CN103773709B - Bacillus subtilis with effect of efficiently dissolving phosphorus and application of bacillus subtilis - Google Patents

Abstract

The invention relates to a bacillus subtilis with the effect of efficiently dissolving phosphorus. The bacillus subtilis is preserved in the China General Microbiological Culture Collection Center and has the preservation NO. of CGMCCNo. 8241. The bacillus subtilis has the relatively high effect of dissolving the phosphorus, cannot pollute environment, and is ecological and safe. The efficient bacillus subtilis can be used independently, or used together with other organic and inorganic nutritional ingredients required by plants to be prepared into biological compound fertilizer, and which has the effects of increasing yield and improving quality.

Description

A kind of subtilis and application thereof with efficient phosphate-solubilizing effect

Technical field

The present invention relates to microorganism and biological fertilizer field, particularly relate to subtilis, specifically, the present invention relates to a kind of subtilis and application thereof of efficient phosphate-solubilizing effect.

Background technology

Phosphate fertilizer can promote plant flowers Bud polarization, early flowering result, promotes seedlings root growth and improves fruit quality.Execute phosphorus and can promote that various Metabolism of Normal carries out, growth and development of plants is good, improves winter resistance and the drought resistance of plant simultaneously.Because the metabolism of phosphorus and carbohydrate, protein and fat and three's phase co-conversion have relation, no matter all need phosphate fertilizer mainly with cultivation food crop, legume crop and oil crop.When lacking phosphorus, protein synthesis is obstructed, and new tenuigenin and nucleus are formed less, affect cell fission, poor growth, also few, branch or minimizing of tillering, and plant is short and small, and blade is dark green, and may be that Growth of Cells is slow, chlorophyll content improves relatively.Certain plants leaf takes on a red color or purple sometimes.Because lack phosphorus to hinder sugar transport, also oneself tire out a large amount of sugars, be conducive to the formation of yellow pigment glycosides.When lacking phosphorus, flowering period and ripening stage all postpone, and output reduces, and resistance weakens.But China has the arable soil of 74% to lack phosphorus, in soil, the phosphorus of more than 95% is invalid form, plant is difficult to directly absorb, and in addition, a large amount of uses the adverse consequencess such as chemical fertilizer obviously causes soil compaction, the decline of soil water-retaining power, grassland degeneration, desertification serious.Therefore, the utilization ratio improving phosphorus is the focus that agronomy, soil science, ecotope and microbiological research person pay close attention to always.

People start the relation noticed between microorganism and soil phosphorus in 20 beginnings of the century.In Sackett(1908) finding that the mixture of some insolublies is manured into soil, can be applied by as phosphorus source, they filter out 50 strain bacteriums from soil, and wherein 36 strains define macroscopic molten phosphorus circle on flat board.Gerretsen in 1948 finds that plant applies insoluble phosphate fertilizer, after inoculation soil microorganisms, facilitates the growth of plant, increases the absorption of phosphorus.He has isolated these microorganisms, finds that these microorganisms can help the dissolving of ground phosphate rock.From then on, many scientists are devoted to the research of phosphate solubilizing bacteria, in succession report many microorganisms and have phosphate solubilization.

Present inventor is through concentrated research for many years, and from plant rhizosphere soil, be separated to the bacillus subtilis strain that a strain is new, this bacterial strain has stronger phosphate solubilization, invalid phosphorus effectively can be transformed into available phosphorus.

Summary of the invention

The object of the present invention is to provide the bacterial strain of a kind of new subtilis, described bacterial strain has good phosphate solubilization.

Subtilis of the present invention (Bacillus subtilis) is deposited in China Committee for Culture Collection of Microorganisms's common micro-organisms center on September 24th, 2013, depositary institution address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, and deposit number is CGMCC No.8241.

Further, the invention provides the purposes of above-mentioned subtilis in phosphorus decomposing.

Further, subtilis of the present invention can make microbiobacterial agent, cultivates in LB nutrient solution by described bacterial strain, and culture temperature is 27 DEG C, and cultivated days is 5 days, and rotating speed is 200 rpm, and bacterium liquid cell count is adjusted to 10 after filtering by nutrient solution ⁹individual/mL, i.e. obtained microorganism Bacillus subtilis microbial inoculum of the present invention.

Subtilis provided by the present invention is separated and obtains from plant rhizosphere soil, its laboratory called after bacterial strain Fdp6.

Bacterial strain Fdp6 is rounded at the upper bacterium colony of LB solid medium (substratum consists of: Tryptones 10g/L, yeast extract 5g/L, sodium-chlor 10g/L, agar 15g/L), and edge is irregular, oyster white, opaque, and surface irregularity has fold, matt.Be cultured to 30h, thalline all exists with the form of hypopus gemma.Bacterium colony is light yellow.Microscopic examination thalline is unicellular, shaft-like, single raw or twin, sometimes becomes chain.Gram-positive, gemma is oval.VP reaction, Starch Hydrolysis test, nitrate reduction reaction, Citrate trianion utilization, gelatine liquefication are the positive; The utilization of the test of phenylpropionic acid desaminase, M.R., urine enzyme test, propionic salt is feminine gender, can grow in containing the LB substratum of 6.5% NaCl.16S rDNA gene specific primer is utilized to increase to 16S rDNA, amplified production is reclaimed and checks order, sequencing result is carried out Blast analysis, found that with the bacterial strain of bacterial strain Fdp6 very high homology are all genus bacillus, homology more than 98%, and in conjunction with physiological and biochemical property, identify that it is subtilis.

Effect of the present invention

In flat band method, cultivate on the solid medium containing insoluble phosphate or organophosphorus by phosphate solubilizing bacteria, periphery of bacterial colonies produces larger molten phosphorus circle, it is 400.236 mg/L that subtilis of the present invention records its phosphorus decomposing effect through P-Mo blue spectrophotometry, illustrates that bacterial strain of the present invention has stronger phosphate solubilization.

Embodiment

The invention discloses a kind of efficient phosphate-solubilizing bacterium subtilis, those skilled in the art can use for reference present disclosure, and suitable improving technique parameter realizes.Special needs to be pointed out is, all similar replacements and change apparent to those skilled in the art, these are all deemed to be included in by invention.Subtilis of the present invention is described by the embodiment compared with specification, related personnel obviously can change methods and applications as herein described and suitable change and combination not breaking away from content of the present invention, spirit and scope, realizes and applies the technology of the present invention.

Below in conjunction with embodiment, set forth the present invention further.

embodiment 1 microorganism is from the separation soil sample

The Huang top chrysanthemum rhizosphere soil adopted back near the Hengshui Lake of Hebei, takes 10g soil 90mL sterilized water and mixes, and then dilutes therefrom getting 1mL sample 9mL sterilized water, carries out 6 times, be diluted to 10 with this ^-6, 10 ^-7, 10 ^-83 gradients, pipette bacteria suspension 100 microlitre of last three gradients, coat Meng Jinna inorganic phosphorus substratum (glucose 10 g, (NH ₄) ₂sO4 0.5 g, NaCl 0.3 g, KCl 0.3 g, FeSO47H2O 0.03 g, MnSO44H2O 0.03 g, MgSO47H2O 0.3 g, ground phosphate rock 10 g, yeast extract paste 0.4 g, agar 15 g, distilled water 1000 ml, pH 7.0 ~ 7.5) on flat board, with last diluent in contrast, cultivate at 28 DEG C, and every 24h observes once.Select without bacterium colony in contrast, and in diluent before this, grow the bacterial strain of bacterium colony, jump according to the feature such as colonial morphology, color and get single bacterium colony in liquid Meng Jinna inorganic phosphorus substratum and cultivate, and purifying is numbered.

embodiment 2phosphorus decomposing the screening of bacterial strain

In an aseptic environment, by all inoculation on Meng Jinna substratum, cultivate 7 days for 30 DEG C.Observe colony growth situation in flat board, filter out efficient phosphate-solubilizing bacterium according to generation phosphorus decomposing circle size.

the Sequencing and Characterization of the 16S rDNA of embodiment 3 bacterial strain and physiological and biochemical test qualification

Subtilis DNA extraction adopts conventional phenol method, and by bacterial universal primers amplification 16S rDNA sequence, primer sequence is 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT).PCR reaction system (50 μ L) is: 10 X PCR damping fluid 5 μ L, dNTP 4 μ L, each 1 μ L of primer, DNA profiling 2.5 μ L, Takara Taq enzyme 0.25 μ L, ultrapure water 36 μ L.Pcr amplification program is 94 DEG C of 3min; 94 DEG C of 1min, 52 DEG C of 1 min, 72 DEG C of 1.5 min, 30 circulations; 72 DEG C of 10 min.Amplified production is served Hai Sheng work bio tech ltd and is checked order.

By the 16S rDNA sequence inputting GenBank recorded, application BLAST software carries out homology search.Choose the 16S rDNA sequence of different strains and carry out tetraploid rice with known 16S rDNA in GenBank.

Homology search result is as follows:

This pcr amplification product is carried out in GenBank blast comparison result to show, 50 bacterial classifications of bacterial strain Fdp6 of the present invention and its very high homology are all bacillus, and its homology is all more than 99%.Table 1 is depicted as 10 high bacterial strains of the 16S rDNA homology of bacterial strain Fdp6.Bacterial strain physiological and biochemical index deducibility Fdp6 bacterial strain thus shown in associative list 2 belongs to subtilis.

Table 1 16S rDNA tetraploid rice

Serial ID	Bacterial strain	Homology
			AB740156.1	Bacillus subtilis gene for 16S rRNA, partial sequence, strain: Szi4-15	100%
KC121034.1	Bacillus sp. JN08 16S ribosomal RNA gene, partial sequence	100%
			JX390617.1	Bacillus subtilis strain NEHU.FNSRJ.113 16S ribosomal RNA gene, partial sequence	100%
JQ267474.1	Bacillus subtilis strain LY-001 16S ribosomal RNA gene, partial sequence >gb|JX849029.1| Bacillus sp. M7(2012) 16S ribosomal RNA gene, partial sequence	100%
			JQ023605.1	Bacillus methylotrophicus strain LZ043 16S ribosomal RNA gene, partial sequence	100%
JN400257.1	Bacillus subtilis strain WRL-101 16S ribosomal RNA gene, partial sequence	100%
			EU729126.1	Bacillus subtilis strain JSU-2 16S ribosomal RNA gene, partial sequence	100%
AM981259.1	Bacillus sp. NIOT-2 partial 16S rRNA gene, isolate NIOT-2	100%
			AB848923.1	Bacillus subtilis gene for 16S ribosomal RNA, partial sequence	99%

Preliminary Physiology and biochemistry qualification is carried out to the antagonistic bacterium of screening, comprise gram mensuration, catalase reaction, VP test, anaerobic growth, Starch Hydrolysis, 50 DEG C of growths and 6.5% NaCl growth test, described test method adopts the conventional methods of this kind of physiological and biochemical index of the mensuration of this area.

The Determination of Physiological And Biochemical Indices of table 2 bacterial strain

Testing index	Strain characteristics	Testing index	Strain characteristics
				Gram stain test	+	Indole test	-
MR tests	+	VP tests	-
				Catalase test	+	H 2S produces	-
Nitrate reduction test	-	Sugar alcohol fermentation test	-
				6.5% NaCl	+	Hydrolyzed starch is tested	-
The glycoxidative fermentation test of glucose	-

the preparation of embodiment 4 microorganism Bacillus subtilis microbial inoculum of the present invention

Be that the subtilis of CGMCC No. 8241 is cultivated in LB nutrient solution by deposit number, culture-liquid temp is 27 DEG C, and number of days is 5 days, and rotating speed is 200rpm, and pH value is 8.After fermentation culture, add the sucrose of 5%, then filter and regulate bacterium liquid cell count to be 10 ⁹individual/mL, i.e. obtained microorganism Bacillus subtilis microbial inoculum of the present invention.

embodiment 5 molybdenum antimony scandium colorimetric method for determining microorganism dissolving P capacity

In phosphorous solution, add ammonium molybdate, under certain acidity condition, it is yellow that phosphoric acid in solution and molybdic acid complexing form yellow phosphorus molybdenum heterozygosis acid one phosphorus molybdenum, then make reductive agent with xitix tartarize antimony potassium, phosphato-molybdic heteropolyacid can be made to change into stable blue solution (molybdenum blue), its shade and phosphorus content proportional, can colorimetric assay be carried out thus. measure the light absorption value of molybdenum blue at wavelength 700 nm place with spectrophotometer, with quantitative analysis phosphorus content.

The drafting of phosphorus typical curve

Draw 0.0,0.8,1.6,2.4,3.2,4.0 mL 5 mg/L phosphate standard solution successively and enter test tube, respectively add the anti-developer of 2 mL aluminium antimony, 20 mL are settled to distilled water, after shaking up standing 15-20 min, measure absorbancy under 700 nm " to take absorbancy as ordinate zou; take phosphorus concentration as X-coordinate, draw phosphorus typical curve ", now in each pipe, phosphorus concentration is respectively: 0.00,0.20,0.40,0.60,0.80,1.00 mg/L.

The mensuration of titanium pigment content in nutrient solution

Get 1 mL at insoluble inorganic phosphorus liquid nutrient medium (glucose 10 g, (NH ₄) ₂sO ₄0.5 g, NaCl 0.3 g, KCl 0.3 g, MgSO ₄7H ₂o 0.3 g, FeSO ₄7H ₂o 0.03 g, MnSO ₄h ₂o 0.03 g, Ca ₃(PO ₄) ₂5.0 g, be settled to 1000 mL, pH 7.0 ~ 7.5) in cultivate the thalline fermented liquid after 4d with centrifugal 10 min of 10000 g, supernatant liquor adds absorption 200 μ L and enters color board after suitably diluting, add aluminium antimony anti-developer 2 mL again, distilled water is settled to 20 mL, and after leaving standstill 15-20 min, measuring titanium pigment content under 700 nm is 400.236 mg/L.

A kind of efficient phosphate-solubilizing bacterium subtilis of the present invention and application thereof are described by concrete example, those skilled in the art can use for reference content of the present invention, the links such as appropriate change raw material, processing condition realize other object corresponding, its relevant change does not all depart from content of the present invention, all similar replacements and change will become apparent to those skilled in the art that and be all deemed to be included within scope of the present invention.

Claims (1)

1. a subtilis ( bacillus subtilis)the application of Fdp6 in phosphorus decomposing, described subtilis is deposited in China Committee for Culture Collection of Microorganisms's common micro-organisms center on September 24th, 2013, depositary institution address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, and deposit number is CGMCC No.8241.