CN102559509B - Screening and application of Bohai Bay acremonium cephalosporium - Google Patents

Abstract

The invention provides an acremonium strictum strain BH-0531 separated from a Bohai Bay water area and screening and an application thereof. The strain is collected in the China General Microbiological Culture Collection Center with the collection number of CGMCC No.5445. The strain is separated from a sample of bottom layer seawater in the Bohai Bay, and is obtained by screening and identifying. The BH-0531 strain separated and screened in the invention belongs to acremonium strictum (originally called cephalosporium), has the characteristics of low growing temperatures of marine microorganisms and growth under high-salt conditions, and has the capability of producing nematicidal active metabolic products; produced nematicidal substances have high thermal stability and water solubility; the nematicidal activity can be over 94 percent under experimental conditions; and the acremonium strictum strain BH-0531 can be applied to fermentation production of bioactive substances such as nematicides, antibiotics and the like.

Description

Mould screening and the application of the thread thalassiomycetes branch of Bohai Sea Gulf nematicide top spore

Technical field

The invention belongs to Living marine resources and microbial strains, be embodied in a kind of separation from the nematicide branch top in waters, Bohai Sea Gulf spore trichoderma strain ( Acremonium cephalosporium) BH-0531 and screening and application.

Background technology

The pathogen that nematode is important as a class, its harm has become the major issue on agricultural and forestry production.The plant nematode that the whole world has been reported reaches 200 more and belongs to more than 5000 kinds.The plant nematode disease is brought the financial loss of nearly 1,250 hundred million dollars to the whole world agricultural every year, is only second to fungal disease.Therefore, administer soil and plant nematode and become global a, major issue that urgent will solve.Nematocide, the monobromethane occurred as early stage as the forties, amino formate and organophosphorus compounds etc. appear in the later stage fifties, mostly are poisonous agricultural chemicals, be found to have teratogenesis, the severe toxicity effect such as carcinogenic, have serious 3R problem: resistance, drug residue, insect be ferocious sticking up again simultaneously.Along with the enhancing of mankind's environmental consciousness, biological control has become the leading of control of nematode.

Microorganism is the miscellaneous renewable resources of a class, is the abundantest genetic storehouse, is also the Important Natural Enemy of plant pathogeny line insect, and secondary metabolite is the important sources of biologically active substance.

The first-generation nematode biological prevention and control agent of exploitation is mainly the viable bacteria body preparation at present, and wherein the biological and ecological methods to prevent plant disease, pests, and erosion factor of most study comprises: nematode-trapping fungi, inner parasitic epiphyte and parasitics bacterium.But the viable bacteria body preparation is due to the mutual restraining effect of various degrees between the micro-flora in soil ecosystem, the unstable and the discordance that cause live body biocontrol microorganisms prevention effect in the Different Soil of country variant, make its use be very limited.

The secondary metabolite of fungi, as the s-generation nematode biological and ecological methods to prevent plant disease, pests, and erosion factor, plays a role in the mode that directly acts on the farm crop nematode, has that effect is fast, drug effect is high, Environmental compatibility good, is not easy to cause the advantage such as secondary pollution.The eelworm-killing activity metabolite of having found has been added up 179 kinds more than, comprises alkaloids, polypeptide class, terpene, Macrolide, oxa-lopps, benzo class, quinones, fats, simple aromatics etc.But stay in the laboratory study stage more, and be mostly water-soluble poor lipid-soluble substance, need to carry out hydrotropy by adding synergistic agent, this has caused difficulty for practical application.Therefore, developing efficient, low toxicity, relative specificity and cheap microorganism nematode killing agent, will be research emphasis from now on.

The ball total area 71% is taken up an area in ocean, and tellurian 80% is lived in ocean.The special environment space in ocean has been brought up the secondary metabolism circulation of marine organisms uniquenesses, and the genetic background and the pathways metabolism that develop and to be different from terrestrial organism are the precious resources of finding new drug or lead compound.Cephalosporin C is the microbiotic be separated to from thalassiomycetes the earliest, and after this research exponentially of relevant this respect increases, as Australian Capon study group filters out two strain nematicide thalassiomycetess from the ocean, South Australia Aspergillus caneusWith Raspailia sp(Caponn RJ, 2003).Xiao Yongtang etc. (2005) carry out nematicidal toxicity mensuration to 188 strain thalassiomycetes metabolites, and the bacterial strain that the virulence rank reaches the A level accounts for 1.60%; And the bacterial strain that mortality ratio reaches more than 50% accounts for 43.1% of sum.Zheng Zhonghui etc. (2005) are observed rhabditis axei effect phenomenon a strain thalassiomycetes metabolite, think a kind of nerve poison.Showed the potential of thalassiomycetes in the nematicide field.

Summary of the invention

One object of the present invention is to overcome the deficiency that exists in existing nematocides and the problem of nematocides High-efficient Production microorganism resource scarcity, thus the thread thalassiomycetes branch of the Bohai Sea Gulf nematicide top spore trichoderma strain BH-0531 bacterial strain (preserving number CGMCC-5445) that provides a strain to there is the nematicide function.

Another object of the present invention is to provide the screening method of the thread thalassiomycetes branch of nematicide top, a kind of Bohai Sea Gulf spore trichoderma strain.

The application that provides the thread thalassiomycetes branch of nematicide top, a kind of Bohai Sea Gulf spore trichoderma strain BH-0531 bacterial strain to produce for agricultural insecticide, biological pesticide and antibiotic fermentation as biologically active substance in preparation is provided an also purpose of the present invention.

For achieving the above object, the invention provides following technical scheme:

The thread thalassiomycetes branch of nematicide top, a kind of Bohai Sea Gulf spore trichoderma strain ( Acremonium cephalosporium) the BH-0531 bacterial strain, its preserving number at China Committee for Culture Collection of Microorganisms's common micro-organisms center is: CGMCC-5445.The preservation time: 2011-11-4.This bacterial classification by pick up from the Bohai Sea (117 ° 53 ' 23.2 of longitude E ", in 38 ° of 55 ' 51.0 ") bottom Seawater Samples of latitude N, separate.

Colony characteristics: 26 ℃ of 7d diameter 33-35mm on Cha Shi agar, 14d reaches 50-65 mm; Initial quality carpet shape; Primary mycelium white, extend and be pale yellow to baby pink with incubation time, and because a large amount of Sporulation bacterium colony quality become the opaque shape, colony edge is closely neat; Without transudate; The bacterium colony reverse side is shallow tangerine or yellow.

The mycelia feature: have every, thinner, diameter (2.0 ± μ m); Conidiophore bears from mycelia, upright, and short and small, end is gradually thin, and top is spherical, living spore estranged without every, mostly be oval, major diameter 3.0～4.0 μ m, minor axis diameter 2.1 ± μ m, wall is bordering on smooth.

Branch top spore mould BH-0531 bacterial strain be under the jurisdiction of a mould genus of top spore ( AcremoniumBe once called as Cephalosporium, Cephalosporium.).This bacterial strain has at sea water medium with not containing growing on the substratum such as Cha Shi, PDA of seawater, and produces the performance of nematicide isoreactivity material, and the active substance eelworm-killing activity produced is high, but the also growth of Antifungi and bacterium.Therefore can be applicable to the fermentative production fields such as nematicide biological prevention and control agent, biological pesticide and microbiotic.

Screening of the present invention refers to take the mortality ratio of nematode and the nematicide ability of bacterial strain is estimated as index.

The present invention further discloses the screening method of the thread thalassiomycetes branch of Bohai Sea Gulf nematicide top spore trichoderma strain BH-0531, it is characterized in that:

(1) separation of bacterial classification, purifying:

Sample is from the bottom seawater in Bohai Sea Gulf, after via hole diameter 0.45 μ m nitrocellulose filter (f50) filters, filter membrane is placed on the seawater solid medium, obtain bacterium colony in 26 ℃ of constant temperature culture, the monospore method is chosen in employing, it is proceeded to new flat board and cultivate, this process is carried out repeatedly, until the bacterium colony purifying; Described seawater solid medium: glucose 10g/L, peptone 2g/L, yeast extract paste 2g/L, seawater 600mL/L, distilled water 400mL/L, agar 20 g/L;

(2) screening of bacterial classification:

1) bacterial classification of above-mentioned separation and purification is inoculated in liquid nutrient medium and carries out the shake flask fermentation cultivation, the nutrient solution via hole diameter after fermentation culture is 0.22 μ m membrane filtration, collects and obtains ferment filtrate; Wherein said liquid nutrient medium refers to Cha Shi liquid nutrient medium: NaNO ₃2 g/L, K ₂HPO ₄1 g/L, KCl 0.5 g/L, MgSO ₄0.5 g/L, FeSO ₄0.01 g/L, sucrose 30 g/L, PH nature;

Or seawater liquid nutrient medium: glucose 10g/L, peptone 2g/L, yeast extract paste 2g/L, seawater 600mL/L, distilled water 400mL/L;

Culture condition is: inoculum size 2 * 10 ⁶Spore suspension, rotating speed 120r/min, initial pH6.5,26 ℃ of fermentation 96h;

2) use 24 porocyte culture plates, add 1mL ferment filtrate and 100 μ L nematode suspensions (average 1500 nematodes/100 μ L) in every hole, 26 ℃ of standing 3d, after 5d, add up nemic death rate under anatomical lens; After separation screening, obtain have the nematicide function from the thread thalassiomycetes branch of Bohai Sea Gulf nematicide top spore trichoderma strain BH-0531, its virulence rank reaches the A level of mortality ratio >=90%;

(3) optimization of spawn culture condition:

The substratum of optimizing is: peeling potato 150g/L, glucose 10g/L, yeast extract paste 2g/L, seawater content 600ml/L; Wherein removing the peel potato 150g/L refers to: peeling potato 150g puts liquor in 400mL distilled water, taking juice, then be settled to 400mL;

The culture condition of optimizing is: inoculum size 2 * 10 ⁶Spore suspension, rotating speed 120r/min, initial pH6.5,26 ℃ of fermentation 96h; Cultivation obtains the thread thalassiomycetes branch of nematicide top spore trichoderma strain.

The screening reached of the present invention refers to and utilizes nemic death rate as index, by the nematicide ability to bacterial strain, estimated, the nemic death rate of take high (mortality ratio >=90%) is the standard implementation screening, and described nematode is pine wood nematode (Institute of Plant Protection provides by Chinese agricultural science institution).

The present invention obtains and confirms to have from the Bohai Sea water area separation BH-0531 bacterial strain that kills the line activity and under this background, utilizes nemic death rate as index exactly, by experiment ferment culture condition such as affecting larger pH value, inoculum size, culture temperature, incubation time and carbon nitrogen source and content thereof is optimized and obtains.

It kills the line activity and reaches A level (>=90%), available not containing the culture medium culturing of seawater, is applicable to normal fermentation equipment.The nematicide material that this bacterium produces is neutral, water-soluble, heat-resistant activity material, molecular weight<6000 D.This material also is proved has the bacteriostatic action that suppresses yeast and bacterium.Bacterial strain is defined as through observation evaluation and the ITS sequential analysis of classical classification indicators Acremonium cephalosporium.BH-0531.

The present invention further discloses the application that the thread thalassiomycetes branch of Bohai Sea Gulf nematicide top spore trichoderma strain BH-0531 bacterial strain is produced for agricultural insecticide, biological pesticide and antibiotic fermentation as biologically active substance in preparation.Wherein said agricultural insecticide, biological pesticide and microbiotic object are plant pathogeny line insect, plant pathogenic fungi and plant pathogenetic bacteria.

The present invention is more detailed to be described as follows:

One, concrete technical support

(i) microbial name and preservation situation

The mould BH-0531 bacterial strain of branch top spore.This bacterial classification at the preserving number at China Committee for Culture Collection of Microorganisms's common micro-organisms center is: CGMCC-5445, preservation time: 2011-11-4.

(ii) the biological characteristics of bacterial strain and evaluation

1. the morphological feature of branch top spore mould BH-0531 bacterial strain

Colony characteristics: 26 ℃ of 7d diameter 33-35mm on Cha Shi agar, 14d reaches 50-65 mm; Initial quality carpet shape; Primary mycelium white, extend and be pale yellow to baby pink with incubation time, and because a large amount of Sporulation bacterium colony quality become the opaque shape, colony edge is closely neat; Without transudate; The bacterium colony reverse side is shallow tangerine or yellow.

The mycelia feature: have every, thinner, diameter (2.0 ± μ m); Conidiophore bears from mycelia, upright, and short and small, end is gradually thin, and top is spherical, living spore estranged without every, mostly be oval, major diameter 3.0～4.0 μ m, minor axis diameter 2.1 ± μ m, wall is bordering on smooth.

According to " bacteriology complete works " (Qiu Weifan, bacteriology complete works of [M]. Beijing: Science Press, 1998:890) and " common and commonly used fungi " (Institute of Microorganism, Academia Sinica [M]. Beijing: Science Press, 1973), this bacterium feature conforms to a branch top spore mould feature, the utmost point like the cephalosporium acremonium described in " common and commonly used fungi " ( Cephalosporium acremonium.).

2. 18S rDNA ITS sequential analysis and qualification result

Sequencing result: connect product order-checking after transforming, by Beijing Hua Da Gene science sequencing fragment length, be about 500bp, sequencing result is as follows:

GGCAAAGGAGTCACTCCAACCCCTGTGACATACCTATGTTGCTTCGGCGG

GCCGTCCCGCGGCGCGCCCACGTGGCGTGACCCGGAACCAGGCGCCCGCC

GGGGACCCAAACTCTTGCCTTTTTAGTGTCTCCTCTGAGTGGCATAAGCA

AAAATAAACAAAACTTTCAGCAACGGATCTCTTGGTTCTGGCATCGATGA

AGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT

CATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATG

CCTGTCTGAGCGTCATTTCAACCCTCAGCCCCCGTTCGCGGGGCGCTGGC

GTTGGGGATCGGCCGTCCTCGCGGCGGCCGGCCCCGAAACACAGTGGCGG

TCTCCTGCAGACTCCCCTGCGTAGTAGCACTACCTCGCAGAAGGGACGAG

CGGGCTGGCCACGCCGTAAAACCCCCAACTTCTCCAGGTTGACCTCAGAT

CAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGAA

Sequence is submitted to the Gen-Bank database, carry out the BLAST comparison, result shows that this bacterial strain ITS sequence and Acremonium sp. NJM 0672, Acremonium sp. NJM 0567 homology are that 100%(all is located away from the mantis shrimp body of Japan Sea fungi infestation); With Emericellopsis maritima strain, Emericellopsis maritima strain, Emericellopsis sp. r454, Emericellopsis sp. s030 homology be that 99%(Emericellopsis is the Acremonium kind of having found to have the perfect stage).Combining form is learned qualification result, and this bacterium is defined as to a mould BH-0531(of top spore Acremonium cephalosporium).

(iii) the separation of bacterial classification, screening

1. the separation of bacterial classification, purifying

Pick up from the Bohai Sea (117 ° 53 ' 23.2 of longitude E "; the sample of 38 ° of 55 ' 51.0 ") bottom seawater of latitude N is through 0.45 μ m nitrocellulose filter (f50, commercially available) filter after, filter membrane is placed on the seawater solid medium, in 26 ℃ of constant temperature culture.The monospore method is chosen in employing, it is proceeded to new flat board and cultivate.This process is carried out repeatedly, until the bacterium colony purifying.Described seawater solid medium: glucose 10g/L, peptone 2g/L, yeast extract paste 2g/L, seawater 600mL/L, distilled water 400mL/L, agar 20 g/L.

2. the screening of bacterial classification

(2) screening of bacterial classification:

1) bacterial classification of above-mentioned separation and purification is inoculated in liquid nutrient medium and carries out the shake flask fermentation cultivation, the nutrient solution via hole diameter after fermentation culture is that 0.22 μ m filter membrane (commercially available) filters collected filtrate and is ferment filtrate;

Wherein said liquid nutrient medium refers to Cha Shi liquid nutrient medium: NaNO ₃2 g/L, K ₂HPO ₄1 g/L, KCl 0.5 g/L, MgSO ₄0.5 g/L, FeSO ₄0.01 g/L, sucrose 30 g/L, PH nature; Or seawater liquid nutrient medium: glucose 10g/L, peptone 2g/L, yeast extract paste 2g/L, seawater 600mL/L, distilled water 400mL/L;

2) use 24 porocyte culture plates, add 1mL ferment filtrate and 100 μ L nematode suspensions (average 1500 nematodes/100 μ L) in every hole, 26 ℃ of standing 3d, after 5d, add up nemic death rate under anatomical lens; Obtain the branch of the nematicide from the waters, the Bohai Sea Gulf top spore trichoderma strain BH-0531 with nematicide function after separation screening, its virulence rank reaches the level of mortality ratio >=90% A; Culture condition is: rotating speed 120r/min, initial pH6.5,26 ℃ of fermentation 96h.This bacterial classification is in the center preservation of China Committee for Culture Collection of Microorganisms's common micro-organisms, and preserving number is: CGMCC-5445.

3. the optimization of culture condition:

3.1 the impact that initial pH produces producing nematocidal active material: result is as shown in table 1, result shows that initial pH value raises with the pH value at 6.5 its lytic activities when following, pH is that to reach activity at 6.5 to 7.5 o'clock higher and relatively stable, and pH has again decline to 8 after product activity.

The impact of the initial pH of table 1 on strain growth and nematocidal active material formation:

Initial pH value	Dry cell weight (g/L)	Nemic death rate after 3d (%)	Nemic death rate after 5d (%)
				4	2.4±0.2	61.07	74.36
4.5	3.3±0.2	61.12	74.58
				5	3.3±0.2	66.67	75.12
5.5	3.4±0.2	74.64	79.56
				6	3.7±0.2	83.65	88.77
6.5	3.9±0.2	85.50	93.55
				7	3.4±0.2	85.87	93.17
7.5	3.0±0.2	90.10	95.61
				8	2.9±0.2	75.96	86.35
8.5	2.8±0.2	64.32	75.83
				9	2.5±0.2	49.32	60.28
Contrast	——	1.41	3.25

3.2 dissolved oxygen is on the BH-0531 strain growth and produce the impact that nematocidal active material produces:

Study the impact of dissolved oxygen on BH-0531 strain growth and nematocidal active material formation by adopting different shaking speed and different liquid amounts.Result is as shown in table 2, table 3:

The impact of table 2 shaking speed on strain growth and nematocidal active material formation:

Shaking speed (r/min)	Dry cell weight (g/L)	Nemic death rate after 3d (%)	Nemic death rate after 5d (%)
				100	3.5±0.2	52.82	78.19
120	3.9±0.2	71.67	94.22
				150	3.4±0.2	60.42	83.37
170	3.0±0.2	54.88	72.66
				Contrast	——	2.44	4.00

The impact of table 3 liquid amount on strain growth and nematocidal active material formation:

Liquid amount (mL)	Dry cell weight (g/L)	Nemic death rate after 3d (%)	Nemic death rate after 5d (%)
				50	2.4±0.2	36.30	68.54
75	3.3±0.2	70.12	83.14
				100	3.6±0.2	82.06	95.20
125	3.9±0.2	79.62	85.71
				150	3.2±0.2	74.71	76.87
200	2.9±0.2	55.61	55.88
				Contrast	——	3.04	4.79

Result shows, during rotating speed 120r/min, during liquid amount 100mL, thalli growth is best, and the thalline biomass is moderate, and the ferment filtrate eelworm-killing activity reaches the highest.

3.3 the impact that culture temperature produces producing nematocidal active material

Table 4 result shows, in the optimal temperature scope, thalli growth becomes positive correlation with temperature, and wherein bacterial metabolism thing eelworm-killing activity is the highest 26 ℃ the time, and thalli growth is comparatively vigorous:

Table 4 treatment of different temperature is killed the impact of line rate and dry cell weight on bacterial strain:

Temperature (℃)	Dry cell weight (g/L)	Nemic death rate after 3d (%)	Nemic death rate after 5d (%)
				15	2.0±0.2	19.17	30.07
20	3.1±0.2	42.36	63.94
				22	3.6±0.2	55.28	70.74
24	3.9±0.2	73.562	83.45
				26	4.0±0.2	81.59	94.14
28	4.2±0.2	81.38	91.11
				Contrast	——	3.98	8.10

3.4 different carbon, nitrogen, somatomedin proportioning are on producing the impact of nematicide active substance:

By carbon source, nitrogenous source, three trophic factors of somatomedin (yeast extract paste), as research object, are selected L16(4 ³) orthogonal table, 4 levels of each factor design, result is as shown in table 5; The different carbon sources of table 5 substratum, nitrogenous source, the somatomedin proportioning

BH-0531 bacterial strain metabolite is killed to the impact of line activity (5d) and thalli growth

Table 5 result shows, when 3 kinds of factor content are low, thalline breeding quantity is few, is unfavorable for the accumulation of product; When 3 kinds of factor content are higher, thalli growth is too vigorous, is unfavorable for its accumulation secondary metabolite, and easily causes thalline to shift to an earlier date old and feeble self-dissolving.While only having three kinds of factor content moderate, thalli growth is moderate, is beneficial to fermented liquid and kills the accumulation of line active metabolite.

Range analysis and the results of analysis of variance show, carbon source is the most remarkable to activity influence, each factor on the active order that affects is: glucose > yeast extract paste > potato fruit, its allocation optimum is glucose 10g/L, yeast extract paste 2g/L, peeling potato 150g/L, now thalli growth is moderate, and fermented liquid obtains maximum eelworm-killing activity.

3.5 seawater content is on producing the impact of nematicide active substance

Result is as shown in table 6, and sea water medium seawater content is less on BH-0531 strain growth impact, and the generation of eelworm-killing activity metabolite is had to considerable influence.When wherein content is every 400-600 mL/L, the upgrowth situation of thalline is better, and when content is 600mL/L, to kill the line ability the strongest for fermented liquid, shows that the BH-0531 bacterial strain has the marine microorganism feature, and seawater is conducive to strain for accumulating specific metabolic thing.

The different seawater content of table 6 substratum kills the impact of line activity (5d) and thalli growth on bacterial strain metabolite to be measured

According to above-mentioned result of study, the optimum culture condition of the marine filamentous fungus that the present invention screens-mould BH-0531 bacterial strain of branch top spore is: peeling potato 150g/L, glucose 10g/L, yeast extract paste 2g/L, seawater content 600ml/L.Inoculum size 2 * 10 ⁶Spore suspension, rotating speed 120r/min, initial pH6.5,25～26 ℃ of fermentation 96h.

(4) property analysis of nematocidal active material

By cultured fermented liquid, with aperture, be that 0.22 μ m filter membrane (commercially available) filters the meta-bolites ferment filtrate that is wanted bacterial classification.Further adopt the UEOS-503 type hollow fiber film assembly (Tianjin MoTian Membrane Engineering Technology Co., Ltd) that the molecular weight that dams is 6000dalton to carry out the ultrafiltration classification to ferment filtrate, the filtrate of acquisition is ultrafiltrated, for property analysis.

1. the thermostability and the pH that kill the line active substance change killing the impact of line active substance in ferment filtrate

As shown in Table 7, the ferment filtrate of BH-0531 still retains and better kills the line activity after 121 ℃ are processed 20min, and its activity keeping is at more than 95% of former activity.The nematocidal active material that its generation is described has good thermostability.And the activity change after fermenation raw liquid and tune neutrality not obvious all has and kills preferably the line activity.Because China's soil generally has southern meta-acid north meta-alkalescence characteristic, under neutrallty condition, the activated material of tool demonstrates good soil application prospect.

Table 7 differing temps and pH change the impact that active metabolite is killed to line rate (%)

Treatment temp	121℃ 20min	Room temperature	Contrast (water)	Action time
						86.25	90.13	0.00	3d
	89.34	93.85	2.01	5d
					pH	Ferment filtrate, 5.1	Adjust neutral	Contrast (water)
	93.85	94.73	1.00	3d

2. the dissolubility test of fermentating liquid filtrate active substance

Ultrafiltrated is made to dry powder for dissolubility test, and result is as shown in table 8.Experimental result explanation, the BH-0531 fermentating metabolism product is soluble in water, is partially dissolved in the methyl alcohol ether, slightly soluble or be insoluble to other organic solvents.

Table 8 solvent solubility and kill the line activity

Processing mode

Water

Methyl alcohol

Ether

Propyl carbinol

Ethyl acetate

Sherwood oil

Supernatant

A

B

C

C

D

D

Precipitation

——

C

C

B

B

B

Water (contrast)

D

——

——

——

——

——

Annotate: A level mortality ratio >=90%; B level 90% ﹥ mortality ratio >=70%; C level 70% ﹥ mortality ratio >=50%; D level mortality ratio ﹤ 50%.

Four, application advantage of the present invention

1. culture condition is simple

Before address, the marine filamentous fungus that the present invention screens-mould BH-0531 bacterial strain of branch top spore all can be grown preferably at sea water medium with in not containing the substratum of seawater, its biomass is not subject to the impact of seawater content substantially, and the difference of the eelworm-killing activity of actives on different culture media is little.The culture temperature of this bacterium is 26 ℃, less demanding to energy consumption, and its applicable nutraceutical matrix raw material is easy to get, without special somatomedin.Therefore all there is suitability in inland and coastland.

2. the thermostability of nematicide material and water-soluble strong, used safe, easy to operate

It kills marine filamentous fungus provided by the present invention-mould BH-0531 bacterial strain of branch top spore line and has very strong thermostability and water-soluble from active substance, has overcome the deficiency of existing nematocides non-refractory and organic solvent dissolution.Therefore bring convenience to actually operating, preserve without keeping away temperature, avoided potential hazard and residue problem with an organic solvent.

3. the applicable pH of nematicide material is between 5～8, applied widely.

Before address, marine filamentous fungus provided by the present invention-mould BH-0531 bacterial strain of branch top spore its kill line from active substance, between pH5～8, have preferably active (in Table 1 and table 8).Because China's soil generally has southern meta-acid north meta-alkalescence characteristic, thereby demonstrate comparatively broad soil range of application.

4. nematicide is effective

The nematicide rate all be take as following the tracks of the detection index in above table 1～8, demonstrate marine filamentous fungus provided by the present invention-mould BH-0531 bacterial strain of branch top spore single factors with all there is the relative effect of nematicide preferably under the composite factor condition, particularly, under the condition of optimizing, its nematicide effect reaches the A level.

The accompanying drawing explanation:

Fig. 1 is that a-f is the form of BH-0531 bacterial strain on substratum; Wherein: a BH-0531 Cha Shi cultivates 2d, b BH-0531 Cha Shi cultivates 7d, and c BH-0531 Cha Shi cultivates 14d (front), and d BH-0531 Cha Shi cultivates 14d (reverse side), e BH-0531 sea water medium colonial morphology, the sub-form of f BH-0531 seawater liquid culture basal growth;

Fig. 2 is that g-j shows BH-0531 bacterial strain microscopic features; Wherein: g h shows the BH-0531 aerial hyphae, the i primary hyphae, and j shows conidium, k shows BH-0531 spore head;

Fig. 3 is 4 kinds of components that high performance liquid phase detects;

The UV scanning absorption peak that Fig. 4 is the water component;

Fig. 5 is active result SQ-1 infrared detection result;

The bacteriostatic action qualitative results that Fig. 6 is BH-0531 bacterial strain metabolite; Wherein: the restraining effect of a to bacterium, b is to saccharomycetic restraining effect.

Embodiment

Below in conjunction with embodiment, the present invention is described, the scheme of embodiment described here, do not limit the present invention, one of skill in the art can make improvements and change according to spirit of the present invention, described these improvement and variation all should be considered as within the scope of the invention, and scope of the present invention and essence are limited by claim.Unless otherwise indicated, other all has commercially available the raw material of wherein said various substratum.

Embodiment 1

The mould BH-0531 bacterial strain of screening branch top spore

(1) separation of bacterial classification, purifying

Pick up from the Bohai Sea (117 ° 53 ' 23.2 of longitude "; 38 ° 55 ' 51.0, latitude ") sample of bottom seawater is through 0. 45 μ m nitrocellulose filter (diameters 50, commercially available) filter after, filter membrane is placed on the seawater solid medium, in 26 ℃ of constant temperature culture.Monospore is chosen in employing, it is proceeded to new flat board and cultivate.This process is carried out repeatedly, until the bacterium colony purifying.Described seawater solid medium: glucose 10g/L, peptone 2g/L, yeast extract paste 2g/L, seawater 600mL/L, distilled water 400mL/L, agar 20g/L.

(2) screening of bacterial classification:

1) bacterial classification of above-mentioned separation and purification is inoculated in liquid nutrient medium and carries out the shake flask fermentation cultivation, the nutrient solution via hole diameter after fermentation culture is that 0.22 μ m filter membrane (commercially available) filters collected filtrate and is ferment filtrate;

Wherein said liquid nutrient medium refers to Cha Shi liquid nutrient medium: NaNO ₃2 g/L, K ₂HPO ₄1 g/L, KCl 0.5 g/L, MgSO ₄0.5 g/L, FeSO ₄0.01 g/L, sucrose 30 g/L, PH nature; Or seawater liquid nutrient medium: glucose 10g/L, peptone 2g/L, yeast extract paste 2g/L, seawater 600mL/L, distilled water 400mL/L;

2) use 24 porocyte culture plates, add 1mL ferment filtrate and 100 μ L nematode suspensions (average 1500 nematodes/100 μ L) in every hole, 26 ℃ of standing 3d, after 5d, add up nemic death rate under anatomical lens; Obtain the branch of the nematicide from the waters, the Bohai Sea Gulf top spore trichoderma strain BH-0531 with nematicide function after separation screening, its virulence rank reaches the A level of mortality ratio >=90%; Culture condition is: rotating speed 120r/min, initial pH6.5,26 ℃ of fermentation 96h.

Obtain the bacterial strain of the present invention from the waters, Bohai Sea Gulf with nematicide function-branch top spore trichoderma strain BH-0531(CGMCC-5445 through above step separation screening), its virulence rank reaches the A level.

(3) biological assay:

Colony characteristics: 25 ℃ of 7d diameter 35mm on Cha Shi agar, 14d reaches 50 mm; Initial quality carpet shape; Primary mycelium white, extend and be baby pink with incubation time, and because a large amount of Sporulation bacterium colony quality become the opaque shape, colony edge is closely neat; Without transudate; The bacterium colony reverse side is shallow tangerine or yellow.

The mycelia feature: have every, thinner, diameter (2.0 ± μ m); Conidiophore bears from mycelia, upright, and short and small, end is gradually thin, and top is spherical, living spore estranged without every, mostly be oval, major diameter 3.0 ± μ m, minor axis diameter 2.1 ± μ m, wall is bordering on smooth.

18S rDNA ITS sequential analysis is identified: sequence is submitted to the Gen-Bank database, carries out the BLAST comparison, and by homology and priority principle, combining form is learned CHARACTERISTICS IDENTIFICATION kind status.Identify bacterial strain of the present invention from the waters, Bohai Sea Gulf-branch top spore trichoderma strain BH-0531(CGMCC-5445 through above step).

Embodiment 2

Branch top spore trichoderma strain BH-0531(CGMCC-5445) cultivation:

Best substratum is: peeling potato 150g/L, glucose 10g/L, yeast extract paste 2g/L, seawater content 600ml/L; Described peeling potato 150g/L refers to: peeling potato 150g puts liquor in 400mL distilled water, taking juice, then be settled to 400mL;

Optimal culture condition is: the spore suspension of inoculum size 2 * 106, rotating speed 120r/min, initial pH6.5,26 ℃ of fermentation 96h.

Embodiment 3

Branch top spore trichoderma strain BH-0531(CGMCC-5445) the nematicide condition is wide in range, suitability is wide:

The ferment filtrate of BH-0531 bacterial strain still retains and better kills the line activity after 121 ℃ are processed 20min, and its activity keeping is at more than 95% of former activity, and the ferment filtrate applicable pH is more wide in range (referring to table 7) also, fermentating metabolism product good water solubility (table 8).Because China's soil generally has southern meta-acid north meta-alkalescence characteristic, the nematocidal active material that branch top spore trichoderma strain BH-0531 produces has more advantage in practicing, and has realized overcoming the shortcoming that existing nematocides mostly is organic dissolubility, poorly water-soluble.

Embodiment 4

Nematicide branch top spore trichoderma strain ( Acremonium cephalosporium) application of BH-0531 bacterial strain in sterilant (plant pathogeny line insect) and biological pesticide:

Endanger (Beichen District Han Jia villa, Tianjin) in serious cucumber and tomato planting greenhouse root knot nematode, before transplanting seedlings, the ferment filtrate of bacterial strain of the present invention-branch top spore trichoderma strain BH-0531 is pressed to every canopy (300m ²) the 2000mL consumption, add the equivalent clear water, thin spray earth's surface equably, the then shallow earth of digging, then the field planting of transplanting seedlings, take clear water as contrast.A situation arises and population density to detect root knot while uprooting plants after their edible portions have been harvested, and uses strain fermentation filtrate of the present invention, and population density contrasts and descends more than 30%, root knot incidence minimizing 20%.

Embodiment 5

The application of bacterial strain of the present invention-branch top spore trichoderma strain BH-0531 in antibiotic fermentation (plant pathogenic fungi and bacterium) is produced:

Take G-bacterium intestinal bacteria, G+ bacterium streptococcus aureus (purchase of DSMZ of the Chinese Academy of Sciences) is target bacteria, for the target fungi, bacterial strain of the present invention-branch top spore trichoderma strain BH-0531 is carried out to the analysis of antibacterial ability quantitative and semi-quantitative with yeast (saccharomyces fragilis 413, DSMZ of the Chinese Academy of Sciences buys).The qualitative results demonstration, branch top spore trichoderma strain BH-0531 fermenation raw liquid and filtrate have obvious bacteriostatic action to target bacteria, and particularly to the effect of G-bacterium intestinal bacteria, obviously (Fig. 6 is a); Saccharomycetic bacteriostatic action is also reached to obvious degree (Fig. 6 b).The demonstration of sxemiquantitative Potency Analysis result, filtrate is diluted at 1/4 o'clock and still has 50% bacteriostatic activity.

In sum, every claim and technical support that the present invention's " the thread thalassiomycetes of Bohai Sea Gulf nematicide-mould screening and application of branch top spore " addresses are clear and definite, and any modification that all foundations technical support essence of the present invention is done still belongs in the scope of the technology of the present invention support with variation.

SEQUENCE LISTING

<110 > Tianjin Normal University

<120 > mould screening and the application of the thread thalassiomycetes branch of Bohai Sea Gulf nematicide top spore

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 548

<212> DNA

<213> Acremonium cephalosporium

<400> 1

ggcaaaggag tcactccaac ccctgtgaca tacctatgtt gcttcggcgg gccgtcccgc 60

ggcgcgccca cgtggcgtga cccggaacca ggcgcccgcc ggggacccaa actcttgcct 120

ttttagtgtc tcctctgagt ggcataagca aaaataaaca aaactttcag caacggatct 180

cttggttctg gcatcgatga agaacgcagc gaaatgcgat aagtaatgtg aattgcagaa 240

ttcagtgaat catcgaatct ttgaacgcac attgcgcccg ccagtattct ggcgggcatg 300

cctgtctgag cgtcatttca accctcagcc cccgttcgcg gggcgctggc gttggggatc 360

ggccgtcctc gcggcggccg gccccgaaac acagtggcgg tctcctgcag actcccctgc 420

gtagtagcac tacctcgcag aagggacgag cgggctggcc acgccgtaaa acccccaact 480

tctccaggtt gacctcagat caggtaggaa tacccgctga acttaagcat atcaataagg 540

cggaggaa 548

Claims (3)

1. The thread thalassiomycetes branch of a Bohai Sea Gulf nematicide top spore mould ( Acremonium sp.) the BH-0531 bacterial strain, its preserving number at China Committee for Culture Collection of Microorganisms's common micro-organisms center is: CGMCC No.5445.
2. 2. the application of the thread thalassiomycetes branch of nematicide top, the described Bohai Sea Gulf of claim 1 spore trichoderma strain BH-0531 in the biological pesticide for the preparation of killing plant pathogeny line insect.
3. 3. the application of the fermented liquid of the thread thalassiomycetes branch of nematicide top, the described Bohai Sea Gulf of claim 1 spore trichoderma strain BH-0531 in suppressing intestinal bacteria or yeast.

Images