CN101118234A - Method for detecting bacillus coli inducing diarrhoea and hydropsy during pig weaning period and reagent kit thereof - Google Patents
Method for detecting bacillus coli inducing diarrhoea and hydropsy during pig weaning period and reagent kit thereof Download PDFInfo
- Publication number
- CN101118234A CN101118234A CNA2006100991739A CN200610099173A CN101118234A CN 101118234 A CN101118234 A CN 101118234A CN A2006100991739 A CNA2006100991739 A CN A2006100991739A CN 200610099173 A CN200610099173 A CN 200610099173A CN 101118234 A CN101118234 A CN 101118234A
- Authority
- CN
- China
- Prior art keywords
- gene
- escherichia coli
- virulence factor
- dna
- oedema
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a gene chip, a testing method and a testing reagent case used for testing E.coli serological type and virulent gene that cause diarrhea and hydropsy of piglets in the ablactation period. The gene chip is fixed on an oligonucleotide probe of a solid phase support, the gene chip is mainly to select DNA fragments from UDPG-glucosyltransferase and Oligosaccharide unit treatment enzyme gene on E.coli serological type O-antigen gene cluster and main E.coil virulent factors that cause diarrhea and hydropsy of piglets in the ablactation period. The gene chip and the designed primer can be used for testing and can be made into the reagent case. The product and the method of the present invention can realize the purpose of testing test the common diarrhea and hydropsy of piglets in the ablactation period which are caused by E.coil serological type and virulent factors. The present invention has the advantages of simple operation, high accuracy and strong repetition; and is of great significance to the study and diagnosis of epidemiology.
Description
Technical field
The present invention relates to detection method and kit, relate in particular to a kind of be used to detect cause pig weaning period diarrhoea and the e. coli serotype of oedema and the genetic chip and the kit of virulence factor.
Background technology
Pig weaning period diarrhoea (post-weaning diarrhea, PWD) and bowel oedema disease (porcine edema disease ED) is two kinds of important communicable diseases that cause piglet death, the present disease that pig industry is had important harm that become.PWD often betides wean back to 12 ages in week, and especially at back 14 days Nei Yifa of wean, dead peak is usually in 4-10 age in week.This disease occurrence cause has multiple, and wherein topmost is exactly the diarrhoea that enteropathogenic E causes.In pathogenic process, enteropathogenic E produces toxin and is absorbed by piglet, thereby causes a series of clinical symptoms and cause piglet death.ED is a kind of more common infectious disease of piglet, mainly betides the piglet about one week of wean, is by producing the infectiousness enterotoxemia that the cytotoxic Escherichia coli of vero cause.PWD and ED often betide same swinery, and the virulence factor of pathogen also has points of resemblance, and all are to cause that by having certain adhesion factor and can producing one or more ectotoxic coli strains adhesion factor can make Escherichia coli grow in small intestine surely.
The Escherichia coli that PWD is relevant with ED belong to limited several serotypes mostly.In a given zone, quite constant adhesion factor and the toxin of a serotype and a cover is closely related.The e. coli serotype that causes PWD and ED mainly contains O149, O138, O139, O141, O8, O147, O45, O157 (Kai Frydendahl, 2001).Relevant virulence factor mainly contains 6 kinds of adhesion factors and comprises F18 (107), F4 (K88), F5 (K99), F6 (987P), F41, intimin, and 5 kinds of toxin comprise STap, STb, LT, Stx2e, EAST1.In Denmark, in the 184 strain enteropathogenic Es that are separated in 28 to the 49 age in days diarrhea of weaned piglets samples, F18 (107) and F4 (K88) account for 44% and 36% (Ojeniyi etc., 1994 respectively; Ripying etc., 1995); In Germany, F18ab and F18ac in the 380 strain Escherichia coli that Wittig etc. are separated to from PWD and ED case (two kinds of different subtypes of F18) account for 40% and 35% respectively, and F4 accounts for 14%; F5, F6, F41 also are detected (Wilson etc., 1986 in succession; Harel etc., 1991; Ojeniyi etc., 1994).Osek etc. (2000) cause in the 46 strain Escherichia coli that are separated to the PWD case from Poland has 34 strains (73.9%) can produce Stx2e; Contain pathogenic escherichia colis thermally-stabilised and heat labile enterotoxin such as STb, STap, LT, EAST1 in addition and also be separated to (Bertschinger, 1996 widely; Nagy etc., 1999; Savarino etc., 1996; Yamamoto etc., 1997; Choi etc., 2001).
Traditional Escherichia coli serological typing method is an immunization, though this method is simple to operate, wastes time and energy.But because colibacillary serotype more (only by the O antigens genotyping kind more than 180 just being arranged at present), Dui Ying antiserum kind is generally incomplete with it; Easily produce cross reaction between the different serotype; Clinical separation strain usually exists from the transformation of smooth type to rough type, thereby is easy to generate false negative (Chitrita DebRoy etc., 2005); Also there are some difficulties in a large amount of antiserums in preparation with in storing, and these shortcomings cause that immunological method sensitivity is low, loss is high, accuracy is also poor.
The method of conventional sense Escherichia coli virulence factor is divided into method that detects the Escherichia coli adhesion factor and the method that detects toxin, and the former comprises the electron microscope observation method, D-mannose opposing hemagglutination test, and cell adhesion test and immune serum learn a skill.The latter comprise zoopery, tissue culture, immunological method (RIA, ELISA) etc.These method complex operations, specificity is not high, has certain limitation, will replace for the modern molecular biology method so generally believe serology and virulence factor detection method that these are traditional now.Molecular biology method mainly comprises PCR method and the biochip technology that grew up in recent years.PCR method is a mature methods, and is quick, simple, responsive, and its shortcoming is that the one-time detection quantity of information is limited, be not suitable for the detection to a large amount of samples, and developing biochip technology just can remedy these deficiencies.
In July, 1997, Affymetric, Inc. (Santa Clara, CA) the 6th, 228, No. 575 U.S. Patent Publications of the people such as Thomas R. of company invention the method for microorganism being carried out deciding kind and phenotype analytical with biochip technology.Since nineteen nineties, biochip technology has been set up as a kind of brand-new foranalysis of nucleic acids detection technique, and the progressively development along with carrying out of the Human Genome Project.Technology such as molecular biology, integrated circuit manufacturing, computing machine, semiconductor, confocal laser scanning, fluorescence labeling have been used in this technological synthesis, make testing process have characteristics such as susceptibility height, high specificity, large scale integration, robotization, simple and efficient to handle, efficient height, be widely used at aspects such as gene expression correlative study and bio-pharmaceuticals researchs.Therefore,, not only can simplify detection means greatly, improve detection speed, and have high accuracy, high sensitivity, high flux, repeatable plurality of advantages such as strong if biochip technology is used for the evaluation of bacterium serotype and virulence factor.
The colibacillary categorizing system that obtains by serotype is that eighties of last century proposes (Kauffmann, 1975) first by Kauffman the forties.2000, Roney used the method for rfb-RFLP to the Escherichia coli somatotype, and the result thinks that this method is than serotype more reliable (Roney S.Coimbraa, 2000).Wang Lei professor and Reeves professor have proposed the theory that glycosyltransferase gene and oligosaccharide unit treatment enzyme gene are O-antigen-specific gene (international patent application, WO 98-AU315 and WO99-AU385) in 1998.At glycosyltransferase gene and the oligosaccharide unit treatment enzyme gene design primer in the O-antigen gene bunch, filter out the gene and the oligonucleotide fragment of high special by PCR method, the O-antigen serotype of identification of escherichia coli that can precise and high efficiency.PCR method has its limitation as mentioned before, and biochip technology can remedy these shortcoming and defect.Glycosyltransferase gene or oligosaccharide unit treatment enzyme gene are combined with advanced person's biochip technology, we work out a kind of the detection fast, accurately, delicately and cause pig weaning period diarrhoea and the colibacillary serotype of oedema and the method and the kit of virulence factor, thereby have finished the present invention.
Summary of the invention
An object of the present invention is to provide a kind of genetic chip that is used to cause pig weaning period diarrhoea and oedema e. coli serotype and virulence factor detection.
Another object of the present invention provides a kind of said gene chip that utilizes and comes fast, detects accurately, delicately the method that causes pig weaning period diarrhoea and oedema e. coli serotype and virulence factor.
Another purpose of the present invention provides a kind of detection and causes pig weaning period diarrhoea and the e. coli serotype of oedema and the kit of virulence factor.
For achieving the above object, the present invention has adopted following technical scheme:
The present invention proposes a kind of genetic chip that is used to cause pig weaning period diarrhoea and oedema e. coli serotype and virulence factor detection, comprise solid phase carrier and the oligonucleotide probe that is fixed on this carrier, these oligonucleotide probes comprise the dna fragmentation of choosing from the main e. coli serotype O-antigen gene bunch last glycosyltransferase gene relevant with causing pig weaning period diarrhoea and oedema and oligosaccharide unit treatment enzyme gene and the main virulence factor gene of Escherichia coli.
In an embodiment of the present invention, above-mentioned oligonucleotide probe also comprises the dna fragmentation of choosing from bacterium 16s rDNA conserved region and Shigella ipaH gene.
Wherein, above-mentioned main cause pig weaning period diarrhoea and the relevant e. coli serotype of oedema comprise O149, O138, O139, O141, O8, O147, O45 and O157; The main virulence factor of above-mentioned Escherichia coli comprises F18 (107), F4 (K88), F5 (K99), F6 (987P), F41, intimin, STap, STb, LT, Stx2e and EAST1.
Wherein, the above-mentioned dna fragmentation of choosing from the main e. coli serotype O-antigen gene bunch last glycosyltransferase gene relevant with causing pig weaning period diarrhoea and oedema and oligosaccharide unit treatment enzyme gene and the main virulence factor gene of Escherichia coli is selected from the base sequence shown in SEQ ID NO:4-NO:55; The above-mentioned dna fragmentation of choosing from bacterium 16s rDNA conserved region and Shigella ipaH gene is the base sequence shown in SEQ ID NO:1-NO:3.Wherein the base sequence shown in the SEQ ID NO:4-NO:33 is the dna fragmentation of choosing from above-mentioned 8 kinds of main e. coli serotype O-antigen genes bunch last glycosyltransferase genes relevant with causing pig weaning period diarrhoea and oedema or oligosaccharide unit treatment enzyme gene, the dna fragmentation of base sequence shown in the SEQ ID NO:34-NO:55 for from the main 11 kinds of virulence factor genes of Escherichia coli, choosing, base sequence shown in the SEQ ID NO:1 has been reported dna fragmentation (Nadkarni etc. for what choose in pertinent literature from bacterium 16s rDNA conserved region, 2002), the dna fragmentation of the base sequence shown in the SEQ ID NO:2-NO:3 for choosing from Shigella ipaH gene.
The present invention also proposes a kind of detection and causes pig weaning period diarrhoea and the e. coli serotype of oedema and the method for virulence factor, may further comprise the steps:
(1) according to the O-antigen gene that causes the e. coli serotype that pig weaning period diarrhoea and oedema are relevant bunch in glycosyltransferase gene and oligosaccharide unit treatment enzyme gene order, the gene order of Escherichia coli virulence factor and bacterium 16s rDNA conserved region sequence and Shigella ipaH gene order design also prepares the primer that is used for pcr amplification;
(2) prepare the genomic DNA of testing sample according to a conventional method, use primer in the step (1) to treat test sample product genomic DNA and carry out pcr amplification and purifying target sequence;
(3) target sequence that obtains in the markers step (2);
(4) with target sequence behind the mark and the described gene chip hybridization of claim 1;
(5) obtain hybridization signal and Analysis and Identification results of hybridization with biochip scanner.
Wherein, main cause pig weaning period diarrhoea and the relevant e. coli serotype of oedema comprises O149, O138, O139, O141, O8, O147, O45 and O157 described in the above-mentioned steps (1); The main virulence factor of above-mentioned Escherichia coli comprises F1 8 (107), F4 (K88), F5 (K99), F6 (987P), F41, intimin, STap, STb, LT, Stx2e and EAST1.
The described primer that is used for pcr amplification of above-mentioned steps (1) is the base sequence that is selected from shown in SEQ ID NO:56-NO:97.Wherein, shown in the SEQ ID NO:56-NO:63 with the primer of the base sequence shown in the SEQ ID NO:75-NO:82 for designing according to glycosyltransferase gene in above-mentioned 8 kinds of main e. coli serotype O-antigen genes relevant bunch or oligosaccharide unit treatment enzyme gene order with causing pig weaning period diarrhoea and oedema; SEQ ID NO:64-NO:74 and SEQ ID NO:83-NO:93 are the primer according to 11 kinds of virulence factor gene sequences Design of Escherichia coli; SEQID NO:94-NO:95 is according to bibliographical information (Dorsch etc., 1992; Labrenz etc., 2004) the upstream and downstream primer sequence of the bacterium 16s rDNA conserved region of choosing; SEQ ID NO:96-NO:97 is the upstream and downstream primer sequence according to the design of Shigella ipaH gene order.
The present invention also proposes a kind of detection and causes pig weaning period diarrhoea and the e. coli serotype of oedema and the kit of virulence factor, wherein include genetic chip, this genetic chip comprises solid phase carrier and the oligonucleotide probe that is fixed on this carrier, and these oligonucleotide probes comprise from main e. coli serotype O-antigen gene bunch last glycosyltransferase gene and the oligosaccharide unit treatment enzyme gene relevant with causing pig weaning period diarrhoea and oedema, the dna fragmentation of choosing in main virulence factor gene of Escherichia coli and bacterium 16s rDNA conserved region and the Shigella ipaH gene.
This kit also comprises the pcr amplification primer, and these pcr amplification primers are selected from the amplimer of the base sequence shown in SEQ ID NO:56-NO:97.
This kit can also comprise the interpretation software that hybridizing box, hybridization solution and Analysis and Identification result use.
As seen from the above technical solutions, the present invention causes biochip technology the e. coli serotype and the virulence factor detection range of pig weaning period diarrhoea and oedema first, set up a kind of quick, sensitive, the accuracy height, the strong brand-new detection of repeatability causes the genetic chip and the detection method thereof of pig weaning period diarrhoea and oedema e. coli serotype and virulence factor, utilize genetic chip of the present invention to reach and detect the common purpose that causes pig weaning period diarrhoea and oedema e. coli serotype and virulence factor, because it is easy and simple to handle, the accuracy height, repeatability is strong, and is significant for epidemiological study and diagnosis.
For above and other objects of the present invention, feature and advantage can be become apparent, below especially exemplified by preferred embodiment, and cooperate Figure of description, be described in detail below.
Description of drawings
Fig. 1 is the profile synoptic diagram of an embodiment of genetic chip of the present invention.
Fig. 2 is the rule synoptic diagram (sequence of each bar probe and function thereof are referring to table 1 on the dot matrix) of arranging of single dot matrix probe on the embodiment of genetic chip of the present invention.
Fig. 3 A utilizes an embodiment of genetic chip of the present invention to detect 8 kinds of main and results of hybridization PWD and ED e. coli serotype, has marked the serotype that is detected below every results of hybridization figure.
Fig. 3 B utilizes an embodiment of genetic chip of the present invention to detect the results of hybridization figure of 5 strain enteropathogenic E clinical separation strains.The numbering of this separated strain and the relevant virulence gene that is contained thereof have been marked below every results of hybridization figure.
Embodiment
For further specifying genetic chip and the detection method thereof that causes pig weaning period diarrhoea and oedema e. coli serotype and virulence factor that be used to detect of the present invention, describe especially exemplified by following preferred embodiment, this embodiment is in order to explain rather than limit by any way the present invention.
Embodiment one: the design of probe and preparation
1. sequence obtains: download 5 kinds of O antigen serotype Escherichia coli (O8, O45, O138, O139 and O157) O antigen synthetic gene bunch sequence (the O antigen synthetic gene bunch sequence of other 3 kinds of O141, O147, O149 is finished order-checking by inventor unit one belongs to, and patent applied for), 11 kinds of virulence factor gene sequences of Escherichia coli and the Shigella ipaH gene order that obtains from the GenBank public database with the arrangement of Artemis software.
2. probe design: above-mentioned sequence is imported in the OligoArray2.0 software, carry out the design of probe with reference to the operation instruction of this software.
In a preferred embodiment of the invention, selected 71 probes, and carried out the probe screening, finally obtained probe as shown in table 1 by 156 hybrid experiments by the OligoArray2.0 software design.Wherein, probe SEQ ID NO:1 is selected from the conserved region of bacterium 16s rDNA, as over against according to probe.The probe that probe is numbered OA_750 is a fluorescence probe, is used for the probe on the dot matrix is positioned.The probe that probe is numbered WL_4006 is a poly T fragment, as negative contrast probe.Probe SEQ ID NO:2-NO:3 is selected from Shigella ipaH gene, (the O antigen gene bunch sequence similarity of O147 and shigella flexneri 6 types and O149 and Shigella bogdii 1 type is very high to be used for distinguishing O147 and shigella flexneri 6 types and O149 and Shigella bogdii 1 type, so select for use the ipaH gene to distinguish), probe SEQ ID NO:4-NO:33 is selected from common pig weaning period diarrhoea and the oedema e. coli serotype (O149 of causing, O138, O139, O141, O8, O147, O45, O157) glycosyl transferase or oligosaccharide unit pol gene on the O-antigen gene bunch, probe SEQ ID NO:34-NO:55 are selected from and commonly cause pig weaning period diarrhoea and oedema Escherichia coli virulence factor gene (F1 8 (107), F4 (K88), F5 (K99), F6 (987P), F41, intimin, STap, STb, LT, Stx2e, EAST1).
Table 1: sequence oligonucleotide probe of selecting for use on the genetic chip of the present invention and the effect in detection
| The probe numbering | SEQ ID | Probe sequence (5 '-3 ') | Probe in detecting object or effect |
| OA_1997 | NO：1 | GTGCCAGCAGCCGCGGTAATACG | Over against photograph |
| OA_750 | Cy3_TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTT | Fluorescence probe is used for the location of probe points | |
| WL_4006 | TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT | Negative contrast | |
| OA_1987 | NO：2 | GATAATGATACCGGCGCTCTGCTCTCC | Distinguish O147 and shigella flexneri 6 types and O149 and Shigella bogdii 1 type |
| OA_1990 | NO：3 | AGGAAATGCGTTTCTATGGCGTGTCG | |
| OA_1937 | NO：4 | TCTGAAAACGGCAGAACTTTATCAAATCGACGATAAAT | Escherichia coli O8 |
| OA_1938 | NO：5 | TGAAGCTTTGATTCAGAAAATCCTTGCTATCTCACAAG | |
| 0A_1939 | NO：6 | GACGATGTATACAAACCCTACTACTTACAGAAAGTTGAGT | |
| OA_1940 | NO：7 | GCTTCCAGGACCTATTCCCCAGTGTTATCAGAAATCTCAT | Escherichia coli O45 |
| OA_1941 | NO：8 | TCAATATTTGTTGTCACCAGAAGGACAATTTCTGTCGAGT | |
| OA_1942 | NO：9 | GCTCATCATTTGGTGCTTTGTGATAATTCCTGATGTGGTT | |
| OA_1943 | NO：10 | TGACTACTAATATTAGCCCGCTCTCAAATGAGATGGTGGT | |
| OA_1917 | NO：11 | AGTTCTCGCTGTAGTTATCACCTCTGATCGATTATCTAAT | Escherichia coli O138 |
| OA_1918 | NO：12 | TGGTTGCATTTTGGAGTTTTCGATATAGCTACAGGTTTAT | |
| OA_1919 | NO：13 | GGAAACCCAGGTTATCTTAGTATGTCAACTGTATTGATCT | |
| OA_1920 | NO：14 | GCATGTAAGAATGCATACTCTTTATCGAGACAAATGGTTT | |
| OA_1921 | NO：15 | TGACTCGAAATTCAGTGAATTCAGTCATTTTGCAAAAGAT | Escherichia coli O139 |
| OA_1922 | NO：16 | AGCTCAAACATATTCAAAACTGACTCGAAATTCAGTGAAT | |
| OA_1923 | NO：17 | TGAACGAGGATTAGAAGAGCAGGTATATAGTACCATAACA | |
| OA_1924 | NO：18 | ACTATCAATGGCTTATATAGCTCACATAACTTTGGGGTTT | |
| OA_1925 | NO：19 | CGTTTGAATGGTTATACATGGCTAACAAAGGTAGATTGTT | Escherichia coli O141 |
| OA_1926 | NO：20 | TCCATAGCTTACCGATTTTCGTACTATGGTTATGCTTTTA | |
| OA_1927 | NO：21 | TCATCTGTCTGCTTTCCATTCAAGGAAGACATCTTAAATA | |
| OA_1928 | NO：22 | TGAGTGGTTTTATTGCAACAAAATTAAAAGGATACGCTGA |
| OA_1933 | NO：23 | TTCTGGTTTGGGTAATGTCATCAAAATTCAAACTCCTATC | Escherichia coli O147 |
| 0A_1934 | NO：24 | CTGATTCTTCTTTAGGAGTTAGATGGGATCAGTTTACTGT | |
| OA_1935 | NO：25 | AGTGGCTGGTAATTTTGCATATTTTGTTTCGATATGCTTG | |
| OA_1936 | NO：26 | GCTCTCATTCCATTTGCCTTTATGTTGCATATAGTCATAA | |
| OA_1966 | NO：27 | TCATTTATAGGCATTGAGTTGTTAACTAATGCTCTGAGGC | Escherichia coli O149 |
| OA_1967 | NO：28 | AGTTGCCATATTAGTTGGTTAATTTGGATATGGCCAATAT | |
| OA_1968 | NO：29 | AGGGATTCTCAATAGCAGTACTGTTATTATCGTTCTGTTT | |
| OA_1929 | NO：30 | AGGGAATAAAGCATCAAGACTTATTTTATGGAGAACGGTT | Escherichia coli O 157 |
| 0A_1930 | NO：31 | TTTCCGACACCAGAGTTAGAAAAGGAATTAAAAGCAATAA | |
| OA_1932 | NO：32 | GGTTATCGTTCTGAATTGGTGTTGCTCATTCTTCAATATA | |
| OA_1994 | NO：33 | ATGATGAGCATAAATTCAAACAGAGGACCATCATATTTGT | |
| OA_1944 | NO：34 | TAATGAGGATAATACCTTTACTGTGAAGGTGTCAGGAAG | Stx2e |
| OA_1945 | NO：35 | TGACTGTAACAATCATATCTAATACCTGCAGTTCAGGC | |
| OA_1946 | NO：36 | GAAGAGAATACTGGACGAACAGATGGAATTTGCAGCCAT | |
| OA_1959 | NO：37 | GTTACAACATTATGGAACGGCAGAGGTTAATCTGCAGAG | intimin |
| OA_1995 | NO：38 | TTTGACGGTAGTTCACTGGACTTCTTATTACCGTTCTATG | |
| OA_1957 | NO：39 | ACACATTAAGAATCACATATCTGACCGAGACCAAAATTGA | LT |
| OA_1958 | NO：40 | GCAAAAGAGAAATGGTTATCATTACATTTAAGAGCGGCG | |
| OA_1961 | NO：41 | CATCCAGTTATGCATCGTGCATATGGTGCGCAACAG | EAST1 |
| OA_1947 | NO：42 | TATCACTGCAGATGATTATCGTCAGAAATGGGAATGGA | F4(K88) |
| OA_1948 | NO：43 | AGGTCTTAATGGATTTGGTAATGTATTGAATGACCTGACC | |
| OA_1951 | NO：44 | TAATACTTCATTCACTACGGCTGAATACACTCACACTTCT | F5(K99) |
| OA_1952 | NO：45 | TGGTGGTGCTAATATTAATACTTCATTCACTACGGCTGAA | |
| OA_1953 | NO：46 | ATAGATCTTGGAGAGTTGTCTACTTCTGCTCTTAAAGCTA | F6(987P) |
| OA_1954 | NO：47 | CAAGTGGATACTTCTAATCTGTCGCAAACCATAGATCTTG | |
| OA_1949 | NO：48 | AACTACCTGTAATTTGACACCACAAATAAGTGGCACTGTA | F18(F107) |
| OA_1950 | NO：49 | ATCAAAAGCAACTACGGAAGGTTTCAAATTTACTGCTCA | |
| OA_1955 | NO：50 | AGAATATAGCCTATAAATGGAATGGACTCTCAAAAGCTGA | F41 |
| OA_1956 | NO：51 | GGCATCTTATGATGGTAGTGTTATTACACCTAGTTTCACT |
| OA_1962 | NO：52 | TTATCTTTCCCCTCTTTTAGTCAGTCAACTGAATCACTTG | STap |
| OA_1963 | NO：53 | GACTCTTCAAAAGAGAAAATTACATTAGAGACTAAAAAGTG | |
| OA_1965 | NO：54 | TTCTATTGCTACAAATGCCTATGCATCTACACAATCAAA | STb |
| OA_1996 | NO：55 | AGGTTTTTTAGGGGTTAGAGATGGTACTGCTGGAGCATG |
4. probe is synthetic: entrust probe Synesis Company (Beijing AudioCodes company) synthetic, standby after 5 ' of the probe sequence in the table 1 is held 15 T of prolongation and amination.
Embodiment two: primer design and preparation
1. sequence obtains: download 5 kinds of O antigen serotype Escherichia coli (O8, O45, O138, O139 and O157) O antigen synthetic gene bunch sequence (the O antigen synthetic gene bunch sequence of other 3 kinds of O141, O147, O149 is finished order-checking by laboratory, inventor place, and patent applied for), 11 kinds of virulence factor gene sequences of Escherichia coli and the Shigella ipaH gene order that obtains from the GenBank public database with the arrangement of Artemis software.
2. design primer: above-mentioned sequence is imported in primer-design software Primer Premier 5.0 softwares, carry out primer design with reference to the operation instruction of this software.
In a preferred embodiment of the invention, chosen and not only comprised probe but also be fit to being used to increase and causing the main e. coli serotype (O149 of pig weaning period diarrhoea and oedema of Multiplex PCR, O138, O139, O141, O8, O147, O45, O157) and virulence factor gene (F18 (107), F4 (K88), F5 (K99), F6 (987P), F41, intimin, STap, STb, LT, Stx2e, EAST1) primer of DNA is 30 pairs, for adapting to Multiplex PCR, through the bioinformatics primary dcreening operation and by a large amount of Multiplex PCR experiment screenings, filter out suitable primer as shown in table 2.
Table 2 is used for the primer sequence of the pcr amplification of Escherichia coli testing sample DNA
| The primer numbering | SEQ ID | Primer sequence (5 '-3 ') | Amplification effect |
| wl-5599 | NO：56 | TGTTCGTGCGATGGACC | The 08orf469 upstream primer |
| wl-5617 | NO：57 | TGCTTCAATTTGGCTGTT | The O45wzy upstream primer |
| wl-818 | NO：58 | TGCCGACAACATTATCAA | The O138wzy upstream primer |
| wl-5589 | NO：59 | ATAACGCATCCGCCAACT | The O139wzy upstream primer |
| wl-5591 | NO：60 | TGAACCTGGGTTTACATT | The O141wzy upstream primer |
| wl-5595 | NO：61 | TTTTGCTCTTATGGAACC | The O147wzy upstream primer |
| wl-5597 | NO：62 | TTTGGTGCAGATACTCAGA | The O149wzy upstream primer |
| wl-5593 | NO：63 | TCAGCGGCTAAGTTGATT | The O157wzy upstream primer |
| wl-5619 | NO：64 | TTGTATGGCTAGTTCTTCTA | The Stx2e upstream primer |
| wl-5633 | NO：65 | AGCACCTATGTGGAGTTTG | The intimin upstream primer |
| wl-5631 | NO：66 | CAATAACCAATGTTCCCAAT | The LT upstream primer |
| wl-5635 | NO：67 | GATAAATAAGCCAATAACCC | The EAST1 upstream primer |
| wl-5621 | NO：68 | GTTCATACGATTCGCTACA | F4 (K88) upstream primer |
| wl-5625 | NO：69 | CACCACCATAGTAACCAAAG | F5 (K99) upstream primer |
| wl-5627 | NO：70 | ACTCTCCATTCTAAGCCTT | F6 (987P) upstream primer |
| wl-5623 | NO：71 | TCTGCCAAACATCTCCATA | F18 (F107) upstream primer |
| wl-5629 | NO：72 | AGACTGATAAGATAAGTAGCCA | The F41 upstream primer |
| wl-5637 | NO：73 | ATCCCAATAGACGTATGAAA | The STap upstream primer |
| wl-5641 | NO：74 | ATGTAGCCTCCATCGTAAT | The STb upstream primer |
| wl-5600 | NO：75 | TATCCGAATGGGCCTTCT | The O8orf469 downstream primer |
| wl-5618 | NO：76 | CGTTGGCATTATCGTCTA | The O45wzy downstream primer |
| wl-5588 | NO：77 | CAAACTTTACCCGACGAA | The O138wzy downstream primer |
| wl-5590 | NO：78 | CCGACTAATACGGAAACA | The O139wzy downstream primer |
| wl-5592 | NO：79 | GTACAATTATCATTGCGAGT | The O141wzy downstream primer |
| wl-5596 | NO：80 | ATAACGCCAAGTTGATTT | The O147wzy downstream primer |
| wl-5598 | NO：81 | GAACAATAGATGCGATACAA | The O149wzy downstream primer |
| wl-5594 | NO：82 | ATTTGCTCCCATGTCTCC | The O157wzy downstream primer |
| wl-5620 | NO：83 | TCAGTTAAACTTCACCTGGGC | The Stx2e downstream primer |
| wl-5633 | NO：84 | TTATTGTATGACTCATGCCAG | The intimin downstream primer |
| wl-5632 | NO：85 | TACTGATTGCCGCAATTG | The LT downstream primer |
| wl-5636 | NO：86 | GCGAGTGACGGCTTTGT | The EAST1 downstream primer |
| wl-5622 | NO：87 | TTGCTACGTTCAGCGGAG | F4 (K88) downstream primer |
| wl-5626 | NO：88 | GCTGAAGTAGTAAATACGC | F5 (K99) downstream primer |
| wl-5628 | NO：89 | TTTGTATCAGGATTCCCT | F6 (987P) downstream primer |
| wl-5624 | NO：90 | TTGTAAGTAACCGCGTAAG | F18 (F107) downstream primer |
| wl-5630 | NO：91 | TGTGACTGAGGTCATCCC | The F41 downstream primer |
| wl-5638 | NO：92 | TACAACAAAGTTCACAGCAG | The STap downstream primer |
| wl-5642 | NO：93 | GCATCCTTTTGCTGCAAC | The STb downstream primer |
| wl-3110 | NO：94 | GAGTTTGATCCTGGCTCAG | 16s rDNA upstream primer |
| wl-3111 | NO：95 | CCGTCAATTCCTTTGAGTTT | 16s rDNA downstream primer |
| wl-5795 | NO：96 | TGACCGCCTTTCCGATA | The ipaH upstream primer |
| wl-5796 | NO：97 | TTCTCCAGCATCTCATAYTTC | The ipaH downstream primer |
3. primer is synthetic: entrust primer Synesis Company (Beijing AudioCodes) synthetic, standby primer sequence in the table 2.
Embodiment three: genetic chip preparation---chip point sample
1. dissolving probe: probe synthetic among the embodiment one is dissolved in respectively in the 50%DMOS solution, makes the final concentration of probe reach 1 μ g/ μ l.
2. splice: will dissolve the relevant position that good probe adds 384 orifice plates, every hole 10 μ l.
3. point sample: the aldehyde radical slide (CELAssociates of the cleaning of 57.5mm * 25.5mm * 1mm (length * wide * height) that will be as shown in Figure 1, Inc.) be put on the objective table of chip point sample instrument (Spotarray 72), use the Control Software (Tele chem smp3stealty pin) of SpotArray, working procedure, in the point sample district by arrangement mode point 4.5mm * 4.5mm on the slide of aldehyde radicalization shown in Figure 2, constitute low-density DNA micromatrix, the array arrangement rule is identical in six point sample districts on the slide.
4. dry: dried overnight under the chip room temperature that will put, then 45 ℃ of oven dryings 2 hours.
5. crosslinked: with crosslinked 2 times of crosslinked instrument (uvpcl-2000M ultraciolet Crosslinker) 600J.Crosslinked good chip is put back in the clean chip cartridges, standby.
As seen from Figure 2, in each point sample district be the individual probe points in 15 (OK) * 15 (row).The sequence and the function thereof of fixing probe see Table 1 on each position.
Embodiment four: utilize genetic chip fast detecting e. coli serotype and virulence factor
1. extraction genome: the single bacterium colony LB nutrient culture media of the Escherichia coli to be measured that will be separated to, 37 ℃ of shaking table 180rpm incubated overnight are extracted the genomic DNA of the genomic method extraction of common Gram-negative bacteria culture of Escherichia coli according to routine.
2. amplified target sequence: respectively get said extracted to 200ng/ μ l genomic DNA 1 μ l add in the Multiplex PCR reaction mixture 1,2, wherein mixed liquor 1 is used to increase, and (if tested bacterial strain is shigella flexneri 6 types, O147wzy gene and ipaH gene and 16s rDNA simultaneously can increase for e. coli serotype gene and 16s rDNA; If tested bacterial strain is Shigella bogdii 1 type, O149wzy gene and ipaH gene and 16srDNA simultaneously can increase), mixed liquor 2 be used to increase Escherichia coli virulence factor gene and 16s rDNA, PCR reaction mixture 1,2 prescriptions are shown in following table 3,4.(annotate: PCR bufier, MgCl in the following table 3-table 6
2, dNTP Mixture, the Taq enzyme is all available from TAKARA company)
Table 3Multiplex PCR reaction mixture 1 prescription (50 μ l system)
| Composition | Concentration | Application of sample amount (μ l) |
| ddH 2O 10×PCR buffer MgCl 2DNTP Mixture wl-5599 and wl-5600 wl-5595 and wl-5596 | - 10× 25mM 10mM 10μM 10μM | 11.5 552 each 3 each 2 |
| + wl-5597 and wl-5598 | 10μM | Each is 1.5 years old |
| Wl-5617 and wl-5618, wl-818 and wl-5588, wl-5589 and wl-5590, wl-5591 and wl-5590, wl-5593 and wl-5594 | 10μM | Each is 1 years old |
| Wl-5795 and wl-5796 | 10μM | Each is 0.5 years old |
| Wl-3110 and wl-3111 | 10μM | Each is 0.5 years old |
| The Taq enzyme | 5U/μl | 0.5 |
Annotate: the primer of wl numbering is a primer listed in the table 2 in the table.
Table 4Multiplex PCR reaction mixture 2 prescriptions (50 μ l system)
| Composition | Concentration | Application of sample amount (μ l) |
| ddH 2O 10×PCR buffer MgCl 2DNTP Mixture wl-5631 and wl-5632, wl-5637 and wl-5638 wl-5619 and wl-5620, wl-5623 and wl-5624, wl-5629 and wl-5630 wl-5633 and wl-5634, wl-5635 and wl-5636, wl-5621 and wl-5622, wl-5625 and wl-5626, wl-5627 and wl-5628, wl-5641 and wl-5642 | - 10× 25mM 10mM 20μM 20μM 20μM | 17 552 each 1.5 each 1 each 0.5 |
| Wl-3110 and wl-3111 | 10μM | Each is 0.75 years old |
| The Taq enzyme | 5U/μl | 0.5 |
Annotate: the primer of wl numbering is a primer listed in the table 2 in the table.
Reaction tube is put into PCR instrument (Biometra), and the loop parameter of setting is as follows:
94 ℃ of 5min, 94 ℃ of 30sec, 50 ℃ of 30sec, 72 ℃ of 2min got back to for second step, totally 35 circulations;
72 ℃ of 5min then, 4 ℃ of 20hr.
3. purifying: the pcr amplification product of above-mentioned acquisition is used purification column (MILLIPORE company) purifying respectively,
Concrete steps are as follows:
(1) the PCR product is transferred in the purification column, adds water and complement to 400 μ l.
(2) 25 ℃, the centrifugal 15min of 1000 * g abandon collection tube.
(3) purification column is transferred in the centrifuge tube of new 1.5ml, added the ultrapure water (Milli_Q) of 30 μ l, place 5min for 37 ℃.
(4) the purification column inversion is placed on the centrifuge tube of 1.5ml, the centrifugal 2min of 1000 * g collects product.
4. mark sample: get 20 μ l purified products, add respectively in the corresponding mark mixed liquor 1,2, labeled reactant mixed liquor 1,2 prescriptions are shown in following table 5,6.
Table 5 mark mixed liquor 1 prescription (30 μ l system)
| Composition | Concentration | Application of sample amount (μ l) |
| ddH 2O 10×PCR buffer MgCl 2 dNTP Mixture wl-5600 wl-5596 | - 10× 25mM 10mM 10μM 10μM | 5.3 3 3 0.3 1.8 1.2 |
| wl-5598 | 10μM | 0.9 |
| wl-5618、wl-5588、wl-5590、 wl-5592、wl-5594 | 10μM | Each is 0.6 years old |
| wl-5796 | 10μM | 0.3 |
| wl-3111 | 10μM | 0.6 |
| Cy3-dUTP | 25nM | 0.3 |
| The Taq enzyme | 5U/μl | 0.3 |
Annotate: the primer of wl numbering is a primer listed in the table 2 in the table.
Table 6 mark mixed liquor 2 prescriptions (30 μ l system)
| Composition | Concentration | Application of sample amount (μ l) |
| ddH 2O 10×PCR buffer MgCl 2 dNTP Mixture wl-5632、wl-5638 wl-5620、wl-5624、wl-5630 wl-5634、wl-5636、wl-5622、 wl-5626、wl-5628、wl-5642 | - 10× 25mM 10mM 20μM 20μM 20μM | 7.25 33 0.3 each 0.9 each 0.6 each 0.3 |
| wl-3111 | 10μM | 0.45 |
| Cy3-dUTP | 25nM | 0.3 |
| The Taq enzyme | 5U/μl | 0.3 |
Annotate: the primer of wl numbering is a primer listed in the table 2 in the table.
Reaction tube is put into PCR instrument (Biometra), and the loop parameter of setting is as follows:
94 ℃ of 5min, 94 ℃ of 30sec, 50 ℃ of 30sec, 72 ℃ of 2min got back to for second step, totally 35 circulations; 72 ℃ of 5min, 4 ℃ of 20hr.
5. hybridization: the pre-150 μ l ddH that add in hybridizing box (Bo Ao company)
2O is to keep humidity.8 μ l hybridization solutions (it is as follows to fill a prescription) and 8 μ l purified products are mixed and are added in the probe array zone that is used to detect the genetic chip that causes pig weaning period diarrhoea and oedema e. coli serotype and virulence factor for preparing among the embodiment three, cover the cover plate (Bo Ao company) (noting between cover plate and the microslide bubble being arranged) of customization, cover tight hybridizing box, hybridize 1.5h in 50 ℃ of water-baths.
6. washing: when hybridizing to, take out hybridizing box, remove cover plate, genetic chip is washed 3min successively in washing lotion A, wash 3min among the washing lotion B, wash 90sec among the washing lotion C, air-dry in the air.
Hybridization solution prescription: 10% dextran sulfate (dextran Sulfate); 25% formamide (formamide); 0.1%SDS (lauryl sodium sulfate); 6 * SSPE
Washing lotion A:1 * SSC (sodium chloride-sodium citrate solution); 0.1%SDS
Washing lotion B:0.05 * SSC
Washing lotion C:95% ethanol
8. scanning: with GenePix personal 4100A biochip scanner (AXON instrument) scanning, used parameter is as follows:
Software and version: GenePix Pro 6.0
official name：575DF35
PMT Gain：600
Scanning resolution: 10 μ m
Scanning result saves as JPG, TIF, GPR form
Detect the results of hybridization figure of 8 kinds of main e. coli serotypes relevant and 5 strain enteropathogenic E clinical separation strains respectively shown in Fig. 3 A and 3B with genetic chip of the present invention with PWD and ED.
Embodiment five: genetic chip is carried out specificity evaluation and sensitivity detection
The specificity that is used to detect the genetic chip that causes pig weaning period diarrhoea and oedema e. coli serotype and virulence factor to preparation among the embodiment three is identified as follows:
Identify that with the Escherichia coli with different serotypes and virulence factor and other bacteriums being used to of preparing among the embodiment three causes that pig weaning period is suffered from diarrhoea and the specificity of the genetic chip of oedema e. coli serotype and virulence factor.In this specificity design test, used 233 strain bacterium (comprising the Escherichia coli clinical separation strain of type strain, 35 known serotypes and virulence factor of 186 strain Escherichia coli and Shigella O antigen and the bacterium of 12 other kinds of strain) to utilize genetic chip of the present invention and the above-mentioned detection method to hybridize detection, all shown correct results of hybridization, this illustrates that genetic chip of the present invention has good specificity.
Sensitivity to the genetic chip that is used to detect the e. coli serotype that causes pig weaning period diarrhoea and oedema and virulence factor of preparation among the embodiment three detects as follows:
The detection sensitivity of this genetic chip is through the checking of 78 hybrid experiments, the micro-genomic DNA or 10 of 0.1ng/ml
3Individual amount of bacteria just can guarantee that the Escherichia coli with above-mentioned serotype and virulence factor have stable, good results of hybridization, and this illustrates that genetic chip of the present invention has very high detection sensitivity.
Description according to technical scheme of the present invention and preferred embodiment thereof; any those skilled in the art; without departing from the spirit and scope of the present invention; can make various possible being equal to and change or replacement, and all these changes or replacement all should belong to the protection domain of claim of the present invention.
Sequence table
＜110〉Tianjin Biochip Technology Co., Ltd
＜120〉cause pig weaning period diarrhoea and colibacillary detection method of oedema and kit
<130>6P13002-CN
<160>97
<170>PatentIn version 3.2
<210>1
<211>23
<212>DNA
＜213〉based on the conserved regions design of bacterium 16s rDNA and the probe sequence of synthetic
<400>1
gtgccagcag ccgcggtaat acg 23
<210>2
<211>27
<212>DNA
＜213〉based on the probe sequence of Shigella ipaH gene design and synthetic
<400>2
gataatgata ccggcgctct gctctcc 27
<210>3
<211>26
<212>DNA
＜213〉based on the probe sequence of Shigella ipaH gene design and synthetic
<400>3
aggaaatgcg tttctatggc gtgtcg 26
<210>4
<211>38
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O8 and the probe sequence of synthetic
<400>4
tctgaaaacg gcagaacttt atcaaatcga cgataaat 38
<210>5
<211>38
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O8 and the probe sequence of synthetic
<400>5
tgaagctttg attcagaaaa tccttgctat ctcacaag 38
<210>6
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O8 and the probe sequence of synthetic
<400>6
gacgatgtat acaaacccta ctacttacag aaagttgagt 40
<210>7
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O45 and the probe sequence of synthetic
<400>7
gcttccagga cctattcccc agtgttatca gaaatctcat 40
<210>8
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O45 and the probe sequence of synthetic
<400>8
tcaatatttg ttgtcaccag aaggacaatt tctgtcgagt 40
<210>9
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O45 and the probe sequence of synthetic
<400>9
gctcatcatt tggtgctttg tgataattcc tgatgtggtt 40
<210>10
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O45 and the probe sequence of synthetic
<400>10
tgactactaa tattagcccg ctctcaaatg agatggtggt 40
<210>11
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O138 and the probe sequence of synthetic
<400>11
agttctcgct gtagttatca cctctgatcg attatctaat 40
<210>12
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O138 and the probe sequence of synthetic
<400>12
tggttgcatt ttggagtttt cgatatagct acaggtttat 40
<210>13
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O138 and the probe sequence of synthetic
<400>13
ggaaacccag gttatcttag tatgtcaact gtattgatct 40
<210>14
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O138 and the probe sequence of synthetic
<400>14
gcatgtaaga atgcatactc tttatcgaga caaatggttt 40
<210>15
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O139 and the probe sequence of synthetic
<400>15
tgactcgaaa ttcagtgaat tcagtcattt tgcaaaagat 40
<210>16
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O139 and the probe sequence of synthetic
<400>16
agctcaaaca tattcaaaac tgactcgaaa ttcagtgaat 40
<210>17
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O139 and the probe sequence of synthetic
<400>17
tgaacgagga ttagaagagc aggtatatag taccataaca 40
<210>18
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O139 and the probe sequence of synthetic
<400>18
actatcaatg gcttatatag ctcacataac tttggggttt 40
<210>19
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O141 and the probe sequence of synthetic
<400>19
cgtttgaatg gttatacatg gctaacaaag gtagattgtt 40
<210>20
<211>40
<212>DNA
＜213〉based on the 0-antigen gene bunch design of Escherichia coli O141 and the probe sequence of synthetic
<400>20
tccatagctt accgattttc gtactatggt tatgctttta 40
<210>21
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O141 and the probe sequence of synthetic
<400>21
tcatctgtct gctttccatt caaggaagac atcttaaata 40
<210>22
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O141 and the probe sequence of synthetic
<400>22
tgagtggttt tattgcaaca aaattaaaag gatacgctga 40
<210>23
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O147 and the probe sequence of synthetic
<400>23
ttctggtttg ggtaatgtca tcaaaattca aactcctatc 40
<210>24
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O147 and the probe sequence of synthetic
<400>24
ctgattcttc tttaggagtt agatgggatc agtttactgt 40
<210>25
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O147 and the probe sequence of synthetic
<400>25
agtggctggt aattttgcat attttgtttc gatatgcttg 40
<210>26
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O147 and the probe sequence of synthetic
<400>26
gctctcattc catttgcctt tatgttgcat atagtcataa 40
<210>27
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O149 and the probe sequence of synthetic
<400>27
tcatttatag gcattgagtt gttaactaat gctctgaggc 40
<210>28
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O149 and the probe sequence of synthetic
<400>28
agttgccata ttagttggtt aatttggata tggccaatat 40
<210>29
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O149 and the probe sequence of synthetic
<400>29
agggattctc aatagcagta ctgttattat cgttctgttt 40
<210>30
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O 157 and the probe sequence of synthetic
<400>30
agggaataaa gcatcaagac ttattttatg gagaacggtt 40
<210>31
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O 157 and the probe sequence of synthetic
<400>31
tttccgacac cagagttaga aaaggaatta aaagcaataa 40
<210>32
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O 157 and the probe sequence of synthetic
<400>32
ggttatcgtt ctgaattggt gttgctcatt cttcaatata 40
<210>33
<211>40
<212>DNA
＜213〉based on the O-antigen gene bunch design of Escherichia coli O 157 and the probe sequence of synthetic
<400>33
atgatgagca taaattcaaa cagaggacca tcatatttgt 40
<210>34
<211>39
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor Stx2e
<400>34
taatgaggat aataccttta ctgtgaaggt gtcaggaag 39
<210>35
<211>38
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor Stx2e
<400>35
tgactgtaac aatcatatct aatacctgca gttcaggc 38
<210>36
<211>39
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor Stx2e
<400>36
gaagagaata ctggacgaac agatggaatt tgcagccat 39
<210>37
<211>39
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor intimin
<400>37
gttacaacat tatggaacgg cagaggttaa tctgcagag 39
<210>38
<211>40
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor intimin
<400>38
tttgacggta gttcactgga cttcttatta ccgttctatg 40
<210>39
<211>40
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor LT
<400>39
acacattaag aatcacatat ctgaccgaga ccaaaattga 40
<210>40
<211>39
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor LT
<400>40
gcaaaagaga aatggttatc attacattta agagcggcg 39
<210>41
<211>36
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor EAST1
<400>41
catccagtta tgcatcgtgc atatggtgcg caacag 36
<210>42
<211>38
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor F4 (K88)
<400>42
tatcactgca gatgattatc gtcagaaatg ggaatgga 38
<210>43
<211>40
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor F4 (K88)
<400>43
aggtcttaat ggatttggta atgtattgaa tgacctgacc 40
<210>44
<211>40
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor F5 (K99)
<400>44
taatacttca ttcactacgg ctgaatacac tcacacttct 40
<210>45
<211>40
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor F5 (K99)
<400>45
tggtggtgct aatattaata cttcattcac tacggctgaa 40
<210>46
<211>40
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor F6 (987P)
<400>46
atagatcttg gagagttgtc tacttctgct cttaaagcta 40
<210>47
<211>40
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor F6 (987P)
<400>47
caagtggata cttctaatct gtcgcaaacc atagatcttg 40
<210>48
<211>40
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor F18 (F107)
<400>48
aactacctgt aatttgacac cacaaataag tggcactgta 40
<210>49
<211>39
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor F18 (F107)
<400>49
atcaaaagca actacggaag gtttcaaatt tactgctca 39
<210>50
<211>40
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor F41
<400>50
agaatatagc ctataaatgg aatggactct caaaagctga 40
<210>51
<211>40
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor F41
<400>51
ggcatcttat gatggtagtg ttattacacc tagtttcact 40
<210>52
<211>40
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor STap
<400>52
ttatctttcc cctcttttag tcagtcaact gaatcacttg 40
<210>53
<211>41
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor STap
<400>53
gactcttcaa aagagaaaat tacattagag actaaaaagt g 41
<210>54
<211>39
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor STb
<400>54
ttctattgct acaaatgcct atgcatctac acaatcaaa 39
<210>55
<211>39
<212>DNA
＜213〉design the also probe sequence of synthetic based on Escherichia coli virulence factor STb
<400>55
aggtttttta ggggttagag atggtactgc tggagcatg 39
<210>56
<211>17
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli O8orf469
<400>56
tgttcgtgcg atggacc 17
<210>57
<211>18
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli O45wzy
<400>57
tgcttcaatt tggctgtt 18
<210>58
<211>18
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli O138wzy
<400>58
tgccgacaac attatcaa 18
<210>59
<211>18
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli O139wzy
<400>59
ataacgcatc cgccaact 18
<210>60
<211>18
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli O141wzy
<400>60
tgaacctggg tttacatt 18
<210>61
<211>18
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli O147wzy
<400>61
ttttgctctt atggaacc 18
<210>62
<211>19
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli O149wzy
<400>62
tttggtgcag atactcaga 19
<210>63
<211>18
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli O 157 wzy
<400>63
tcagcggcta agttgatt 18
<210>64
<211>20
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli virulence factor Stx2e
<400>64
ttgtatggct agttcttcta 20
<210>65
<211>19
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli virulence factor intimin
<400>65
agcacctatg tggagtttg 19
<210>66
<211>20
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli virulence factor LT
<400>66
caataaccaa tgttcccaat 20
<210>67
<211>20
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli virulence factor EAST1
<400>67
gataaataag ccaataaccc 20
<210>68
<211>19
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli virulence factor F4 (K88)
<400>68
gttcatacga ttcgctaca 19
<210>69
<211>20
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli virulence factor F5 (K99)
<400>69
caccaccata gtaaccaaag 20
<210>70
<211>19
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli virulence factor F6 (987P)
<400>70
actctccatt ctaagcctt 19
<210>71
<211>19
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli virulence factor F18 (F107)
<400>71
tctgccaaac atctccata 19
<210>72
<211>22
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli virulence factor F41
<400>72
agactgataa gataagtagc ca 22
<210>73
<211>20
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli virulence factor STap
<400>73
atcccaatag acgtatgaaa 20
<210>74
<211>19
<212>DNA
＜213〉design the also upstream primer of synthetic based on Escherichia coli virulence factor STb
<400>74
atgtagcctc catcgtaat 19
<210>75
<211>18
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli O8orf469
<400>75
tatccgaatg ggccttct 18
<210>76
<211>18
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli O45wzy
<400>76
cgttggcatt atcgtcta 18
<210>77
<211>18
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli O138wzy
<400>77
caaactttac ccgacgaa 18
<210>78
<211>18
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli O139wzy
<400>78
ccgactaata cggaaaca 18
<210>79
<211>20
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli O141wzy
<400>79
gtacaattat cattgcgagt 20
<210>80
<211>18
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli O147wzy
<400>80
ataacgccaa gttgattt 18
<210>81
<211>20
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli O149wzy
<400>81
gaacaataga tgcgatacaa 20
<210>82
<211>18
<212>DNA
＜213〉design the also downstream primer of synthetic based on colon bacillus 0157 wzy
<400>82
atttgctccc atgtctcc 18
<210>83
<211>21
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli virulence factor Stx2e
<400>83
tcagttaaac ttcacctggg c 21
<210>84
<211>21
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli virulence factor intimin
<400>84
ttattgtatg actcatgcca g 21
<210>85
<211>18
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli virulence factor LT
<400>85
tactgattgc cgcaattg 18
<210>86
<211>17
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli virulence factor EAST1
<400>86
gcgagtgacg gctttgt 17
<210>87
<211>18
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli virulence factor F4 (K88)
<400>87
ttgctacgtt cagcggag 18
<210>88
<211>19
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli virulence factor F5 (K99)
<400>88
gctgaagtag taaatacgc 19
<210>89
<211>18
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli virulence factor F6 (987P)
<400>89
tttgtatcag gattccct 18
<210>90
<211>19
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli virulence factor F18 (F107)
<400>90
ttgtaagtaa ccgcgtaag 19
<210>91
<211>18
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli virulence factor F41
<400>91
tgtgactgag gtcatccc 18
<210>92
<211>20
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli virulence factor STap
<400>92
tacaacaaag ttcacagcag 20
<210>93
<211>18
<212>DNA
＜213〉design the also downstream primer of synthetic based on Escherichia coli virulence factor STb
<400>93
gcatcctttt gctgcaac 18
<210>94
<211>19
<212>DNA
＜213〉based on the conserved regions design of bacterium 16s rDNA and the upstream primer of synthetic
<400>94
gagtttgatc ctggctcag 19
<210>95
<211>20
<212>DNA
＜213〉based on the conserved regions design of bacterium 16s rDNA and the downstream primer of synthetic
<400>95
ccgtcaattc ctttgagttt 20
<210>96
<211>17
<212>DNA
＜213〉based on the upstream primer of Shigella ipaH gene design and synthetic
<400>96
tgaccgcctt tccgata 17
<210>97
<211>21
<212>DNA
＜213〉based on the downstream primer of Shigella ipaH gene design and synthetic
<400>97
ttctccagca tctcataytt c 21
Claims (10)
1. one kind is used to cause that pig weaning period is suffered from diarrhoea and the genetic chip of oedema e. coli serotype and virulence factor detection, comprise solid phase carrier and the oligonucleotide probe that is fixed on this carrier, these oligonucleotide probes comprise the dna fragmentation of choosing from the main e. coli serotype O-antigen gene bunch last glycosyltransferase gene relevant with causing pig weaning period diarrhoea and oedema and oligosaccharide unit treatment enzyme gene and the main virulence factor gene of Escherichia coli.
2. genetic chip according to claim 1, wherein above-mentioned oligonucleotide probe also comprise the dna fragmentation of choosing from bacterium 16srDNA conserved region and Shigella ipaH gene.
3. genetic chip according to claim 1, the wherein above-mentioned main e. coli serotype relevant with causing pig weaning period diarrhoea and oedema comprises O149, O138, O139, O141, O8, O147, O45 and O157; The main virulence factor of above-mentioned Escherichia coli comprises F18 (107), F4 (K88), F5 (K99), F6 (987P), F41, intimin, STap, STb, LT, Stx2e and EAST1.
4. genetic chip according to claim 1, the wherein above-mentioned dna fragmentation of choosing from the main e. coli serotype O-antigen gene bunch last glycosyltransferase gene relevant with causing pig weaning period diarrhoea and oedema and oligosaccharide unit treatment enzyme gene and the main virulence factor gene of Escherichia coli is selected from the base sequence shown in SEQ ID NO:4-55.
5. genetic chip according to claim 1, the wherein above-mentioned dna fragmentation of choosing from bacterium 16s rDNA conserved region and Shigella ipaH gene is the base sequence shown in SEQ ID NO:1-3.
6. a detection causes pig weaning period diarrhoea and the e. coli serotype of oedema and the method for virulence factor, may further comprise the steps:
(1) according to the O-antigen gene that causes the e. coli serotype that pig weaning period diarrhoea and oedema are relevant bunch in glycosyltransferase gene and oligosaccharide unit treatment enzyme gene order, the gene order of Escherichia coli virulence factor and bacterium 16s rDNA conserved region sequence and Shigella ipaH gene order design also prepares the primer that is used for pcr amplification;
(2) prepare the genomic DNA of testing sample according to a conventional method, use primer in the step (1) to treat test sample product genomic DNA and carry out pcr amplification and purifying target sequence;
(3) with the target sequence that obtains in the fluorescein-labelled step (2);
(4) with target sequence behind the mark and the described gene chip hybridization of claim 1;
(5) obtain hybridization signal and Analysis and Identification results of hybridization with biochip scanner.
7. detection according to claim 6 causes pig weaning period diarrhoea and the e. coli serotype of oedema and the method for virulence factor, and the primer that wherein is used for pcr amplification in the above-mentioned steps (1) is selected from the base sequence shown in SEQ ID NO:56-NO:97.
8. a detection causes pig weaning period diarrhoea and the e. coli serotype of oedema and the kit of virulence factor, wherein include genetic chip, this genetic chip comprises solid phase carrier and the oligonucleotide probe that is fixed on this carrier, and these oligonucleotide probes comprise from main e. coli serotype O-antigen gene bunch last glycosyltransferase gene and the oligosaccharide unit treatment enzyme gene relevant with causing pig weaning period diarrhoea and oedema, the dna fragmentation of choosing in main virulence factor gene of Escherichia coli and bacterium 16s rDNA conserved region and the Shigella ipaH gene.
9. detection according to claim 8 causes pig weaning period diarrhoea and the e. coli serotype of oedema and the kit of virulence factor, also comprises to have the pcr amplification primer that is selected from the base sequence shown in SEQ ID NO:56-NO:97.
10. detection according to claim 8 causes pig weaning period diarrhoea and the e. coli serotype of oedema and the kit of virulence factor, also comprises the interpretation software that hybridizing box, hybridization solution and Analysis and Identification result use.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006100991739A CN101118234B (en) | 2006-07-31 | 2006-07-31 | Method for detecting bacillus coli inducing diarrhoea and hydropsy during pig weaning period and reagent kit thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006100991739A CN101118234B (en) | 2006-07-31 | 2006-07-31 | Method for detecting bacillus coli inducing diarrhoea and hydropsy during pig weaning period and reagent kit thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101118234A true CN101118234A (en) | 2008-02-06 |
| CN101118234B CN101118234B (en) | 2011-04-06 |
Family
ID=39054433
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2006100991739A Expired - Fee Related CN101118234B (en) | 2006-07-31 | 2006-07-31 | Method for detecting bacillus coli inducing diarrhoea and hydropsy during pig weaning period and reagent kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101118234B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105061602A (en) * | 2015-08-03 | 2015-11-18 | 江苏省农业科学院 | Fusion protein for detecting anti-ETEC (enterotoxigenic escherichia coil) antibody of pigs, as well as preparation method and application thereof |
| CN110982917A (en) * | 2020-01-09 | 2020-04-10 | 中国农业科学院上海兽医研究所(中国动物卫生与流行病学中心上海分中心) | Double PCR detection kit for Escherichia coli O8 and O9 serotypes and detection method thereof |
| CN113249504A (en) * | 2021-06-11 | 2021-08-13 | 内蒙古农业大学 | Bovine-derived escherichia coli detection primer probe combination, kit and application |
| KR20220062841A (en) * | 2020-11-09 | 2022-05-17 | 대한민국(농림축산식품부 농림축산검역본부장) | Method and Kit for Identifying F18 encoding enterotoxigenic and shigatoxin-producing Escherichia coli in Pigs using PNA probe |
| KR20220080460A (en) * | 2020-12-07 | 2022-06-14 | 대한민국(농림축산식품부 농림축산검역본부장) | Method and Kit for Identifying the serotype of Actinobacillus pleuropneumoniae causing pneumonia in Pigs using PNA probe |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107245525A (en) * | 2017-07-20 | 2017-10-13 | 北京农业职业学院 | The genome sequencing analysis method of grice diarrhoea Escherichia coli |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH11332599A (en) * | 1998-05-29 | 1999-12-07 | Shimadzu Corp | Oligonucleotide for detecting enterohemorrhagic escherichia colt and detection using the same |
| US6696254B2 (en) * | 2001-11-21 | 2004-02-24 | Kimberly-Clark Worldwide, Inc. | Detection and identification of enteric bacteria |
| CN1255554C (en) * | 2002-12-12 | 2006-05-10 | 山东澳兰生物工程研究院 | Diagnostic gene chip for pig infectious diarrhea and its use |
| CN1536090A (en) * | 2003-04-07 | 2004-10-13 | 中国人民解放军军事医学科学院卫生学 | Food-originated pathogenic bactenium quick detection gene chip and its application |
-
2006
- 2006-07-31 CN CN2006100991739A patent/CN101118234B/en not_active Expired - Fee Related
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105061602A (en) * | 2015-08-03 | 2015-11-18 | 江苏省农业科学院 | Fusion protein for detecting anti-ETEC (enterotoxigenic escherichia coil) antibody of pigs, as well as preparation method and application thereof |
| CN105061602B (en) * | 2015-08-03 | 2018-04-13 | 江苏省农业科学院 | For detecting fusion protein, the preparation method and application of anti-pig enterotoxigenic escherichia coil antibody |
| CN110982917A (en) * | 2020-01-09 | 2020-04-10 | 中国农业科学院上海兽医研究所(中国动物卫生与流行病学中心上海分中心) | Double PCR detection kit for Escherichia coli O8 and O9 serotypes and detection method thereof |
| KR20220062841A (en) * | 2020-11-09 | 2022-05-17 | 대한민국(농림축산식품부 농림축산검역본부장) | Method and Kit for Identifying F18 encoding enterotoxigenic and shigatoxin-producing Escherichia coli in Pigs using PNA probe |
| KR20220080460A (en) * | 2020-12-07 | 2022-06-14 | 대한민국(농림축산식품부 농림축산검역본부장) | Method and Kit for Identifying the serotype of Actinobacillus pleuropneumoniae causing pneumonia in Pigs using PNA probe |
| CN113249504A (en) * | 2021-06-11 | 2021-08-13 | 内蒙古农业大学 | Bovine-derived escherichia coli detection primer probe combination, kit and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101118234B (en) | 2011-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102851356B (en) | Composite gene chip and method for detection of fourteen common pathogenic bacteria | |
| CN103911443B (en) | The gene chip of a kind of detection 11 kinds of Common infectious dysentery substances and application thereof | |
| CN101118234B (en) | Method for detecting bacillus coli inducing diarrhoea and hydropsy during pig weaning period and reagent kit thereof | |
| CN101748193B (en) | Gene chip for detecting pathogens of lower respiratory tract and reagent kit | |
| CN103898108A (en) | Nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN102140507B (en) | Detection genetic chip and detection kit for infectious diarrhea | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN104017909A (en) | Oligonucleotide microarray for identification of pathogens | |
| CN104232800A (en) | Gene chip and kit for detecting porcine japanese encephalitis virus, swine fever virus and porcine reproductive and respiratory syndrome virus | |
| CN101760514A (en) | Gene chip and kit for detecting diarrheagenic escherichia coli in food and clinical samples | |
| CN101967509A (en) | Method, gene chip and detection reagent kit for detecting common cow pathogenic escherichia coli | |
| CN111961763A (en) | Novel gene chip for detecting coronavirus | |
| CN102424862A (en) | Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila | |
| CN104293976A (en) | Gene chip and kit for detecting pig epidemic type B encephalitis virus and/or pig porcine reproductive and respiratory syndrome virus | |
| CN104293981A (en) | Gene chip and kit for detecting swine epidemic encephalitis B viruses (SEEBVs) and/or swine fever viruses (SFVs) | |
| CN103993090A (en) | Specific nucleotides for providencia O31, O41, O42, O43 and O50 and application of specific nucleotides | |
| CN101121946A (en) | Combination detection gene chip kit for three kinds of genitourinary infection pathogen | |
| CN1328391C (en) | Gene chip for detecting B group of streptococcus, detection method and kit for detection | |
| CN101400801A (en) | Oligonucleotide microarray for identification of pathogens | |
| CN102888467A (en) | Gene chip for detecting porcine respiratory disease complex virus and method for detecting porcine respiratory disease complex virus | |
| CN105256041A (en) | Specific nucleotide for aeromonas hydrophila O44, O24, O25 and O28 and application thereof | |
| CN102154466B (en) | Nucleotides with specificity to internal transcribed spacer(ITS) of neisseria meningitidis and application thereof | |
| CN105200044A (en) | Nucleotides specific to vibrio fluvialis O1, O6, O7, O8 and O9 as well as application of nucleotides | |
| CN105200045A (en) | Nucleotides specific to vibrio fluvialis O11, O14, O16 and O17 as well as application of nucleotides | |
| CN110273014A (en) | A method of integrating one step of multiplex-nested PCR detection multiple-microorganism |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110406 Termination date: 20110731 |