgL
-1The mycelia dry weight respectively from 0.0027,0.0024,0.0026,0.0024gL
-1Rise to 0.0147,0.0115,0.0087,0.0046gL
-1, in 4 various concentrations over control treatment, ρ
(formaldehyde)Do not have quick decrement phase, the mycelia dry weight rises also very mild.Blank 144h volatilization seldom can be ignored volatilization fully when weighing or calculate the degradation of formaldehyde amount and not remember.
When formaldehyde and first order seed almost add when separating minimum medium simultaneously, sampling is added with the C of formaldehyde and 5mL first order seed during 0h
(formaldehyde)All not add the blank of bacterium low by about 4%～10% than only adding formaldehyde, this just explanation have a spot of formaldehyde just to contact just to be absorbed or adsorb by Paecilomyces javanicus H 2 with mycelium.
In 4 different concentration of formaldehyde of present embodiment are handled, the C of Paecilomyces javanicus H 2
(formaldehyde)Do not have quick decrement phase, the mycelia dry weight does not have the fast rise phase.
The carbon source metabolism and the optimum carbon source of embodiment 4 Paecilomyces javanicus H 2s
Choose 4 kinds of carbon sources commonly used: glucose, sucrose, maltose, Zulkovsky starch, press 10% of culture volume and add (wv
-1), the carbon source of 5 kinds of different treatment is set, be respectively: 0.1% formaldehyde, 0.1% formaldehyde+10% sucrose, 0.1% formaldehyde+10% maltose, 0.1% formaldehyde+10% starch, 0.1% formaldehyde+10% glucose, the same minimum medium of all the other compositions, pH value H1 is 4.5, H2 is 5.0, H4 is 5.5, select the packing of big mouthful of 150mL triangular flask for use, bottleneck seals with the aseptic culture membrane that seals, and inserts first order seed 5mL (OD
475Value is 0.210), put 30 ℃ of 160rmin on the shaking table
-1Cultivate, and in the 0th, 24,48,72,96,120 of inoculation, the 144h sampling is got 2 bottles at every turn, surveys C
(formaldehyde)With mycelia dry weight value, the processing of glucose is arranged in the H4 substratum, add and survey C
(glucose), and band only adds the substratum blank that glucose does not add bacterium.The OD pH-value determination pH TU-1800 of Beijing Puxi General Instrument Co., Ltd type ultraviolet-visible pectrophotometer, sampling back 7000 * centrifugal 15min, filtration, filtrate being used for measured C
(formaldehyde)And C
(glucose), C
(formaldehyde)Detect C with the AHMT spectrophotometry
(glucose)Detect with the anthrone colorimetry, filter paper and bacterium change over to together and have claimed to survey the mycelia dry weight to the beaker of constant weight.The result is as the criterion with actual measurement data, and gets its mean value mapping.
Shown in Fig. 8,9, Paecilomyces javanicus H 2 effective degradation of formaldehyde in 5 kinds of different carbon sources, in handling 0.1% formaldehyde+10% sucrose, 0.1% formaldehyde+10% maltose, 0.1% formaldehyde+10% starch, 0.1% formaldehyde+10% glucose, C
(formaldehyde)Respectively from 1214,1213,1204,1257mgL
-1Drop to 282,424,315,248mgL
-1, degradation rate is respectively 76.8,80.0,74.9,78.3%, in the 96h, the mycelia dry weight respectively from 0.0036,0.0034,0.0035,0.0036gL
-1Rise to 0.0164,0.0171,0.0165,0.0172gL
-1, C
(formaldehyde)It is very fast to descend, and mycelia increases slower.
In the processing of having only formaldehyde as carbon source, the C of H2 when cultivating 144h
(formaldehyde)From 1214mgL
-1Drop to 436mgL
-1, degradation rate is 64.1%, the mycelia dry weight rises to 0.0041gL from 0.0033
-1, C behind the 24h
(formaldehyde)Lowering speed is accelerated, so Paecilomyces javanicus H 2 can utilize formaldehyde to be carbon source and degradation of formaldehyde separately, but degraded slowly, and effect is not as adding compounded carbons.
As shown in figure 10, the add-on of glucose is 13926mgL
-1, C
(glucose)Decline be acceleration and descend, slow slightly before the 48h, the amount that consumes every 24h is 657,1229,3551,3049,2549,2510mgL
-1, to 144h C
(glucose)Be 381mgL
-1Only add the blank that glucose does not add bacterium, C
(glucose)Stable, can ignore this blank when calculating the glucose consumption amount.
By above data as seen, Paecilomyces javanicus H 2 should be the PARA FORMALDEHYDE PRILLS(91,95) inhibitory phase to sensitivity, the formaldehyde utilization ratio is less relatively, can utilize compounded carbons and degradation of formaldehyde, also can utilize formaldehyde for sole carbon source but the mycelia dry weight increases slowly, degradation effect is also not as compounded carbons.
Claims (1)
1, the application of Paecilomyces javanicus H 2 in degradation of formaldehyde.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100274006A CN101250488A (en) | 2008-04-14 | 2008-04-14 | Use of Paecilomyces javanicus H2 in degradation of formaldehyde |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100274006A CN101250488A (en) | 2008-04-14 | 2008-04-14 | Use of Paecilomyces javanicus H2 in degradation of formaldehyde |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101250488A true CN101250488A (en) | 2008-08-27 |
Family
ID=39954088
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100274006A Pending CN101250488A (en) | 2008-04-14 | 2008-04-14 | Use of Paecilomyces javanicus H2 in degradation of formaldehyde |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101250488A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102021120A (en) * | 2010-08-13 | 2011-04-20 | 广东省生态环境与土壤研究所 | Paecilonyces variotii strain and application thereof |
| CN102417885A (en) * | 2011-11-24 | 2012-04-18 | 哈尔滨师范大学 | Penicillium vinaceum SGFA3 and application thereof |
| CN114606139A (en) * | 2022-03-24 | 2022-06-10 | 华南理工大学 | Beautiful millettia root endophytic fungus and fermentation product and application thereof |
-
2008
- 2008-04-14 CN CNA2008100274006A patent/CN101250488A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102021120A (en) * | 2010-08-13 | 2011-04-20 | 广东省生态环境与土壤研究所 | Paecilonyces variotii strain and application thereof |
| CN102021120B (en) * | 2010-08-13 | 2012-07-25 | 广东省生态环境与土壤研究所 | Paecilonyces variotii strain and application thereof |
| CN102417885A (en) * | 2011-11-24 | 2012-04-18 | 哈尔滨师范大学 | Penicillium vinaceum SGFA3 and application thereof |
| CN114606139A (en) * | 2022-03-24 | 2022-06-10 | 华南理工大学 | Beautiful millettia root endophytic fungus and fermentation product and application thereof |
| CN114606139B (en) * | 2022-03-24 | 2023-11-07 | 华南理工大学 | Penicillium javanicum and fermentation product and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103952362B (en) | One strain is to the oranges and tangerines endogeny rayungus of various plants pathogenic bacteria tool bacteriostatic activity | |
| CN103114064B (en) | Marine actinomycete with antibacterial activity to multiple plant pathogens | |
| CN102389022B (en) | Method for preparing ayfivin compound protein feed additive by degrading feather with bacillus licheniformis | |
| CN103710271A (en) | Morchella esculenta bacterial strain and culture method thereof | |
| CN102796671A (en) | Paecilomyces lilacinus for degrading phoxim and application of Paecilomyces lilacinus | |
| CN112920956A (en) | Beauveria bassiana BD01 strain and fermentation method and application thereof | |
| CN117887638B (en) | Tricholoma giganteum growth-promoting microorganism SLTmB strain and application thereof | |
| CN109082396A (en) | Bacterium and its application in control of plant disease is quenched in a kind of DSF colony induction signaling molecule | |
| CN104263682A (en) | Plant-growth-promoting endophytic bacterium having polycyclic aromatic hydrocarbons degrading function and application thereof | |
| CN109321500B (en) | Bacillus amyloliquefaciens strain and application thereof in prevention and treatment of camellia oleifera anthracnose disease | |
| CN101250486A (en) | Use of aspergillus flavus H4 in degradation of formaldehyde | |
| CN101250488A (en) | Use of Paecilomyces javanicus H2 in degradation of formaldehyde | |
| CN103555636B (en) | Streptomyces violaceorubidus and application thereof | |
| Zhang et al. | Effects of inoculation with ectomycorrhizal fungi on microbial biomass and bacterial functional diversity in the rhizosphere of Pinus tabulaeformis seedlings | |
| CN105331548A (en) | Lepista nuda strain and liquid culture and preparation method thereof | |
| CN103773709B (en) | Bacillus subtilis with efficient phosphate solubilizing effect and application thereof | |
| CN103468579B (en) | New lecanicillium bacteria genus fungi specie providing pathogenicity for diaphorina citri | |
| CN102021120B (en) | Paecilonyces variotii strain and application thereof | |
| CN110560469B (en) | Method for restoring uranium-cadmium combined polluted soil by using uranium-cadmium-resistant fungi enhanced plants | |
| Nwakoby et al. | Isolation and identification of bacteria and fungi from cassavamill effluent in Afikpo, Ebonyi State Nigeria | |
| CN109439582B (en) | Bacillus megaterium grown in chrysanthemum morifolium and application thereof | |
| Swart et al. | Comparison of Sphaeropsis sapinea and Sphaeropsis sapinea f. sp. cupressi | |
| CN103305481B (en) | Method for producing laccase by fermenting cerrena unicolor | |
| CN102021121B (en) | Halictidae aspergillus nomius strain and application thereof | |
| CN104805018A (en) | Agromyces sp. MT-E used for simultaneous degradation of plurality of phthalic acid esters |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20080827 |