CN102559509A - Screening and application of Bohai Bay acremonium cephalosporium - Google Patents
Screening and application of Bohai Bay acremonium cephalosporium Download PDFInfo
- Publication number
- CN102559509A CN102559509A CN2011103479796A CN201110347979A CN102559509A CN 102559509 A CN102559509 A CN 102559509A CN 2011103479796 A CN2011103479796 A CN 2011103479796A CN 201110347979 A CN201110347979 A CN 201110347979A CN 102559509 A CN102559509 A CN 102559509A
- Authority
- CN
- China
- Prior art keywords
- strain
- nematicide
- seawater
- screening
- branch
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides an acremonium strictum strain BH-0531 separated from a Bohai Bay water area and screening and an application thereof. The strain is collected in the China General Microbiological Culture Collection Center with the collection number of CGMCC No.5445. The strain is separated from a sample of bottom layer seawater in the Bohai Bay, and is obtained by screening and identifying. The BH-0531 strain separated and screened in the invention belongs to acremonium strictum (originally called cephalosporium), has the characteristics of low growing temperatures of marine microorganisms and growth under high-salt conditions, and has the capability of producing nematicidal active metabolic products; produced nematicidal substances have high thermal stability and water solubility; the nematicidal activity can be over 94 percent under experimental conditions; and the acremonium strictum strain BH-0531 can be applied to fermentation production of bioactive substances such as nematicides, antibiotics and the like.
Description
Technical field
The invention belongs to Living marine resources and microbial strains, be embodied in a kind of separation from the nematicide branch top in waters, Bohai Sea Gulf the spore trichoderma strain (
Acremonium cephalosporium) BH-0531 and screening and application.
Background technology
Nematode is as one type of important pathogen, and its harm has become the major issue on the agricultural and forestry production.The plant nematode that the whole world has been reported reaching 200 more belong to 5000 surplus kind.The plant nematode disease brings nearly 1,250 hundred million dollars financial loss for the whole world agricultural every year, is only second to fungal disease.Therefore, administer soil and plant nematode and become a major issue global, that urgent will solve.The chemistry nematode killing agent; Like the early stage monobromethane that the occurs forties, amino formate and organophosphorus compounds etc. appear in the later stage fifties, are mostly poisonous agricultural chemicals; Come to light teratogenesis, severe toxicity effect such as carcinogenic, have serious 3R problem simultaneously: resistance, drug residue, insect are ferocious again to stick up.Along with the enhancing of human environmental consciousness, biological control has become the leading of control of nematode.
Mikrobe is one type of miscellaneous renewable resources, is the abundantest genetic storehouse, also is the important natural enemy of plant pathogeny line insect, and secondary metabolite is the important source of biologically active substance.
The first-generation nematode biological prevention and control agent of exploitation mainly is the viable bacteria body preparation at present, wherein studies maximum biological and ecological methods to prevent plant disease, pests, and erosion factors and comprises: nematode-trapping fungi, inner parasitic epiphyte and parasitics bacterium.But the viable bacteria body preparation is owing to the mutual restraining effect of various degrees between the micro-flora in the soil ecosystem; The unstable and the discordance that cause live body biocontrol microorganisms control effect in the Different Soil of country variant make its use be very limited.
The secondary metabolite of fungi plays a role with the mode that directly acts on the farm crop nematode as the s-generation nematode biological and ecological methods to prevent plant disease, pests, and erosion factor, has that effect is fast, drug effect is high, Environmental compatibility good, is not easy to cause advantage such as secondary pollution.The eelworm-killing activity metabolite of having found has been added up 179 kinds more than, comprises alkaloids, polypeptide class, terpene, Macrolide, oxa-lopps, benzo class, quinones, fats, simple aromatics etc.But stay in the laboratory study stage more, and be water-soluble relatively poor lipid-soluble substance mostly, need come hydrotropy through adding synergistic agent, this has caused difficulty for practical application.Therefore, developing efficient, low toxicity, relative specificity and cheap mikrobe nematode killing agent, will be research emphasis from now on.
The ball total area 71% is taken up an area of in the ocean, and tellurian 80% is lived in the ocean.The special environment space in ocean has been brought up the unique secondary metabolism circulation of sea life, and the genetic background and the pathways metabolism that develop and to be different from terrestrial organism are the precious resources of seeking new drug or lead compound.Cephalosporin C is the microbiotic that from thalassiomycetes, is separated to the earliest, and the research exponentially of after this relevant this respect increases, and filters out two strain nematicide thalassiomycetess from the ocean, South Australia like Australian Capon study group
Aspergillus caneusWith
Raspailia sp(Caponn RJ, 2003).Xiao Yongtang etc. (2005) carry out the nematicide toxicity test to 188 strain thalassiomycetes metabolites, and the bacterial strain that the virulence rank reaches the A level accounts for 1.60%; And the bacterial strain that mortality ratio reaches more than 50% accounts for 43.1% of sum.Zheng Zhonghui etc. (2005) observe rhabditis axei effect phenomenon a strain thalassiomycetes metabolite, think a kind of nerve poison.Showed the potential of thalassiomycetes in the nematicide field.
Summary of the invention
One object of the present invention is to overcome deficiency and the deficient problem of nematocides High-efficient Production microorganism resource that exists in the existing nematocides, thus the thread thalassiomycetes branch of the Bohai Sea Gulf nematicide top spore trichoderma strain BH-0531 bacterial strain (preserving number CGMCC-5445) that provides a strain to have the nematicide function.
Another object of the present invention is to provide the screening method of the thread thalassiomycetes branch of nematicide top, a kind of Bohai Sea Gulf spore trichoderma strain.
Also purpose of the present invention is to provide the thread thalassiomycetes branch of nematicide top, a kind of Bohai Sea Gulf spore trichoderma strain BH-0531 bacterial strain to be used for the application that agricultural insecticide, biological pesticide and antibiotic fermentation are produced in preparation as biologically active substance.
For realizing above-mentioned purpose, the invention provides following technical scheme:
The thread thalassiomycetes branch of nematicide top, a kind of Bohai Sea Gulf spore trichoderma strain (
Acremonium cephalosporium) the BH-0531 bacterial strain, its preserving number at China Committee for Culture Collection of Microorganisms common micro-organisms center is: CGMCC-5445.The preservation time: 2011-11-4.This bacterial classification by pick up from the Bohai Sea (117 ° 53 ' 23.2 of longitude E ", separate in 38 ° of 55 ' 51.0 ") bottom of latitude N seawater sample.
Colony characteristics: 26 ℃ of 7d diameter 33-35mm on Cha Shi agar, 14d reaches 50-65 mm; Initial quality carpet shape; Primary mycelium white is pale yellow to baby pink with the incubation time prolongation, and quality becomes the opaque shape because a large amount of sporebearers fall, and colony edge is closely neat; No transudate; The bacterium colony reverse side is shallow tangerine or yellow.
The mycelia characteristic: have separated, thinner, diameter (2.0 ± μ m); Conidiophore bears from mycelia, and is upright, and short and small, end is gradually thin, and the top is spherical, and that living spore estranged does not have is separated, be mostly oval, major diameter 3.0~4.0 μ m, and minor axis diameter 2.1 ± μ m, wall is bordering on smooth.
Branch top spore mould BH-0531 bacterial strain be under the jurisdiction of a mould genus of top spore (
AcremoniumBe once called as Cephalosporium,
Cephalosporium.).This bacterial strain has at sea water medium and do not contain on the substratum such as the Cha Shi of seawater, PDA grows, and produces the performance of nematicide isoreactivity material, and the active substance eelworm-killing activity that is produced is high, also can suppress the growth of fungi and bacterium.Therefore can be applicable to fermentative prodn fields such as nematicide biological prevention and control agent, biological pesticide and microbiotic.
The mortality ratio that screening of the present invention refers to nematode is that index is estimated the nematicide ability of bacterial strain.
The present invention further discloses the screening method of the thread thalassiomycetes branch of Bohai Sea Gulf nematicide top spore trichoderma strain BH-0531, it is characterized in that:
(1) separation of bacterial classification, purifying:
Sample is from the bottom seawater in Bohai Sea Gulf; Via hole diameter 0.45 μ m nitrocellulose filter (f50) places filter membrane on the seawater solid medium after filtering, and obtains bacterium colony in 26 ℃ of constant temperature culture; The monospore method is chosen in employing; Change it over to new flat board and cultivate, this process is carried out repeatedly, till the bacterium colony purifying; Described seawater solid medium: glucose 10g/L, peptone 2g/L, yeast extract paste 2g/L, seawater 600mL/L, zero(ppm) water 400mL/L, agar 20 g/L;
(2) screening of bacterial classification:
1) bacterial classification inoculation with above-mentioned separation and purification carries out the shake flask fermentation cultivation in liquid nutrient medium, and the nutrient solution via hole diameter after the fermentation culture is 0.22 μ m membrane filtration, collects to obtain ferment filtrate; Wherein said liquid nutrient medium is meant Cha Shi liquid nutrient medium: NaNO
32 g/L, K
2HPO
41 g/L, KCl 0.5 g/L, MgSO
40.5 g/L, FeSO
40.01 g/L, sucrose 30 g/L, PH nature;
Or seawater liquid nutrient medium: glucose 10g/L, peptone 2g/L, yeast extract paste 2g/L, seawater 600mL/L, zero(ppm) water 400mL/L;
Culture condition is: inoculum size 2 * 10
6Spore suspension, rotating speed 120r/min, initial pH6.5,26 ℃ of fermentation 96h;
2) use 24 porocyte culture plates, in every hole, add 1mL ferment filtrate and 100 μ L nematode suspensions (average 1500 nematodes/100 μ L), 26 ℃ leave standstill 3d, and behind the 5d, anatomical lens is the statistics nemic death rate down; Obtain behind the separation screening to have the nematicide function from the thread thalassiomycetes branch of Bohai Sea Gulf nematicide top spore trichoderma strain BH-0531, its virulence rank reaches the A level of mortality ratio >=90%;
(3) optimization of spawn culture condition:
The substratum of optimizing is: peeling yam 150g/L, glucose 10g/L, yeast extract paste 2g/L, seawater content 600ml/L; Wherein removing the peel yam 150g/L refers to: peeling yam 150g puts liquor in the 400mL zero(ppm) water, and taking juice is settled to 400mL again;
The culture condition of optimizing is: inoculum size 2 * 10
6Spore suspension, rotating speed 120r/min, initial pH6.5,26 ℃ of fermentation 96h; Cultivation obtains the thread thalassiomycetes branch of nematicide top spore trichoderma strain.
The screening that reaches according to the invention is meant and utilizes nemic death rate as index; Nematicide ability through to bacterial strain is estimated; With nemic death rate high (mortality ratio >=90%) is the standard implementation screening, and said nematode is pine wood nematode (being provided by the agricultural AS of China Institute of Plant Protection).
The present invention separates to obtain and to confirm to have from Bohai Sea water area and kills the active BH-0531 bacterial strain of line and under this background, utilize nemic death rate as index with exactlying, fermentation is influenced culture condition such as bigger pH value, inoculum size, culture temperature, incubation time and carbon nitrogen source and content thereof through experiment and is optimized and obtains.
It kills the line activity and reaches A level (>=90%), and the available culture medium culturing that does not contain seawater is applicable to conventional fermentation equipment.The nematicide material that this bacterium produces is neutral, water-soluble, heat-resisting active substance, molecular weight < 6000 D.This material also is proved has the bacteriostatic action that suppresses yeast and bacterium.Bacterial strain is confirmed as through the observation evaluation and the ITS sequential analysis of classical classification indicators
Acremonium cephalosporium.BH-0531.
The present invention further discloses the thread thalassiomycetes branch of Bohai Sea Gulf nematicide top spore trichoderma strain BH-0531 bacterial strain and be used for the application that agricultural insecticide, biological pesticide and antibiotic fermentation are produced as biologically active substance in preparation.Wherein said agricultural insecticide, biological pesticide and microbiotic object are plant pathogeny line insect, plant pathogenic fungi and plant pathogenetic bacteria.
The more detailed explanation of the present invention is following:
One, concrete technical support
(1) microbial name and preservation situation
The mould BH-0531 bacterial strain of branch top spore.This bacterial classification at the preserving number at China Committee for Culture Collection of Microorganisms common micro-organisms center is: CGMCC-5445, preservation time: 2011-11-4.
The biological characteristics of (2) bacterial strain and evaluation
1. the morphological feature of branch top spore mould BH-0531 bacterial strain
Colony characteristics: 26 ℃ of 7d diameter 33-35mm on Cha Shi agar, 14d reaches 50-65 mm; Initial quality carpet shape; Primary mycelium white is pale yellow to baby pink with the incubation time prolongation, and quality becomes the opaque shape because a large amount of sporebearers fall, and colony edge is closely neat; No transudate; The bacterium colony reverse side is shallow tangerine or yellow.
The mycelia characteristic: have separated, thinner, diameter (2.0 ± μ m); Conidiophore bears from mycelia, and is upright, and short and small, end is gradually thin, and the top is spherical, and that living spore estranged does not have is separated, be mostly oval, major diameter 3.0~4.0 μ m, and minor axis diameter 2.1 ± μ m, wall is bordering on smooth.
According to " bacteriology is complete works of " (Qiu Weifan; Bacteriology complete works of [M]. Beijing: Science Press; 1998:890) with " common and commonly used fungi " (Institute of Microorganism, Academia Sinica [M]. Beijing: Science Press; 1973), this bacterium characteristic conforms to a branch top spore mould characteristic, the utmost point like the cephalosporium acremonium described in " common and commonly used fungi " (
Cephalosporium acremonium.).
2. 18S rDNA ITS sequential analysis and qualification result
Sequencing result: connect product and after transforming, check order, be about 500bp by the big Gene science sequencing fragment length of Beijing China, sequencing result is following:
GGCAAAGGAGTCACTCCAACCCCTGTGACATACCTATGTTGCTTCGGCGG
GCCGTCCCGCGGCGCGCCCACGTGGCGTGACCCGGAACCAGGCGCCCGCC
GGGGACCCAAACTCTTGCCTTTTTAGTGTCTCCTCTGAGTGGCATAAGCA
AAAATAAACAAAACTTTCAGCAACGGATCTCTTGGTTCTGGCATCGATGA
AGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT
CATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATG
CCTGTCTGAGCGTCATTTCAACCCTCAGCCCCCGTTCGCGGGGCGCTGGC
GTTGGGGATCGGCCGTCCTCGCGGCGGCCGGCCCCGAAACACAGTGGCGG
TCTCCTGCAGACTCCCCTGCGTAGTAGCACTACCTCGCAGAAGGGACGAG
CGGGCTGGCCACGCCGTAAAACCCCCAACTTCTCCAGGTTGACCTCAGAT
CAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGAA
Sequence is submitted to the Gen-Bank DB; Carry out the BLAST comparison, the result shows that this bacterial strain ITS sequence and Acremonium sp. NJM 0672, Acremonium sp. NJM 0567 homology are 100% (both all are located away from the mantis shrimp body of Japanese marine site fungi infestation); Be 99% with Emericellopsis maritima strain, Emericellopsis maritima strain, Emericellopsis sp. r454, Emericellopsis sp. s030 homology (Emericellopsis is for found to have the Acremonium kind of perfect stage).Combining form is learned qualification result, with this bacterium confirm as a mould BH-0531 of top spore (
Acremonium cephalosporium).
The separation of (3) bacterial classification, screening
1. the separation of bacterial classification, purifying
Pick up from the Bohai Sea (117 ° 53 ' 23.2 of longitude E ", the sample of 38 ° of 55 ' 51.0 ") bottom of latitude N seawater places filter membrane on the seawater solid medium, in 26 ℃ of constant temperature culture after 0.45 μ m nitrocellulose filter (f50, commercially available) filters.The monospore method is chosen in employing, changes it over to new flat board and cultivates.This process is carried out repeatedly, till the bacterium colony purifying.Described seawater solid medium: glucose 10g/L, peptone 2g/L, yeast extract paste 2g/L, seawater 600mL/L, zero(ppm) water 400mL/L, agar 20 g/L.
2. the screening of bacterial classification
(2) screening of bacterial classification:
1) bacterial classification inoculation with above-mentioned separation and purification carries out the shake flask fermentation cultivation in liquid nutrient medium, and the nutrient solution via hole diameter after the fermentation culture is that the collected filtrating of 0.22 μ m filter membrane (commercially available) filtration is ferment filtrate;
Wherein said liquid nutrient medium is meant Cha Shi liquid nutrient medium: NaNO
32 g/L, K
2HPO
41 g/L, KCl 0.5 g/L, MgSO
40.5 g/L, FeSO
40.01 g/L, sucrose 30 g/L, PH nature; Or seawater liquid nutrient medium: glucose 10g/L, peptone 2g/L, yeast extract paste 2g/L, seawater 600mL/L, zero(ppm) water 400mL/L;
2) use 24 porocyte culture plates, in every hole, add 1mL ferment filtrate and 100 μ L nematode suspensions (average 1500 nematodes/100 μ L), 26 ℃ leave standstill 3d, and behind the 5d, anatomical lens is the statistics nemic death rate down; The nematicide branch top spore trichoderma strain BH-0531 that acquisition has the nematicide function behind the separation screening from the waters, Bohai Sea Gulf, its virulence rank reaches the level of mortality ratio >=90% A; Culture condition is: rotating speed 120r/min, initial pH6.5,26 ℃ of fermentation 96h.In China Committee for Culture Collection of Microorganisms's common micro-organisms center preservation, preserving number is this bacterial classification: CGMCC-5445.
3. the optimization of culture condition:
3.1 initial pH is to producing the influence that nematocidal active material produces: the result is as shown in table 1; The result shows that original ph raises with the pH value at 6.5 its lytic activities when following; PH reached active higher and relatively stable at 6.5 to 7.5 o'clock, and pH has decline again to 8 after product activity.
The initial pH of table 1 is to the influence of strain growth with nematocidal active material formation:
Original ph | Dry cell weight (g/L) | Nemic death rate behind the 3d (%) | Nemic death rate behind the 5d (%) |
4 | 2.4±0.2 | 61.07 | 74.36 |
4.5 | 3.3±0.2 | 61.12 | 74.58 |
5 | 3.3±0.2 | 66.67 | 75.12 |
5.5 | 3.4±0.2 | 74.64 | 79.56 |
6 | 3.7±0.2 | 83.65 | 88.77 |
6.5 | 3.9±0.2 | 85.50 | 93.55 |
7 | 3.4±0.2 | 85.87 | 93.17 |
7.5 | 3.0±0.2 | 90.10 | 95.61 |
8 | 2.9±0.2 | 75.96 | 86.35 |
8.5 | 2.8±0.2 | 64.32 | 75.83 |
9 | 2.5±0.2 | 49.32 | 60.28 |
Contrast | —— | 1.41 | 3.25 |
3.2 the influence that dissolved oxygen produces BH-0531 strain growth and generation nematocidal active material:
Study the influence of dissolved oxygen through adopting different shaking speed and different liquid amounts to BH-0531 strain growth and nematocidal active material formation.The result is shown in table 2, table 3:
The influence that table 2 shaking speed forms strain growth and nematocidal active material:
Shaking speed (r/min) | Dry cell weight (g/L) | Nemic death rate behind the 3d (%) | Nemic death rate behind the 5d (%) |
100 | 3.5±0.2 | 52.82 | 78.19 |
120 | 3.9±0.2 | 71.67 | 94.22 |
150 | 3.4±0.2 | 60.42 | 83.37 |
170 | 3.0±0.2 | 54.88 | 72.66 |
Contrast | —— | 2.44 | 4.00 |
The influence that table 3 liquid amount forms strain growth and nematocidal active material:
Liquid amount (mL) | Dry cell weight (g/L) | Nemic death rate behind the 3d (%) | Nemic death rate behind the 5d (%) |
50 | 2.4±0.2 | 36.30 | 68.54 |
75 | 3.3±0.2 | 70.12 | 83.14 |
100 | 3.6±0.2 | 82.06 | 95.20 |
125 | 3.9±0.2 | 79.62 | 85.71 |
150 | 3.2±0.2 | 74.71 | 76.87 |
200 | 2.9±0.2 | 55.61 | 55.88 |
Contrast | —— | 3.04 | 4.79 |
The result shows that during rotating speed 120r/min, thalli growth is best during liquid amount 100mL, and the thalline living weight is moderate, and the ferment filtrate eelworm-killing activity reaches the highest.
3.3 culture temperature is to producing the influence that nematocidal active material produces
Table 4 result shows that in the optimal temperature scope, thalli growth becomes positive correlation with temperature, and wherein bacterial metabolism thing eelworm-killing activity is the highest 26 ℃ the time, and thalli growth is comparatively vigorous:
Table 4 treatment of different temperature is killed the influence of line rate and dry cell weight to bacterial strain:
Temperature (℃) | Dry cell weight (g/L) | Nemic death rate behind the 3d (%) | Nemic death rate behind the 5d (%) |
15 | 2.0±0.2 | 19.17 | 30.07 |
20 | 3.1±0.2 | 42.36 | 63.94 |
22 | 3.6±0.2 | 55.28 | 70.74 |
24 | 3.9±0.2 | 73.562 | 83.45 |
26 | 4.0±0.2 | 81.59 | 94.14 |
28 | 4.2±0.2 | 81.38 | 91.11 |
Contrast | —— | 3.98 | 8.10 |
3.4 different carbon, nitrogen, growth factor proportioning are to producing the influence of nematicide active substance:
With carbon source, nitrogenous source, three trophic factors of growth factor (yeast extract paste) are selected L16 (4 for use as research object
3) orthogonal table, 4 levels of each factor design, the result is as shown in table 5; The different carbon sources of table 5 substratum, nitrogenous source, the growth factor proportioning
BH-0531 bacterial strain metabolite is killed the influence of line activity (5d) and thalli growth
Table 5 is the result show, when 3 kinds of factor content were low, thalline breeding quantity was few, is unfavorable for the accumulation of product; When 3 kinds of factor content were higher, thalli growth was too vigorous, was unfavorable for its accumulation secondary metabolite, and was prone to cause thalline to shift to an earlier date old and feeble self-dissolving.When having only three kinds of factor content moderate, thalli growth is moderate, is beneficial to fermented liquid and kills the accumulation of line active metabolite.
Range analysis and The results of analysis of variance show; Carbon source is the most remarkable to activity influence, and each factor to the active order that influences is: glucose>yeast extract paste>potato fruit, its allocation optimum is glucose 10g/L; Yeast extract paste 2g/L; Peeling yam 150g/L, this moment, thalli growth was moderate, and fermented liquid obtains maximum eelworm-killing activity.
3.5 seawater content is to producing the influence of nematicide active substance
The result is shown in table 6, and sea water medium seawater content is less to BH-0531 strain growth influence, and the generation of eelworm-killing activity metabolite is had considerable influence.The upgrowth situation of thalline was better when wherein content was every 400-600 mL/L, and to kill the line ability the strongest for fermented liquid when content was 600mL/L, shows that the BH-0531 bacterial strain has marine microorganism property characteristic, and promptly seawater helps strain for accumulating specific metabolic thing.
The different seawater content of table 6 substratum kill the influence of line activity (5d) and thalli growth to bacterial strain metabolite to be measured
According to above-mentioned result of study, the optimization culture condition of the ocean filamentous fungus that the present invention screened-mould BH-0531 bacterial strain of branch top spore is: peeling yam 150g/L, glucose 10g/L, yeast extract paste 2g/L, seawater content 600ml/L.Inoculum size 2 * 10
6Spore suspension, rotating speed 120r/min, initial pH6.5,25~26 ℃ of fermentation 96h.
(4) property analysis of nematocidal active material
It is that 0.22 μ m filter membrane (commercially available) filters the meta-bolites ferment filtrate that is the bacterial classification of wanting that cultured fermented liquid is used the aperture.Further adopting the molecular weight that dams is that the UEOS-503 type hollow fiber film assembly (Tianjin MoTian Membrane Engineering Technology Co., Ltd) of 6000dalton carries out the ultrafiltration classification to ferment filtrate, and the filtrating of acquisition is ultrafiltrated, is used for property analysis.
1. the thermostability and the pH that kill the line active substance change killing the influence of line active substance in the ferment filtrate
Can be known that by table 7 ferment filtrate of BH-0531 still keeps better line activity extremely behind 121 ℃ of processing 20min, its activity remains on former active more than 95%.The nematocidal active material that its generation is described has good thermostability.And the activity change after fermenation raw liquid and the accent neutrality and not obvious all has and kills the line activity preferably.Because China's soil generally has southern meta-acid north meta-alkalescence characteristic, under neutrallty condition, has active material and demonstrates good soil Application prospect.
Table 7 differing temps and pH change the influence that active metabolite is killed line rate (%)
Treatment temp | 121℃? 20min | Room temperature | Contrast (water) | Action time |
? | 86.25 | 90.13 | 0.00 | 3d |
? | 89.34 | 93.85 | 2.01 | 5d |
pH | Ferment filtrate, 5.1 | Transfer neutral | Contrast (water) | ? |
? | 93.85 | 94.73 | 1.00 | 3d |
2. the dissolubility test of fermentating liquid filtrate active substance
Ultrafiltrated is processed dry powder be used for dissolubility test, the result is as shown in table 8.Experimental result explanation, the BH-0531 fermentating metabolism product is soluble in water, is partially dissolved in the methyl alcohol ether, slightly soluble or be insoluble to other organic solvents.
Table 8 solvent solubility and to kill line active
Processing mode | Water | Methyl alcohol | Ether | Propyl carbinol | ETHYLE ACETATE | Sherwood oil |
Supernatant | A | B | C | C | D | D |
Deposition | —— | C | C | B | B | B |
Water (contrast) | D | —— | —— | —— | —— | —— |
Annotate: A level mortality ratio >=90%; B level 90% ﹥ mortality ratio >=70%; C level 70% ﹥ mortality ratio >=50%; D level mortality ratio ﹤ 50%.
Four, application advantage of the present invention
1. culture condition is simple
Before address; The ocean filamentous fungus that the present invention screened-mould BH-0531 bacterial strain of branch top spore is at sea water medium and do not contain in the substratum of seawater and all can grow preferably; Its living weight does not receive the influence of seawater content basically, and the difference of the eelworm-killing activity of actives on different substratum is little.The culture temperature of this bacterium is 26 ℃, less demanding to energy consumption, and its nutraceutical matrix raw material that is suitable for is easy to get, and need not special growth factor.Therefore all has suitability in landlocked and coastland.
2. the thermostability of nematicide material and water-soluble strong, safe in utilization, easy to operate
It kills ocean provided by the present invention filamentous fungus-mould BH-0531 bacterial strain of branch top spore line and has very strong thermostability and water-soluble from active substance, has overcome the deficiency of existing nematocides non-refractory and organic solvent dissolution property.Therefore bring convenience to actually operating, need not to keep away temperature and preserve, avoided potential hazard and residue problem with an organic solvent.
3. the applicable pH of nematicide material is between 5~8, and is applied widely.
Before address, it kills ocean provided by the present invention filamentous fungus-mould BH-0531 bacterial strain of branch top spore line and between pH5~8, has preferably active (seeing table 1 and table 8) from active substance.Because China's soil generally has southern meta-acid north meta-alkalescence characteristic, thereby demonstrates comparatively broad soil Application scope.
4. nematicide is effective
Above table 1~8 serve as to follow the tracks of to detect index with the nematicide rate all; Demonstrate ocean provided by the present invention filamentous fungus-mould BH-0531 bacterial strain of branch top spore and under single factors and composite factor condition, all have nematicide effect relatively preferably; Particularly under optimized conditions, its nematicide effect reaches the A level.
Description of drawings:
Fig. 1 is the form of BH-0531 bacterial strain on substratum for a-f; Wherein: a BH-0531 Cha Shi cultivates 2d; B BH-0531 Cha Shi cultivates 7d, and c BH-0531 Cha Shi cultivates 14d (front), and d BH-0531 Cha Shi cultivates 14d (reverse side); E BH-0531 sea water medium colonial morphology, the sub-form of f BH-0531 seawater liquid culture basal growth;
Fig. 2 shows BH-0531 bacterial strain microscopic features for g-j; Wherein: g h shows the BH-0531 aerial hyphae, the i primary hyphae, and j shows conidium, k shows BH-0531 spore head;
Fig. 3 is the detected 4 kinds of components of performance liquid;
Fig. 4 is the UV scanning absorption peak of water component;
Fig. 5 is active result SQ-1 infrared detection result;
Fig. 6 is the bacteriostatic action qualitative results of BH-0531 bacterial strain metabolite; Wherein: a is to the restraining effect of bacterium, and b is to saccharomycetic restraining effect.
Embodiment
Below in conjunction with embodiment the present invention is described; The scheme of embodiment described here; Do not limit the present invention; One of skill in the art can make improvements and change according to spirit of the present invention, and described these improvement and variation all should be regarded as within the scope of the invention, and scope of the present invention and essence are limited claim.The raw material of wherein said various substratum unless otherwise indicated, other all has commercially available.
The mould BH-0531 bacterial strain of screening branch top spore
(1) separation of bacterial classification, purifying
The sample that picks up from the Bohai Sea (117 ° 53 ' 23.2 of longitude ", 38 ° 55 ' 51.0 in latitude ") bottom seawater places filter membrane on the seawater solid medium, in 26 ℃ of constant temperature culture after 0. 45 μ m nitrocellulose filters (diameter 50, commercially available) filter.Monospore is chosen in employing, changes it over to new flat board and cultivates.This process is carried out repeatedly, till the bacterium colony purifying.Described seawater solid medium: glucose 10g/L, peptone 2g/L, yeast extract paste 2g/L, seawater 600mL/L, zero(ppm) water 400mL/L, agar 20g/L.
(2) screening of bacterial classification:
1) bacterial classification inoculation with above-mentioned separation and purification carries out the shake flask fermentation cultivation in liquid nutrient medium, and the nutrient solution via hole diameter after the fermentation culture is that the collected filtrating of 0.22 μ m filter membrane (commercially available) filtration is ferment filtrate;
Wherein said liquid nutrient medium is meant Cha Shi liquid nutrient medium: NaNO
32 g/L, K
2HPO
41 g/L, KCl 0.5 g/L, MgSO
40.5 g/L, FeSO
40.01 g/L, sucrose 30 g/L, PH nature; Or seawater liquid nutrient medium: glucose 10g/L, peptone 2g/L, yeast extract paste 2g/L, seawater 600mL/L, zero(ppm) water 400mL/L;
2) use 24 porocyte culture plates, in every hole, add 1mL ferment filtrate and 100 μ L nematode suspensions (average 1500 nematodes/100 μ L), 26 ℃ leave standstill 3d, and behind the 5d, anatomical lens is the statistics nemic death rate down; The nematicide branch top spore trichoderma strain BH-0531 that acquisition has the nematicide function behind the separation screening from the waters, Bohai Sea Gulf, its virulence rank reaches the A level of mortality ratio >=90%; Culture condition is: rotating speed 120r/min, initial pH6.5,26 ℃ of fermentation 96h.
Through the bacterial strain of the present invention from the waters, Bohai Sea Gulf-branch top spore trichoderma strain BH-0531 (CGMCC-5445) that above step separation screening acquisition has the nematicide function, its virulence rank reaches the A level.
(3) biological assay:
Colony characteristics: 25 ℃ of 7d diameter 35mm on Cha Shi agar, 14d reaches 50 mm; Initial quality carpet shape; Primary mycelium white is baby pink with the incubation time prolongation, and quality becomes the opaque shape because a large amount of sporebearers fall, and colony edge is closely neat; No transudate; The bacterium colony reverse side is shallow tangerine or yellow.
The mycelia characteristic: have separated, thinner, diameter (2.0 ± μ m); Conidiophore bears from mycelia, and is upright, and short and small, end is gradually thin, and the top is spherical, and that living spore estranged does not have is separated, be mostly oval, major diameter 3.0 ± μ m, and minor axis diameter 2.1 ± μ m, wall is bordering on smooth.
18S rDNA ITS sequential analysis is identified: sequence is submitted to the Gen-Bank DB, carries out the BLAST comparison, and by homology and priority principle, combining form is learned CHARACTERISTICS IDENTIFICATION kind status.Identify bacterial strain of the present invention-branch top spore trichoderma strain BH-0531 (CGMCC-5445) through above step from the waters, Bohai Sea Gulf.
Embodiment 2
The cultivation of branch top spore trichoderma strain BH-0531 (CGMCC-5445):
Best substratum is: peeling yam 150g/L, glucose 10g/L, yeast extract paste 2g/L, seawater content 600ml/L; Described peeling yam 150g/L refers to: peeling yam 150g puts liquor in the 400mL zero(ppm) water, and taking juice is settled to 400mL again;
Optimal culture condition is: the spore suspension of inoculum size 2 * 106, rotating speed 120r/min, initial pH6.5,26 ℃ of fermentation 96h.
Embodiment 3
Branch top spore trichoderma strain BH-0531 (CGMCC-5445) nematicide condition is wide in range, suitability is wide:
The ferment filtrate of BH-0531 bacterial strain still keeps better line activity extremely behind 121 ℃ of processing 20min, its activity remains on former active more than 95%, ferment filtrate applicable pH also more wide in range (referring to table 7), fermentating metabolism product good water solubility (table 8).Because China's soil generally has southern meta-acid north meta-alkalescence characteristic, the nematocidal active material that branch top spore trichoderma strain BH-0531 produces has more advantage in practicing, and has realized overcoming the shortcoming mostly existing nematocides is organic dissolubility, poorly water-soluble.
Embodiment 4
Nematicide branch top spore trichoderma strain (
Acremonium cephalosporium) application of BH-0531 bacterial strain in sterilant (plant pathogeny line insect) and biological pesticide:
In root knot nematode harm serious cucumber and tomato planting booth (Beichen District Han Jia villa, Tianjin), before transplanting seedlings, the ferment filtrate of bacterial strain of the present invention-branch top spore trichoderma strain BH-0531 is pressed every canopy (300m
2) the 2000mL consumption, add the equivalent clear water, the thin equably spray face of land, the shallow then earth of digging, the field planting of transplanting seedlings again is contrast with the clear water.Detect root bind up one's hair living situation and population density when uprooting plants after their edible portions have been harvested, uses strain fermentation filtrating of the present invention, population density contrast descends more than 30%, root knot incidence minimizing 20%.
Embodiment 5
The application of bacterial strain of the present invention-branch top spore trichoderma strain BH-0531 in antibiotic fermentation (plant pathogenic fungi and bacterium) is produced:
With G-bacterium intestinal bacteria, G+ bacterium streptococcus aureus (purchase of DSMZ of the Chinese Academy of Sciences) is target bacteria; For the target fungi bacterial strain of the present invention-branch top spore trichoderma strain BH-0531 is carried out the qualitative and semi-quantitative analysis of antibacterial ability with yeast (saccharomyces fragilis 413, DSMZ of the Chinese Academy of Sciences buys).Qualitative results shows that branch top spore trichoderma strain BH-0531 fermenation raw liquid has tangible bacteriostatic action with filtrating to target bacteria, and particularly obviously (Fig. 6 a) to the effect of G-bacterium intestinal bacteria; Saccharomycetic bacteriostatic action is also reached obvious degree (Fig. 6 b).The sxemiquantitative analytical results of tiring shows that filtrating is diluted at 1/4 o'clock and still has 50% bacteriostatic activity.
In sum; Each item claim and technical support that the present invention " the thread thalassiomycetes of Bohai Sea Gulf nematicide-mould screening and the application of branch top spore " is addressed are clear and definite, and any modification that all foundations technical support essence of the present invention is done still belongs in the scope of technical support of the present invention with variation.
SEQUENCE?LISTING
< 110>Tianjin Normal University
< 120>mould screening and the application of the thread thalassiomycetes branch of Bohai Sea Gulf nematicide top spore
<160> 1
<170> PatentIn?version?3.5
<210> 1
<211> 548
<212> DNA
<213> Acremonium?cephalosporium
<400> 1
ggcaaaggag?tcactccaac?ccctgtgaca?tacctatgtt?gcttcggcgg?gccgtcccgc 60
ggcgcgccca?cgtggcgtga?cccggaacca?ggcgcccgcc?ggggacccaa?actcttgcct 120
ttttagtgtc?tcctctgagt?ggcataagca?aaaataaaca?aaactttcag?caacggatct 180
cttggttctg?gcatcgatga?agaacgcagc?gaaatgcgat?aagtaatgtg?aattgcagaa 240
ttcagtgaat?catcgaatct?ttgaacgcac?attgcgcccg?ccagtattct?ggcgggcatg 300
cctgtctgag?cgtcatttca?accctcagcc?cccgttcgcg?gggcgctggc?gttggggatc 360
ggccgtcctc?gcggcggccg?gccccgaaac?acagtggcgg?tctcctgcag?actcccctgc 420
gtagtagcac?tacctcgcag?aagggacgag?cgggctggcc?acgccgtaaa?acccccaact 480
tctccaggtt?gacctcagat?caggtaggaa?tacccgctga?acttaagcat?atcaataagg 540
cggaggaa 548
Claims (4)
- The thread thalassiomycetes branch of a Bohai Sea Gulf nematicide top spore trichoderma strain ( Acremonium cephalosporium) the BH-0531 bacterial strain, its preserving number at China Committee for Culture Collection of Microorganisms common micro-organisms center is: CGMCC-5445.
- 2. the screening method of the right 1 said Bohai Sea Gulf thread thalassiomycetes branch of a nematicide top spore trichoderma strain BH-0531 is characterized in that:(1) separation of bacterial classification, purifying:Sample is from the bottom seawater in Bohai Sea Gulf; Via hole diameter 0.45 μ m nitrocellulose filter (f50) places filter membrane on the seawater solid medium after filtering, and obtains bacterium colony in 26 ℃ of constant temperature culture; The monospore method is chosen in employing; Change it over to new flat board and cultivate, this process is carried out repeatedly, till the bacterium colony purifying; Described seawater solid medium: glucose 10g/L, peptone 2g/L, yeast extract paste 2g/L, seawater 600mL/L, zero(ppm) water 400mL/L, agar 20 g/L;(2) screening of bacterial classification:1) bacterial classification inoculation with above-mentioned separation and purification carries out the shake flask fermentation cultivation in liquid nutrient medium, and the nutrient solution via hole diameter after the fermentation culture is 0.22 μ m membrane filtration, collects to obtain ferment filtrate; Wherein said liquid nutrient medium is meant Cha Shi liquid nutrient medium: NaNO 32 g/L, K 2HPO 41 g/L, KCl 0.5 g/L, MgSO 40.5 g/L, FeSO 40.01 g/L, sucrose 30 g/L, PH nature;Or seawater liquid nutrient medium: glucose 10g/L, peptone 2g/L, yeast extract paste 2g/L, seawater 600mL/L, zero(ppm) water 400mL/L;Culture condition is: inoculum size 2 * 10 6Spore suspension, rotating speed 120r/min, initial pH6.5,26 ℃ of fermentation 96h;2) use 24 porocyte culture plates, in every hole, add 1mL ferment filtrate and 100 μ L nematode suspensions (average 1500 nematodes/100 μ L), 26 ℃ leave standstill 3d, and behind the 5d, anatomical lens is the statistics nemic death rate down; Obtain behind the separation screening to have the nematicide function from the thread thalassiomycetes branch of Bohai Sea Gulf nematicide top spore trichoderma strain BH-0531, its virulence rank reaches the A level of mortality ratio >=90%;(3) optimization of spawn culture condition:The substratum of optimizing is: peeling yam 150g/L, glucose 10g/L, yeast extract paste 2g/L, seawater content 600ml/L; Wherein removing the peel yam 150g/L refers to: peeling yam 150g puts liquor in the 400mL zero(ppm) water, and taking juice is settled to 400mL again;The culture condition of optimizing is: inoculum size 2 * 10 6Spore suspension, rotating speed 120r/min, initial pH6.5,26 ℃ of fermentation 96h; Cultivation obtains the thread thalassiomycetes branch of nematicide top spore trichoderma strain.
- 3. the thread thalassiomycetes branch of nematicide top, right 1 said Bohai Sea Gulf spore trichoderma strain BH-0531 bacterial strain is used for the application that agricultural insecticide, biological pesticide and antibiotic fermentation are produced in preparation as biologically active substance.
- 4. right 2 described application, wherein said agricultural insecticide, biological pesticide and microbiotic object are plant pathogeny line insect, plant pathogenic fungi and plant pathogenetic bacteria.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110347979 CN102559509B (en) | 2011-11-07 | 2011-11-07 | Screening and application of Bohai Bay acremonium cephalosporium |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110347979 CN102559509B (en) | 2011-11-07 | 2011-11-07 | Screening and application of Bohai Bay acremonium cephalosporium |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102559509A true CN102559509A (en) | 2012-07-11 |
CN102559509B CN102559509B (en) | 2013-02-27 |
Family
ID=46406120
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201110347979 Expired - Fee Related CN102559509B (en) | 2011-11-07 | 2011-11-07 | Screening and application of Bohai Bay acremonium cephalosporium |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102559509B (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104974949A (en) * | 2014-04-08 | 2015-10-14 | 国家海洋局第一海洋研究所 | Screening method of insecticidal bacteria aiming to marine fish philasterides dicentrarchi antigen |
CN105199999A (en) * | 2015-11-15 | 2015-12-30 | 国家海洋局第一海洋研究所 | Zunongwangia profunda and application thereof |
CN115798588A (en) * | 2022-01-10 | 2023-03-14 | 北京理工大学 | Method for carrying out endophytic physiological screening capable of promoting accumulation of active products at root of Glycyrrhiza uralensis Fisch based on bioinformatics means |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101235355A (en) * | 2008-03-03 | 2008-08-06 | 中国热带农业科学院环境与植物保护研究所 | Plants endogenetic fungus and application thereof |
-
2011
- 2011-11-07 CN CN 201110347979 patent/CN102559509B/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101235355A (en) * | 2008-03-03 | 2008-08-06 | 中国热带农业科学院环境与植物保护研究所 | Plants endogenetic fungus and application thereof |
Non-Patent Citations (4)
Title |
---|
YUN-MEI BI等: "Metabolites from the Fungus Cephalosporium sp. AL031", 《ARCH PHARM RES》 * |
何培新等: "两种枝顶孢霉胞内细菌的分离鉴定及种群演替", 《生态学报》 * |
杨燕玲等: "顶头孢霉菌(Cephalosporium acremonium)原生质体融合研究", 《生物工程学报》 * |
袁理春等: "麻疯树根部内生真菌分离及鉴定", 《西南农业学报》 * |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104974949A (en) * | 2014-04-08 | 2015-10-14 | 国家海洋局第一海洋研究所 | Screening method of insecticidal bacteria aiming to marine fish philasterides dicentrarchi antigen |
CN104974949B (en) * | 2014-04-08 | 2018-02-13 | 国家海洋局第一海洋研究所 | A kind of screening technique for seawater fish shield infusorian cause of disease insecticidal bacteria |
CN105199999A (en) * | 2015-11-15 | 2015-12-30 | 国家海洋局第一海洋研究所 | Zunongwangia profunda and application thereof |
CN105199999B (en) * | 2015-11-15 | 2018-02-27 | 国家海洋局第一海洋研究所 | A kind of deep layer Wang Zunong Salmonella and its application |
CN115798588A (en) * | 2022-01-10 | 2023-03-14 | 北京理工大学 | Method for carrying out endophytic physiological screening capable of promoting accumulation of active products at root of Glycyrrhiza uralensis Fisch based on bioinformatics means |
CN115798588B (en) * | 2022-01-10 | 2024-02-20 | 北京理工大学 | Endophyte for promoting accumulation of active product of roots of uralensis, screening method and application |
Also Published As
Publication number | Publication date |
---|---|
CN102559509B (en) | 2013-02-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Saharan et al. | Sclerotinia diseases of crop plants: biology, ecology and disease management | |
CN103436450B (en) | Alkaline-tolerant and halophilic aspergillus strain and application thereof in environmental management | |
CN111254099B (en) | Streptomycete | |
Diene et al. | Pseudosigmoidea ibarakiensis sp. nov., a dark septate endophytic fungus from a cedar forest in Ibaraki, Japan | |
CN108192829B (en) | Streptomyces luteorusand biological control preparation and application thereof | |
CN111500644A (en) | Preparation method of composite bacteria fermentation product for preventing and treating phytophthora root rot of plants, composite bacteria fermentation product and application of composite bacteria fermentation product | |
CN104877950B (en) | The bacillus pumilus of one high-efficiency degradation Atrazine | |
CN104560827A (en) | Biocontrol actinomycete strain for preventing and controlling tobacco bacterial wilt and application thereof | |
CN103667136A (en) | Separation and identification of lysobacter antibioticus OH13 capable of antagonizing plant pathogenic bacteria | |
CN102191184B (en) | Biocontrol endophytic fungi-Alternaria alternata | |
CN105368720A (en) | Cotton fungal endophyte CEF-082 and application of cotton fungal endophyte CEF-082 in prevention and treatment of cotton verticillium wilt | |
CN102206593A (en) | Streptomyces aureoverticillatus strain and its application | |
CN103243030B (en) | Lecanicilliumpsalliotae strain used for preventing and treating diaphorina citri | |
CN113862156B (en) | Fusarium oxysporum (Fusarium oxysporum) K2018-1418 and application thereof | |
CN102204571A (en) | Application of Alternaria alternata metabolic product in controlling watermelon fusarium oxysporum | |
CN109628341B (en) | Streptomyces violaceorubidus and biological control microbial inoculum and preparation method thereof | |
CN102559509B (en) | Screening and application of Bohai Bay acremonium cephalosporium | |
Weinstein et al. | Ecological and physiological characterization of Humicola marvinii, a new psychrophilic fungus from fellfield soils in the maritime Antarctic | |
CN116463239B (en) | Streptomyces mirabilis BD2233, oil suspending agent and application thereof | |
CN102242066B (en) | Acremonium hansfordii Ahy1 and Acremonium hansfordii wettable powder | |
CN106434488A (en) | Entomopathogenic nematode symbiotic bacteria with soybean phytophthora root rot inhibiting function and application | |
CN102382775A (en) | Eelworm killing metarhizium and application thereof | |
CN110669675A (en) | Metarhizium anisopliae MANGS71814 and application thereof in control of potato tuber moth | |
Tanney et al. | The production of nematode-immobilizing secretory cells by Climacodon septentrionalis | |
CN114032182A (en) | Fungus with functions of antagonizing garlic root rot pathogenic bacteria and promoting growth |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130227 Termination date: 20171107 |