CN103773709B - Bacillus subtilis with effect of efficiently dissolving phosphorus and application of bacillus subtilis - Google Patents

Bacillus subtilis with effect of efficiently dissolving phosphorus and application of bacillus subtilis Download PDF

Info

Publication number
CN103773709B
CN103773709B CN201310474439.3A CN201310474439A CN103773709B CN 103773709 B CN103773709 B CN 103773709B CN 201310474439 A CN201310474439 A CN 201310474439A CN 103773709 B CN103773709 B CN 103773709B
Authority
CN
China
Prior art keywords
bacillus subtilis
phosphorus
subtilis
effect
present
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201310474439.3A
Other languages
Chinese (zh)
Other versions
CN103773709A (en
Inventor
时翠平
霍静倩
赵斌
齐萌
张金林
董金皋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hebei Agricultural University
Original Assignee
Hebei Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hebei Agricultural University filed Critical Hebei Agricultural University
Priority to CN201310474439.3A priority Critical patent/CN103773709B/en
Publication of CN103773709A publication Critical patent/CN103773709A/en
Application granted granted Critical
Publication of CN103773709B publication Critical patent/CN103773709B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Abstract

The invention relates to a bacillus subtilis with the effect of efficiently dissolving phosphorus. The bacillus subtilis is preserved in the China General Microbiological Culture Collection Center and has the preservation NO. of CGMCCNo. 8241. The bacillus subtilis has the relatively high effect of dissolving the phosphorus, cannot pollute environment, and is ecological and safe. The efficient bacillus subtilis can be used independently, or used together with other organic and inorganic nutritional ingredients required by plants to be prepared into biological compound fertilizer, and which has the effects of increasing yield and improving quality.

Description

A kind of subtilis and application thereof with efficient phosphate-solubilizing effect
Technical field
The present invention relates to microorganism and biological fertilizer field, particularly relate to subtilis, specifically, the present invention relates to a kind of subtilis and application thereof of efficient phosphate-solubilizing effect.
Background technology
Phosphate fertilizer can promote plant flowers Bud polarization, early flowering result, promotes seedlings root growth and improves fruit quality.Execute phosphorus and can promote that various Metabolism of Normal carries out, growth and development of plants is good, improves winter resistance and the drought resistance of plant simultaneously.Because the metabolism of phosphorus and carbohydrate, protein and fat and three's phase co-conversion have relation, no matter all need phosphate fertilizer mainly with cultivation food crop, legume crop and oil crop.When lacking phosphorus, protein synthesis is obstructed, and new tenuigenin and nucleus are formed less, affect cell fission, poor growth, also few, branch or minimizing of tillering, and plant is short and small, and blade is dark green, and may be that Growth of Cells is slow, chlorophyll content improves relatively.Certain plants leaf takes on a red color or purple sometimes.Because lack phosphorus to hinder sugar transport, also oneself tire out a large amount of sugars, be conducive to the formation of yellow pigment glycosides.When lacking phosphorus, flowering period and ripening stage all postpone, and output reduces, and resistance weakens.But China has the arable soil of 74% to lack phosphorus, in soil, the phosphorus of more than 95% is invalid form, plant is difficult to directly absorb, and in addition, a large amount of uses the adverse consequencess such as chemical fertilizer obviously causes soil compaction, the decline of soil water-retaining power, grassland degeneration, desertification serious.Therefore, the utilization ratio improving phosphorus is the focus that agronomy, soil science, ecotope and microbiological research person pay close attention to always.
People start the relation noticed between microorganism and soil phosphorus in 20 beginnings of the century.In Sackett(1908) finding that the mixture of some insolublies is manured into soil, can be applied by as phosphorus source, they filter out 50 strain bacteriums from soil, and wherein 36 strains define macroscopic molten phosphorus circle on flat board.Gerretsen in 1948 finds that plant applies insoluble phosphate fertilizer, after inoculation soil microorganisms, facilitates the growth of plant, increases the absorption of phosphorus.He has isolated these microorganisms, finds that these microorganisms can help the dissolving of ground phosphate rock.From then on, many scientists are devoted to the research of phosphate solubilizing bacteria, in succession report many microorganisms and have phosphate solubilization.
Present inventor is through concentrated research for many years, and from plant rhizosphere soil, be separated to the bacillus subtilis strain that a strain is new, this bacterial strain has stronger phosphate solubilization, invalid phosphorus effectively can be transformed into available phosphorus.
Summary of the invention
The object of the present invention is to provide the bacterial strain of a kind of new subtilis, described bacterial strain has good phosphate solubilization.
Subtilis of the present invention (Bacillus subtilis) is deposited in China Committee for Culture Collection of Microorganisms's common micro-organisms center on September 24th, 2013, depositary institution address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, and deposit number is CGMCC No.8241.
Further, the invention provides the purposes of above-mentioned subtilis in phosphorus decomposing.
Further, subtilis of the present invention can make microbiobacterial agent, cultivates in LB nutrient solution by described bacterial strain, and culture temperature is 27 DEG C, and cultivated days is 5 days, and rotating speed is 200 rpm, and bacterium liquid cell count is adjusted to 10 after filtering by nutrient solution 9individual/mL, i.e. obtained microorganism Bacillus subtilis microbial inoculum of the present invention.
Subtilis provided by the present invention is separated and obtains from plant rhizosphere soil, its laboratory called after bacterial strain Fdp6.
Bacterial strain Fdp6 is rounded at the upper bacterium colony of LB solid medium (substratum consists of: Tryptones 10g/L, yeast extract 5g/L, sodium-chlor 10g/L, agar 15g/L), and edge is irregular, oyster white, opaque, and surface irregularity has fold, matt.Be cultured to 30h, thalline all exists with the form of hypopus gemma.Bacterium colony is light yellow.Microscopic examination thalline is unicellular, shaft-like, single raw or twin, sometimes becomes chain.Gram-positive, gemma is oval.VP reaction, Starch Hydrolysis test, nitrate reduction reaction, Citrate trianion utilization, gelatine liquefication are the positive; The utilization of the test of phenylpropionic acid desaminase, M.R., urine enzyme test, propionic salt is feminine gender, can grow in containing the LB substratum of 6.5% NaCl.16S rDNA gene specific primer is utilized to increase to 16S rDNA, amplified production is reclaimed and checks order, sequencing result is carried out Blast analysis, found that with the bacterial strain of bacterial strain Fdp6 very high homology are all genus bacillus, homology more than 98%, and in conjunction with physiological and biochemical property, identify that it is subtilis.
Effect of the present invention
In flat band method, cultivate on the solid medium containing insoluble phosphate or organophosphorus by phosphate solubilizing bacteria, periphery of bacterial colonies produces larger molten phosphorus circle, it is 400.236 mg/L that subtilis of the present invention records its phosphorus decomposing effect through P-Mo blue spectrophotometry, illustrates that bacterial strain of the present invention has stronger phosphate solubilization.
Embodiment
The invention discloses a kind of efficient phosphate-solubilizing bacterium subtilis, those skilled in the art can use for reference present disclosure, and suitable improving technique parameter realizes.Special needs to be pointed out is, all similar replacements and change apparent to those skilled in the art, these are all deemed to be included in by invention.Subtilis of the present invention is described by the embodiment compared with specification, related personnel obviously can change methods and applications as herein described and suitable change and combination not breaking away from content of the present invention, spirit and scope, realizes and applies the technology of the present invention.
Below in conjunction with embodiment, set forth the present invention further.
embodiment 1 microorganism is from the separation soil sample
The Huang top chrysanthemum rhizosphere soil adopted back near the Hengshui Lake of Hebei, takes 10g soil 90mL sterilized water and mixes, and then dilutes therefrom getting 1mL sample 9mL sterilized water, carries out 6 times, be diluted to 10 with this -6, 10 -7, 10 -83 gradients, pipette bacteria suspension 100 microlitre of last three gradients, coat Meng Jinna inorganic phosphorus substratum (glucose 10 g, (NH 4) 2sO4 0.5 g, NaCl 0.3 g, KCl 0.3 g, FeSO47H2O 0.03 g, MnSO44H2O 0.03 g, MgSO47H2O 0.3 g, ground phosphate rock 10 g, yeast extract paste 0.4 g, agar 15 g, distilled water 1000 ml, pH 7.0 ~ 7.5) on flat board, with last diluent in contrast, cultivate at 28 DEG C, and every 24h observes once.Select without bacterium colony in contrast, and in diluent before this, grow the bacterial strain of bacterium colony, jump according to the feature such as colonial morphology, color and get single bacterium colony in liquid Meng Jinna inorganic phosphorus substratum and cultivate, and purifying is numbered.
embodiment 2phosphorus decomposing the screening of bacterial strain
In an aseptic environment, by all inoculation on Meng Jinna substratum, cultivate 7 days for 30 DEG C.Observe colony growth situation in flat board, filter out efficient phosphate-solubilizing bacterium according to generation phosphorus decomposing circle size.
the Sequencing and Characterization of the 16S rDNA of embodiment 3 bacterial strain and physiological and biochemical test qualification
Subtilis DNA extraction adopts conventional phenol method, and by bacterial universal primers amplification 16S rDNA sequence, primer sequence is 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT).PCR reaction system (50 μ L) is: 10 X PCR damping fluid 5 μ L, dNTP 4 μ L, each 1 μ L of primer, DNA profiling 2.5 μ L, Takara Taq enzyme 0.25 μ L, ultrapure water 36 μ L.Pcr amplification program is 94 DEG C of 3min; 94 DEG C of 1min, 52 DEG C of 1 min, 72 DEG C of 1.5 min, 30 circulations; 72 DEG C of 10 min.Amplified production is served Hai Sheng work bio tech ltd and is checked order.
By the 16S rDNA sequence inputting GenBank recorded, application BLAST software carries out homology search.Choose the 16S rDNA sequence of different strains and carry out tetraploid rice with known 16S rDNA in GenBank.
Homology search result is as follows:
This pcr amplification product is carried out in GenBank blast comparison result to show, 50 bacterial classifications of bacterial strain Fdp6 of the present invention and its very high homology are all bacillus, and its homology is all more than 99%.Table 1 is depicted as 10 high bacterial strains of the 16S rDNA homology of bacterial strain Fdp6.Bacterial strain physiological and biochemical index deducibility Fdp6 bacterial strain thus shown in associative list 2 belongs to subtilis.
Table 1 16S rDNA tetraploid rice
Serial ID Bacterial strain Homology
AB740156.1 Bacillus subtilis gene for 16S rRNA, partial sequence, strain: Szi4-15 100%
KC121034.1 Bacillus sp. JN08 16S ribosomal RNA gene, partial sequence 100%
JX390617.1 Bacillus subtilis strain NEHU.FNSRJ.113 16S ribosomal RNA gene, partial sequence 100%
JQ267474.1 Bacillus subtilis strain LY-001 16S ribosomal RNA gene, partial sequence >gb|JX849029.1| Bacillus sp. M7(2012) 16S ribosomal RNA gene, partial sequence 100%
JQ023605.1 Bacillus methylotrophicus strain LZ043 16S ribosomal RNA gene, partial sequence 100%
JN400257.1 Bacillus subtilis strain WRL-101 16S ribosomal RNA gene, partial sequence 100%
EU729126.1 Bacillus subtilis strain JSU-2 16S ribosomal RNA gene, partial sequence 100%
AM981259.1 Bacillus sp. NIOT-2 partial 16S rRNA gene, isolate NIOT-2 100%
AB848923.1 Bacillus subtilis gene for 16S ribosomal RNA, partial sequence 99%
Preliminary Physiology and biochemistry qualification is carried out to the antagonistic bacterium of screening, comprise gram mensuration, catalase reaction, VP test, anaerobic growth, Starch Hydrolysis, 50 DEG C of growths and 6.5% NaCl growth test, described test method adopts the conventional methods of this kind of physiological and biochemical index of the mensuration of this area.
The Determination of Physiological And Biochemical Indices of table 2 bacterial strain
Testing index Strain characteristics Testing index Strain characteristics
Gram stain test + Indole test -
MR tests + VP tests -
Catalase test + H 2S produces -
Nitrate reduction test - Sugar alcohol fermentation test -
6.5% NaCl + Hydrolyzed starch is tested -
The glycoxidative fermentation test of glucose -
the preparation of embodiment 4 microorganism Bacillus subtilis microbial inoculum of the present invention
Be that the subtilis of CGMCC No. 8241 is cultivated in LB nutrient solution by deposit number, culture-liquid temp is 27 DEG C, and number of days is 5 days, and rotating speed is 200rpm, and pH value is 8.After fermentation culture, add the sucrose of 5%, then filter and regulate bacterium liquid cell count to be 10 9individual/mL, i.e. obtained microorganism Bacillus subtilis microbial inoculum of the present invention.
embodiment 5 molybdenum antimony scandium colorimetric method for determining microorganism dissolving P capacity
In phosphorous solution, add ammonium molybdate, under certain acidity condition, it is yellow that phosphoric acid in solution and molybdic acid complexing form yellow phosphorus molybdenum heterozygosis acid one phosphorus molybdenum, then make reductive agent with xitix tartarize antimony potassium, phosphato-molybdic heteropolyacid can be made to change into stable blue solution (molybdenum blue), its shade and phosphorus content proportional, can colorimetric assay be carried out thus. measure the light absorption value of molybdenum blue at wavelength 700 nm place with spectrophotometer, with quantitative analysis phosphorus content.
The drafting of phosphorus typical curve
Draw 0.0,0.8,1.6,2.4,3.2,4.0 mL 5 mg/L phosphate standard solution successively and enter test tube, respectively add the anti-developer of 2 mL aluminium antimony, 20 mL are settled to distilled water, after shaking up standing 15-20 min, measure absorbancy under 700 nm " to take absorbancy as ordinate zou; take phosphorus concentration as X-coordinate, draw phosphorus typical curve ", now in each pipe, phosphorus concentration is respectively: 0.00,0.20,0.40,0.60,0.80,1.00 mg/L.
The mensuration of titanium pigment content in nutrient solution
Get 1 mL at insoluble inorganic phosphorus liquid nutrient medium (glucose 10 g, (NH 4) 2sO 40.5 g, NaCl 0.3 g, KCl 0.3 g, MgSO 47H 2o 0.3 g, FeSO 47H 2o 0.03 g, MnSO 4h 2o 0.03 g, Ca 3(PO 4) 25.0 g, be settled to 1000 mL, pH 7.0 ~ 7.5) in cultivate the thalline fermented liquid after 4d with centrifugal 10 min of 10000 g, supernatant liquor adds absorption 200 μ L and enters color board after suitably diluting, add aluminium antimony anti-developer 2 mL again, distilled water is settled to 20 mL, and after leaving standstill 15-20 min, measuring titanium pigment content under 700 nm is 400.236 mg/L.
A kind of efficient phosphate-solubilizing bacterium subtilis of the present invention and application thereof are described by concrete example, those skilled in the art can use for reference content of the present invention, the links such as appropriate change raw material, processing condition realize other object corresponding, its relevant change does not all depart from content of the present invention, all similar replacements and change will become apparent to those skilled in the art that and be all deemed to be included within scope of the present invention.

Claims (1)

1. a subtilis ( bacillus subtilis)the application of Fdp6 in phosphorus decomposing, described subtilis is deposited in China Committee for Culture Collection of Microorganisms's common micro-organisms center on September 24th, 2013, depositary institution address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, and deposit number is CGMCC No.8241.
CN201310474439.3A 2013-10-12 2013-10-12 Bacillus subtilis with effect of efficiently dissolving phosphorus and application of bacillus subtilis Expired - Fee Related CN103773709B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310474439.3A CN103773709B (en) 2013-10-12 2013-10-12 Bacillus subtilis with effect of efficiently dissolving phosphorus and application of bacillus subtilis

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310474439.3A CN103773709B (en) 2013-10-12 2013-10-12 Bacillus subtilis with effect of efficiently dissolving phosphorus and application of bacillus subtilis

Publications (2)

Publication Number Publication Date
CN103773709A CN103773709A (en) 2014-05-07
CN103773709B true CN103773709B (en) 2015-05-20

Family

ID=50566476

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310474439.3A Expired - Fee Related CN103773709B (en) 2013-10-12 2013-10-12 Bacillus subtilis with effect of efficiently dissolving phosphorus and application of bacillus subtilis

Country Status (1)

Country Link
CN (1) CN103773709B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104195078B (en) * 2014-08-22 2017-01-11 西安文理学院 Bacillus subtilis
CN104263679B (en) * 2014-09-03 2016-08-24 南京聚肽高科农业有限公司 A kind of efficient phosphate-solubilizing bacterium and application thereof
CN112625947B (en) * 2020-12-16 2021-08-03 江苏省中国科学院植物研究所 Bacillus subtilis capable of dissolving phosphorus strongly, carbon-based microbial compound fertilizer thereof and application of bacillus subtilis

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101899405B (en) * 2010-01-20 2012-04-25 辛伟成 Bacillus subtilis GU and application in preparing efficient biological compound phosphate fertilizer thereof
CN102061273B (en) * 2010-11-05 2012-09-12 南开大学 Bacillus subtilis with phosphate-solubilizing effect and application thereof
CN102399713B (en) * 2011-09-22 2013-01-30 华南农业大学 Bacillus subtilis HL-1 and application thereof in respect of soil phosphate dissolving

Also Published As

Publication number Publication date
CN103773709A (en) 2014-05-07

Similar Documents

Publication Publication Date Title
CN102876608B (en) Bacillus amyloliquefaciens and application thereof
CN103396971B (en) Burkholderia cepacia and application thereof
CN102399713B (en) Bacillus subtilis HL-1 and application thereof in respect of soil phosphate dissolving
CN106167776A (en) A kind of can bacillus cereus (Bacillus cereus) TH 35 of heavy metal cadmium and application thereof in activating soil
CN106222096B (en) One plant of Tabin aspergillus bacterium CT1 and its application in terms of the phosphorus decomposing of salt-soda soil
CN103773709B (en) Bacillus subtilis with effect of efficiently dissolving phosphorus and application of bacillus subtilis
CN103642734A (en) Microbacterium maritypicum and application thereof in preventing sugar beet disease-causing organisms
CN101381685A (en) Preparation method of tobacco black shank inoculum
CN103320371A (en) Bacterium having growth-promoting effect in synergism with AM fungus and application of bacterium in vegetable growth promoting
CN105400717A (en) Bacterial strain HBRM-16 capable of promoting growth of roots of rubber tree and application of bacterial strain HBRM-16
CN110396485B (en) Brevibacillus brevis for producing auxin and application thereof
CN110396492A (en) One plant of walnut branch-rot antagonistic bacterium and its application
CN104593301A (en) Bacillus muralis G1 as well as preparation method and application thereof
CN109321500B (en) Bacillus amyloliquefaciens strain and application thereof in prevention and treatment of camellia oleifera anthracnose disease
CN109439582B (en) Bacillus megaterium grown in chrysanthemum morifolium and application thereof
CN104673715A (en) Enteric bacilli with fixing effect on cadmium capable of promoting plant growth and application of enteric bacilli
CN103114057B (en) The cellulosic Pseudomonas mendocina of one high-efficiency degradation
CN106591173A (en) Bacillus flexus HL-37 capable of activating soil heavy metal cadmium, and applications thereof
CN103805518A (en) Efficient phosphorus dissolving aspergillus niger and application thereof
CN110684696B (en) Bacillus megaterium QZY-3 and application thereof
CN112280703A (en) Method for screening, identifying and biocontrol activity of acidophilic PGPR strain
CN106190871A (en) A kind of method that compound thread fungal organism drip leaching with straw as carbon source processes heavy-metal contaminated soil
CN109762766B (en) Bacterium capable of adsorbing heavy metals, dissolving phosphorus and benefiting plants and application thereof
Wafula et al. Isolation and characterization of bacillus species from soil in Ngere tea catchment area of Murang’a county, Kenya
CN108165506B (en) Streptomyces aureoflavus and application thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20150520

Termination date: 20181012

CF01 Termination of patent right due to non-payment of annual fee