CN103305481B - Method for producing laccase by fermenting cerrena unicolor - Google Patents
Method for producing laccase by fermenting cerrena unicolor Download PDFInfo
- Publication number
- CN103305481B CN103305481B CN201310263157.9A CN201310263157A CN103305481B CN 103305481 B CN103305481 B CN 103305481B CN 201310263157 A CN201310263157 A CN 201310263157A CN 103305481 B CN103305481 B CN 103305481B
- Authority
- CN
- China
- Prior art keywords
- gsm
- cerrena unicolor
- same colour
- substratum
- bacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention discloses a method for producing laccase by fermenting cerrena unicolor. The method comprises the steps of culturing cerrena unicolor in a liquid medium and collecting fermentation liquid or/and a mycelium, wherein the strain number of cerrena unicolor is GSM-01 and the collection number is CGMCC No.7713. Cerrena unicolor with strain number of GSM-01 and collection number of CGMCC No.7713 is fermented in 1.0mmol/L of Cu<2+> medium for 192 hours at 25 DEG C to obtain fermentation liquid with extracellular laccase yield of 2855.00+/-41.63U/mL.
Description
Technical field
The present invention relates to a kind of method that peristome bacterium of fermenting produces laccase.
Background technology
Whiterot fungi belongs to Basidiomycota (Basidiomycota), has its distinctive Ligninolytic Enzymes, saprophytic timber or trees because of it, cause wooden bleach rot and this name.At present, the whiterot fungi of most study has: Corilus versicolor Quel. (Coliolus versicolor), Phanerochaete chrysosporium (Phanerochaete chrysosporium), variable color bolt bacterium (Trametes versicolor), penetrate arteries and veins bacterium (Phlebia radiata), bright red samguineus (Pycnoporus cinnabarinus), Pleurotus sajor-caju (Pleurotus pulm onarius), Coriolus Versicolor (Trametes versicolor), oyster cap fungus (Pleurotus) etc.The secreted lignin-degrading enzymes of whiterot fungi mainly contains 3 kinds, i.e. xylogen peroxidase, manganese peroxidase and laccase.
Laccase (Laccase is called for short Lac) is a kind of polyphenol oxides of cupric, and people are finding in the secretory product of lacquer tree, in succession in some higher fungies, plant, insect and bacterium, find this kind of enzyme again thereafter.Utilize the organic compound that laccase can degrading chlorophenol class, alleviate and environment has been caused to severe contamination and destruction because of the excessive chloride aromatic compounds agricultural chemicals of use; Produce laccase bacterium dyestuff is had to stronger decoloring ability, this class fungi can be degraded into CO by kinds of artificial dyestuff thoroughly by the enzyme system of self secretion
2and H
2o; Laccase can be bleached paper pulp, the release of toxic compounds while having avoided utilizing chlorine to bleach, the pollution level of reduction environment; In addition, in the production technique of paper pulp, also can use laccase.Adopt optionally lignin degrading production paper pulp of laccase, not only can save equipment and energy consumption, the production cycle of paper pulp is shortened, thereby reduce production costs, will bring good economic benefit and social benefit to paper industry like this; In food production process, laccase is mainly used in the color and luster of beverage and the control of clarity, and polyphenols can be oxidized to polyphenol oxides, thereby makes it that polymerization occur, and the macrobead of formation can be by membrane retention, to reach the object that beverage is purified.The strong specificity of utilizing this reaction, pollution index is low, obtains the fruit juice lighter color of clarification, and the advantage such as stable, can well solve the muddy problem of secondary in fruit juice processing.
The application prospect of laccase is boundless.Along with the development of scientific research, people can have more understanding to mechanism, enzyme active center and the mechanism of action of white rot class fungi enzyme.But still there are many problems, and as on the low side in bacterial strain synthetic lacquer enzyme level, thalli growth is slower, and enzyme catalysis efficiency is low, is unsuitable for suitability for industrialized production etc.Therefore, strengthen the interdisciplinary research exploitation laccase high expression level bacterial strains such as biology, chemical industry, food, agricultural, explore the anabolic factor of influence of laccase and action rule thereof, new Application Areas and the application approach of developing laccase, will have far-reaching scientific meaning and huge economic benefit.
Summary of the invention
A technical problem to be solved by this invention is to provide the method for the fermentative production of laccase that a kind of laccase output is higher.
The method of fermentative production of laccase provided by the present invention, be included in and in liquid nutrient medium, cultivate peristome bacterium of the same colour (Cerrena unicolor), collect fermented liquid or/and mycelial step, the bacterial strain number of described peristome bacterium of the same colour (Cerrena unicolor) is GSM-01, and it is numbered CGMCC No.7713 registering on the books of China Committee for Culture Collection of Microorganisms's common micro-organisms center.
In aforesaid method, the culture temperature that described cultivation adopts can be 25 DEG C-36 DEG C, as 25 DEG C; Incubation time can be 48-192 hour, as 192 hours.
In aforesaid method, Cu in described liquid nutrient medium
2+concentration can be 1.0-2.0mmol/L.
In aforesaid method, every liter of described liquid nutrient medium is to add CuSO in PD substratum
4solution is to Cu
2+concentration is the liquid that 1.0-2.0mmol/L obtains; Every liter of described PD substratum is prepared as follows: potato 200g, and glucose 20g, adjust pH 7.0-7.2 water is settled to 1000mL.
In an embodiment of the invention, Cu in described liquid nutrient medium
2+concentration is 1.0mmol/L.Described incubation time is 192 hours.
Liquid nutrient medium for peristome bacterium of the same colour (Cerrena unicolor) the product laccase that ferments used in aforesaid method also belongs to protection scope of the present invention.
The peristome bacterium of the same colour (Cerrena unicolor) that is used for fermenting produces the liquid nutrient medium of laccase, and every liter of described liquid nutrient medium is to add CuSO in PD substratum
4solution is to Cu
2+concentration is the liquid that 1.0-2.0mmol/L obtains; Every liter of described PD substratum is prepared as follows: potato 200g, and glucose 20g, adjust pH 7.0-7.2 water is settled to 1000mL;
The bacterial strain number of described peristome bacterium of the same colour (Cerrena unicolor) is GSM-01, and it is numbered CGMCC No.7713 registering on the books of China Committee for Culture Collection of Microorganisms's common micro-organisms center.
In aforesaid liquid substratum, Cu in described liquid nutrient medium
2+concentration is 1.0mmol/L.
1.0-2.0mmol/L Cu
2+solution also belongs to protection scope of the present invention in the application improving in peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 product laccase.
In above-mentioned application, described 1.0-2.0mmol/L Cu
2+solution specifically can be 1.0Cu
2+solution.Described Cu
2+solution specifically can be CuSO
4solution.
Experiment showed, that peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 is at 1.0mmol/L Cu
2+substratum (1.0mmol/L Cu
2+substratum is to add CuSO in PD substratum
4solution is to Cu
2+final concentration is the liquid that 1.0mmol/L obtains) in outside 25 DEG C of fermentations born of the same parents of peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 of 192 hours laccase output be 2855.00 ± 41.63U/mL fermented liquid.
biomaterial information
Classification And Nomenclature: peristome bacterium of the same colour (Cerrena unicolor)
Strain number: GSM-01
Preservation mechanism: China Committee for Culture Collection of Microorganisms's common micro-organisms center
Preservation mechanism is called for short: CGMCC
Address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City
Preservation date: on 06 05th, 2013
The preservation center numbering of registering on the books: CGMCC No.7713
Describe the present invention in detail below in conjunction with specific embodiment, these embodiment are for understanding instead of restriction the present invention.
Brief description of the drawings
Below, describe by reference to the accompanying drawings embodiment of the present invention in detail, wherein:
Fig. 1 is Cu
2+on the impact of liquid fermenting peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 laccase output.
Fig. 2 is the culture medium culturing dull and stereotyped photo of 5 day of peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 in different carbon sources.
Fig. 3 is the culture medium culturing dull and stereotyped photo of 5 day of peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 in different nitrogen sources.
Fig. 4 is the culture medium culturing dull and stereotyped photo of 10 day of peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 in different carbon-nitrogen ratios.
Fig. 5 is the culture medium culturing dull and stereotyped photo of 5 day of peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 in different somatomedins.
Fig. 6 is the dull and stereotyped photo that peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 cultivates in differing temps 3 days.
Fig. 7 is the dull and stereotyped photo that peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 cultivates at different pH 4 days.
Embodiment
Below in conjunction with embodiment, the present invention is further described in detail, the embodiment providing is only in order to illustrate the present invention, instead of in order to limit the scope of the invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.Material, reagent etc. used in following embodiment, if no special instructions, all can obtain from commercial channels.
Substratum used in following embodiment is as follows:
PDA substratum
Potato 200g, glucose 20g, agar 20g, pH value 7.0-7.2, is settled to 1000mL with distilled water.By peeling potatoes, be cut into small pieces, to put into 1000ml water and boil 30min, four layers of filtered through gauze, collect filtrate.Dissolve in glucose and agar, moisturizing is to 1000ml, pH value 7.0-7.2.121 DEG C of moist heat sterilization 30min.Be mainly used in strain separating and preservation.
PD substratum
Potato 200g, glucose 20g, pH value 7.0-7.2, is settled to 1000mL with distilled water.Peeling potatoes, cuts fritter, puts into 1000ml left and right water and boils 30min, and four layers of filtered through gauze, collect filtrate.Dissolve in glucose, moisturizing is to 1000ml, pH value 7.0-7.2.121 DEG C of moist heat sterilization 30min.Be mainly used in the experiment of mycelium liquid fermentation culture.
Basic medium
Glucose 20g, soy peptone 2g, potassium primary phosphate 1g, magnesium sulfate 0.5g, vitamins B
110mg, agar 20g, pH value 7.0-7.2, is settled to l000mL with distilled water.Reagent is mixed with to solution.121 DEG C of moist heat sterilization 30min.Be mainly used in the experiment of mycelium optimal culture condition.Wherein, the carbon content of 20g glucose is 8g, and the nitrogen content of 2g soy peptone is 0.4g, and carbon-nitrogen ratio is 20:1.Enriched medium
Glucose 20g, soy peptone 2g, potato 200g, magnesium sulfate 0.5g, potassium primary phosphate 1g, vitamins B
110mg, agar 20g, pH value 7.0-7.2, is settled to l000mL with distilled water.Peeling potatoes, cuts fritter, puts into 1000mL left and right water and boils 30min, and four layers of filtered through gauze, collect filtrate.Dissolve in other solution such as glucose, soy peptone, moisturizing is to 1000mL, pH value 7.0-7.2.121 DEG C of moist heat sterilization 30min.Be mainly used in the experiment of mycelium optimal culture condition.
The Isolation and Identification of embodiment 1, peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713
1, the separation of peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713
Take the fungus sporophore on the little wax of green plants (Ligustrum sinense) trunk between 2, No. 3 office buildings of Beijing Agricultural College, utilize separate tissue to obtain 2 strain pure culture bacterial strains, numbering is respectively GSM-01 and GSM-10.
2, the qualification of peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713
Respectively taking the genomic dna of bacterial strain GSM-01 and GSM-10 as template, by ITS1 (5'TCCGTAGGTGAACCTGCGG3') and ITS4 (5'TCCTCCGCTTATTGATATGC3') pcr amplification ITS sequence, bacterial strain GSM-01 increase ITS sequence as SEQ ID No.1, bacterial strain GSM-10 increase ITS sequence as SEQ ID No.2.The consistence of bacterial strain GSM-01 and GSM-10 is 98.26%.
The sporophore shape feature of bacterial strain GSM-01 and GSM-10 is all as follows: sporophore is less, imbricate is arranged, bacteria cover diameter 4-8cm, and thick about 0.5cm, fan-shaped, conchoidal or calm to warp, keratin, fresh is surface white, transfers yellow-white after maturation to.
The morphological specificity of bacterial strain GSM-01 and GSM-10 is all as follows: mycelia is pure white, dense, produces abundant white aerial hyphae when test tube is cultivated, and after thalline is aging, is light yellow.
According to sporophore shape and Molecular Identification feature, bacterial strain GSM-01 and GSM-10 are all accredited as to peristome bacterium of the same colour (Cerrena unicolor).Bacterial strain GSM-01 has been preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC) on 06 05th, 2013, the preservation center numbering of registering on the books: CGMCC No.7713.Below this bacterial strain is called to peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713.The ITS sequence of bacterial strain GSM-10 has been submitted GenBank GenBank, its GenBank Accession Number JQ798288 on 06 11st, 2012.Hereinafter this bacterial strain is called to peristome bacterium of the same colour (Cerrena unicolor) GSM-10.
Embodiment 2, peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 and peristome bacterium of the same colour (Cerrena unicolor) GSM-10 liquid fermenting produce enzyme characteristic research
1, liquid fermenting
Peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 and peristome bacterium of the same colour (Cerrena unicolor) GSM-10 are inoculated in separately respectively in PD substratum, 25 DEG C, 180rpm(rotation radius 20mm) shaking culture 5d, as seed liquor; The volume of inoculating content 100ml PD substratum taking 5% (v/v) inoculum size is in the triangular flask of 500ml, 25 DEG C, 180rpm(rotation radius 20mm) shaking culture 6d, the centrifugal 15min of 12000rpm at 4 DEG C, collecting precipitation obtains mycelium, collect supernatant liquor and obtain fermented liquid, the mycelium obtaining is ground to form to homogenate for subsequent use.Obtain respectively peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 mycelium, peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 fermented liquid, peristome bacterium of the same colour (Cerrena unicolor) GSM-10 mycelium and peristome bacterium of the same colour (Cerrena unicolor) GSM-10 fermented liquid, respectively as laccase activity testing sample.Above-mentioned experiment repeats 3 times, and each repeated using 100ml PD substratum ferments.
2, laccase activity is measured
Peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 mycelium and fermented liquid that step 1 is obtained, peristome bacterium of the same colour (Cerrena unicolor) GSM-10 mycelium and fermented liquid carry out respectively laccase activity mensuration by the following method:
Laccase activity adopts ABTS method.Using ABTS as reaction substrate.Reaction system is 150 μ l, comprises 5 μ l testing samples and 145 μ L2,2-connection nitrogen-bis-(3-ethyl-benzothiazole-6-sulfonic acid) di-ammonium salts (ABTS) solution (0.5mg/ml, with the sodium acetate buffer solution preparation of 10mM pH4.6).Control tube is used through the sample of deactivation in advance and replaces testing sample, and all the other conditions are identical.37 DEG C of water-bath 5min, survey the light absorption value at 420nm place immediately.Enzymic activity definition: the required enzyme amount of every min catalysis 1 μ mol ABTS is defined as 1 enzyme activity unit (U).
Experimental result is as shown in table 1, the laccase activity that shows every milliliter of fermented liquid of peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 is 965.42 ± 13.71U, every mg(weight in wet base) mycelial laccase activity is 2822.71 ± 312.33U; The laccase activity of peristome bacterium of the same colour (Cerrena unicolor) every milliliter of fermented liquid of GSM-10 is 792.50 ± 32.27U, every mg(weight in wet base) mycelial laccase activity is 2142.87 ± 196.20U.The laccase production ability that peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 is described is 1.22 times of peristome bacterium of the same colour (Cerrena unicolor) GSM-10.Therefore select peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 to carry out the research of fermentation condition and the research of growth characteristics.
Table 1. peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 and peristome bacterium of the same colour (Cerrena unicolor) GSM-10 laccase production ability
Embodiment 3, liquid fermenting peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 produce laccase
The present embodiment has been tested five kinds of liquid fermentation mediums, is respectively 0mmol/L Cu
2+substratum, 1.0mmol/L Cu
2+substratum, 2.0mmol/L Cu
2+substratum, 5.0mmol/L Cu
2+substratum and 10mmol/L Cu
2+substratum.0mmol/L Cu
2+substratum is PD substratum.1.0mmol/L Cu
2+substratum is to add 1.0mol/L CuSO in PD substratum
4solution is to Cu
2+final concentration is the liquid that 1.0mmol/L obtains.2.0mmol/L Cu
2+substratum is to add 1.0mol/L CuSO in PD substratum
4solution is to Cu
2+final concentration is the liquid that 2.0mmol/L obtains.5.0mmol/L Cu
2+substratum is to add 1.0mol/L CuSO in PD substratum
4solution is to Cu
2+final concentration is the liquid that 5.0mmol/L obtains.10mmol/L Cu
2+substratum is to add 1.0mol/L CuSO in PD substratum
4solution is to Cu
2+final concentration is the liquid that 10mmol/L obtains.
Peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 is inoculated in PD substratum to 25 DEG C, 180rpm(rotation radius 20mm) shaking culture 5d, as seed liquor.With 5% (v/v) inoculum size 0mmol/L Cu of accessing content 100ml respectively
2+substratum, 1.0mmol/L Cu
2+substratum, 2.0mmol/L Cu
2+substratum, 5.0mmol/L Cu
2+substratum and 10mmol/L Cu
2+the volume of substratum is in 500ml triangular flask.At 25 DEG C, 180rpm(rotation radius 20mm) shaking culture carries out liquid fermenting.In inoculation the 48th, 96,144 and 192h, every kind of substratum got 3 bottles of fermenting cultures, and the centrifugal 15min of 12000rpm at 4 DEG C, collects supernatant liquor and obtain fermented liquid, measures the laccase activity of fermented liquid according to the method for embodiment 2.Three repetitions are established in experiment.
Result as shown in Figure 1, shows the Cu of 1.0mmol/L-2.0mmol/L
2+improve the outer laccase output of born of the same parents of peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713, the Cu of 10mmol/L
2+greatly reduce the outer laccase output of born of the same parents of peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713.Wherein, fermentation 48-192h, 1.0mmol/L Cu
2+significantly improve the outer laccase output of born of the same parents of peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713, the outer laccase output of born of the same parents of peristome bacterium of the same colour (Cerrena unicolor) the GSM-01CGMCC No.7713 of fermentation 192h is 2855.00 ± 41.63U/mL fermented liquid, for not adding in the same time Cu
2+live (673.61 ± 18.49U/mL fermented liquid) 4.24 times of PD substratum fermentation broth enzyme.Peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 is not adding Cu
2+pD substratum in the outer laccase output of the born of the same parents of fermenting 144 hours the highest, be 965.42 ± 13.71U/mL fermented liquid.
Embodiment 4, peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 solid culture condition optimizing
1, test materials
Substratum: PDA substratum, PD substratum, basic medium, enriched medium, form the same.
2, test reagent and instrument
(1) test reagent
Glucose, agar, distilled water, soy peptone, potassium primary phosphate, magnesium sulfate, vitamins B
1, sucrose, maltose, lactose, starch, sorbyl alcohol, N.F,USP MANNITOL and Xylo-Mucine, yeast soaks powder, beef extract, ammonium nitrate, ammonium sulfate, urea, analysis for soybean powder and glycine.
(2) test apparatus
CPA224S analytical balance Germany Sai Duolisi
Xuanwu District, table balance Beijing balance factory
Orion company of the pH meter U.S.
Ya Tai Cologne, Bechtop Beijing
Constant incubator HuaPu reaches instrument manufacturing factory
SANYO company of high-pressure steam sterilizing pan Japan
3, test method
(1) preservation of bacterial classification and cultivation
With aseptic technique, peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 is inoculated in to dull and stereotyped PDA substratum central authorities, in 25 DEG C of constant incubators, cultivates.The mycelium inoculation obtaining, in inclined-plane PDA substratum, is covered with at latter 4 DEG C to lucifuge preservation for subsequent use.
(2) impact of different carbon sources on mycelial growth rate
9 kinds of processing are established in experiment, respectively above-mentioned basic medium, the sucrose of using respectively equivalent carbon content (8g), maltose, lactose, starch, sorbyl alcohol, N.F,USP MANNITOL and Xylo-Mucine, replace the glucose in above-mentioned basic medium, not add basic medium (the soy peptone 2g of carbon source, potassium primary phosphate 1g, magnesium sulfate 0.5g, vitamins B
110mg, agar 20g, is settled to l000mL, pH value 7.0-7.2 with distilled water) (CK) in contrast.Every processing repeats for 5 times.
Each processing sterilizing is poured into after culture dish (diameter is 9cm), one of peristome bacterium of the same colour (Cerrena unicolor) the GSM-01CGMCC No.7713 bacterium colony that is 5mm at each flat board (thickness is about 5mm) central authorities inoculation diameter, in 25 DEG C of constant incubators, lucifuge is cultivated, observation mycelial growth amount (colony diameter) and growing way situation, calculate the average daily speed of growth of mycelium [mycelial growth rate=colony radius growth degree (mm) ÷ cultivated days (d)].In the time of the full flat board of the fastest group leader of growing way, stop cultivating, reclaim each processing mycelium, measure mycelium dry weight.Wherein, the incubation time of the fastest one group of growing way is 5 days.
Result show maltose and glucose favourable to peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 mycelial growth, peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 is taking glucose the fastest (10.7 ± 0.5mm/d) of mycelial growth on carbon source substratum, taking lactose mycelial growth (3.8 ± 0.6mm/d) the most slowly on carbon source substratum, taking maltose dry weight on carbon source substratum the highest (57.6 ± 6.0mg/ ware), the suitableeest carbon source that peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 mycelium culture is described is maltose (table 2 and Fig. 2).
The impact of the different carbon sources of table 2. on mycelial growth
In table 2 ,+represent that growth is sparse, ++ represent that growth is finer and close, +++ represent that growth is fine and close.It is remarkable that in same column, different lowercases are illustrated in 5% level difference, and it is remarkable that different capitalizations are illustrated in 1% level difference.The present embodiment following table is same.
(3) impact of different nitrogen sources on mycelial growth rate
9 kinds of processing are established in experiment, be respectively above-mentioned basic medium, use the yeast of equivalent nitrogen content (0.4g) to soak powder, beef extract, ammonium nitrate, ammonium sulfate, urea, analysis for soybean powder and glycine respectively, replace the soy peptone in above-mentioned basic medium, not add basic medium (the glucose 20g of nitrogenous source, potassium primary phosphate 1g, magnesium sulfate 0.5g, vitamins B
110mg, agar 20g, is settled to l000mL, pH value 7.0-7.2 with distilled water) (CK) in contrast.Every processing repeats for 5 times.
Each processing sterilizing is poured into after culture dish (diameter is 9cm), one of peristome bacterium of the same colour (Cerrena unicolor) the GSM-01CGMCC No.7713 bacterium colony that is 5mm at each flat board (thickness is about 5mm) central authorities inoculation diameter, in 25 DEG C of constant incubators, lucifuge is cultivated, observation mycelial growth amount (colony diameter) and growing way situation, calculate the average daily speed of growth of mycelium [mycelial growth rate=colony radius growth degree (mm) ÷ cultivated days (d)].In the time of the full flat board of the fastest group leader of growing way, stop cultivating, reclaim each processing mycelium, measure mycelium dry weight.Wherein, the incubation time of the fastest one group of growing way is 5 days.
Result shows that soy peptone and yeast extract are favourable to peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 growth, peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 is mycelial growth (8.8 ± 0.3mm/d) the soonest on the substratum taking soy peptone as nitrogenous source, mycelial growth (4.0 ± 0.2mm/d) the most slowly on substratum taking glycine as nitrogenous source, dry weight the highest (30.5 ± 1.6mg/ ware) on the substratum taking yeast extract as nitrogenous source.The suitableeest nitrogenous source that peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 mycelium culture is described is yeast extract, is secondly soy peptone (table 3 and Fig. 3).
The impact of table 3 different nitrogen sources on mycelial growth
(4) impact of different C/N on mycelial growth
Substitute the glucose of above-mentioned basic medium with maltose, making maltose content is 20g/L, and the soy peptone in above-mentioned basic medium is substituted with the yeast extract of different mass, be mixed with C/N than the different culture media that is respectively 10/1,20/1,30/1,40/1,50/1 and 60/1, pH value 7.0-7.2, every processing repeats for 5 times.
Each processing sterilizing is poured into after culture dish (diameter is 9cm), one of peristome bacterium of the same colour (Cerrena unicolor) the GSM-01CGMCC No.7713 bacterium colony that is 5mm at each flat board (thickness is about 5mm) central authorities inoculation diameter, in 25 DEG C of constant incubators, lucifuge is cultivated, observation mycelial growth amount (colony diameter) and growing way situation, calculate the average daily speed of growth of mycelium [mycelial growth rate=colony radius growth degree (mm) ÷ cultivated days (d)].In the time of the full flat board of the fastest group leader of growing way, stop cultivating, reclaim each processing mycelium, measure mycelium dry weight.Wherein, the incubation time of the fastest one group of growing way is 10 days.
Result shows that C/N is that 20/1,40/1,10/1 pair of peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 mycelial growth is favourable, carbon-nitrogen ratio is the fastest (4.0 ± 0.0mm/d) of mycelial growth on 20/1 substratum, carbon-nitrogen ratio is the slowest (3.8 ± 0.0mm/d) of mycelial growth on 60/1 substratum, carbon-nitrogen ratio is dry weight the highest (38.3 ± 1.1mg) on 10/1 substratum, dry weight minimum (being respectively 20.4 ± 0.8mg) (table 4 and Fig. 4) on the substratum that carbon-nitrogen ratio is 60/1.The suitableeest C/N ratio that peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 mycelium culture is described is 10/1, is secondly 20/1.
The impact of the different C/N comparison of table 4 mycelial growth
(5) impact of different somatomedins on mycelial growth
Adopt basic medium, use respectively vitamins B
2(10mg), vitamins B
6(10mg), vitamins C (10mg), corn steep liquor (10mg), inositol (10mg) are replaced the vitamins B in basic medium
1(10mg),, not add somatomedin as contrast (CK), every processing repeats for 5 times.
Each processing sterilizing is poured into after culture dish (diameter is 9cm), one of peristome bacterium of the same colour (Cerrena unicolor) the GSM-01CGMCC No.7713 bacterium colony that is 5mm at each flat board (thickness is about 5mm) central authorities inoculation diameter, in 25 DEG C of constant incubators, lucifuge is cultivated, observation mycelial growth amount (colony diameter) and growing way situation, calculate the average daily speed of growth of mycelium [mycelial growth rate=colony radius growth degree (mm) ÷ cultivated days (d)].In the time of the full flat board of the fastest group leader of growing way, stop cultivating, reclaim each processing mycelium, measure mycelium dry weight.Wherein, the incubation time of the fastest one group of growing way is 5 days.
Result shows with vitamins B
6for (8.9 ± 0.1mm/d) the soonest of mycelial growth on the substratum of somatomedin, mycelial growth (8.6 ± 0.1mm/d) the most slowly on the substratum taking inositol as somatomedin, with vitamins B
1for dry weight the highest (37.2 ± 6.1mg) on the substratum of somatomedin, with vitamins B
6for dry weight on the substratum of somatomedin minimum (24.7 ± 3.6mg) (table 5 and Fig. 5).Comprehensive growth velocity and mycelia dry weight index, the most suitable growth factor of peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 mycelium culture is vitamins B
1, be secondly vitamins C.
The impact of the different somatomedins of table 5 on mycelial growth
(6) impact of differing temps on mycelial growth rate
Substitute carbon source, the nitrogenous source in enriched medium with the suitableeest carbon nitrogen source in above-mentioned test respectively, adjust C/N than being the suitableeest C/N ratio, pH value 7.0-7.2, be made into improved culture medium, it is composed as follows: maltose 20g, soy peptone 4g, potassium primary phosphate 1g, magnesium sulfate 0.5g, vitamins B
110mg, agar 20g, pH value 7.0-7.2, is settled to l000mL with distilled water.After inoculation, at 16,20,24,28,32,36 DEG C, constant temperature lucifuge is cultivated respectively, and every processing repeats for 5 times.
Each processing sterilizing is poured into after culture dish (diameter is 9cm), one of peristome bacterium of the same colour (Cerrena unicolor) the GSM-01CGMCC No.7713 bacterium colony that is 5mm at each flat board (thickness is about 5mm) central authorities inoculation diameter, in 25 DEG C of constant incubators, lucifuge is cultivated, observation mycelial growth amount (colony diameter) and growing way situation, calculate the average daily speed of growth of mycelium [mycelial growth rate=colony radius growth degree (mm) ÷ cultivated days (d)].In the time of the full flat board of the fastest group leader of growing way, stop cultivating, reclaim each processing mycelium, measure mycelium dry weight.Wherein, the incubation time of the fastest one group of growing way is 3 days.
Result shows, peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 mycelial growth (13.2 ± 0.2mm/d) the soonest 32 DEG C time, mycelial growth (4.3 ± 0.2mm/d) the most slowly 16 DEG C time, peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 dry weight the highest (48.2 ± 6.0mg) 32 DEG C time, peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 dry weight minimum (13.4 ± 0.4mg) (table 6 and Fig. 6) 16 DEG C time.The optimum temperuture that peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 mycelium culture is described is 32 DEG C, is secondly 36 DEG C.
The impact of table 6 differing temps on mycelial growth
(7) impact of different pH values on mycelial growth
After above-mentioned improved culture medium sterilizing, adjust pH is difference 5.0,5.5,6.0,6.5,7.0,7.5,8.0,8.5 and 9.0, and every processing repeats for 5 times.
Each processing sterilizing is poured into after culture dish (diameter is 9cm), one of peristome bacterium of the same colour (Cerrena unicolor) the GSM-01CGMCC No.7713 bacterium colony that is 5mm at each flat board (thickness is about 5mm) central authorities inoculation diameter, in 25 DEG C of constant incubators, lucifuge is cultivated, observation mycelial growth amount (colony diameter) and growing way situation, calculate the average daily speed of growth of mycelium [mycelial growth rate=colony radius growth degree (mm) ÷ cultivated days (d)].In the time of the full flat board of the fastest group leader of growing way, stop cultivating, reclaim each processing mycelium, measure mycelium dry weight.Wherein, the incubation time of the fastest one group of growing way is 4 days.
Peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 mycelial growth (8.99 ± 0.1mm/d) the soonest when result shows pH6.5, mycelial growth (7.2 ± 0.14mm/d) the most slowly when pH9.0, mycelia dry weight the highest (35.5 ± 6.6mg) when pH6.5, mycelia dry weight minimum (23.5 ± 1.1mg) when pH8.0.(table 7 and Fig. 7) illustrates that the optimal pH of peristome bacterium of the same colour (Cerrena unicolor) GSM-01CGMCC No.7713 mycelium culture is 6.5, is secondly 5.0,5.5.
The impact of the different pH values of table 7 on mycelial growth
(8) statistical analysis
All data acquisitions carry out Treatment Analysis with SPSS14.0 statistical software.
Claims (8)
1. the method for a fermentative production of laccase, be included in and in liquid nutrient medium, cultivate peristome bacterium of the same colour (Cerrena unicolor), collect fermented liquid or/and mycelial step, the bacterial strain number of described peristome bacterium of the same colour (Cerrena unicolor) is GSM-01, and it is numbered CGMCC No.7713 registering on the books of China Committee for Culture Collection of Microorganisms's common micro-organisms center.
2. method according to claim 1, is characterized in that: the culture temperature that described cultivation adopts is 25 DEG C-36 DEG C, and incubation time is 48-192 hour.
3. method according to claim 1 and 2, is characterized in that: Cu in described liquid nutrient medium
2+concentration be 1.0-2.0mmol/L.
4. method according to claim 3, is characterized in that: every liter of described liquid nutrient medium is to add CuSO in PD substratum
4solution is to Cu
2+concentration is the liquid that 1.0-2.0mmol/L obtains; Every liter of described PD substratum is prepared as follows: potato 200g, and glucose 20g, adjust pH 7.0-7.2 water is settled to 1000mL.
5. method according to claim 3, is characterized in that: Cu in described liquid nutrient medium
2+concentration is 1.0mmol/L.
6. method according to claim 5, is characterized in that: described incubation time is 192 hours.
7.1.0-2.0mmol/L Cu
2+solution is in the application improving in peristome bacterium of the same colour (Cerrena unicolor) product laccase; The bacterial strain number of described peristome bacterium of the same colour (Cerrena unicolor) is GSM-01, and it is numbered CGMCC No.7713 registering on the books of China Committee for Culture Collection of Microorganisms's common micro-organisms center.
8. application according to claim 7, is characterized in that: described Cu
2+solution is CuSO
4solution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310263157.9A CN103305481B (en) | 2013-06-27 | 2013-06-27 | Method for producing laccase by fermenting cerrena unicolor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310263157.9A CN103305481B (en) | 2013-06-27 | 2013-06-27 | Method for producing laccase by fermenting cerrena unicolor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103305481A CN103305481A (en) | 2013-09-18 |
| CN103305481B true CN103305481B (en) | 2014-06-25 |
Family
ID=49131203
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310263157.9A Active CN103305481B (en) | 2013-06-27 | 2013-06-27 | Method for producing laccase by fermenting cerrena unicolor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103305481B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105062983A (en) * | 2015-08-05 | 2015-11-18 | 北京农学院 | Cerrena unicolor laccase with dye degradation activity and preparation method thereof |
| CN105274066B (en) * | 2015-12-02 | 2018-08-07 | 三峡大学 | A kind of enzyme preparation, preparation method and its application in degradation tonyred |
| CN113201460B (en) * | 2021-03-23 | 2022-04-22 | 山东理工大学 | Medicinal fungus trichoderma brevicompactum and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012138474A1 (en) * | 2011-04-06 | 2012-10-11 | Danisco Us Inc. | Laccase variants having increased expression and/or activity |
| CN102181410B (en) * | 2011-05-12 | 2013-02-27 | 福州大学 | Method for producing laccase by virtue of fermentation |
| CN103305430B (en) * | 2013-06-27 | 2014-06-11 | 北京农学院 | Laccase generation cerrena and application thereof |
-
2013
- 2013-06-27 CN CN201310263157.9A patent/CN103305481B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN103305481A (en) | 2013-09-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103436450B (en) | Alkaline-tolerant and halophilic aspergillus strain and application thereof in environmental management | |
| CN103305430B (en) | Laccase generation cerrena and application thereof | |
| CN101503659B (en) | Trichoderma harzianum strain and use thereof | |
| CN100434506C (en) | Screening for strain of steepletop hickory chick and process for preparing strain thereof | |
| Mata et al. | Changes in lignocellulolytic enzyme activites in six Pleurotus spp. strains cultivated on coffee pulp in confrontation with Trichoderma spp. | |
| CN114381378B (en) | Penicillium chrysogenum for degrading lignin and application thereof | |
| CN100340654C (en) | Screening for strain of balck vein hickory chick and process for preparing strain thereof | |
| CN103215311A (en) | Method for producing high-quality aquilaria sinensis material through aspergillus niger conversion | |
| CN105039171A (en) | Trametes sp. and application thereof | |
| CN102363748B (en) | New fungus Acremonium sp. DPZ-SYz-2-3 for high efficiency cellulose degradation and application thereof | |
| CN103305481B (en) | Method for producing laccase by fermenting cerrena unicolor | |
| CN102417890B (en) | Sinorhizobium meliloti and method for applying same for fermenting to produce manganese peroxidase | |
| CN101790937B (en) | Screening and culture preparing method of Russula.alutacea strain | |
| CN103409379B (en) | A kind of Resina Ferulae mushroom and rhodotorula mucilaginosa are total to the method for fermentative production of laccase | |
| CN102986536B (en) | A kind of flammulina velutipes strain and preparation method | |
| CN102021120B (en) | Paecilonyces variotii strain and application thereof | |
| CN100434507C (en) | Pleurotus ostreatus KZH-2 and its preparing process | |
| CN103004465A (en) | Coprinus comatus strain and preparation method | |
| CN113388525B (en) | Application of monascus in treatment of ultra-high concentration white spirit wastewater | |
| CN102559509B (en) | Screening and application of Bohai Bay acremonium cephalosporium | |
| CN102021121B (en) | Halictidae aspergillus nomius strain and application thereof | |
| CN108004271A (en) | A kind of streptomycete and its application with alga-lysing activity | |
| Kumar et al. | Ligninolytic enzymes production by endophytic fungus Diaporthe phaseolorum (Desm.) Sacc. under the influence of different carbon and nitrogen sources | |
| CN101928699A (en) | Fermentation process for improving yield of lucid ganoderma laccase | |
| CN110241032A (en) | A kind of nearly rose color lock shadow yeast and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhang Guoqing Inventor after: Chen Qingjun Inventor after: Zhao Xiaomeng Inventor after: Wang Zijian Inventor after: Wang Shanshan Inventor after: Cui Kai Inventor before: Zhang Guoqing Inventor before: Chen Qingjun Inventor before: Cui Kai Inventor before: Wang Zijian Inventor before: Wang Shanshan Inventor before: Zhao Xiaomeng |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: ZHANG GUOQING CHEN QINGJUN CUI KAI WANG ZIJIAN WANG SHANSHAN ZHAO XIAOMENGTO: ZHANG GUOQING CHEN QINGJUN ZHAO XIAOMENG WANG ZIJIAN WANG SHANSHAN CUI KAI |