CN101400801A - Oligonucleotide microarray for identification of pathogens - Google Patents
Oligonucleotide microarray for identification of pathogens Download PDFInfo
- Publication number
- CN101400801A CN101400801A CNA2006800534905A CN200680053490A CN101400801A CN 101400801 A CN101400801 A CN 101400801A CN A2006800534905 A CNA2006800534905 A CN A2006800534905A CN 200680053490 A CN200680053490 A CN 200680053490A CN 101400801 A CN101400801 A CN 101400801A
- Authority
- CN
- China
- Prior art keywords
- seq
- probe
- nucleic acid
- target nucleic
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
A method for detecting a target nucleic acid of a pathogen in a test sample, the method comprising preparing a target nucleic acid detecting reagent and contacting the target nucleic acid detecting reagent with an oligonucleotide microarray. A kit for detecting a target nucleic acid of a pathogen in a test sample is also described. The kit comprises at least one primer pair and an oligonucleotide microarray comprising at least one probe.
Description
The application requires in the rights and interests of the U.S. Provisional Patent Application 60/755,504 of submission on December 30th, 2005.
Background of invention
The present invention relates to be used for detecting test kit and the method that there is situation in the check sample pathogenic agent.Check sample can be available from the patient or from the source of food that may contain pathogenic agent or beverage.
Disease such as encephalitis, meningitis, brain (ridge) film inflammation, pneumonia, gastroenteritis, endocarditis, urinary tract infection is caused by pathogenic infection.Pathogenic agent comprises different bacteriums, virus, fungi and protozoon.Different pathogenic infections often has similar symptom, and this causes to be difficult to provide and infects or the making a definite diagnosis of the cause of disease.For example, the scorching patient of encephalitis and brain (ridge) film fever, headache generally can occur and faint from fear.Identify quickly and accurately and cause that the pathogenic agent of these symptoms is most important for determining to leave what prescription.Currently be used to identify that the diagnostic method of pathogenic agent comprises: microscopy, microorganism culturing, seroimmunity test and polymerase chain reaction (PCR).These methods need be through the personnel that screw up discipline and very time-consuming.
According to the PCR method of routine, the check sample that will contain the gene of rapping plate effect mixes with at least one pair of PCR primer of at least a gene with length-specific of being designed for increasing.Amplification PCR products is carried out agarose gel electrophoresis and is made its dyeing by making, and the PCR product is manifested.According to PCR method, identify gene contained in the check sample according to the PCR product length that is manifested.In same sample, can increase many to primer so that more effectively screen several genes.
Yet along with the quantity of contained PCR primer in the primer reagent increases, " noise " on running gel also increases thereupon.When producing the PCR product owing to non-specific annealing, " noise " will occur.For this reason, when using the PCR reaction, be difficult to determine not just only minority gene existence.
In addition, be necessary to design primer, so that on the limited running gel of resolving power, can distinguish through PCR product that PCR reaction amplifies.Design and to produce the low primer of suitable distinguishable PCR product and noise and be not easy and consuming time.Therefore, Yan Ge PCR-based/electrophoretic method is poor efficiencys for a large amount of genetic expressions of screening.
Summary of the invention
The present invention relates to be used for the method and the test kit of the target nucleic acid of detection of biological sample or check sample.Use oligonucleotide microarray apace the high flux screening pathogenic agent have a situation.Oligonucleotide microarray contains the various polynucleotides (probe) of known pathogenic agent, and identifies the pathogen with a hybridization assays.
On the one hand, the present invention relates to a kind of simple and easy and determine whether to exist in biological sample or the check sample method of the polynucleotide that contain target nucleic acid apace.
On the other hand, the present invention relates to a kind of method that is used for the target nucleic acid of detection of biological sample or check sample pathogenic agent, described method comprises: utilize with more than a kind of pathogenic agent in the conserved regions bonded a pair of or more to increase target nucleic acid in the sample of primer; The target nucleic acid of amplification is contacted with oligonucleotide microarray; And detect the situation that combines of target nucleic acid and probe, wherein combine and then show this pathogenic agent of existence in the sample with the special pathogen probe.Described microarray comprises two kinds or above probe or the probe groups that contains with different pathogens complementary polynucleotide sequence.
Another aspect the present invention relates to a kind of method of distinguishing intestinal bacteria in the sample (E.coli) and Salmonellas.Described method comprises: the conserved regions bonded in utilization and intestinal bacteria and the Salmonellas is a pair of or more to the nucleic acid in the primer amplification sample; The target nucleic acid of amplification is contacted with oligonucleotide microarray; And detect nucleic acid with as indicating the situation that combines that has the probe of intestinal bacteria and/or Salmonellas in the sample.Described microarray comprise contain with intestinal bacteria and Salmonellas in two kinds or above probe of variable region complementary polynucleotide sequence.
On the other hand, the present invention relates to a kind of test kit that is used for detecting at the target nucleic acid of biological sample or check sample pathogenic agent, described test kit comprises: at least one pair of primer and oligonucleotide microarray, described microarray comprise at least a probe that is immobilized on the solid support.
According to the following description and in conjunction with the accompanying drawings, and illustrate the principle of the invention by illustration, other aspects of the present invention and advantage will be apparent.
The accompanying drawing summary
Figure 1A and Figure 1B have shown the conservative guiding region and the variable probe region of the DNA of bacteria sequence of 16S rDNA.
Fig. 2 A and Fig. 2 B have shown the conservative guiding region and the variable probe region of the fungal DNA sequence of 18S rDNA.
Fig. 3 is the graphic general introduction of embodiment of the present invention.
Detailed Description Of The Invention
1. pathogen
Term " pathogen " refers to disease factor or virulence factor. Terms pathogen typically refers to infectious organisms most. They include but not limited to: bacterium, virus, fungi and protozoan. Method of the present invention and kit can be used for identifying pathogen and the microorganism that has produced communicable diseases or poisoned by food. The example of pathogen includes but not limited to: rickettsia, Chlamydia, mycoplasma, conveyor screw, streptococcus, salmonella (almonella), staphylococcus, mycoplasma, Listeria Monocytogenes (L.monocytogenes), Neisseria meningitidis (N. meningtides), Escherichia coli, haemophilus influenzae (H.influenzae), B. burgdorferi (B.burgdorferi), Leptospira, mycetozoan, anaerobic bacteria (anaecrobacter), Mycobacterium tuberculosis (M.tuberculosis), enterococcus, poliovirus 1, Enterovirus 71, Enterovirus 70, echovirus 2, echovirus 4, echovirus 6, echovirus 9, echovirus 11, echovirus 12, echovirus 26, CA 13, CA 15, CA 18, CA 20, CA 21, CB 3-A, CB 3-C, HSV-1 and HSV-2.
2. biological sample and sample survey
Used term " biological sample " refers to take from the sample of the component (for example cell) of organism or organism in the literary composition. In one embodiment, organism is mammal. In another embodiment, organism is human. Sample can be any biological tissue or biofluid. Usually biological sample is taken from the patient. These samples include but not limited to: tissue, cell, blood, serum, cerebrospinal fluid, urine, cell lysate, blood plasma, ight soil, saliva, haemocyte, fine-needle aspiration biopsy sample, peritoneal fluid and liquor pleurae, or from the cell of above sample. Biological sample comprises histotomy equally, for example is used for the frozen section of histology purposes.
In certain embodiments, the present invention relates to a kind of method, wherein biological sample is selected from tissue, cell, blood, serum, cerebrospinal fluid, urine, cell lysate, blood plasma, ight soil, saliva, haemocyte, fine-needle aspiration biopsy sample, peritoneal fluid and liquor pleurae, or from the cell of above sample.
Term used herein " sample survey " refers to take from the sample in non-living body source. The source of sample survey includes but not limited to: food, beverage, soil, underground water, seawater and lakebed bog water. In these sample surveys, usually contain pathogen and by the cell of pathogenic infection.
The pathogenic agent of coming identification of organism sample and check sample according to the target nucleic acid that whether has special pathogen.In certain embodiments, target nucleic acid comprises: the genome material of pathogenic agent, Mitochondrial DNA, rRNA, tRNA, mRNA, viral RNA, plasmid DNA and their fragment.
According to symptom and route of infection, pathogenic agent is classified into numerous groups.For a plurality of groups of correspondence, prepare plurality of target detection of nucleic acids reagent and oligonucleotide microarray.Use target nucleic acid detection reagent and oligonucleotide microarray, they are selected according to symptom.Therefore, can among the pathogenic agent of predicting according to symptom and route of infection, identify real pathogenic agent pin-point accuracy.
3. target nucleic acid
Target nucleic acid is pathogenic agent institute inherent polynucleotide to be tested.These polynucleotide are genetic stockss, and it comprises: genomic dna/RNA, Mitochondrial DNA, rRNA, tRNA, mRNA, viral RNA and plasmid DNA.By detecting the situation that exists of the distinctive target nucleic acid of pathogenic agent, can infer the situation that exists of pathogenic agent self.Similarly, existence has then shown this genus of existence member to the specific target nucleic acid of the genus of pathogenic agent.
Term " nucleotide sequence " or " nucleic acid " or " polynucleotide " commutative use and refer to the sequence of heteropolymer or these Nucleotide of Nucleotide." oligonucleotide " refers to the polynucleotide of about 50 or following Nucleotide.These terms refer to DNA or RNA equally, and they can be strand or two strands, and can represent positive-sense strand or antisense strand for cDNA.In the sequence of this paper, A is a VITAMIN B4, and C is a cytosine(Cyt), and T is a thymus pyrimidine, and G is a guanine, and N is A, C, G or T (U).Can expect that if polynucleotide are RNA, the T (thymus pyrimidine) in the sequence that this paper provided replaces with U (uridylic) so.
Term " complementary " or " complementarity " refer to the natural combination by the base pairing polynucleotide.For example, sequence 5 '-AGT-3 ' combines with complementary sequence 3 '-TCA-5 '.Article two, the complementarity between the single chain molecule can be " part ", causes to have only some nucleic acid combination; Can be " completely " perhaps, cause between single chain molecule, to have complementarity fully.Complementary degree between the nucleic acid chains influences the efficient and the intensity of hybridizing between the nucleic acid chains significantly.
Term used herein " purifying " or " purifying basically " refer to: indicated nucleic acid or polypeptide to be to exist under the situation that does not have other biological macromole (such as polynucleotide, protein etc.) basically.
Term used herein " isolating " refers to: nucleic acid separates with at least a other components that therewith exist in this nucleic acid natural origin.In one embodiment, described nucleic acid is only at (if any) solvent, buffer reagent, ion or normally be present under the situation that other components in the nucleic acid solution exist and exist.Term " isolating " and " purifying " do not comprise the nucleic acid in the natural origin that is present in them.
This paper employed " being equal to basically " or " substantially similar " refer to: owing to one or more displacement, disappearance or add the nucleotide sequence be different from reference sequence, and the actual result of described displacement, disappearance or insertion does not cause between reference sequence and the tested sequence disadvantageous function different.Usually this sequence that is equal to basically have be no more than about 35% difference (promptly compare with corresponding reference sequence, the quantity that is equal to displacement, interpolation and/or the disappearance of indivedual Nucleotide in the sequence basically divided by be equal to basically in the sequence total quantity of Nucleotide approximate 0.35 or still less).This sequence be considered to shown in sequence have 65% sequence identity.In one embodiment, the sequence that is equal to basically of the present invention is no more than 30% different (70% sequence identity) with reference sequence; In the variant of this embodiment, be no more than 25% difference (75% sequence identity); In another variant of this embodiment, be no more than 20% difference (80% sequence identity); In another variant of this embodiment, be no more than 10% difference (90% sequence identity); In another variant of this embodiment, be no more than 5% difference (95% sequence identity).In one embodiment, described nucleotide sequence has the identity at least about 65%.In other embodiments, described nucleotide sequence has the identity at least about 75%, 80%, 85%, 90%, 95%, 98% or 99%.
In some aspects, the present invention relates to preparation " target nucleic acid detection reagent ".The target nucleic acid detection reagent can or target nucleic acid self or the amplification target nucleic acid.
Use conventional technology that the target nucleic acid sequence is separated from biological sample and check sample.Determine used technology according to the polynucleotide (DNA or RNA) that will isolatingly be what type.Isolation technique also can modify according to the type of pathogenic agent to be investigated and the amount of biology/check sample.
4. detection reagent
In certain embodiments, before hybridizing with oligonucleotide microarray, target nucleic acid is amplified earlier to produce " target nucleic acid detection reagent ".In other embodiments, before hybridizing with oligonucleotide microarray, target nucleic acid is not amplified, and at this moment " target nucleic acid detection reagent " and target nucleic acid are equal to.In one embodiment, with one or more target nucleic acids of planting tagged molecule target-marking nucleic acid or being increased.Being attached with of tagged molecule is beneficial to the target nucleic acid that detects target nucleic acid or increased when hybridizing with oligonucleotide microarray.Can mix tagged molecule by in many methods ripe known to those skilled in the art any.In one embodiment, can when the amplification step in the target nucleic acid of preparation sample, mix tagged molecule simultaneously.Therefore, for example use the polymerase chain reaction (PCR) of the primer or the Nucleotide that comprise tagged molecule that the amplified production that contains described tagged molecule will be provided.In certain embodiments, tagged molecule comprises: vitamin H, magnetic bead, fluorescence dye, radio-labeling, enzyme, colorimetric mark, tinted shade or plastic bead.In one embodiment, as mentioned before, use the Nucleotide (fluorescein-labeled UTP and/or CTP) that contains tagged molecule to carry out transcription amplification, cause mark to be incorporated in the nucleic acid of being transcribed.
As selection, tagged molecule can directly be added in the original object nucleic acid (for example: mRNA, polyA, mRNA, cDNA etc.).The method that makes tagged molecule adhere to nucleic acid is known by those skilled in the art, these methods comprise: for example by make the target nucleic acid phosphorylation carry out nick translation or end mark via kinase reaction, by the nucleic acid joint sample nucleic acid is connected with tagged molecule subsequently.
Be applicable to that detectable label molecule of the present invention comprises: by the detectable any composition of method of Wave Spectrum, photochemistry, biological chemistry, immunochemistry, electricity, optics or chemistry.Useful tagged molecule of the present invention comprises: vitamin H, with the streptavidin conjugate dyeing of mark; Magnetic bead (Dynabeads for example
TM); Fluorescence dye (for example fluorescein, texas Red, rhodamine, green fluorescent protein etc.); Radio-labeling (for example
3H,
125I,
35S,
14C or
32P); Enzyme (for example horseradish peroxidase, alkaline phosphatase and normally used other enzymes in ELISA); And the colorimetric mark, such as Radioactive colloidal gold or tinted shade or plastics (for example polystyrene, polypropylene, rubber etc.) pearl.Instruction uses the patent of these marks to comprise: U.S. Patent number 3,817,837,3,850,752,3,939,350,3,996,345,4,277,437,4,275,149 and 4,366,241.In one embodiment, tagged molecule be contain mix the Nucleotide of the tagged molecule in the target nucleic acid that increases.
The Nucleotide that contains tagged molecule can be with fluorescent substance (Cy3, Cy5 etc.) or biotin labeled Nucleotide (monomer), because it has high detection sensitivity and easy handling.The Nucleotide that contains tagged molecule is brought in the polynucleotide that increase by the PCR reaction, and the polynucleotide of amplification are carried out mark.Under the situation with biotin labeling Nucleotide, the polynucleotide that are labeled manifest by enzyme-linked immunosorbent assay (ELISA).
In certain embodiments, the present invention includes:, and detect the gene test step that in PCR reaction amplified production, whether has the polynucleotide that contain target nucleic acid by the amplification step of pcr amplification target nucleic acid.In the gene test step, for example use oligonucleotide microarray to detect the situation that exists of polynucleotide.
5. target nucleic acid amplification step
In certain embodiments, the target nucleic acid detection reagent provides by the amplification target nucleic acid.In one embodiment, use pcr amplification target nucleic acid detection reagent.In the target nucleic acid amplification step, use the sample extraction thing, the gene test primer reagent and the mark Nucleotide of the polynucleotide that contain target nucleic acid of being used to increase carries out the PCR reaction.The sample extraction thing is the extract of following acquisition: according to being used for extracting and the known polynucleotide extracting method of purify DNA or RNA extracts and the contained polynucleotide of purifying check sample.The sample extraction thing uses as template in the PCR reaction.
If a kind of nucleic acid and second kind of nucleic acid are hybridized with same probe nucleic acid under stringent condition, then this nucleic acid is substantially the same with second kind of nucleic acid.Homology between the substantially the same nucleic acid can for 80%, 90%, 95% or more than.
In order to carry out the gene amplification step, allow sample extraction thing, Causal Agent Identification primer reagent, the Nucleotide that is labeled and PCR necessary other reagent of reaction and enzyme in a reaction tubes, carry out the PCR reaction.By RCR reaction amplification polynucleotide.
Usually, it is desirable to amplification of nucleic acid sample before hybridizing with oligonucleotide microarray.Suitable amplification method includes but not limited to: polymerase chain reaction (PCR) (Innis etc., PCRProtocols.A guide to Methods and Application.Academic Press, Inc.SanDiego, (1990)), ligase chain reaction (LCR) (LCR) is (referring to Wu and Wallace, Genomics, 4:560 (1989); Landegren etc., Science, 241:1077 (1988); With Barringer etc., Gene, 89:117 (1990)), transcription amplification (Kwoh etc., Proc.Natl.Acad.Sci.USA, 86:1173 (1989)), self-sustained sequence replication (Guatelli etc., Proc.Nat.Acad.Sci.USA, 87:1874 (1990)).In one embodiment, use the pcr amplification target nucleic acid.In another embodiment, use ThermoScript II (RT)-pcr amplification target nucleic acid.In yet another embodiment, use Tth archaeal dna polymerase (can derive from for example Promega (Cat.No.M210A)) to carry out PT-PCR.The Tth archaeal dna polymerase is a recombinant form of taking from the enzyme of thermophilic eubacterium thermus thermophilus (Thermus thermophilus) HB-8, is the thermophilic enzyme at 74 ℃ of following repetition DNAs, and shows under 95 ℃ 20 minutes transformation period.Tth archaeal dna polymerase catalysis Nucleotide direction along 5 ' → 3 ' in the presence of magnesium aggregates into double-stranded DNA, and uses the direction of RNA template along 5 ' → 3 ' to make Nucleotide aggregate into DNA in the presence of manganese.The TthDNA polysaccharase is through being usually used in PCR, RT-PCR, reverse transcription and the primer extension reaction under elevated temperature.
Amplification method of the present invention has utilized following enzymic activity: the RNA polymerase of archaeal dna polymerase and dependence DNA.The archaeal dna polymerase that is used for the inventive method and composition can be implemented primer extension according to method of the present invention.Therefore, selected polysaccharase is the polysaccharase that nucleic acid primer is extended along the target nucleic acid template, and described target nucleic acid template at least mainly is made up of deoxyribonucleotide.Polysaccharase can be replaced nucleic acid chains from polynucleotide, and wherein said polynucleotide are described displacement chain bonded polynucleotide with it.
Any ThermoScript II all can be used for including but not limited in the enforcement of the present invention: Superscript RTII, " regular " MMLV-RT, AMV RT or their combination.
When not having the pathogenic agent of prediction in the sample extraction thing, and when not having polynucleotide in the sample extraction thing, then in the PCR product, there are not the polynucleotide of amplification, and in detection gene step subsequently, can not detect polynucleotide.
When having the pathogenic agent of prediction in the sample extraction thing, the polynucleotide that derive from described pathogenic agent then serve as template in the PCR reaction.Combine with template by the corresponding amplimer in the Causal Agent Identification primer reagent, the PCR reaction is carried out, and amplifies the polynucleotide that contain pathogenic agent institute inherent target nucleic acid thus.Mark Nucleotide is brought in the polynucleotide (DNA) that increased, and promptly is brought in the PCR reaction product.The PCR reaction product is labeled thus.
Be used for increasing the primer of target nucleic acid according to designing: bacterium, virus, fungi and protozoon from being selected from the isolating polynucleotide of following pathogenic agent.In other embodiments, be used for increasing the primer of target nucleic acid according to designing: Rickettsiae from being selected from the isolating polynucleotide of following pathogenic agent, chlamydozoan, mycoplasma, spirochete, suis, Salmonellas, staphylococcus, mycoplasma, monocyte hyperplasia listeria spp (L.monocytogenes), Neisseria meningitidis (N.meningtides), intestinal bacteria, hemophilus influenzae (H.influenz α e), B. burgdorferi (B.burgdorferi), Leptospira, mycetozoan, anerobe, Mycobacterium tuberculosis (M.tuberculosis), faecalis, poliovirus 1, Enterovirus 71, Enterovirus 70, ECHO virus 2, ECHO virus 4, ECHO virus 6, ECHO virus 9, ECHO virus 11, ECHO virus 12, ECHO virus 26, CA 13, CA 15, CA 18, CA 20, CA 21, Coxsackie B virus 3-A, Coxsackie B virus 3-C, HSV-1 and HSV-2.In some embodiments, PCR has utilized the primer that contains isolating polynucleotide sequence from above listed pathogenic agent at least a.
In certain embodiments, specific primer is to annealing with the polynucleotide of more than a kind of pathogenic agent.This primer is to being annealed to zone conservative in some pathogenic agent.Yet primer is the variable region to the nucleotide sequence of adjacency.Use this primer can be amplified, but also allow these pathogenic agent when hybridizing, can be distinguished with oligonucleotide microarray to the nucleotide sequence that makes multiple pathogenic agent.When using two same zone from the 16S/18S rDNA gene of many bacteriums and fungi as primer, these two districts provide the dna fragmentation of 197 base pairs (bacterium) or 248 base pairs (fungi) by pcr amplification.Find many low conserved regions in the dna fragmentation between guiding region, these low conserved regions provide probe to distinguish pathogenic agent according to its particular sequence by hybridization.Figure 1A and 1B referring to the DNA of bacteria sequence of having shown 16S rDNA.Shown the variable probe region between these two conservative guiding regions and this two conserved regions.Fig. 2 A and 2B have shown guiding region and the probe region in the described 18S rDNA fragment of fungal DNA sequence.
In one embodiment, PCR utilizes the primer that contains the polynucleotide that are selected from SEQ ID NO:1-12 (table 1).Some right combinations of primer comprise: SEQ ID NO:1 and 2; SEQ IDNO:1 and 4; SEQ ID NO:1 and 6; SEQ ID NO:3 and 2; SEQ ID NO:3 and 4; SEQ ID NO:3 and 6; SEQ ID NO:5 and 2; SEQ ID NO:5 and 4; SEQ ID NO:5 and 6; SEQ ID NO:5 and 6; SEQ ID NO:7 and 8; SEQ ID NO:9 and 10 and/or SEQ ID NO:11 and 12.
Table 1
| The primer source | Sequence (5 ' → 3 ') | SEQ?ID?NO |
| Bacterium+ | actcctacgggaggcagcag | 1 |
| Bacterium- | attaccgcggctgctggcac | 2 |
| Bacterium+ | ccagactcctacgggaggcagcag(353) | 3 |
| Bacterium- | gattaccgcggctgctggcac(553) | 4 |
| Bacterium+ | ccatactcctacgggaggcagcag(353) | 5 |
| Bacterium- | tattaccgcggctgctggcac(553) | 6 |
| Enterovirus: | ctccggcccctgaatgcgg(372) | 7 |
| Enterovirus: | acccaaagtagtcggttccg(478) | 8 |
| HSV | ggaactcctccaccgccca(74869) | 9 |
| HSV | gtaccagggcgtcctgggc(75086) | 10 |
| Fungi | ggccgttcttagttggtggagt | 11 |
| Fungi | atgctctatccccagcacgac | 12 |
The numeral of sequence back refers to the nucleotide position of primer annealing on various templates.
6. microarray
" microarray " is the linear or two-dimentional microarray of the discrete regions that forms on the solid support surface, and each discrete regions all has definite zone.Use a kind of in the displaying strategy described below, will be fixed on the solid support with target nucleic acid sequence or its subsequence complementary oligonucleotide probe microarray.Method of the present invention is used to contain and is represented the oligonucleotide microarray of planting the probe of target nucleic acid sequence complementarity with one or more.Usually these probes are DNA, and are fixed on the solid surface in the mode of highdensity microarray (i.e. " gene chip ").Basically any possible substrate (substrate) all can be the present invention and utilizes.Substrate can be biological substrate, abiotic substrate, organic substrate, inorganic substrate or their any combination that exists with particle, chain, throw out, gel, thin slice, pipe, spheroid, container, kapillary, pad, section, film, plate, slide glass etc.Substrate can have any suitable shape, for example disk, square, spherical, annular etc.Substrate is normally flat, but can present multiple alternative surface tissue.For example, substrate can contain and carries out synthetic convex area or depressed area thereon.The rigid support body that carries out reaction described herein above substrate and surface thereof can be formed on.Same substrate and the surface thereof selected provides suitable light absorption characteristics.For example, substrate can be polymeric Langmuir-Bu Luo Ztel film, functional glass (functionalized glass), Si, Ge, GaAs, GaP, SiO
2, SiN
4, modification silicon or numerous kinds gel or in the polymkeric substance any, such as (gathering) tetrafluoroethylene, (gathering) vinylidene fluoride, polystyrene, polycarbonate or their combination.Other substrate materials will be apparent when those skilled in the art consult this disclosure.In one embodiment, substrate is a plain film glass.
Various strategies can be used for making the customization of oligonucleotide probe microarray and are presented on the substrate, the sequence information maximization about target nucleic acid that hybridization collection of illustrative plates and deducibility are gone out.Exemplary representing with custom strategies describes in PCT patent disclosure specification sheets WO 94/12305, and the document is hereby incorporated by reference.
Probe can be oligodeoxyribonucleotide or oligoribonucleotide, or can be by the modified forms of complementary base pairing with the above nucleotide polymer of target nucleic acid sequence hybridization.Modified forms comprises 2 '-O-methyl oligoribonucleotide and so-called PNA, and oligodeoxyribonucleotide passes through peptide bond but not connects by phosphodiester bond in PNA.Probe can be connected (for example 3 ', 5 ' or pass through base) by any key with support.3 ' connection is more commonly used, because the location is consistent with the chemical method that is used for the oligonucleotide solid phase synthesis like this.Numerous single probes are fixed in the on-chip discrete location, so that the hybridization of discrimination objective detection of nucleic acids reagent and every type of probe.In numerous discrete single probes each is called as " point ".The size of point can have 0.35 μ M to 40 μ MDNA in each point about diameter 0.7mm to 1mm.For example, be used to check the polynucleotide of suis and two kinds of pathogenic agent of Salmonellas to exist the dna microarray of situation can have two points: be made up of the suis probe for one, another is made up of the Salmonellas probe.In certain embodiments, there are 6,12,24,36,56,64,96,108 or 384 different probe points to be fixed on the substrate.In one embodiment, microarray can be 1.5mm
2
In some microarraies, the length of all probes is all identical.Other microarraies use the probe of different lengths.The length of probe can change to optimize specific hybridization conditions.Optimize hybridization conditions to reduce " noise ".Revise hybridization conditions by the pH, temperature and the ion condition that change hybridization.Term " strictness " be used for indicating be interpreted as in the art usually need between the nucleotide sequence highly complementary so that the condition that hybridization is taken place.Stringent condition can comprise the height stringent condition, for example under 65 ℃, at 0.5M NaHPO
4, hybridize in 7% sodium lauryl sulphate (SDS), 1mM EDTA.Under the situation of oligonucleotide hybridization, other exemplary stringent hybridization conditions are included under 37 ℃, wash in 6 * SSC/0.05% trisodium phosphate.Higher temperature can be used for longer oligonucleotide for for example 48 ℃, 55 ℃, 60 ℃ and 64 ℃.
In another embodiment, the present invention relates to further comprise that there are the method for situation in washing oligonucleotide microarray and certification mark molecule.For example in 0.1 * SSC/0.1%SDS, wash under 68 ℃ and stringent condition in appropriateness under wash (promptly under 42 ℃, in 0.2 * SSC/0.1%SDS, washing).
In some embodiments, probe is designed to and isolating polynucleotide complementation from pathogenic agent, and described pathogenic agent is selected from: bacterium, virus, fungi, protozoon.In other embodiments, probe is designed to and isolating polynucleotide complementation from be selected from following pathogenic agent: Rickettsiae, chlamydozoan, mycoplasma, spirochete, suis, Salmonellas, staphylococcus, mycoplasma, monocyte hyperplasia listeria spp (L.monocytogenes), Neisseria meningitidis (N.meningtides), intestinal bacteria, hemophilus influenzae (H.influenzae), B. burgdorferi (B.burgdorferi), Leptospira, mycetozoan, anerobe, Mycobacterium tuberculosis (M.tuberculosis), faecalis, poliovirus 1, Enterovirus 71, Enterovirus 70, ECHO virus 2, ECHO virus 4, ECHO virus 6, ECHO virus 9, ECHO virus 11, ECHO virus 12, ECHO virus 26, CA 13, CA 15, CA 18, CA 20, CA 21, Coxsackie B virus 3-A, Coxsackie B virus 3-C, HSV-1 and HSV-2.In another embodiment, probe is selected from SEQ ID NO:13-52 (table 2).
Table 2
| The probe source | Sequence (5 ' → 3 ') | SEQ?ID?NO | |
| Suis | ccgagcaacgccgcgtgagtgaagaaggttttcggatc | 13 | |
| Salmonellas | tgcagccatgccgcgtgtatgaagaaggccttcgggtt | 14 | |
| Salmonellas | tttttccccggggaggaaggtgttgtggttaata | 15 | |
| Salmonellas | tttttccccgtgttgtggttaataaccgcagcaa | 16 | |
| Salmonellas | cccccgtactttcagcggggaggaaggtgttgtggttaat | 17 | |
| Staphylococcus | cggagcaacgccgcgtgagtgatgaaggtcttcggatc | 18 | |
| Mycoplasma | tgaagcaatgccgcgtgagtgatgacggccttcgggtt | 19 | |
| The monocyte hyperplasia | cggagcaacgccgcgtgtatgaagaaggttttcggatc | 20 | |
| Neisseria meningitidis | tccagccatgccgcgtgtctgaagaaggccttcgggtt | 21 | |
| Intestinal bacteria | tgcagccatgccgcgtgtatgaagaaggccttcgggtt | 22 | |
| Intestinal bacteria | gaagggagtaaagttaatacctttgctcattgacg | 23 | |
| Intestinal bacteria | tttttcccccggggaggaagggagtaaagttaata | 24 | |
| Intestinal bacteria | cgtcaatgagcaaaggtattaactttactccctt | 25 | |
| Intestinal bacteria | ccccccgtcaatgagcaaaggtattaactttactccctt | 26 | |
| Hemophilus influenzae | cgcagccatgccgcgtgaatgaagaaggccttcgggtt | 27 | |
| B. burgdorferi | cggagcgacactgcgtgaatgaagaaggtcgaaagatt | 28 | |
| Leptospira | agcagcgacgccgcgtgaacgatgaaggtcttcggatt | 29 | |
| | tgcagccatgccgcgtgtatgaagaaggccttagggtt | 30 | |
| Anerobe | tgcagcaacgccgcgtgagtgataaggcttcgggttgt | 31 | |
| Mycobacterium tuberculosis | tgcagcgacgccgcgtgggggatgacggccttcgggtt | 32 | |
| Faecalis | ccgagcaacgccgcgtgagtgaagaaggttttcggatc | 33 | |
| Poliovirus 1 | ccacggagcaagtgccctcaatccagagggtggctt | 34 | |
| Enterovirus 71 | ctgcggagcacatgctcacaaaccagtgggtggtgt | 35 | |
| |
ccatggagcaaatgctcacaatccagtgagtggttt | 36 | |
| ECHO virus 2 | ctgcggagcaggtacccacgagccagtgggcagcct | 37 | |
| ECHO virus 4 | ctgcggagcacacgctcacaagccagtgagtggtgt | 38 | |
| ECHO virus 6 | ctgcggagcaggtgctcacaatccagtgggtggcct | 39 | |
| ECHO virus 9 | |
40 |
| ECHO virus 11 | ctgcggagcacatacccctaatccaaggggcagtgt | 41 | |
| ECHO virus 12 | ctgtggagcaagtgcccacaacccagtgggtggctt | 42 | |
| ECHO virus 26 | ctgcggagcaggcacccacaagccagtgggcagcct | 43 | |
| CA 13 | ccatggagcaagtgatcacaatccagtgatattctt | 44 | |
| CA 15 | ccacggagcaggtgacttcaagccagaagttggcct | 45 | |
| CA 18 | ccacggagcaagtgctcacgaaccagtgagtggctt | 46 | |
| |
ccatggagcaggcggtcacagaccagtgactagctt | 47 | |
| CA 21 | ccacggagcaaccgctcacaacccagtgagtaggtt | 48 | |
| Coxsackie B virus 3-A | ctgtggatcatgcgccctcaaaccagagggaagcgt | 49 | |
| Coxsackie B virus 3- | ctgcggagcatgcacccacaagccagtgggtagcgt | 50 | |
| HSV-1 | gttgggccacgcgccccccgagctggtggacggccccgg | 51 | |
| HSV-2 | gcttggtgacgcgcgcgcccagctcctccacggcctccg | 52 |
Developed the high density oligonucleotide microarray that some technology designed, synthesize, hybridize and explained type mentioned above already.
Can make and use up guiding synthetic (light directed synthesis) to set up oligonucleotide probe (Fodor etc., Science, 251:767-73 (1991)) at substrate surface.The synthetic photolithography of based semiconductor and the solid state chemistry of making of light guiding synthesizes linked together.This method originate in when the joint of modifying with the removable blocking group of photochemistry and solid substrate be that substrate surface is when being connected.The joint and the phosphoramidite that have synthesized the protecting group of band photo-labile, and by Pease etc., PNAS, 91:11241-11245 (1994) describes.Light is directed into the specific region of synthetic surface by photo etched mask, and activates these zones so that carry out subsequently chemical coupling.To have in a series of Nucleotide of photo-labile protecting group first with the substrate incubation, chemical coupling occurs on those positions of having been illustrated in abovementioned steps.Light is directed to next synthesising position by the different piece of mask then, constructs chemical step, promptly stipulates the polynucleotide probe of intersection, and each probe all has its own unique address on the surface of substrate.Oligonucleotide microarray and fluorescent label DNA or RNA hybridization that amplification produces are hybridized and are detected (Fodor etc., 1993) by falling to penetrating fluorescence confocal microscope (epi-fluorescence confocal microscopy).
In one embodiment, oligonucleotide microarray has the point that contains the tested whole probes of each pathogenic agent institute's inherent.
Therefore, the present invention relates to be used for the method for target nucleic acid of the pathogenic agent of detection of biological sample or check sample.Described method comprises: preparation target nucleic acid detection reagent; And the target nucleic acid detection reagent is contacted with oligonucleotide microarray.In some embodiments, pathogenic agent is selected from suis, Salmonellas, staphylococcus, mycoplasma, monocyte hyperplasia listeria spp (L.monocytogenes), Neisseria meningitidis (N.meningtides), intestinal bacteria, hemophilus influenzae (H.influenzae), B. burgdorferi (B.burgdorferi), Leptospira, mycetozoan, anerobe, Mycobacterium tuberculosis (M.tuberculosis), faecalis, poliovirus 1, Enterovirus 71, Enterovirus 70, ECHO virus 2, ECHO virus 4, ECHO virus 6, ECHO virus 9, ECHO virus 11, ECHO virus 12, ECHO virus 26, CA 13, CA 15, CA 18, CA 20, CA 21, Coxsackie B virus 3-A, Coxsackie B virus 3-C, HSV-1 and HSV-2.In some embodiments, oligonucleotide microarray comprises probe, and described probe comprises isolating polynucleotide sequence from the above pathogenic agent of enumerating at least a.In another embodiment, probe comprises the polynucleotide sequence that is selected from SEQ ID NO:13-52.
7. test kit
In some aspects, the invention still further relates to the test kit of the target nucleic acid that is used for detecting the check sample pathogenic agent.Described test kit comprises at least one pair of primer and comprises the oligonucleotide microarray of at least a probe.In one embodiment, described primer is to comprising the primer that is selected from ID NO:1-12.In another embodiment, probe comprises the polynucleotide sequence that is selected from SEQ ID NO:13-52.
The present invention will explain in more detail by following examples.It is illustrative and nonrestrictive that embodiments of the invention and embodiment should be construed to, and the present invention is intended to be subject to details given in the literary composition, but can modify in the scope of appended claims and equivalency range.
8. embodiment
Embodiment 1
The dna microarray preparation method
1. glass surface washing
The slide glass of cleaning is immersed H
2SO
4/ H
2O
2Among the 2:1 30 minutes.Use H
2O washing 3 times is used methanol wash 2 times then.In forced air stream, dry up, dried by the fire 10 minutes down at 80 ℃ then.
2. the silanization of glass
In the 1mM acetum of 2%N-(2-aminoethyl)-3-aminopropyl trimethoxysilane (EDA), descended supersound process 30 minutes in room temperature (RT).Use H
2O washing 3 times is used methanol wash 2 times then.At N
2Dry up in the air-flow, dried by the fire 15 minutes down at 110 ℃ then.
3. modify the silanization slide glass with the Heterobifunctional linking agent
Under room temperature, immersed cross-linking agent solution (80ml that contains 384mg PDITC (2mmol) contains the DMF of 10% anhydrous pyridine) 2 hours.With DMF flushing 3 times, then with ethylene dichloride flushing 2 times.At N
2In dry up.
4. microarray trace and DNA immobilization
In containing 40 μ M NH putting on the activatory slide glass under 60% humidity
2The 0.1M carbonate buffer solution of-oligodeoxynucleotide (ODN) (pH 9.0).Reaction is more than 1 hour under 37 ℃ of saturated humidities.The water flushing also is immersed in the aqueous solution that contains 6-amino-hexanol (100mM).With 100 ℃ water washing 2-3 minutes, under forced air, dry up then.
DNA immobilization structure
Embodiment 2
The dna microarray hybridizing method
1.PCR amplification and mark
1 μ l DNA sample is joined in the 100 μ l PCR reaction buffers, and described reaction buffer contains the primer (every kind) of 10mM Tris-HCl (pH 9.0), 50mM KCl, 3.75mM MgCl2,0.1%Triton X-100,0.1mM dNTP (every kind) and 0.2 μ M Cy5 mark.Add 5u Taq archaeal dna polymerase then, carry out pcr amplification by following temperature condition:
I) .96 ℃ 2 minutes
Ii) .95 ℃ 20 seconds
Iii) .60 ℃ 20 seconds
Iv) .72 ℃ 30 seconds
Get back to step I i), 28 circulations
V) .72 ℃ 2 minutes
Total reaction time about 1 hour 20 minutes.
2.DNA microarray hybridization
The hybridization buffer dilution PCR solution that contains 0.75M NaCl, 75mM Trisodium Citrate and 0.1%SDS pH 7.2 with 5 times of volumes.Hybridized 1 hour down in 61 ℃.
3.DNA microarray washing
Slide glass after hybridization 0.3M NaCl, 30mM Trisodium Citrate and 0.1%SDS were washed 15 minutes down at 50 ℃, wash altogether 3 times, washed 15 minutes down at 50 ℃ with 0.3M NaCl, 30mM Trisodium Citrate then.The water flushing is dry in forced air then.
4. microarray reads
The dna microarray results of hybridization is passed through FuJiFilm
TMFluorescent scanning instrument FLA3000 reads, and (633nm) excites Cy5 with HeNe laser.Use software packaging ArrayGuage
TMAnalytical signal density.
Embodiment 3
From by direct collecting cell the isolating tissue slice of patient.Use any known solutions from these cells, to extract DNA.Use two couples of primer SEQ ID NO:1-2 and SEQ ID NO:7-8 DNA by the about 2-10ng of pcr amplification.Will [
32P]-dCTP is included in the PCR reaction, with the DNA of mark amplification, thereby produces the target nucleic acid detection reagent of tape label molecule.
The target nucleic acid detection reagent of tape label molecule via centrifugal post (spin column) purifying unnecessary to remove [
32P]-dCTP, 95 ℃ of following incubation sex change, subsequently directly in cooled on ice.Under high stringent condition, make the target nucleic acid detection reagent of the tape label molecule of sex change contain incubation in the presence of the oligonucleotide microarray of probe then, described probe contains SEQ ID NO:13-52.Hybridization is at 0.5M NaHPO
4, under 65 ℃, carried out 2 hours in 7% sodium lauryl sulphate (SDS), 1mM EDTA, subsequently in 0.1 * SSC/0.1% SDS in 68 ℃ of washings 3 times down.This microarray is exposed to X-ray film and the autoradiogram(ARGM) that develops.
Embodiment 4
From any general drinking water source (for example from retention basin or from water), separate the tap water sample.With sample concentration and/or filter to separate any pathogenic agent.Use any known solutions from these cells, to extract DNA.Use two couples of primer SEQ ID NO:1-2 and SEQ ID NO:7-8 DNA by the about 2-10ng of pcr amplification.Will [
32P]-dCTP is included in the PCR reaction, with the mark DNA amplification, thereby produces the target nucleic acid detection reagent of tape label molecule.
The target nucleic acid detection reagent of tape label molecule through centrifugal column purification unnecessary to remove [
32P]-dCTP, 95 ℃ of following incubation sex change, subsequently directly in cooled on ice.Under high stringent condition, make the target nucleic acid detection reagent of the tape label molecule of sex change contain incubation in the presence of the oligonucleotide microarray of probe then, described probe contains SEQ ID NO:13-52.Hybridization is at 0.5M NaHPO
4, under 65 ℃, carried out 2 hours in 7% sodium lauryl sulphate (SDS), 1mM EDTA, subsequently in 0.1 * SSC/0.1% SDS in 68 ℃ of washings 3 times down.This microarray is exposed to X-ray film and the autoradiogram(ARGM) that develops.
Although used at least one illustrative embodiment to describe the present invention, when reading this specification sheets, many changes and modification it will be apparent to those of skill in the art.Therefore, intention is: appended claims should consider that prior art as far as possible broadly is interpreted as comprising all these changes and modification.
Sequence table
＜110〉Honeywell Int Inc
Gu，Yuandong
Xu，Leon
＜120〉be used to identify the oligonucleotide microarray of pathogenic agent
<130>1100.1430101
<150>60/755,504
<151>2005-12-30
<160>52
<170>PatentIn?version?3.4
<210>1
<211>20
<212>DNA
＜213〉bacterium
<400>1
<210>2
<211>20
<212>DNA
＜213〉bacterium
<400>2
<210>3
<211>24
<212>DNA
＜213〉bacterium
<400>3
<210>4
<211>21
<212>DNA
＜213〉bacterium
<400>4
<210>5
<211>24
<212>DNA
＜213〉bacterium
<400>5
<210>6
<211>21
<212>DNA
＜213〉bacterium
<400>6
<210>7
<211>19
<212>DNA
＜213〉virus
<400>7
<210>8
<211>20
<212>DNA
＜213〉virus
<400>8
<210>9
<211>19
<212>DNA
＜213〉virus
<400>9
<210>10
<211>19
<212>DNA
＜213〉virus
<400>10
<210>11
<211>22
<212>DNA
＜213〉fungi
<400>11
<210>12
<211>21
<212>DNA
＜213〉fungi
<400>12
<210>13
<211>38
<212>DNA
<213>Streptococcus
<400>13
<210>14
<211>38
<212>DNA
<213>Salmonella?typhimurium
<400>14
<210>15
<211>34
<212>DNA
<213>Salmonella?typhimurium
<400>15
<210>16
<211>34
<212>DNA
<213>Salmonella?typhimurium
<400>16
<210>17
<211>40
<212>DNA
<213>Salmonella?typhimurium
<400>17
<210>18
<211>38
<212>DNA
<213>Staphylococcus
<400>18
<210>19
<211>38
<212>DNA
<213>Mycoplasma
<400>19
<210>20
<211>38
<212>DNA
<213>Listeria?monocytogenes
<400>20
<210>21
<211>38
<212>DNA
<213>N.meningitides
<400>21
<210>22
<211>38
<212>DNA
<213>E.Coli
<400>22
<210>23
<211>35
<212>DNA
<213>Enterococcus?Coli
<400>23
<210>24
<211>35
<212>DNA
<213>E.Coli
<400>24
<210>25
<211>34
<212>DNA
<213>E.Coli
<400>25
<210>26
<211>39
<212>DNA
<213>E.Coli
<400>26
<210>27
<211>38
<212>DNA
<213>H.influenzae
<400>27
<210>28
<211>38
<212>DNA
<213>B.burgdorferi
<400>28
<210>29
<211>38
<212>DNA
<213>Leptospira
<400>29
<210>30
<211>38
<212>DNA
<213>Proteus?mirabilis
<400>30
<210>31
<211>38
<212>DNA
<213>Anaerobacter
<400>31
<210>32
<211>38
<212>DNA
<213>M.tuberculosis
<400>32
<210>33
<211>38
<212>DNA
<213>Enterococcus?Coli
<400>33
<210>34
<211>36
<212>DNA
＜213〉poliovirus 1
<400>34
<210>35
<211>36
<212>DNA
＜213〉Enterovirus 71
<400>35
<210>36
<211>36
<212>DNA
＜213〉Enterovirus 70
<400>36
<210>37
<211>36
<212>DNA
＜213〉ECHO virus 2
<400>37
<210>38
<211>36
<212>DNA
＜213〉ECHO virus 4
<400>38
<210>39
<211>36
<212>DNA
＜213〉ECHO virus 6
<400>39
<210>40
<211>36
<212>DNA
＜213〉ECHO virus 9
<400>40
<210>41
<211>36
<212>DNA
＜213〉ECHO virus 11
<400>41
<210>42
<211>36
<212>DNA
＜213〉ECHO virus 12
<400>42
<210>43
<211>36
<212>DNA
＜213〉ECHO virus 26
<400>43
<210>44
<211>36
<212>DNA
＜213〉CA 13
<400>44
<210>45
<211>36
<212>DNA
＜213〉CA 15
<400>45
<210>46
<211>36
<212>DNA
＜213〉CA 18
<400>46
<210>47
<211>36
<212>DNA
＜213〉CA 20
<400>47
<210>48
<211>36
<212>DNA
＜213〉CA 21
<400>48
<210>49
<211>36
<212>DNA
＜213〉Coxsackie B virus 3-A
<400>49
<210>50
<211>36
<212>DNA
＜213〉Coxsackie B virus 3-C
<400>50
<210>51
<211>39
<212>DNA
＜213〉human herpesvirus 1
<400>51
<210>52
<211>39
<212>DNA
＜213〉human herpesvirus 2
<400>52
Claims (20)
1. one kind is used for detection of biological sample or check sample one or more plants the method for the target nucleic acid of pathogenic agent, and described method comprises:
Utilization is a pair of or more to increase target nucleic acid in the sample of primer in conjunction with the conserved regions of more than a kind of pathogenic agent;
The target nucleic acid of amplification is contacted with oligonucleotide microarray, and described microarray comprises two kinds or above probe or the two or more probe groups that contains with different pathogens complementary polynucleotide sequence;
Detect the situation that combines of target nucleic acid and probe, wherein combine and then mean this pathogenic agent of existence in sample with the special pathogen probe.
2. the process of claim 1 wherein that described pathogenic agent is selected from: suis, Salmonellas, staphylococcus, mycoplasma, monocyte hyperplasia listeria spp (L.monocytogenes), Neisseria meningitidis (N.meningtides), intestinal bacteria, hemophilus influenzae (H.influenzae), B. burgdorferi (B.burgdorferi), Leptospira, mycetozoan, anerobe, Mycobacterium tuberculosis (M.tuberculosis), faecalis, poliovirus 1, Enterovirus 71, Enterovirus 70, ECHO virus 2, ECHO virus 4, ECHO virus 6, ECHO virus 9, ECHO virus 11, ECHO virus 12, ECHO virus 26, CA 13, CA 15, CA 18, CA 20, CA 21, Coxsackie B virus 3-A, Coxsackie B virus 3-C, HSV-1 and HSV-2.
3. the method for claim 2, wherein said probe is selected from SEQ ID NO:13-52.
4. the method for claim 3, wherein said target nucleic acid is intestinal bacteria and Salmonellas, and described probe is selected from SEQ ID NO:14-17 and 22-26.
5. the process of claim 1 wherein that described amplification step comprises utilizing is selected from a pair of of SEQ IDNO:1-12 or more primer is carried out polymerase chain reaction (PCR).
6. the method for claim 5, it is right that wherein said primer is selected from following primer: SEQ IDNO:1 and 2; SEQ ID NO:1 and 4; SEQ ID NO:1 and 6; SEQ ID NO:3 and 2; SEQ ID NO:3 and 4; SEQ ID NO:3 and 6; SEQ ID NO:5 and 2; SEQ ID NO:5 and 4; SEQ ID NO:5 and 6; SEQ ID NO:5 and 6; SEQ ID NO:7 and 8; SEQ ID NO:9 and 10; And SEQ ID NO:11 and 12.
7. the method for claim 6, wherein said primer is to being SEQ ID NO:1-2 and SEQID NO:7-8.
8. the method for claim 5, wherein said probe comprises the polynucleotide sequence that is selected from SEQ ID NO:13-52.
9. the method for claim 8, wherein microarray comprises 2 kinds or above probe from least a pathogenic agent.
10. the method for claim 1, wherein said biological sample is selected from tissue, cell, blood, serum, cerebrospinal fluid, urine, cell lysate, blood plasma, ight soil, saliva, hemocyte, fine needle biopsy samples, peritoneal fluid and Pleural fluid, or from the cell of above sample.
11. the process of claim 1 wherein that described microarray comprises the probe of the pathogenic agent relevant with common symptoms exhibited.
12. the process of claim 1 wherein that described microarray comprises the probe of the pathogenic agent relevant with common route of infection.
13. a method of distinguishing intestinal bacteria in the sample and Salmonellas, described method comprises:
Utilization is a pair of or more to the nucleic acid in the primer amplification sample in conjunction with the conserved regions in intestinal bacteria and the Salmonellas;
The target nucleic acid of amplification is contacted with oligonucleotide microarray, described microarray comprise contain with intestinal bacteria and Salmonellas in two kinds or above probe of variable region complementary polynucleotide sequence;
Detect the nucleic acid and the situation that combines as the probe of indicating intestinal bacteria and Salmonellas in sample, to exist.
14. the method for claim 13, wherein said microarray comprises: the two or more probe groups of colibacillary two or more probe groups and Salmonellas, wherein each probe groups comprises and two kinds of described pathogenic agent complementary or above different probe.
15. the method for claim 13, wherein said primer is to being selected from SEQ ID NO:1-6.
16. the method for claim 15, wherein said probe is selected from SEQ ID NO:14-17 and 22-26.
17. test kit that is used for detecting the target nucleic acid of at least a pathogenic agent of check sample, described test kit comprises: at least one pair of primer that is selected from SEQ ID NO:1-12, and the oligonucleotide microarray that comprises at least a probe, described probe contains the polynucleotide sequence that is selected from SEQ ID NO:13-52, and described probe is fixed on the solid support.
18. the test kit of claim 17, wherein said primer is right to being selected from following primer: SEQ ID NO:1 and 2; SEQ ID NO:1 and 4; SEQ ID NO:1 and 6; SEQ ID NO:3 and 2; SEQ ID NO:3 and 4; SEQ ID NO:3 and 6; SEQ ID NO:5 and 2; SEQ ID NO:5 and 4; SEQ ID NO:5 and 6; SEQ ID NO:5 and 6; SEQ ID NO:7 and 8; SEQ ID NO:9 and 10; And SEQ ID NO:11 and 12.
19. the test kit of claim 18, wherein said probe is selected from SEQ ID NO:14-17 and 22-26.
20. the test kit of claim 17, wherein said at least a probe comprise two kinds or above probe from two kinds or above pathogenic agent.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US75550405P | 2005-12-30 | 2005-12-30 | |
| US60/755,504 | 2005-12-30 | ||
| US11/617,563 | 2006-12-28 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410309119.7A Division CN104017909A (en) | 2005-12-30 | 2006-12-29 | Oligonucleotide microarray for identification of pathogens |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101400801A true CN101400801A (en) | 2009-04-01 |
Family
ID=40518470
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2006800534905A Pending CN101400801A (en) | 2005-12-30 | 2006-12-29 | Oligonucleotide microarray for identification of pathogens |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101400801A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011153954A1 (en) * | 2010-06-10 | 2011-12-15 | 香港理工大学 | Method and device for detecting specific dna sequences |
| CN102312017A (en) * | 2010-07-07 | 2012-01-11 | 上海出入境检验检疫局动植物与食品检验检疫技术中心 | Real-time reverse transcription-polymerase chain reaction (RT-PCR) detection method and kit for Coxsackie virus |
| CN104546943B (en) * | 2014-09-30 | 2019-01-08 | 深圳华大基因科技有限公司 | Sharpe other style bacillus is treating or preventing the application in rheumatoid arthritis or its related disease |
| CN109797204A (en) * | 2019-02-22 | 2019-05-24 | 上海交通大学苏北研究院 | A kind of multiple nucleic acid detection method based on discoid capillary microarray |
| CN109897907A (en) * | 2019-04-15 | 2019-06-18 | 新疆畜牧科学院兽医研究所（新疆畜牧科学院动物临床医学研究中心） | A kind of RAA fluorescent primer, probe and detection method detecting Borrelia burgdoyferi |
-
2006
- 2006-12-29 CN CNA2006800534905A patent/CN101400801A/en active Pending
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011153954A1 (en) * | 2010-06-10 | 2011-12-15 | 香港理工大学 | Method and device for detecting specific dna sequences |
| CN102329723A (en) * | 2010-06-10 | 2012-01-25 | 香港理工大学 | Method and apparatus for detecting specific DNA sequences |
| CN102329723B (en) * | 2010-06-10 | 2014-05-14 | 香港理工大学 | Method and apparatus for detecting specific DNA sequences |
| CN102312017A (en) * | 2010-07-07 | 2012-01-11 | 上海出入境检验检疫局动植物与食品检验检疫技术中心 | Real-time reverse transcription-polymerase chain reaction (RT-PCR) detection method and kit for Coxsackie virus |
| CN104546943B (en) * | 2014-09-30 | 2019-01-08 | 深圳华大基因科技有限公司 | Sharpe other style bacillus is treating or preventing the application in rheumatoid arthritis or its related disease |
| CN109797204A (en) * | 2019-02-22 | 2019-05-24 | 上海交通大学苏北研究院 | A kind of multiple nucleic acid detection method based on discoid capillary microarray |
| CN109897907A (en) * | 2019-04-15 | 2019-06-18 | 新疆畜牧科学院兽医研究所（新疆畜牧科学院动物临床医学研究中心） | A kind of RAA fluorescent primer, probe and detection method detecting Borrelia burgdoyferi |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101748192B (en) | Gene chip of main pathogenic microorganism in drinking water and testing kit | |
| CN104017909A (en) | Oligonucleotide microarray for identification of pathogens | |
| CN104313180A (en) | A novel method for simultaneous detection and discrimination of bacterial, fungal, parasitic and viral infections of eye and central nervous system | |
| ES2659798T3 (en) | Detection of immunoglobulin light chain restriction by in situ RNA hybridization | |
| CN101400801A (en) | Oligonucleotide microarray for identification of pathogens | |
| CN109439727A (en) | A kind of method and kit detecting microorganism | |
| CN111344419A (en) | Kit for tuberculosis diagnosis and method for diagnosing tuberculosis by using the same | |
| WO2009087685A2 (en) | Method for detection of hepatitis nucleic acid and uses thereof | |
| US20050170346A1 (en) | Method and a kit for determination of a microbial count | |
| CN102168131B (en) | Primer for amplifying specific regions of common pathogenic type Legionella gyrB genes and application thereof | |
| CN1328391C (en) | Gene chip for detecting B group of streptococcus, detection method and kit for detection | |
| KR100819634B1 (en) | Novel Oligonucleotide Probes DNA Chip and Detection Kit for Diagnosing Sexual Transmitted Disease and Method of Manufacturing Thereof | |
| CN102676646A (en) | Reverse dot-blot hybridization gene chip and production method thereof | |
| JP2003144153A (en) | Method for detecting gene, primer for detecting gene, dna microarray and kit for detecting gene | |
| WO2009087688A2 (en) | Method for detection of nucleic acid of mycobacterium and uses thereof | |
| ES2711509T3 (en) | Detection of Streptococcus pneumoniae | |
| JP5137443B2 (en) | Probe set, probe fixing carrier, and genetic testing method | |
| JP2004254525A (en) | Method for species-differentiating detection of cryptosporidium | |
| JP5137441B2 (en) | Probe set, probe fixing carrier, and inspection method | |
| CN105255871B (en) | The nucleotide special to aeromonas hydrophila O7, O8, O9 and O10 and application | |
| JP5078409B2 (en) | Probe set, probe fixing carrier, and inspection method | |
| JP5137442B2 (en) | Probe set, probe fixing carrier, and inspection method | |
| JP5121281B2 (en) | Probe set, probe fixing carrier, and inspection method | |
| JP2007289176A (en) | Probe, probe-immobilized carrier and method for testing | |
| CN115427567A (en) | Method for determining single-base mutation of erm (41) gene of acid-fast bacterium belonging to Mycobacterium abscessus complex, and primer set and probe used in the method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20090401 |