CN101076586A - Detection, isolation and uses of renalase (monoamine oxidase C) - Google Patents

Abstract

The present invention provides for the identification, isolation and uses of mammalian Monoamine Oxidase C (MAO-C), also known as renalase.

Description

Detection, separation and the application of kidney enzyme (monoamine oxidase C)

The cross reference of related application

According to 35 U.S.C.119 (e), the application requires the U.S. Provisional Patent Application No.60/554 of submission on March 19th, 2004, the U.S. Provisional Patent Application No.60/615 that on October 1st, 552 and 2004 submitted to, 452 right of priority, these two pieces of patent applications are incorporated reference at this in full with it.

The research that federal government subsidizes or the statement of exploitation

The present invention's part is subsidized (the fund K08DK of NIH 0291702) by United States Government's fund, so United States Government enjoys certain right in the present invention.

Background of invention

Regulating liquid and electrolyte metabolism is a major function of kidney.Blood enters kidney by renal glomerulus, and glomerular filtration goes out cell and protein and produce with blood plasma liquid by the process that is called glomerular filtration to have the liquid that same ion is formed.Glomerular filtration liquid sexually revises its volume and ion and forms by the tubulose compartment (segment) of a series of uniquenesses then.Known many factors are regulated glomerular filtration, comprise physical force, part and circulating hormone (Brenner etal.1976).Similarly, the heavily absorption of uriniferous tubules and secretion are modified by suitable complicated adjusting process.

Kidney is also as the endocrine organ, because it is the main source of erythropoietin, erythropoietin is red corpuscle progenitor cell and precursor amplification and last eventually main determining factor (Line et al., 1985 that break up required red cell volume; Jacobs et al., 1985).In addition, seem that kidney still is that feritin discharges most important position.The reduction of blood flow, the increase of sympathetic stimulation or the minimizing that is delivered to the sodium in the distal tubule all can stimulate feritin to discharge, and feritin is a kind of enzyme that proangiotensin is decomposed into angiotensin I.Renin-Angiotensin System is the crucial instrumentality of liquid and electrolyte metabolism, blood pressure and heart function.

In these many functions that kidney carries out, understood the importance of renal endocrine function by the discovery of erythropoietin.There is sign prompting kidney except secretion feritin and erythropoietin, also to have complicated endocrine function.The previous unknown protein/hormone by renal secretion of discriminating not only provided to be understood more completely to kidney physiology, significantly improved treatment kidney disease in late period (ESRD) patient's mode.

The patient who suffers from the kidney disease in late period as peritoneal dialysis or hemodialysis, perhaps carries out renal transplantation with the treatment of kidney alternative medicine.At present to late period renal disease patient kidney alternative medicine such as hemodialysis be unique up to now successful long-term (ex vivo) organ auxotherapy that exsomatizes.Successfully prolonged life although dialyse, morbidity relevant with this therapy and mortality ratio are still very high, the quality of life of Most patients relatively poor (Humes et al., 1995; Wolfe etal.1999).For example, these patients suffer from hypertension, cardiovascular disorder such as asymptomatic type left ventricle dysfunction, chronic heart failure and atherosclerosis sign to be increased, and these illnesss are to cause the most common dead factor.Although the reason that these illnesss produce also imperfectly understands, it has been generally acknowledged that not reproducible natural organ's critical function of described therapy.Described therapy uses external " kidney machine " to remove excessive water and solvable refuse from blood, but important absorption, metabolism, internal secretion and the immunologic function of reproducible natural organ not.

This area has proved that fully ESRD patient has the remarkable higher danger that produces cardiovascular disorder, this danger seems to reach relevant (Koomans et al., 2004 with the sympatheticotonia that improves with the oxidative stress relevant (Oberge et al.2004) that increases; Joles et al., 2004).Although ESRD relates to multiple proteins/hormone, only differentiated and identified the factor of participation ESRD seldom.Yet the discriminating of these factors is crucial for diagnosis and the therapeutic advance that ESRD reaches the vascular disease relevant with the protein/hormone of renal secretion.Therefore, need to differentiate the factor relevant with ESRD for a long time with evaluation.

Monoamine oxidase (MAO) is the enzyme that contains flavine-adenosine-dinucleotides (FAD), and it changes biogenic amine into its corresponding aldehyde.There is (MAO-A (SEQ IDNO:11) and MAO-B (SEQ ID NO:13)) in MAO with two kinds of isotypes, they are different gene products, present more than 70% the sequence homogeny with in the katabolism of neurotransmitter such as Dopamine HCL, serotonin and norepinephrine, present different but eclipsed substrate specificity (2,3).MAO-A and MAO-B all participate in many neuroscience illnesss, and are the targets (4) of treatment Parkinson's disease and dysthymia disorders.Mammals MAO combines with mitochondrial outer membrane, and has a FAD molecule, this molecule by with the 8 α-thioether bond of cysteine residues with described protein covalent attachment (5).They are expressed to organize dependency and age dependency dual mode, are clinical widely and the pharmaceutical research object.

MAO-A and MAO-B are anchored on mitochondrial outer membrane (Binda et al., 2002) by C-terminal.They have the eclipsed substrate specificity, make neurotransmitter such as suprarenin, norepinephrine, serotonin and Dopamine HCL generation katabolism, and are suppressed by pargyline and M B 9302 (clorgyline) specificity.Polyamine oxidase (polyamine oxidase, PAO), the another kind of known oxydase that contains FAD is a kind of endo-oxidase, its metabolism spermine and spermidine, and regulate cell growth (Jalkanen et al., 2001).The crystalline structure of people MAO-B is revealed under 3.0A resolving power, shows it is FAD cofactor and the covalently bound a kind of dimer of cysteine side chain (Cys-397) (Binda et al., 2002).MAO-A and MAO-B be by adjoining on the X chromosome but isolating genes encoding, they present more than 70% the sequence homogeny and in neurotransmitter katabolism different but eclipsed substrate specificity.

MAO-A and MAO-B are different aspect tissue distribution, structure and the substrate specificity.MAO-A has higher affinity to serotonin, octopamine, suprarenin and norepinephrine; And the natural substrate of MAO-B is phenylethylamine and tyrasamine.Dopamine HCL is considered to by these two kinds of isotype oxidations.MAO-A and MAO-B be distributed widely in some organs comprise in the brain (A.M.Cesura and A.Pletscher, Prog.Drug Research 1992,38,171-297).Brain MAO-B activity seems to increase along with the age.This increase rule because of in with the relevant gliosis of wearing out (C.J.Fowler et al., J.Neural.Transm.1980,49,1-20).In addition, MAO-B activity (P.Dostert et al. significantly higher in Alzheimer patient brain, Biochem.Pharmacol.1989,38,555-561), have been found that its astroglia cell camber around the senile plaque express (Saura et al., Neuroscience 1994,70,755-774).About this point, because MAO has the NH of definite or genotoxic potential to the oxidative deaminization generation of uncle's monoamine (primary monoamines) ₃, aldehyde and H ₂O ₂, prompting exists uses the dull-witted and parkinsonian rationale of selectivity MAO-B inhibitor for treating.The inhibition of MAO-B causes the enzyme deactivation effect of Dopamine HCL to reduce, and has therefore prolonged the utilizability of neurotransmitter in dopaminergic neuron.The degeneration process relevant with Parkinson's disease with age and Alzheimer also can ascribe the active and caused H of consequential MAO-B by the MAO that increases to ₂O ₂Form the oxidative stress that increases and cause.Therefore, the MAO-B inhibitor can oxyradical forms and increase monoamine level works by reducing in brain.

Because MAO-B participates in above-mentioned neuroscience illness, therefore there is intensive interest to obtain to control the active strong selectivity inhibitor of this kind of enzyme.The pharmacology of some known MAO-B inhibitor for example by D.Bentue-Ferrer etc. at CNS Drugs 1996,6, discuss among the 217-236.And the major limitation of irreversible and non-selective MAO inhibitor activity is the diet of need abiding by the regulations, because when taking in the diet tyrasamine, can induce hypertensive crisis and with the interactional potentially dangerous of other medicines (D.M.Gardner et al., J.Clin.Psychiatry 1996,57,99-104), these rough sledding are not too common at reversible selectivity MAO inhibitor, particularly MAO-B inhibitor.

By suppressing the MAO activity, the MAO inhibitor can be adjusted in the level (comprising Dopamine HCL, norepinephrine and serotonin) that monoamine in different brain area and the body and neurotransmitter thereof discharge.Therefore, the MAO inhibitor can affect the nerves endocrine function, breathing, mood, motion control and function, watch attentively with attention, attention concentrate, the adjusting of memory and cognition and Drug abuse mechanism.Shown that the MAO inhibitor works to attention, cognition, appetite, Drug abuse, memory, cardiovascular function, the outer function of pyramidal tract, pain and gastrointestinal peristalsis and function.MAO widely distributed in brain comprises basal ganglion, pallium, limbic system, and midbrain and back brain nuclei.In peripheral tissues, described distribution comprises muscle, gi tract, cardiovascular systems, autonomic ganglia, liver and endocrine system.

By other inhibitor MAO is suppressed to illustrate the content that can increase monoamine in brain and the body.The monoamine level in the body of regulating has shown at numerous disease and has comprised that in depression, anxiety, stress disorders, disease, neuroendocrine problem, heart dysfunction, gastrointestinal tract disorder, eating disorder, hypertension, Parkinson's disease, dysmnesia and the Withrawal symptom relevant with memory function be effective.

Thought that at present smoking has irreversible restraining effect to monoamine oxidase (MAO).Boulton et al.; " Biogenic Amine Adducts; Monoamine Oxidse Inhibitors; and Smoking; " Lancet, 1 (8577): 114-155 (Jan.16,1988); reported that smoking can help to explain smoking for to antiparkinsonian provide protection to the inhibition activity of MAO, and the psychiatric patient of observing serious smoking does not experience the smoking inductive disease of unusual ratio.Prompting smoking is as the MAO inhibitor, can resist to cause parkinsonian dopaminergic nerve toxicity and shield, and smoking can produce antidepressant effect to the restraining effect of MAO in psychiatric patient.

Summary of the invention

Before the present invention, MAO-A and MAO-B be in human body, differentiate two kinds of monoamine oxidase are only arranged.When the inventor attempts the discriminating of end user's genome database and identifies secretory protein new in the human body, differentiated a kind of new monoamine oxidase.The present invention has disclosed the discriminating and the evaluation of the monoamine oxidase of secreted form, described monoamine oxidase metabolism biological monoamine such as norepinephrine, Dopamine HCL and suprarenin.Because the new monoamine oxidase of differentiating is the third enzyme through discriminating metabolism monoamine in human body, so the inventor is called MAO-C with it.Perhaps, because it is a kind of protein by renal secretion, therefore also be known as kidney enzyme (renalase).Because MAO-C or kidney enzyme are newcomers of monoamine oxidase family, therefore expect that also this kind of enzyme plays a significant role equally with MAO-A and MAO-B in brain.

The present invention relates to the encode nucleic acid (SEQ ID NO:2) of the new Mammals monoamine oxidase (MAO) that is called the kidney enzyme, described kidney enzyme is a kind of new protein that participates in regulating catecholamine.The nucleotide sequence of people's kidney enzyme and the nucleotide sequence of people MAO-A (SEQ ID NO:10) have 27.7% homology, have 38.2% homology with the nucleotide sequence (SEQ ID NO:12) of MAO-B.The kidney enzyme has 13% and 12% homogeny respectively at amino acid levels and MAO-A and MAO-B.It also has substrate specificity different with MAO-A and MAO-B and inhibitor characteristic spectrum, shows the monoamine oxidase that contains FAD that it represents the new uniqueness of a class.

People's kidney enzyme gene is positioned on No. 10 karyomit(e), contains 9 exons and crosses over about 300Kb.342 amino acid whose protein of people's kidney enzyme genes encoding, described protein contains the N-terminal signal sequence, is structural domain and amino oxidase structural domain that contains flavine-adenosine-dinucleotides (FAD) subsequently.Organize the Northern trace to studies show that kidney enzyme strongly expressed in kidney, and expression level is lower in all other tissues of being analyzed.Hybridization in situ experiment shows kidney enzyme high level expression in near-end and distal tubule.

The kidney enzyme is high level expression in in-vitro transcription and translation experiment.People's kidney enzyme cDNA is translated and produces the protein that a kind of molecular weight is approximately 38-kDa, and this protein size with prediction is consistent.The Western trace that the conditioned medium of the HEK293 cell of use transfection carries out studies show that the kidney enzyme is a kind of excretory protein.The kidney enzyme is present in the blood plasma with 5-10mg/l concentration in healthy individual.

End-stage renal disease (ESRD) is relevant with the catecholamine levels that raises, and it causes many pathologies, disease and obstacle thereupon, comprises for example asymptomatic type left ventricle dysfunction, chronic heart failure and atherosclerosis.These pathologies, disease and obstacle are the common factors that causes the ESRD death.

The kidney enzyme is the metabolism catecholamine in the following order: Dopamine HCL＞suprarenin＞norepinephrine.In fact the kidney enzyme can not detect in ESRD patient.Therefore, forfeiture of ESRD patient's middle kidney enzyme or level reduce relevant with the blood plasma catechlolamine horizontal component that raises at least, cause cardiovascular disorder to increase, and are the common factors of ESRD death.

In addition, the related kidney enzyme that makes between kidney enzyme level and the renal function is a kind of ideal diagnostic flag material standed for of diagnosis kidney disease, particularly for the normal acute tubular necrosis that takes place in the intensive care unit.The biological significance of kidney enzyme and potential clinical practice thereof is further discussed at this paper.

The invention provides a kind of new FAD dependency amine oxidase, it is advanced in the blood by renal secretion.It makes the catecholamine metabolism in the blood circulation, especially a kind of effective conditioning agent of blood pressure and heart rate.In addition, its content in ESRD patient's blood plasma reduces the cause-effect relationship between the cardiovascular danger of prompting and sympathetic tone that raises and increase, and this fully proves in this patient group.The more important step of detail knowledge cardiovascular physiology is not only in the discriminating of kidney enzyme, but also is the important step that therapeutic regimen is provided for ephrosis and/or heart trouble and related complication patient thereof.

The present invention includes the isolated nucleic acid molecule of coded polypeptide, nucleotide sequence shown in wherein said nucleic acid molecule and the SEQ ID NO:1 has about at least or is higher than about 40% sequence homogeny.

The present invention includes the isolated nucleic acid molecule of coded polypeptide, the 24-1049 position nucleic acid residue sequence of nucleotide sequence shown in the wherein said nucleic acid molecule SEQID NO:1 has about at least or is higher than about 40% sequence homogeny.

On the one hand, described nucleic acid further comprises the nucleic acid of the covalently bound with it labeling polypeptide of coding.

On the other hand, described nucleic acid further comprises the nucleic acid of promotor/adjusting sequence that representative operably connects with it.

On the one hand, the present invention includes a kind of carrier again, it comprises the isolating nucleic acid of coded polypeptide, and sequence shown in wherein said nucleic acid and the SEQ ID NO:1 has about at least or is higher than about 40% sequence homogeny.

On the other hand, the present invention includes a kind of reconstitution cell, it comprises the isolating nucleic acid of coded polypeptide, and sequence shown in wherein said nucleic acid and the SEQ ID NO:1 has about at least or is higher than about 40% sequence homogeny.

The present invention includes the isolating nucleic acid of isolating nucleic acid complementary or its fragment with coded polypeptide, described complementary nucleic acid is an antisense orientation.

On the one hand, nucleic acid of the present invention has about at least with the nucleic acid complementary nucleic acid with people's kidney enzyme sequence (SEQ ID NO:1) or is higher than about 40% sequence homogeny.

The present invention includes isolating mammal kidney enzyme peptide, polypeptide or protein.

The present invention includes a kind of isolating Mammals polypeptide, wherein said polypeptide comprises the aminoacid sequence that has at least approximately or be higher than about 15% homogeny with the polypeptide with aminoacid sequence shown in the SEQ ID NO:2.

The present invention also comprises a kind of isolated polypeptide, and wherein said polypeptide comprises the aminoacid sequence that has at least approximately or be higher than about 15% homogeny with the polypeptide with 24-342 amino acids residue of aminoacid sequence shown in the SEQID NO:2.

The present invention includes a kind of and mammal kidney enzyme spcificity bonded antibody or its fragment.Described antibody can be polyclonal antibody, monoclonal antibody or synthetic antibody.

The present invention includes a kind of isolating nucleic acid of coded polypeptide and a kind of composition of drug acceptable carrier of comprising, sequence shown in wherein said nucleic acid and the SEQ ID NO:1 has at least approximately or has and is higher than about 40% homogeny.

The present invention includes a kind of composition, it comprises isolating mammal kidney enzyme polypeptide and a kind of medicine acceptable carrier.

The present invention includes a kind of method of differentiating the compound that reduction or inhibition people kidney enzyme are expressed in cell.Described method comprises that the cell that the kidney enzyme is expressed therein contacts with a kind of compound, with people's kidney enzyme with cell that compound contacts in expression level and the expression level of people's kidney enzyme in other same cell compare, wherein people's kidney enzyme with cell that described compound contacts in expression level be lower than its not with other same cell that described compound contacts in expression level show that described compound suppresses people's kidney enzyme and expresses in cell.On the one hand, the present invention includes the compound of differentiating by this method, wherein this compound is the antagonist of people's kidney enzyme.

The present invention comprises that also a kind of the discriminating strengthens or increase the method that people's kidney enzyme is expressed in cell.Described method comprises that the cell that the kidney enzyme is expressed therein contacts with a kind of compound, with people's kidney enzyme with cell that compound contacts in expression level and the expression level of people's kidney enzyme in other same cell compare, wherein people's kidney enzyme with cell that described compound contacts in expression level be higher than its not with other same cell that described compound contacts in expression level show that described compound strengthens or increases people's kidney enzyme and expresses in cell.On the one hand, the present invention includes the compound of differentiating by this method, wherein this compound is the agonist of people's kidney enzyme.

The present invention includes the method for a kind of treatment by pathology, obstacle or the disease of the mediation of people's kidney expression of enzymes.Described method comprises that a kind of people's kidney of people patient expression of enzymes of suffering from the pathology, obstacle or the disease that are mediated by people's kidney expression of enzymes suppresses or the kidney enzyme inhibitors of people's kidney expression of enzymes reduction amount, thereby treatment is by pathology, obstacle or the disease of the mediation of people's kidney expression of enzymes.

The compositions and methods of the invention can be used for treating relevant any pathology, obstacle or the disease of blood vessel, heart, kidney, nerve and/or endocrine system that comprises the people with organism.On the one hand, described pathology, obstacle or disease are selected from ESRD, chronic renal disease, hypertension, cardiovascular disorder such as asymptomatic type left ventricle dysfunction, chronic heart failure, irregular pulse and atherosclerosis.

On the other hand, described kidney enzyme inhibitors comprises the isolating nucleic acid of isolating nucleic acid complementary or its fragment with coding people kidney enzyme, and described complementary nucleic acid is an antisense orientation.

The present invention includes the hypertensive method of a kind of treatment Mammals, described method comprises and gives the mammal kidney enzyme, thus treatment hypertension.

The present invention also comprises the method for a kind of treatment central nervous system (CNS) pathology, obstacle or disease, and described illness includes but not limited to dementia, Alzheimer, schizophrenia, psychosis, depression, headache, migraine or tension headache and epilepsy; And treat and/or prevent CNS illness such as major depressive disorder, comprise the two poles of the earth depression (bipolar depression), the single phase property depression, have or the disease feature that is a cup too low, catatonic schizophrenia feature, melancholia feature, atypical characteristics or outbreak in postpartum single or send out the method for severe depression onset again, the method for treatment anxiety disorder and treatment Phobias.Other mood disorder that the term major depressive disorder is contained comprises early stage and dysthymic disorder, neurotic depression, posttraumatic stress disorder and social phobia late onset and that have or do not have atypical characteristics; The Alzheimer type dementia of early stage or late onset, alcohol, amphetamine, Cocaine, halluoinogen, inhalation, opium, phecyclidine, tranquilizer, soporific, anxiolytic and other material inductive illness.

The present invention comprises that further a kind of discriminating suffers from the method that changes the people patient of relevant disease, obstacle or pathology with the kidney expression of enzymes.Described method comprises the kidney expression of enzymes level in the human body, the expression level of kidney enzyme in this human body and its are not being suffered from the expression level that changes among the normal human of relevant disease, obstacle or pathology with the kidney expression of enzymes comparing, thereby detecting the people patient who suffers from disease, obstacle or the pathology relevant with the change of kidney expression of enzymes.

The accompanying drawing summary

Preamble general introduction and the following detailed description that the present invention may be better understood in conjunction with the accompanying drawings.For illustration the present invention, show preferred embodiment of the invention diagram.Yet, should understand mode shown in the invention is not restricted to and means.In the drawings:

The Northern engram analysis that Figure 1A is to use MGC 12474 clones as probe tissue to be carried out.

Figure 1B is illustrated in the structural motif of inferring that detects in the kidney enzyme: FAD: flavine adenosine dinucleotides, SP: signal peptide.

Fig. 1 C is people's kidney enzyme amino acid sequence of the derivation of comparing with MAO-A.

The Western engram analysis that Fig. 1 D is to use kidney enzyme polyclonal antibody that rat tissue is carried out.

Fig. 2 A illustrates the cDNA and the deduced amino acid of people's kidney enzyme.Amino-acid residue 1-16 in the square frame scope it is believed that the coded signal peptide.

Fig. 2 B illustrates the genome structure of kidney enzyme.

Fig. 2 C is the sequence contrast between people MAO-A, MAO-B and the MAO-C.

Fig. 3 A-3D illustrates the Subcellular Localization of kidney enzyme in people's kidney and heart.

Fig. 3 A is the in situ hybridization analysis that people's kidney is carried out; The left side: antisense probe, amplification 200 *, hollow arrow indication renal glomerulus, filled arrows indication proximal tubule; The right side: amplify 100 * adopted probe contrast arranged.

Fig. 3 B is the in situ hybridization analysis that human heart is carried out; The left side: antisense probe, amplification 200 *, hollow arrow indication blood vessel, filled arrows indication ventricular muscle cell; Right side: adopted probe contrast is arranged.

Fig. 3 C is the immunolocalization image in people's kidney; The left side: anti-kidney enzyme antibody, amplification 630 *, filled arrows is represented proximal tubule; Right side: preimmune serum.

Fig. 3 D is the immunolocalization image of human heart; The left side: anti-kidney enzyme antibody, amplification 630 *, hollow arrow is represented blood vessel, filled arrows is represented ventricular muscle cell; Right side: preimmune serum.

Fig. 4 A-4C illustrates the expression of fusion rotein in the HEK293 cell of kidney of rats enzyme-HA-mark.

Fig. 4 A illustrates the segmental structure of expression TAP of kidney enzyme.

Fig. 4 B is the synoptic diagram of generation and purifying GST-kidney enzyme fusion proteins.To separate on the 10%SDS-polyacrylamide gel with the GST-kidney enzyme (10 μ g) of purifying from the protein (100 μ g) of bacterium cracking crude product, use Coomassie blue stain.Swimming lane A: bacterium cracking crude product; Swimming lane B: the kidney zymoprotein of purifying.

Fig. 4 C illustrates determining of kidney enzymic activity.The GST-kidney enzyme fusion proteins (each reacts 10 μ g) of purifying is used for each analysis.After being incubated 30 minutes with Dopamine HCL or norepinephrine (2mM final concentration), the amino oxidase activity is represented with any flat fluorescent/10 μ g protein.Post 1: control protein (GST) and Dopamine HCL and norepinephrine; Post 2:GST-kidney enzyme and norepinephrine; Post 3:GST-kidney enzyme and Dopamine HCL.

It is a kind of excretory protein that Fig. 5 A-5B illustrates the kidney enzyme.

Fig. 5 A is the synoptic diagram that detects the kidney enzyme in the HEK293 cell culture medium with kidney enzyme cDNA transient transfection.

Fig. 5 B is to use anti-kidney enzyme antibody that human plasma is carried out the synoptic diagram of Western engram analysis, normally is meant the individuality with normal renal function, and contrast is a reorganization kidney enzyme, and ESRD represents to accept the end-stage renal disease patient of hemodialysis.

Fig. 6 A-6C illustrates the enzymic activity and the function of kidney enzyme.

In Fig. 6 A, use 10 μ g GST-kidney enzyme fusion proteins to carry out each analysis; The amine oxidase activity is represented with any flat fluorescent/10 μ g protein; With substrate (2mM) insulation 30 minutes.

In Fig. 6 B, the same with Fig. 6 A, use 1 μ M M B 9302 and 1 μ M pargyline.

Fig. 6 C is the figure of people's kidney enzyme of affinity purification.Use anti-kidney enzyme antibody isolated protein from human urine; Swimming lane 1: human urine, swimming lane 2: only have two anti-contrasts.

Fig. 7 A-7G illustrates the effect of Hemodynamics on Pathogenesis of kidney enzyme; The time of arrow indication injection kidney enzyme, in time, be designated as minute, and the number of times that heart rate is beaten with per minute (bpm) is measured, and shrinks and the diastole arteriotony is represented with mmhg (mmHg).

Fig. 7 A be illustrated in 4 μ g/g body weight carry out IV inject before and afterwards heart reply; The time of arrow indication injection kidney enzyme; The Vp=left ventricular pressure; The HR=heart rate; The pace of change of dP/dt=left ventricular pressure is measured heart contraction.

Fig. 7 B is before injection kidney enzyme and pressure-volume curve afterwards.

Fig. 7 C is the enlarged view (seeing shown in the arrow) of the part of Fig. 7 A.HR: heart rate, Vp: left ventricular pressure.

Fig. 7 D is the kidney enzyme dosage-response curve about cardiac contractility.

Fig. 7 E is the kidney enzyme dosage-response curve about mean arterial pressure.

Fig. 7 F is the time-histories of kidney enzymic activity for plasma epinephrine.

Fig. 7 G is the time-histories of kidney enzymic activity for plasma norepinephrine.

Detailed Description Of The Invention

All publications that the present invention quotes and patent application are all for referencial use with special each publication and the same this paper of incorporating into of patent application that points out respectively to incorporate into reference.

Following description comprises and can be used for understanding information of the present invention. Be not to admit that any information provided herein is prior art or relevant with the present invention who asks for protection, perhaps any publication special or the hint reference is prior art.

Unless otherwise indicated, all technology of the present invention's use and scientific terminology all have the identical meanings that those skilled in the art understand usually. Although implementing or testing among the present invention and can use and similar or suitable any method and material described herein, preferred method described herein and material.

The data that the present invention discloses not except acceptor interaction, data show that the kidney enzyme works in catecholamine that degraded follows such as norepinephrine, dopamine and adrenaline, these are important instrumentalities of kidney, heart and vascular function. Describe more fully such as this paper other places, therefore the kidney enzyme works in the function of regulating other tissue and/or organ as hormone. This also comprises nervous system, is mediated by catecholamine because its function also is part. Therefore, can for example provide the kidney enzyme for the patient that can not produce q.s kidney enzyme. The discriminating of kidney enzyme can engineering participation be used for the methods for the treatment of of end-stage renal disease (ESRD) for example and diagnostic method with treatment/preventing hypertension, angiocardiopathy such as asymptomatic type left ventricle obstacle, chronic congestive heart failure and atherosclerotic.

Similar to the recombinant protein-erythropoietin(EPO) (EPO) that is widely used in treatment anaemia patient, the kidney enzyme is a kind of protein of secretion and expresses in kidney. Another notable feature of kidney enzyme is identical with EPO, in fact can not detect in ESRD patient, and kidney enzyme concentration with about 5-10mg/L in healthy individual blood is expressed.

The existence of a kind of new enzyme of catecholamine is thanked to by the tables of data Ming Dynasty that the present invention discloses. Except the example that enlarges MAO, this newfound enzyme has significant clinical meaning for for example ESRD patient. Additional kidney enzyme level is treatment ESRD patient's rational method with the scheme of the excessive levels of counteracting kidney zymolyte (being catecholamine). In addition, regardless of the renal function state, any Other diseases that is caused by excessive catecholamine levels all can be supplied or the kidney enzyme of magnitude of recruitment is treated by adding.

Perhaps, the kidney enzyme can be used as drug target with the patient's of raising sympathetic tone reduction circulating catecholamines level, and therefore improves the result of some cardiovascular complication. The kidney enzyme also can be used for design for MAO-A or the more special medicine of MAO-B, because present MAO inhibitor also target kidney enzyme unintentionally perhaps causes disadvantageous side effect.

The framework that the discriminating of kidney enzyme and evaluation provide further research kidney enzyme and acted in the Pathological Physiology of angiocardiopathy, described disease such as chronic heart failure (CHF), miocardial infarction (MI), arrhythmia cordis, because these diseases can produce (Wittstein et al. by the unexpected emotional stress that increases sympathetic stimulation, (2005) Neurohumoral features of myocardial stunning due to sudden emotional stress, New England Journal of Medicine, 3 52,539-548). Perhaps more importantly, with MAO-A and-B is the same, the kidney enzyme can provide the potential useful target position of balance the body sympathetic activity.

Except its potential therapeutic action, the kidney enzyme can be used as the diagnostic marker of acute renal failure (be acute tubular necrosis or ATN, this is that a kind of renal ischemic venereal disease becomes). As mentioned above, the patient who does not have a normal renal function has the kidney enzyme of reduced levels.

The present invention also comprises diagnosis for the method for the neurological susceptibility of cardiovascular, heart, kidney and spiritual relevant diseases, obstacle and disease, and described method is based on the mensuration of kidney enzyme gene expression and enzymatic activity. For example, cardiovascular pathological changes, obstacle and diseases, such as hypertension, asymptomatic type left ventricle dysfunction, chronic congestive heart failure, miocardial infarction, arrhythmia cordis and atherosclerotic; Spirit pathology, obstacle and disease such as depression and anxiety disorder; And heart change, obstacle and disease such as pulmonary hypertension, all can diagnose, estimate and monitor by determining kidney enzyme gene expression level, kidney zymoprotein level and/or kidney enzyme enzymatic activity. For example, the reduction of the expression of kidney enzyme gene is the diagnostic marker that increases relevant illness with sympathetic nerve output.

The compositions and methods of the invention can be used for treating, prevent, reduce or improve hypertension, comprise systolic hypertension, isolatism systolic hypertension and diabetic hypertension. In addition, expection has identical benefit to rarer hypertension-pulmonary hypertension. Pulmonary hypertension is a kind of rare lung vascular disorder, and wherein the pressure of pulmonary artery (blood vessel of guide blood from the heart to lung) is higher than normal level, and threat to life. The similitude of the rising of systemic blood pressure in blood pressure rising and diabetic hypertension and the isolatism systolic hypertension points out it to comprise similar mechanism in lung bed (pulmonary bed).

Definition

As used herein, following each term has and its implication relevant in this joint.

" one " refers to one or more (being at least one) in the literary composition. For example, " element " refers to one or more element.

As used herein, term " adjacent " refers between the nucleotides continuously every and the nucleotide sequence that is connected to each other directly. For example, when pentanucleotide 5 '-AAAAA-3 ' and trinucleotide 5 '-TTT-3 ' with 5 '-when the such mode of AAAAATTT-3 ' or 5 '-TTTAAAAA-3 ' is connected, these two nucleotides are adjacent, but with 5 '-the such mode of AAAAACTTT-3 ' then is non-conterminous when connecting.

As used herein, amino acid is with its full name, corresponding trigram code or corresponding single-letter coded representation, and is as shown in the table:

Full name trigram code single-letter code

Aspartic acid Asp D

Glutamic acid Glu E

Lysine Lys K

Arginine Arg R

Histidine H

Tyrosine Tyr Y

Cysteine Cys C

Asparagine Asn N

Glutamine Gln Q

Serine Ser S

Threonine Thr T

Glycine Gly G

Alanine Ala A

Xie Ansuan Val V

Leucine Leu L

Isoleucine Ile I

Methionine(Met) Met M

Proline(Pro) Pro P

Phenylalanine Phe F

Tryptophane Trp W

As used herein, disease, obstacle or pathology " are alleviated " be meant the severity of one or more symptom that reduces described disease, obstacle or pathology.This can include but not limited to before carrying out described methods of treatment or the kidney enzyme level that does not carry out the patient of described methods of treatment compare, the kidney enzyme level that raising is expressed in cell or tissue (for example smooth muscle cell, lung tissue, artery) reduces or improves kidney enzyme level or the like in patient's body.

" antisense " is meant the nucleotide sequence of noncoding strand of the double chain DNA molecule of coded protein especially, perhaps with described noncoding strand homologous sequence basically.Limit the sequence complementation of the double chain DNA molecule of antisense sequences and coded protein as this paper.Antisense sequences be not essential only with the encoding part complementation of described dna molecule encode chain.Antisense sequences can with the adjusting sequence complementation of the expression of specified control encoding sequence on the dna molecule encode chain of coded protein.

Term used herein " loader " is meant and is used for giving mammiferous any device with kidney enzymatic nucleic acid of the present invention, protein and/or composition, includes but not limited to syringe, transfer pipet, bronchoscope, atomizer or the like.

Term used herein " biological sample " is meant the sample that derives from animal, and its expression level, kidney zymoprotein that can be used for evaluating the kidney enzyme exists level or the two.This sample includes but not limited to blood vessel (for example carotid artery, aorta or the like) sample, lung tissue sample and SMC sample.

Be meant the nucleotide sequence of the kidney zymoprotein of not encoding with the some or all of nucleic acid complementation of enzyme " coding kidney ".On the contrary, the sequence of expressing in cell is identical with the nucleic acid noncoding strand of coding kidney zymoprotein, and the kidney zymoprotein of therefore not encoding.

As used herein, term " complementation " and " antisense " are not complete synonyms." antisense " refers in particular to the nucleotide sequence of noncoding strand of the double chain DNA molecule of coded protein, perhaps with noncoding strand homologous sequence basically.

Term used herein " complementation " is meant for example subunit's sequence complementarity between two dna moleculars of two nucleic acid of generalized.When the nucleotide position in two molecules is occupied by the Nucleotide of common base pairing each other, think that then the nucleic acid in this position is complimentary to one another.Therefore, (for example A: T and G: when the Nucleotide C nucleotide pair) occupied, these two nucleic acid were complimentary to one another by base pairing each other usually when the corresponding position of a great deal of (at least 50%) in each molecule.As this paper regulation, the double chain DNA molecule sequence complementation of antisense sequences and coded protein.Antisense sequences be not essential only with the encoding part complementation of dna molecule encode chain.Antisense sequences can with specified adjusting sequence complementation on the dna molecule encode chain of coded protein, the expression of described adjusting sequence control encoding sequence.

" coding region " of gene is made up of the nucleotide residue of genes encoding chain and the Nucleotide of gene noncoding strand, and homology or complementation are distinguished in its coding region with the mRNA molecule that produces by genetic transcription.

" coding region " of mRNA molecule also is made up of the nucleotide residue of mRNA molecule, its with in the anticodon of mRNA molecule translate duration transfer RNA (tRNA) molecule zone coupling or coding terminator codon.Therefore the coding region can comprise the nucleotide residue corresponding to non-existent amino-acid residue in the mature protein of described mRNA molecule encoding (for example amino-acid residue of protein output signal sequence).

" coding " is meant that the specific sequence of Nucleotide in the polynucleotide such as gene, cDNA or mRNA have qualification nucleotide sequence (being rRNA, tRNA and mRNA) or limiting in the biological procedures of aminoacid sequence, reach the therefrom biological property of generation as synthetic other polymkeric substance of template and macromolecular inherent nature.Therefore, if the mRNA corresponding to gene transcribes and translates generation protein in cell or other biosystem, this dna encoding the protein then.Article two, the nucleotide sequence of coding strand is identical with the mRNA sequence, and provides in sequence table usually, and noncoding strand can be called other product of coded protein or this gene or cDNA as the template of open gene or cDNA.

Unless stated otherwise, then " nucleotide sequence of encoding amino acid sequence " comprises all nucleotide sequences of the degeneracy form each other and the same acid sequence of encoding.The nucleotide sequence of coded protein and RNA can comprise intron.

" expression vector " is meant the carrier that comprises recombination of polynucleotide, and described recombination of polynucleotide comprises the expression control sequenc that operably is connected with the nucleotide sequence of being expressed.Expression vector comprises enough cis-acting elements to express; Other element of expressing can provide by host cell or in the vivoexpression system.Expression vector comprises all that expression vector known in the art, as mixes clay, plasmid (for example exposed or be contained in the liposome) and viral (for example retrovirus, adenovirus and the adeno associated virus) of recombination of polynucleotide.

This paper is meant that about the used term of gene-virus therapy carrier of the present invention " replication defective " described virus vector can not further duplicate and pack its genome independently.For example, when infecting the cell of object with the rAAV virion, heterologous gene is expressed in the cell that infects, yet because the cell that infects lacks AAV rep and cap gene and additional functional gene, so rAAV reproducible not.

As used herein, " retrovirus transfer vector " is meant a kind of expression vector, and it comprises the genetically modified nucleotide sequence of coding, and further comprises the essential nucleotide sequence of package carrier.Preferably, the retrovirus transfer vector also is included in the essential sequence of express transgenic in the cell.

As used herein, " packaging system " is meant a series of virus formulation bodies, and it comprises the gene that coding participates in the virus protein of packing recombinant virus.Typically, the construct of packaging system mixes in the packing cell at last.

As used herein, " two generations " slow virus carrier system is meant the slow virus packaging system that lacks functional episome, as wherein one of episome vif, vpr, vpu and nef lack or inactivation.See for example Zufferey et al., 1997, Nat.Biotechnol.15:871-875.

As used herein, " three generations " slow virus carrier system be meant have two generation the carrier system feature, and further lack the slow virus packaging system of functional tat gene, lacked or inactivation as tat gene wherein.Typically, the gene of coding rev provides on an independent expression construct.See for example Dull et al., 1998, J.Virol.72 (11): 8463-8471 is described.

As used herein, " false type (pseudotyped) " is meant the natural envelope protein of envelope protein displacement with allos or functionalized modification.

As used herein, " stripped give (ex vivo administration) " is meant a kind of method, wherein get primary cell, give cell to produce transduction, reconstitution cell that infect or transfection, give identical or different individuality once more this reconstitution cell with carrier from object.

If second zone of first zone of oligonucleotide and oligonucleotide is adjacent one another are or by being no more than about 1000 nucleotide residues, preferably being no more than about 100 nucleotide residues at interval, then first zone is at " flank " in second zone.

As used herein, the term " fragment " that is used for nucleotide sequence or nucleic acid molecule is meant that wherein said fragment is less than the total length of described reference nucleic acid sequence or molecule with reference to a sections of total length nucleotide sequence or molecule or a part.An example of fragment nucleotide sequence or molecule is respectively the sections or the part of total length kidney enzyme cDNA sequence or molecule.Another example of fragment nucleotide sequence or molecule is respectively the sections or the part of full-length gene group kidney enzyme dna sequence or molecule.Fragment can be any length less than total length nature or natural cDNA or gene.Segmental example comprises that length is about at least 20,50,50-100,100-200,200-300,300-350,350-500,500-600,600-650,650-800 or at least about nucleic acid of 800-1000 Nucleotide.

As used herein, the term " fragment " that is used for aminoacid sequence or amino acid molecular is meant that wherein said fragment is less than reference amino acid sequence or molecule total length with reference to a sections of full length amino acid sequence or molecule or a part.The example of fragment aminoacid sequence or molecule is respectively by the sections or the part of the polypeptide of total length kidney enzyme cDNA sequence or molecule encoding.Another example of fragment aminoacid sequence or molecule is respectively by the sections or the part of the polypeptide of full-length gene group kidney enzyme dna sequence or molecule encoding.Fragment can be less than the polypeptide by any length of the full-length polypeptide of natural or natural cDNA or genes encoding.Segmental example comprises that length is about at least 20,30,40,50,60,70,80,90,100,110,120,130,130,140,150,160,170,180,190,200,210,220,230,240,250,260,270,280,290,300,310,320,330 or about at least 340 amino acid.

" genomic dna " is the DNA chain that has with the nucleotide sequence of dna homolog.For example, the karyomit(e) that produces of the reverse transcription by Mammals mRNA and the fragment of cDNA all are genomic dnas.

As used herein, " homology " be meant between two polymer molecules, for example between two nucleic acid molecule, and for example between two dna moleculars or two the RNA molecules, the perhaps subunit's sequence similarity between two peptide molecules.When a subunit position was all occupied by identical monomer subunit in two molecules, if a position for example in two dna moleculars occupies by VITAMIN B4, then these two molecules were homologous in this position.Homology between two sequences is coupling or homology positional number purpose direct function, if for example half position in two compound sequences (for example length is in the polymkeric substance of 10 subunits 5 positions to be arranged) is homologous, then these two sequences are 50% homologous, if 90% position (for example having 9 in 10 positions) is coupling or homologous, then these two sequences present 90% homology.For example, dna sequence dna 3 ' ATTGCC5 ' presents 50% homology with 3 ' TATGGC.

As used herein, " homology " used mutually with " homogeny " synonym.In addition, when term " homology " or " homogeny " when this paper is used to describe nucleic acid or protein, should be interpreted as homology or homogeny at nucleic acid and amino acid sequence level.If first kind of oligonucleotide and second kind of oligonucleotide have only about at least each other 60%, preferably about at least 65%, more preferably anneal then these two oligonucleotide " highly strict " or " under the height stringent condition " annealing under about at least 70%, 80%, 90% or 95% complementary condition.The severity of condition of two oligonucleotide of being used to anneal is functions of the non-homology degree (if known words) of expecting between the G-C content of length, oligonucleotide of ionic strength, soaking time, the oligonucleotide of temperature, annealing medium and two oligonucleotide.The method of adjusting annealing conditions severity known in the art (see for example Sambrook et al., 1989, In:Molecular Cloning:A Laboratory Manual, Cold Spring HarborLaboratory, New York).

Between two Nucleotide or the aminoacid sequence homogeny per-cent determine can use mathematical algorithm to finish.For example, a mathematical algorithm that is used for two sequences of comparison is Karlin and Altschul algorithm (1990, Proc.Natl.Acad.Sci.USA 87:2264-2268), through Karlin and Altschul correct (1993, Proc.Natl.Acad.Sci.USA 90:5873-5877).This algorithm is integrated into NBLAST and the XBLAST program (1990 of Altschul etc., J.Mol.Biol.215:403-410), can obtain at the BLAST website of National Library of Medicine (NLM) NCBI (NCBI) website of for example NIH (NIH).The BLAST nucleotide search can use NBLAST program (being called blastn in the NCBI website) to carry out, and uses following parameter: gap penalty=5; Gapextension penalty=2; Mismatch penalty=3; Match reward=1; Expectationvalue 10.0; Word size=11 is to obtain and nucleic acid homologous nucleotide sequence described herein.The BLAST protein search can use XBLAST program (being called blastn in the NCBI website) or NCBI " blastp " program to carry out, use following parameter: expectation value 10.0, BLOSUM62 scoring matrix is to obtain and protein molecule homologous aminoacid sequence described herein.

In order to obtain series arrangement jaggy, can utilize described Gapped BLAST (1997, Nucleic Acids Res.25:3389-3402) such as Altschul to compare.Perhaps, can use PSI-Blast or PHI-Blast to carry out cyclic search, the edge far away relation between the detection molecules and present relation between the molecule of common mode.When utilizing BLAST, GappedBLAST, PSI-Blast and PHI-Blast program, can use the default parameters of each program (for example XBLAST and NBLAST) that on the NCBI website of the National Library of Medicine of NIH, obtains.

Homogeny per-cent between two sequences can use the technology similar to above-mentioned those technology to determine, has or non-notch.In calculating homogeny per-cent, typically counting accurately mates.

As used herein, term " gene " or " recombination " are meant the nucleic acid molecule of the open reading frame that comprises code book invention polypeptide.This natural allelotrope changes the variation that can typically cause 1-5% in the specific gene nucleotide sequence.Alternative allelotrope can be differentiated by gene of interest in numerous Different Individual is checked order.This can use hybridization probe to carry out, to differentiate the homologous genes seat in numerous individualities.Any and all this Nucleotide change and since natural allelotrope change gained, and do not change the amino acid polymorphism of functionally active or change and all comprise within the scope of the present invention.

In addition, the proteinic nucleic acid molecule of the present invention of other species of encoding (homologue) has and the different nucleotide sequence of murine protein matter described herein, and it also within the scope of the invention.Can separate with the homogeny of mouse nucleic acid molecule based on it corresponding to the natural allele variant of cDNA of the present invention and the nucleic acid molecule of homologue, use mouse cDNA or its part as hybridization probe, under stringent hybridization condition, carry out according to the standard hybridization technique.For example, the nucleic acid homologue of code book invention kidney of rats zymoprotein can based on its with the nucleic acid molecule of coding all or part rat and/or people's kidney enzyme under the height stringent condition hybridization and separate.

" isolating nucleic acid " be meant under native state the sequence of its flank isolating nucleic acid sections or fragment, for example from the common sequence adjacent, for example separated DNA fragment from sequence adjacent with this fragment the genome of natural generation with this fragment.This term also is used to describe basically from natural other composition of following with nucleic acid, for example nucleic acid of purifying in RNA or DNA or the protein.This term also comprises for example recombinant DNA; its be impregnated in the plasmid or the virus of carrier, self-replicating or mix prokaryotic cell prokaryocyte or eukaryotic genomic dna in, perhaps have (for example cDNA or genome or the cDNA fragment that produces by PCR or restriction enzyme digestion) to be independent of independent molecule outside other sequence.This term also comprises the recombinant DNA of a part of the hybrid gene that is the other peptide sequence of coding.

In the present invention, use following abbreviation to represent ubiquitous nucleic acid base: A is meant adenosine, and C is meant cytidine, and G is meant guanosine, and T is meant thymidine, and U is meant uridine.

Two polynucleotide are to be meant " operably connecting " that strand or double stranded nucleic acid segment are included in two polynucleotide arranging by this way in this nucleic acid moiety, and described mode is that at least one can bring into play physiological role to another in two polynucleotide.For example, can promote transcribing of this coding region with the promotor that the coding region of gene operably is connected.Preferably, when the nucleic acid of coding desired protein further comprised a promotor/adjustings sequence, this promotor/adjusting sequence was positioned at 5 ' end of desired protein encoding sequence, and its driving desired protein is expressed in cell thus.In a word, the nucleic acid and the promotor/adjusting sequence thereof of coding desired protein comprise one " transgenosis ".Two polypeptide are nonessential adjacent one another are operably to connect.

The required nucleotide sequence of gene product expression as used herein, that term " promotor/adjusting sequence " is meant with promotor/the adjusting sequence operably is connected.In some cases, this sequence can be the core promoter sequence, and in other situation, this sequence also can comprise enhancer sequence and other regulatory element that gene product expression is required.Promotor/adjusting sequence can for example be with the promotor of tissue specificity mode expressing gene product/adjusting sequence.

" composing type " promotor is such nucleotide sequence, when its polynucleotide with coding or appointment gene product operably are connected, produces in the human body cell that under most of or all physiological conditions of cell described gene product is being lived.

" induction type " promotor is such nucleotide sequence, when its polynucleotide with coding or appointment gene product operably are connected, has only when the inductor corresponding to promotor is present in the cell, and gene product is produced in the human body cell of living.

" tissue specificity " promotor is such nucleotide sequence, when its polynucleotide with coding or appointment gene product operably are connected, only when cell is cell corresponding to the types of organization of promotor, gene product is produced in the human body cell of living.

" polyadenylation sequence " is a polynucleotide sequence, and it instructs the polyA tail to add on the messenger RNA(mRNA) sequence of transcribing.

" polynucleotide " are meant strand or parallel and antiparallel nucleic acid chains.Therefore, polynucleotide can be strand or double-strandednucleic acid.

Term " nucleic acid " typical case is meant big polynucleotide.

Term " oligonucleotide " typical case is meant short polynucleotide, is no more than about 50 Nucleotide usually.Should understand when nucleotide sequence is represented with dna sequence dna (A, T, G, C), also comprise the wherein RNA sequence (being A, U, G, C) of U displacement T.

This paper uses conventional representation to describe polynucleotide sequence: the left distal end of strand polynucleotide sequence is 5 ' end, and the left direction of double-stranded polynucleotide sequence is 5 ' direction.

To be meant transcriptional orientation in the rna transcription thing of 5 '-3 ' direction with Nucleotide adding new life.The DNA chain that has with the mRNA identical sequence is called " coding strand "; The sequence that is positioned at the last reference point 5 ' end of DNA on the DNA chain is called " upstream sequence "; The sequence of 3 ' end of the last reference point of DNA is called " downstream sequence " on the DNA chain.

As used herein, term " treatment significant quantity " is meant the quantity of the medicament of effective treatment pathology, obstacle or disease.

" part " of polynucleotide is meant about at least 20 continuous nucleotide residues of polynucleotide.The part that should understand polynucleotide can comprise each nucleotide residue of these polynucleotide.

" primer " is meant such polynucleotide, its can with specified polynucleotide template specific hybrid, and provide the starting point of synthetic complementary polynucleotide.Inducing when placing under the synthetic condition when the polynucleotide primer, taking place this syntheticly, described condition promptly exists Nucleotide, complementary polynucleotide template and carries out polymeric preparation such as archaeal dna polymerase.The primer typical case is a strand, but also can be double-stranded.The primer typical case is a thymus nucleic acid, but can use the primer of numerous synthetic and natural generations.Primer and the appointment template complementation of hybridization with it as synthetic initiation site, still do not need to reflect the accurate sequence of template.In this case, the specific hybrid of primer and template depends on the severity of hybridization conditions.Primer can be used for example chromophore, radioactivity or fluorescence part mark, but and as the test section.

" probe " be meant can with the polynucleotide of specified another polynucleotide sequence specific hybrid.Probe and target complementary polynucleotide specific hybrid, but do not need to reflect the accurate complementary sequence of template.In this case, the specific hybrid of probe and target depends on the severity of hybridization conditions.But probe can be with for example chromophore, radioactivity or fluorescence part mark and as the test section.

" kidney enzyme inhibitors " is meant a kind of compound, and when comparing with the other identical cell or tissue middle kidney enzyme level that does not have described compound, this compound can suppress the level of cell or tissue middle kidney enzyme with detecting.The level of kidney enzyme include but not limited to the to encode expression of nucleic acids level of this molecule, detectable kidney enzyme level, and/or the level of kidney enzymic activity.The kidney enzyme inhibitors includes but not limited to chemical compound, cofactor, antibody, ribozyme, antisense molecule, nucleic acid or the like.

" recombination of polynucleotide " is meant the polynucleotide with sequence that non-natural combines.Recombination of polynucleotide amplification or assembling can be included in the suitable carriers, and this carrier can be used for transforming proper host cell.Recombination of polynucleotide can provide non-encoding function (for example promotor, replication orgin, ribosome bind site or the like).

" recombinant polypeptide " is based on recombination of polynucleotide and expresses the polypeptide that produces.

" polypeptide " is meant by peptide bond and connects the polymkeric substance of being made up of the structural variant of amino-acid residue, relevant natural generation and analogue that the synthetic non-natural takes place thereof, the structural variant of the natural generation that it is relevant, and the analogue of synthetic non-natural generation.The synthetic polypeptide can for example use automatic Peptide synthesizer synthetic.

Term " protein " typical case is meant big polypeptide.

Term " peptide " typical case is meant short polypeptide.This paper uses conventional representation to describe peptide sequence: the left distal end of peptide sequence is a N-terminal, and the right end of peptide sequence is a C-terminal.

As used herein, term " kidney enzyme (renalase) " is meant the new monoamine oxidase by renal secretion, its metabolism biological monoamine such as Dopamine HCL, norepinephrine and suprarenin.The kidney enzyme molecule that the present invention discloses is that a class comprises that other polypeptide that discloses with the present invention has those molecules of height and/or remarkable sequence homogeny.The kidney enzyme of more particularly, inferring has about at least 40% sequence homogeny with the nucleic acid with sequence shown in the SEQ IDNO:1.More preferably, sequence shown in the nucleic acid of coding kidney enzyme and the SEQ ID NO:1 has about at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or about at least 99% sequence homogeny.More preferably, described nucleic acid is SEQ ID NO:1.

Term " kidney enzyme " also comprises the kidney enzyme isoforms.Kidney enzyme gene contains 9 exons crossing over 310188bp in No. 10 karyomit(e)s of people's gene group.The kidney enzyme clone (SEQ ID NO:1, GenBank registration number BC005364) that the present invention discloses is to contain exons 1,2,3,4,5,6,8 gene.The kidney zymoprotein that at least two kinds of other alternative splicing forms are arranged in people's gene group database.A kind of alternative splicing form contains exons 1,2,3,4,5,6,9, is clone's discriminating of GenBank registration number AK002080 (SEQ ID NO:3) and NM_018363 (SEQ ID NO:4) by registration number in people's gene group database.Another kind of alternative splicing form contains exon 5,6,7,8, by clone's discriminating of GenBank registration number BX648154 in the people's gene group database (SEQ ID NO:5).

Unless stated otherwise, then " kidney enzyme " contains all known kidney enzymes (for example kidney of rats enzyme and people's kidney enzyme), and with found kidney enzyme, includes but not limited to have the characteristic of the kidney enzyme that the present invention discloses and/or the mouse kidney enzyme and the chimpanzee kidney enzyme of physical features.

" restriction site " is the part by the double-strandednucleic acid of restriction endonuclease identification.When nucleic acid contacted with endonuclease, if endonuclease can cut two chains of described nucleic acid in described part, then this part of double-strandednucleic acid was by restriction endonuclease " identification ".

As used herein, term " specificity in conjunction with " be meant a kind of compound for example identification such as protein, nucleic acid, antibody and specificity in conjunction with a specific molecular, but nonrecognition or in conjunction with other molecule in the sample basically.

If first kind of oligonucleotide and second kind of oligonucleotide have only each other about at least 70% or about at least 73%, more preferably about at least 75%, 80%, 85%, 90% or about at least 95% complementary condition under anneal then these two oligonucleotide " highly strict " annealing.The severity of condition of two oligonucleotide of being used to anneal is functions of the non-homogeneous degree (if known words) of expecting between the G-C content of length, oligonucleotide of ionic strength, soaking time, the oligonucleotide of temperature, annealing substratum and two oligonucleotide.The method of adjusting annealing conditions severity known in the art (see for example Sambrook et al., 1989, Molecular Cloning:A Laboratory Manual, Cold Spring HarborLaboratory, New York).

As used herein, term " transgenosis " is meant exogenous nucleic acid sequences, and this exogenous nucleic acid is by transgenic cell or Mammals coding.

" reconstitution cell " is to comprise genetically modified cell.This cell can be eukaryotic cell or prokaryotic cell prokaryocyte.In addition, transgenic cell is contained but is not limited to comprise genetically modified embryonic stem cell, derive from chimeric mammiferous cell (this cell comprises transgenosis), derive from the cell of transgene mammal or its fetus or placenta tissue, and comprise genetically modified prokaryotic cell prokaryocyte derived from transgenosis ES cell.

Term " exogenous nucleic acid " is meant to use to be convenient to technology transfered cell in nucleic acid transfered cell or the animal or the nucleic acid in the animal.

" mark " polypeptide is meant so any protein, when it is connected with protein of interest matter by peptide bond its can be used for locating this protein, with its from cell extract purifying, be fixed to be used for binding analysis or to study its biological property and/or function in addition.

As used herein, term " transgene mammal " is meant that its cell comprises the Mammals of exogenous nucleic acid.Described exogenous nucleic acid can or not be integrated in the mammiferous genome.

As used herein, " treatment " is meant occurrence frequency, degree, seriousness and/or the time length of patients' such as reducing ESRD, hypertension, cardiovascular disorder, mental disorder symptom.

As used herein, term " carrier " is meant any plasmid or the virus of encoding exogenous nucleic acid.This term also should be interpreted as comprising and promote nucleic acid to shift non-plasmid and the non-virus compound in virosome into or the cell, for example many Methionin compound or the like.Carrier can be to be suitable as transport agent the nucleic acid of kidney zymoprotein or encoding mammalian kidney enzyme is transported to patient's virus vector, perhaps can be the non-virus carrier that is suitable for same purpose.

DNA is transported to the virus of cell and tissue and the example of non-virus carrier is known in the art, for example Ma etc. (1997, Proc.Natl.Acad.Sci.U.S.A.94:12744-12746) describe.The example of virus vector include but not limited to vaccinia virus recombinant, recombinant adenovirus, recombinant retrovirus, recombinant adeno-associated virus, recombinant fowlpox virus or the like (Cranage et al., 1986, EMBO is J.5:3057-3063; The International Patent Application WO 94/17810 that on August 18th, 1994 announced; The International Patent Application WO 94/23744 that on October 27th, 1994 announced).The example of non-virus carrier includes but not limited to polyamine derivative of liposome, DNA or the like.

As used herein, term " knocks out targeting vector " and is meant a kind of carrier, and it comprises two nucleotide sequences, each sequence all with interested target sequence both sides, to be lacked or by another nucleotide sequence metathetical nucleic acid region complementation.Therefore these two nucleotide sequences are positioned at the target sequence both sides, are removed by the homologous recombination method.

As used herein, term " chronic nephropathy " is meant the kidney damage more than 3 months, is characterised in that 26S Proteasome Structure and Function is unusual, has or do not have the glomerular filtration rate(GFR (GFR) of reduction, and perhaps GFR is 60mL/ minute/1.73m ²Perhaps lower, there is or do not have kidney damage.GFR is an index of measuring kidney filtering blood ability, and it can compose the branch expression continuously.GFR can pass through serum creatinine, body weight and estimation of Age.

As used herein, term " end-stage renal disease (ESRD) " is meant that kidney drains refuse, concentrated urine and regulate electrolytical function fully or near not bringing into play fully.End-stage renal disease (ESRD) when proceeding to the stage that kidney can only bring into play its 10% following ability, takes place in chronic renal failure.In this stage, the function of kidney is so low, to such an extent as to can not dialyse or renal transplantation, multiple severe complication occurs, owing to death takes place for liquid in the body and gathering of refuse.

Describe

I. isolating nucleic acid

A., phosphorothioate odn is arranged

The present invention includes the molecule that the encoding mammalian kidney is expressed, the isolating nucleic acid of kidney enzyme or its fragment, wherein said nucleic acid and at least a nucleic acid with sequence shown in the SEQ ID NO:1 have about at least 40% homogeny.Perhaps, the SEQ IDNO:1 sequence that discloses of described nucleic acid and this paper has about at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or about at least 99% homology.In one embodiment, described nucleotide sequence or molecule have sequence shown in the SEQ ID NO:1.

On the other hand, the present invention includes isolating nucleic acid or its fragment of encoding mammalian kidney enzyme, wherein have about homology more than 15% by aminoacid sequence shown in the protein of described nucleic acid encoding and the SEQ ID NO:2.Series arrangement comparative study shows that kidney enzyme and monoamine oxidase A have 13.2% amino acid homogeny.

Preferably, by sequence about at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or about at least 99% homology shown in the protein of the isolating nucleic acid encoding of coding kidney enzyme and the SEQ ID NO:2.In one embodiment, the kidney enzyme polypeptide by described nucleic acid encoding has sequence shown in the SEQ ID NO:2.As disclosed, the nucleic acid of SEQ ID NO:1 can be translated to produce and comprise 342 amino acid whose people's kidney zymoproteins, and the calculating molecular weight is 37.8kDa.

The present invention should not be interpreted as only limiting to nucleic acid and the aminoacid sequence that this paper discloses.By means of the present invention, those skilled in the art are easy to recognize and can obtain coding other nucleic acid as the kidney enzyme polypeptide that exists in other Mammals (for example ape, gibbon, ox, sheep, horse, pig, dog, cat, mouse or the like) species, by rat and the people kidney enzymatic nucleic acid method (for example screening-gene group or cDNA library) of the present invention at the separation coding kidney enzyme polypeptide of experiment chapters and sections detailed description, and the method for method well known in the art (for example using the reverse transcription PCR of mRNA sample) and announcement is carried out.

In addition, many methods can be used for producing mutant, derivative or the variant form of kidney enzyme, use recombinant DNA method well known in the art to carry out, Sambrook et al. (1989 for example, Molecular Cloning:A Laboratory Manual, Cold Spring HarborLaboratory Press, New York) and Ausubel et al. (1997, Current Protocols inMolecular Biology, Green ﹠amp; Wiley, New York) described method.

The method that imports amino acid change by the dna sequence dna that changes coded polypeptide in protein or polypeptide is known in the art, also by (1997, as preceding) descriptions such as Sambrook etc. (1989, as preceding) and Ausubel.

The present invention further comprises the nucleic acid of encoding mammalian kidney enzyme, and wherein the nucleic acid of coded markings polypeptide is covalently bound with it.That is to say that a kind of chimeric nucleic acid is contained in the present invention, wherein the nucleotide sequence of coded markings polypeptide is covalently bound with the nucleic acid of at least a people's kidney enzyme of coding.This labeling polypeptide is known in the art, for example comprises green fluorescent protein (GFP), influenza virus hemagglutinin labeling polypeptide, myc, myc-pyruvate kinase (myc-PK), His6, maltose binding protein (MBP), FLAG labeling polypeptide, HA labeling polypeptide, and glutathione-S-transferase (GST) labeling polypeptide.Yet, the present invention's should not be interpreted as only limiting to encoding nucleic acid of above-mentioned labeling polypeptide.Even coding all should be interpreted as comprising in the present invention with any nucleotide sequence of the polypeptide that works to the similar substantially mode of these labeling polypeptides.The nucleic acid that comprises the nucleic acid of coded markings polypeptide is used in location kidney enzyme in cell, tissue (for example blood vessel, bone or the like) and/or the whole organism (for example Amphibians and/or mammal embryo or the like), detect the kidney enzyme and whether from cell, secrete, and the effect of research kidney enzyme in cell.In addition, add labeling polypeptide and can be convenient to " mark " proteinic separation and purifying, protein of the present invention thus can be easy to produce and purifying.

B. antisense nucleic acid

Need to suppress the expression of kidney enzyme in some cases, so the present invention also comprises the composition that is used to suppress the kidney expression of enzymes.Therefore, a part or the isolating nucleic acid of total length complementary that provides with the nucleic acid of encoding mammalian kidney enzyme is provided in the present invention, and this nucleic acid is antisense orientation for transcribing.Described antisense nucleic acid with and SEQ ID NO:1 have at least 40% homologous nucleic acid or its fragment complementation.In other embodiments, antisense nucleic acid with have a part or total length complementary nucleic acid or its fragment about at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or about at least 99% homology of nucleic acid SEQ ID NO:1 sequence, encoding mammalian kidney enzyme, it is an antisense orientation for transcribing.Most preferably, nucleic acid or its segmental part or total length complementation shown in described nucleic acid and the SEQ ID NO:1.This antisense nucleic acid suppresses the expression, function of (kidney enzyme) molecule that kidney expresses or the two.

In addition, can be used for detecting the expression of kidney enzyme mRNA in cell, tissue and/or organism, use and detect such as but not limited to in-situ hybridization method with whole or a part of complementary antisense nucleic acides of the nucleic acid of coding kidney enzyme.Therefore, those skilled in the art will understand based on announcement provided herein, and the present invention has been contained and can be used as the antisense nucleic acid of probe with evaluation kidney expression of enzymes.

Antisense molecule of the present invention can synthesize generation, offers cell then.A preferably approximately 10-30 Nucleotide, the more preferably antisense oligomers of about 15 Nucleotide are because it is easy to be synthesized and import in the target cell.Synthetic antisense molecule of the present invention comprises oligonucleotide derivative known in the art, and its biologic activity with improvement of comparing with the oligonucleotide of unmodified (is seen Cohen, as preceding; Tullis, 1991, U.S. Patent No. 5,023,243 is described, incorporates into for referencial use in full).

II. isolated polypeptide

A. polypeptide, its analogue and modification

The present invention also comprises the isolated polypeptide that comprises the mammal kidney enzyme.In one embodiment, the isolated polypeptide that comprises the mammal kidney enzyme presents about at least 15% homology with the polypeptide with aminoacid sequence shown in the SEQ ID NO:2.In other embodiments, comprise the isolated polypeptide of mammal kidney enzyme and kidney of rats enzyme and have about at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or about at least 99% homology.In one embodiment, the isolated polypeptide that comprises the mammal kidney enzyme is the kidney of rats enzyme polypeptide.In another embodiment, the isolated polypeptide that comprises mammal kidney enzyme molecule is SEQ ID NO:2.

The present invention also provides the protein of the kidney enzyme that comprises the present invention's announcement or the analogue of peptide.By conserved amino acid sequence difference or the modification by not influencing sequence or by this dual mode, analogue is different with the protein or the peptide of natural generation.For example, can carry out conserved amino acid and change,, not change its function usually although this change has changed the primary sequence of protein or peptide.Conserved amino acid replaces the typical case and comprises following group of replacement:

Glycine, L-Ala;

Xie Ansuan, Isoleucine, leucine;

Aspartic acid, L-glutamic acid;

L-asparagine, glutamine;

Serine, Threonine;

Methionin, arginine;

Phenylalanine, tyrosine.

Modification (it does not change primary sequence usually) comprises the body of polypeptide interior or external chemical derivatization, for example acetylize or carboxylation.Described modification also comprises glycosylation, for example by and processing synthetic at polypeptide or those glycosylations that further glycosylation pattern of modified polypeptide produces during the procedure of processing; For example by polypeptide being exposed to the glycosylation that the glycosylated enzyme of influence (for example Mammals glycosylation or deglycosylating enzyme) produces.Described modification also comprises having for example sequence of Tyrosine O-phosphate, phosphoserine or phosphothreonine of phosphorylated amino acid residue.

The present invention also comprises and uses common Protocols in Molecular Biology modified polypeptides, to improve it to the resistance of proteolysis or optimize dissolving properties or it is more suitable for as therapeutical agent.The analogue of this peptide species comprises the residue that contains except the L-amino acid of natural generation, for example the those polypeptides of the synthesizing amino acid of D-amino acid or non-natural generation.Polypeptide of the present invention is not limited to the product of any special exemplary method cited herein.

The present invention also should be interpreted as containing " mutant ", " derivative " and " variant " of peptide of the present invention (the perhaps DNA of code book invention peptide), mutant, derivative and the variant of kidney enzyme peptide is wherein to have changed one or more amino acid (perhaps when describing the nucleotide sequence of encoded peptide, change one or more base pair), gained peptide (perhaps DNA) is different with described sequence thus, but have identical biological property with described peptide, promptly described peptide has the biology/biochemical property of kidney enzyme peptide of the present invention.

In addition, the present invention should be interpreted as comprising the variant or the reorganization deutero-mutant of kidney enzyme isoforms and the natural generation of kidney enzyme sequence, and described variant or mutant make its encoded protein matter compare with full-length clone of the present invention to have more, less or identical biologic activity.

B. from cell, produce and isolated polypeptide

Confirm as this paper other places, the invention still further relates to generation and the method for separating the kidney enzyme polypeptide from the cell that produces the kidney enzyme.The invention still further relates to from the cell culture medium that this cell is grown therein and produce and the method for separating the kidney enzyme.

Can be used for cell in this method comprises any cell of natural generation kidney enzyme and suddenlys change, changes or handle cell with generation kidney enzyme.This cell comprises those cells of generation typical amount kidney enzyme and those cells of excessive generation kidney enzyme.Can produce kidney enzyme or low volume production to non-natural and give birth to the cell of kidney enzyme and suddenly change, change or handle, so that it produces a certain amount of kidney enzyme, with naturally and/or economically it is separated from the substratum of this cell and its growth.

In case produce by cell, then the kidney enzyme can be separated from cell and/or its growth medium, use protein stripping technique well known to those skilled in the art to carry out.If desired or essential, can use purified technology of protein well known to those skilled in the art that isolating kidney enzyme is further purified.

C. purified polypeptide from body fluid

The invention still further relates to a kind of from the animal method of purifying kidney enzyme polypeptide the mammalian body fluid particularly.Any animal that produces the kidney enzyme all can be used for purifying kidney enzyme from its body fluid.Suitable examples of animals includes but not limited to mouse, rat, horse, pig, dog, monkey, ox and people.

Polypeptide comprises that the purifying of fragment, homeopeptide, mutain, analogue, derivative and fusion rotein is well known to those skilled in the art.See for example Scopes, ProteinPurification, 2d ed. (1987).The purifying of chemical synthesising peptide can for example be easy to realize by HPLC.Therefore, the invention provides a kind of from least a body fluid the method for purifying kidney enzyme polypeptide.Described body fluid includes but not limited to blood, serum, blood plasma, saliva, urine, lymph liquid, whole blood, cerebrospinal fluid tissue culture medium (TCM) and cell extract.The purifying of kidney enzyme from body fluid can be undertaken by any method of purifying protein known in the art, includes but not limited to ion exchange chromatography, adsorption chromatography, part binding affinity chromatography and gel permeation chromatography, and independent or combination is carried out.

Having or do not having in the situation of stablizer, one aspect of the present invention provides the isolating protein of the present invention of pure or pure substantially form.Stablizer comprises protein sample or nonprotein sample material, for known in the art.Stablizer such as albumin and polyoxyethylene glycol (PEG) are known in the art and can be purchased.

Although preferred high-caliber purity when the isolating protein of the present invention is used as replacement therapy as therapeutical agent as reaching as vaccine is also useful than the isolating protein of the present invention of low-purity.For example, partially purified protein of the present invention can be used as immunogen to produce antibody in laboratory animal.

D. the activity of polypeptide

The present invention further provides a kind of pharmaceutical composition, it comprises a kind of enzyme and activates cofactor.Disclose more fully as this paper other places, the kidney enzyme is a kind of enzyme that contains flavine-adenosine-dinucleotides (FAD), and it needs cofactor FAD to bring into play its function.By the present invention instruction, those skilled in the art obviously can have other enzyme cofactor activating or inactivation kidney enzymic activity, and described other enzyme cofactor is as to work to the similar substantially mode of FAD and to be those cofactors well known in the art.These cofactors include but not limited to the FAD analogue, Reduced nicotinamide-adenine dinucleotide (NAD), Triphosphopyridine nucleotide, reduced (NADP), thiaminpyrophosphate, flavin adenine dinucleotide (FAD), vitamin B2 phosphate (FMN), pyridoxal phosphate, coenzyme A, tetrahydrofolic acid (THFA), adenosine triphosphate, guanosine triphosphate and S-adenosylmethionine (SAM), metal ion, metalloporphyrin, heme group for example, vitamin H, α 2-microglobulin, thiaminpyrophosphate, coenzyme A, pyridoxal phosphate, actimide, biotin complex of yeast, tetrahydrofolic acid (THFA) and Thioctic Acid.

The kidney enzymic activity also can be regulated by the formation of homology polymer or heteromultimers.The homology polymer can be by three or the polypeptide formed of a plurality of identical subunit.On the other hand, the polymer polypeptide can be a heterodimer, i.e. the polypeptide of forming by two different subunits, and perhaps by three or the heteromultimers formed of a plurality of subunit, wherein at least two of these subunits are different.For example, the polymer polypeptide is made up of numerous subunits, and the mixture of the polypeptide that the polymer polypeptide of its formation " single " or many functions are relevant can be monomer and/or polymer polypeptide.

Homodimer or homology polymer can form by the spontaneous combination of some identical polypeptide subunits.Heterodimer or heteromultimers can form by the spontaneous combination of some different polypeptide subunits.There are indications that the kidney enzyme forms dimer or multimeric complexes (Fig. 6 C).Dimer or the polymerization of be sure oing the kidney enzyme can front or this enzymic activitys of negative impact.Therefore, the destruction of the dimer of expection kidney enzyme or multimeric complexes or stablely can be used in particular for multiple therapeutic purpose.

E. the application of polypeptide

The peptide of described nucleic acid and coding thereof is the effective tool of explanation kidney enzyme molecule function in cell.In addition, the nucleic acid and the amino acid that comprise mammal kidney enzyme molecule are effective target position that can be used for for example differentiating the compound that influences kidney expression of enzymes etc., and are a kind of potential candidate therapeutic medicines of diseases such as hypertension, kidney disease, heart trouble.Described nucleic acid, its encoded protein matter or the two can give Mammals to increase or to reduce expression or the activity of kidney enzyme in Mammals.This is comparing with kidney enzyme normal expression in healthy Mammals, and the kidney enzyme is low in Mammals, and to express or cross in the situation of expressing mediation disease relevant with the change of kidney expression of enzymes or pathology for Mammals may be useful.Thereby can provide the treatment this pathology that benefit influences to include but not limited to hypertension, kidney disease, heart trouble or the like by regulating kidney expression of enzymes or activity.This be because as disclose more fully in this paper other places, be illustrated in the rat and injected the kidney enzyme and can bring high blood pressure down and heart rate.

In addition, nucleic acid of the present invention and amino acid can be used for producing reconstitution cell and transgenic nonhuman mammal, are used to study kidney enzyme function, differentiate the useful tool of the cytosis of new diagnostic reagent and therapeutical agent and explanation kidney enzyme.For example, transgenic animal can be used for studying kidney and vascular disease relevant diseases.

In addition, nucleic acid of the present invention and amino acid can diagnostic be used to assess the severity and the prognosis of ESRD, hypertension, heart trouble, ephrosis, cardiovascular disorder etc. by evaluating gene expression dose or protein expression level.Nucleic acid of the present invention, peptide, polypeptide and protein also can be used for developing the analysis of the treatment measures effectiveness of evaluating prevention ESRD, hypertension, cardiovascular disorder etc.Be that nucleic acid of the present invention, peptide, polypeptide and protein can be used for detecting the effect of multiple therapy methods to the kidney expression of enzymes, thereby determine the effectiveness of this methods of treatment, render a service for the treatment of ESRD, hypertension, heart trouble, ephrosis and cardiovascular disorder such as but not limited to assessment.

F. the micromolecular inhibitor of polypeptide

Except antibody, ribozyme, RNA interfering ' s (being RNAi) and antisense nucleic acid molecule that this paper discloses, the present invention further provides and used small molecules to regulate the method for kidney enzymic activity.As used herein, term " potential micromolecular inhibitor " is meant and the small molecules of the protein bound selected, but also test of the ability of the biologic activity of its inhibitory enzyme (for example reducing the catalysis speed of enzyme).After having confirmed this inhibition feature, described small molecules can be called " micromolecular inhibitor " or more common " inhibitor ".

Term " small molecules " is meant that molecular weight is equal to or less than about 5000 dalton (5kD) or less than about 3kD or less than about 2kD or less than the about compound of 1kD.In some cases, preferred described micromolecular molecular weight is equal to or less than about 700Da.

As providing among the embodiment, protein of the present invention and nucleic acid, as have the protein of aminoacid sequence shown in the SEQ IDNO:2, participate in catecholamine metabolism.Regulate or small molecules that down-regulation protein matter is expressed or as the preparation of proteinic at least a active agonist or antagonist can be used for regulating and this protein function and active relevant biology and pathological process.

Pathological process is meant a kind of biological procedures that produces deleterious effect.For example, protein expression of the present invention lacks or down-regulated expression can be relevant with some disease such as ESRD.As used herein, when micromolecular inhibitor reduces the degree of described process or seriousness, then claim said preparation to regulate this pathological process.For example, can give some mode and reduce or regulates protein expression of the present invention or at least a active preparation and preventing disease or adjusting progression of disease by giving.

Micromolecular inhibitor of the present invention can provide separately, perhaps with other preparation combination of regulating the particular pathologies process.As used herein, when giving two kinds of small molecules simultaneously or so that its mode that works simultaneously when giving two kinds of small molecules separately, then claims these two kinds of small molecules combinations to give.

Micromolecular inhibitor of the present invention can be by parenteral, subcutaneous, intravenously, intramuscular, intraperitoneal, give through skin or through the oral cavity approach.Perhaps, or the while, orally give can be passed through.The dosage that gives depends on receptor's age, state of health and body weight, and the kind for the treatment of simultaneously if having, also has the interaction property of therapeutic frequency and hope.

III. carrier

A. carry out the carrier of vivoexpression

In other related fields, the present invention includes a kind of isolating nucleic acid of encoding mammalian kidney enzyme, it operably is connected with the nucleic acid that comprises promotor/adjusting sequence, and described thus nucleic acid preferably can instruct the expression of its encoded protein matter.Therefore, the present invention has been contained expression vector and will follow in the foreign DNA transfered cell and in this cell have been expressed the method for described foreign DNA, for example as described in (1997, as preceding) such as Sambrook etc. (1989, as preceding) and Ausubel.

Kidney enzyme (merging separately or with detectable labeling polypeptide) is not normally being expressed the kidney enzyme or is not being expressed expression in the cell of the kidney enzyme that merges with labeling polypeptide, can realize by producing plasmid, virus or other type of carrier, described carrier comprises the required nucleic acid that operably is connected with promotor/adjusting sequence, and described promotor/driving of adjusting sequence has or unmarked protein is expressed in the cell that imports described carrier.This area can utilize many genome moulding expression promoter/adjusting sequences that are used to drive, include but not limited to for example cytomegalovirus immediate early promoter enhancer sequence, SV40 early promoter, these two kinds of promotors all are used for the experiment that the present invention discloses, and Rous sarcoma virus promoter or the like.In addition, the induction type of the nucleic acid of coding kidney enzyme and tissue specific expression can be by having coding or the nucleic acid of unmarked kidney enzyme places the control of induction type or tissue-specific promoter/adjustings sequence time to realize.

Be used for the tissue specificity of this purpose or the example of inducible promoter/adjusting sequence and include but not limited to MMTV LTR inducible promoter and SV40 enhancers/promoters in late period.In addition, well known in the artly reply inductor such as metal, glucocorticosteroid etc. and the inductive promotor also contains in the present invention.Therefore, should recognize the present invention includes and use the known or unknown operably any promotor/adjusting sequence of the desired protein of connection expression that can drive with it.

Use vector expression kidney enzyme to make and to separate the protein that a large amount of reorganization produce.In addition, the shortage of kidney expression of enzymes or level reduction cause in the situation of disease, obstacle or the pathology relevant with this expression, the expression of the kidney enzyme that is driven by promotor/adjusting sequence can provide effective methods of treatment, and the gene therapy that provides by the kidney enzyme is provided.For reducing relevant disease, obstacle or pathology with the increase of protein expression level, proteinic level or protein active, giving the kidney enzyme can be effective methods of treatment, includes but not limited to provide the kidney enzyme to carry out gene therapy.Therefore, the present invention not only comprises inhibition kidney expression of enzymes, translation and/or active method, reduction and increase kidney expression of enzymes and/or activity also comprise relating to increasing kidney expression of enzymes, protein level and/or active method, because all can be used for providing effective methods of treatment.

The invention is not restricted to selected any certain plasmid carrier or other dna vector, can utilize many carriers well known in the art.In addition, those skilled in the art know the method for selecting special promotor/adjusting sequence and those promotors/adjusting sequence and the dna sequence dna of the required polypeptide of coding operably being connected.This technology is known in the art, for example by as described in Sambrook (as preceding) and the Ausubel (as preceding).

Therefore the present invention comprises the carrier of the isolating nucleic acid that comprises encoding mammalian kidney enzyme.Being integrated into required nucleic acid in the carrier and selecting carrier is technology known in the art, for example sees as described in Sambrook etc. (as preceding) and Ausubel etc. (as preceding).

The present invention also comprises the cell that contains this carrier, virus, provirus or the like.The method that generation comprises the cell of carrier and/or exogenous nucleic acid is known in the art.For example see as described in Sambrook etc. (as preceding) and Ausubel (as preceding).

The nucleic acid of coding kidney enzyme can be cloned in the into different plasmid vectors.Yet the present invention should not be construed as limited to plasmid or any specific support.On the contrary, the present invention should be interpreted as containing and can be easy to obtain and/or carrier well known in the art and be not carrier.

B. carry out in the body and the carrier that exsomatizes and express

Described kidney enzyme polypeptide also can be used by the expression in vivo of this peptide species according to the present invention, so-called " gene therapy ".

Therefore, for example patient's cell can be used polynucleotide (DNA or the RNA) through engineering approaches of the stripped polypeptide of coding, and the cell with through engineering approaches offers the patient to treat the patient with described polypeptide then.This method is known in the art, instructs obviously by this paper.For example, cell can contain the retroviral plasmid vector of RNA of code book invention polypeptide and through engineering approaches by use.

Similarly, cell can by methods known in the art for example in vivo through engineering approaches with express polypeptide in vivo.For example, with the retroviral plasmid vector transduction of packing cell with the RNA that contains code book invention polypeptide, described thus packing cell produces the infectious viral particle that contains gene of interest.These produce that cells can give the patient so that cell through engineering approaches and express polypeptide in vivo in vivo.Those skilled in the art will obviously give these and other method of polypeptide of the present invention by instruction of the present invention.

Numerous carriers have been contained in the present invention will comprise two or more polypeptide or proteinic encoding sequence and the application of self processing in the construct transfered cell that cuts sequence, cause protein expression thus.The example of many expression vectors known in the art can be virus or non-viral source.Can be used for putting into practice non-viral gene carrying method of the present invention and include but not limited to plasmid, liposome, nucleic acid/liposome complex, cation lipid etc.

Virus vector is transducer cell and himself DNA imported in the host cell effectively.In producing recombinant viral vector, with the gene substitution of dispensable gene with coding protein of interest matter or polypeptide.The carrier of example includes but not limited to virus and non-virus carrier, as retroviral vector (comprising lentiviral vectors), adenovirus (Ad) carrier, comprise that it duplicates competence, replication defective and gutless form, adeno associated virus (AAV) carrier, simian virus 40 (SV-40) carrier, bovine papilloma virus vector, Epstein-Barr virus vector, herpesvirus vector, vaccinia virus vector, Moloney murine leukemia poisonous carrier, Harvey murine sarcoma virus carrier, mouse mammary tumour virus carrier, Rous sarcoma virus carrier and non-virus particle.

The carrier typical case comprises replication orgin, and carrier can comprise or not comprise " mark " or " selectable mark " in addition, can differentiate and select described carrier by these marks.Any selectable mark all can use, be used for recombinant vectors select be labeled as known in the artly, rely on host cell and select suitable selectable mark.The example that coding is given the proteinic selectable mark of microbiotic or other toxin resistance includes but not limited to penbritin, methotrexate, tsiklomitsin, Xin Meisu (Southern et al., J., J Mol ApplGenet.1982; 327-41 (1982)), mycophenolic acid (Mulligan et al., Science 209:1422-7 (1980)), tetracycline, zeomycin, Totomycin (Sugden et al., Mol CellBiol.5 (2): 410-3 (1985)) and G418 1 (4):.Known as those skilled in the art, the expression vector typical case comprises a replication orgin of suitable encoding sequence of being expressed, promotor and ribosome bind site, RNA splice site, polyadenylation site and the transcription termination sequence that the sequence of being expressed with encoding sequence or quilt operably is connected.

The just operably connection of the dna sequence dna that typically cannot not connect of separation or discovery under state of nature of " reorganization " carrier or other dna sequence dna with handling.When expressing and/or control sequence when regulating transcribing and translating of nucleotide sequence (suitably time), this adjusting (expressing and/or control) sequence operably is connected with nucleic acid coding sequence.Therefore, expression and/or control sequence can comprise the 5 ' initiator codon (being ATG) of promotor, enhanser, transcription terminator, encoding sequence, the splicing signal and the terminator codon of intron.

Known adenoviral gene treatment carrier is showed strong transient expression ability, splendid tire and body in the ability (Hitt et al., Adv in Virus Res 55:479-505,2000) of transduction differentiation and undifferentiated cell.Reorganization Ad carrier of the present invention comprises: (1) makes vector integration go into the packaging site in the replication defective Ad virosome; (2) encoding sequence of interested two or more protein or polypeptide; Reach the sequence that (3) are only encoded and self processed cleavage site or make up other proteolysis cleavage site.Be integrated into the infectious virus body essential or auxiliary other element comprise 5 ' and 3 ' Ad ITR, raq gene, part E4 gene and optional E3 gene.

The capsulation of replication defective Ad virosome and reorganization Ad carrier of the present invention produces by standard technique known in the art, uses Ad packing cell and packing technique to carry out.The example of these methods is found in for example U.S. Patent No. 5,872, and 005 is described.Interested two or more polypeptide or proteinic encoding sequence are inserted in the adenovirus in disappearance viral genome E3 zone usually.Preferred practice adenovirus carrier of the present invention is not expressed one or more wild-type Ad gene product, for example E1a, E1b, E2, E3 and E4.Embodiment preferred is a virosome, and it typically uses with package cell line, the function of described package cell line complementary E1, E2A, E4 and optional E3 gene region.See for example U.S. Patent No. 5,872,005,5,994,106,6,133,028 and 6,127,175 is described.Therefore, as used herein, term " adenovirus " and " adenovirus particles " are meant self or derivatives thereof of virus except particularly pointing out, and covered all serotypes and hypotype and natural generation with two kinds of forms of reorganization.This adenovirus can be wild-type or modify in multiple mode known in the art or as herein described.This modification comprises the adenoviral gene group is packaged in the particle to produce the modification of infectious virus.This modification comprises disappearance known in the art, as lacks one or more E1a, E1b, E2a, E2b, E3 or E4 coding region.The packing of example and produce cell-derived from 293, A549 or HeLa cell.Use standard technique purifying known in the art and preparation adenovirus carrier.

Adeno associated virus (AAV) is a kind of human parvovirus that depends on helper virus, and it can be by chromosomal integration and cells infected potentially.Because it can be integrated in the karyomit(e) and non-pathogenic character, AAV has important potentiality in as people's gene treatment carrier.In order to be used to put into practice the present invention, use standard method well known by persons skilled in the art to produce and structure rAAV virosome, it comprises that (as the composition that operably connects with transcriptional orientation) comprises the control sequence and the interested encoding sequence of transcription initiation and terminator sequence thus.More particularly, reorganization of the present invention AAV carrier comprises: (1) one can make vector integration go into packaging site in the replication defective AAV virosome; (2) encoding sequence of interested two or more protein or polypeptide; (3) sequence of only encoding and self processing cleavage site or making up other proteolysis cleavage site.Be used to put into practice AAV carrier of the present invention and be fabricated, it comprises that also (composition that operably connects with transcriptional orientation) comprises the control sequence of transcription initiation and terminator sequence thus.These compositions are functional AAV ITR sequences in 5 ' and 3 ' terminal both sides." functional AAV ITR sequence " is meant that the ITR sequence has redemption, duplicates and pack the function of AAV virosome.

Recombinant protein interested that the AAV carrier feature of recombinating is that also it can instruct selection or polypeptide are expressed in target cell and are produced.Therefore, recombinant vectors comprises the essential AAV sequence of all capsulations at least and infects the physical structure of reorganization AAV (rAAV) virosome.Therefore, the AAV ITR that is used for carrier of the present invention do not need to have the wild-type nucleotide sequence (Kotin for example, Hum.Gene Ther., 5:793-801,1994 is described), can insert, lack or replace by Nucleotide and change, perhaps AAV ITR can be derived from some AAV serotype.Usually, the AAV carrier is the carrier derived from adeno associated virus serotype, includes but not limited to AAV-1, AAV-2, AAV-3, AAV4, AAV-5, AAV-6, AAV-7, AAV-8 or the like.The wild-type REP and the cap gene of the preferred all or part of disappearance of rAAV expression vector, but still reservation function flank ITR sequence.

Typically, the AAV expression vector import is produced in the cell, imported AAV assisting building body subsequently, described assisting building body comprises can express in producing cell and the AAV coding region of the complementary AAV subsidiary function that lacks in the AAV expression vector.As used herein, term " AAV subsidiary function " is meant the AAV viral function of AAV coding region to lack in the complementary rAAV carrier that can express in host cell.Typically, the AAV subsidiary function comprises AAVrep coding region and AAV cap coding region.The assisting building body can be designed as the expression of the big Rep albumen (Rep78 and Rep68) of downward modulation, typically makes up by will the initiator codon after p5 sporting ACG by ATG, and as U.S. Patent No. 6,548,286 is described.

The AAV expression vector is imported typical helper virus and/or the other carrier of importing subsequently in the production cell in producing cell, wherein said helper virus and/or other carrier provide the auxiliary function that can support the generation of effective rAAV virus.

" auxiliary function " is meant that AAV duplicates essential but is not the function that self is provided by the AAV virosome.Therefore, these auxiliary functions and the factor must provide by host cell, virus (for example adenovirus, hsv or vaccinia virus) or by the expression vector of coexpression in same cell.Usually, the E1A of adenovirus and E1B, E2A, E4 and VA coding region are used to provide AAV to duplicate and pack essential auxiliary function (Matsushita et al., GeneTherapy 5:938[1998]).

Cultivate then and produce cell to produce rAAV.These steps use standard method to carry out.The capsulation of replication defective AAV virosome and reorganization AAV carrier of the present invention is to use AAV packing cell and packing technique to be undertaken by standard technique known in the art.The example of these methods is found in for example United States Patent(USP) Nos. 5,436,146,5,753,500,6,040,183,6,093,570 and 6,548, and 286 is described.Other composition packed and method see that (US 2002/0168342) such as Wang is described, and comprise those technology well known by persons skilled in the art.AAV carrier and AAV assisting building body all can be constructed as and contain one or more optional selectable marker gene.Authorize antibiotics resistance or be known in the art the selectable marker gene of suitable selective medium susceptibility.

Term " AAV virosome " is meant a kind of complete virion, as " wild-type " (wt) AAV virion (comprising and AAV capsid protein shell bonded linearity, strand AAV nucleic acid gene group).On the contrary, " reorganization AAV virosome " and " rAAV virosome " are meant the infectious viral particle that contains interested allogeneic dna sequence in AAV ITR both sides.

In putting into practice the present invention, the host cell that produces the rAAV virosome comprises mammalian cell, insect cell, microorganism and yeast.Host cell also can be a packing cell, and wherein AAV rep and cap stable gene remain on host cell or produce in the cell, and wherein AAV vector gene group is stabilized and keeps and packing.The packing of example and produce cell-derived from 293, A549 or HeLa cell.Use standard technique purifying known in the art and preparation AAV carrier.

Retroviral vector also is a kind of common tool (Miller, Nature357:455-460,1992) that gene is carried.Retroviral vector reaches more particularly, and lentiviral vectors can be used for implementing the present invention.Therefore, term used herein " retrovirus " or " retroviral vector " are meant respectively and comprise " slow virus " and " lentiviral vectors ".Retroviral vector is tested and finds that it is with the stable suitable transport agent that imports in the extensive target cell genome of gene of interest.The ability that single copy transgenosis that retroviral vector will not reset is delivered in the cell makes retroviral vector very be fit to transgenosis is advanced in the cell.In addition, retrovirus enters host cell by retrovirus envelope glycoprotein with combining of specific cell surface receptor on the host cell.Therefore, also can find the purposes of pseudo-type retrovirus vector in putting into practice the present invention, the natural envelope protein of encoding in the described pseudo-type retrovirus vector is replaced by a kind of allos envelope protein, this allos envelope protein has the cell-specific different with natural envelope protein (for example comparing with natural envelope protein, in conjunction with different cell surface receptors).The retroviral vector of one or more target protein encoding sequence of guidance coding is delivered to the ability of specific target cell and puts into practice required for the present invention.

The invention provides retroviral vector, it comprises retrovirus transfer vector that for example comprises one or more transgenic sequence and the retrovirus package carrier that comprises one or more packing element.Especially, the invention provides the pseudo-type retrovirus vector of envelope protein of coding allos or functionalized modification to produce pseudotyped retroviral virus.

The core sequence of retroviral vector of the present invention can be easy to derived from numerous retrovirus, comprise for example B, C and D type retrovirus and foamy virus (spumaviruses) and slow virus (RNA Tumor Viruses, Second Edition, ColdSpring Harbor Laboratory, 1985).Be applicable to that the retroviral example in the compositions and methods of the invention includes but not limited to slow virus.Be applicable to that other retrovirus in the compositions and methods of the invention includes but not limited to avian leukosis viruses, bovine leukemia virus, murine leukemia virus, Mink-Cell Focus-Inducing Virus, murine sarcoma virus, reticuloendotheliosis virus and Rous sarcoma virus.Preferred muroid leukemia virus comprises 4070A and 1504A (Hartley and Rowe, J.Virol.19:19-25,1976), Abelson (ATCC No.VR-999), Friend (ATCC No.VR-245), Graffi, Gross (ATCCNo.VR-590), Kirsten, Harvey sarcoma virus and Rauscher (ATCC No.VR-998) and Moloney muroid leukemia virus (ATCC No.VR-190).This retrovirus can be easy to American type culture collection (ATCC freely; Rockville, preservation thing Md.) perhaps uses common technology to separate from known source.

Preferably, retroviral vector sequence of the present invention is derived from slow virus.Preferred slow virus is the human immunodeficiency virus, for example 1 type or 2 types (be HIV-1 or HIV-2, wherein HIV-1 was known as lymphadenopathy associated virus 3 (HTLV-III) and acquired immune deficiency syndrome (AIDS) (AIDS) correlated virus (ARV) originally) or relevant with HIV-1 or HIV-2 modified and with the another kind of virus of AIDS or AIDS sample disease-related.Other slow virus comprises sheep Visna/maedi virus, feline immunodeficiency virus (FIV), ox slow virus, simian immunodeficiency virus (SIV), equine infectious anaemia virus (EIAV) and caprine arthritis-encephalitis virus (CAEV).

Be applicable to that retroviral a plurality of kinds in the compositions and methods of the invention and strain are known in the artly (to see for example Fields Virology, Third Edition, edited by B.N.Fields et al., Lippincott-Raven Publishers (1996), see for example Chapter 58, Retroviridae:The Viruses and Their Replication, Classification, pages1768-1771).

Packaging system of the present invention comprises at least two package carriers, first package carrier comprises first nucleotide sequence, this sequence comprises gag, pol or gag and pol gene, second package carrier comprises second nucleotide sequence, and this sequence comprises the env gene of allos or functionalized modification.In a preferred embodiment, the retrovirus element is derived from slow virus, as HIV.Preferably, described carrier lacks functional tat gene and/or function auxiliary gene (vif, vpr, vpu, vpx, nef).In a preferred embodiment, described system further comprises the 3rd package carrier, and it comprises a nucleotide sequence, and this sequence comprises the rev gene.Described packaging system can contain first, second packing cell form that reaches optional the 3rd nucleotide sequence provides.

The present invention is applicable to many systems, and those skilled in the art recognize not the total common element of retrovirus on the same group.The present invention uses the slow virus system as representative example.Yet all retrovirus all present the feature of enveloped virus body, have protrusion of surface, contain a linear sense single stranded rna molecule, and the genome by dimer is formed reaches total protein gag, pol and env.

Slow virus presents some total structural virosome albumen, comprises envelope glycoprotein SU (gp120) and TM (gp41), and it is by the env genes encoding; CA (p24), MA (p17) and NC (p7-11), it has the gag genes encoding; Reach RT, PR and IN by the pol genes encoding.HIV-1 and HIV-2 contain auxiliary protein and other protein of participate in regulating viral RNA synthetic and processing and other copy function.Auxiliary protein by vif, vpr, vpu/vpx and nef genes encoding can omit (perhaps inactivation) in recombination system.In addition, tat and rev can for example omit or inactivation by sudden change or disappearance.

First-generation lentiviral vectors packaging system provides the independent packing construct at gag/pol and env, for security reasons and the envelope protein matter of typically used allos or functionalized modification.In s-generation slow virus carrier system, auxiliary gene vif, vpr, vpu and nef are lacked or inactivation.Preferred third generation slow virus carrier system is used to put into practice the present invention, comprises wherein that the tat gene has lacked or those slow virus carrier systems of inactivation (for example by sudden change) in addition.

The transcriptional regulatory that compensation is provided by tat usually can provide by using strong constitutive promoter, as early stage immediately (HCMV-IE) enhancers/promoters of human cytomegalic inclusion disease virus.Other promotor/enhanser can be based on the constitutive promoter activity intensity, cross the other factors of expression and select for the specificity of target tissue or about required control, and these are known in the art.For example in some embodiments, can use a kind of inducible promoter such as tet and realize the control expression.The gene of coding rev preferably provides on independent expression construct, and typical thus third generation slow virus carrier system will comprise four plasmid: gagpol, rev, coating and transfer vectors.Which no matter is used for packaging system, gag and pol all can provide on the construct or on the independent construct.

Typically, package carrier is included in the packing cell, and by transfection, transduction or infection in the transfered cell.The method of carrying out transfection, transduction or infection is well known to those skilled in the art.Retrovirus of the present invention/lentivirus transfer carrier can import in the package cell line by transfection, transduction or infection, produces cell or clone to produce.

Package carrier of the present invention can import in people's cell or the clone by standard method, is for example undertaken by calcium phosphate transfection, lipofection or electroporation.In some embodiments, but package carrier in a kind of dominance selective marker transfered cell, described mark such as neo, DHFR, Gin synthetic enzyme or ADA select and separating clone existing under the condition of suitable drug subsequently.But selectable marker gene can with the gene physical connection of package carrier coding.

Known wherein packaging function is designed to the stable cell lines by suitable packing cell expression.See the U.S. Patent No. 5,686,279 of for example describing packing cell, and Ory et al., Proc.Natl.Acad.Sci. (1996) 93:11400-11406 is described.Be found in Dull et al. about producing further describing of stable cell lines, 1998, J.Virology 72 (11): 8463-8471; And Zufferey et al., 1998, J.Virology 72 (12): 9873-9880.

Zufferey et al., 1997, Nature Biotechnology 15:871-875 has instructed a kind of slow virus packaging plasmid, comprising the 3 ' sequence deletion of the pol of HIV-1 env gene.This construct contains tat and rev sequence, and 3 ' LTR is replaced by the polyA sequence.5 ' LTR and psi sequence are by another kind of promoter replacement, as being replaced by inducible promoter.For example, can use CMV promotor or derivatives thereof.

Preferred package carrier can contain other packaging function and change, to strengthen the slow virus protein expression and to increase security.For example, all HIV sequences of gag upstream all can be removed.Equally, the downstream sequence of coating also can be removed.In addition, can adopt the modification carrier to strengthen RNA montage and steps of translating.

Randomly, the working conditions packaging system, as Dull et al., J.Virology 72 (11): 8463-8471,1998 packaging systems of describing.Also preferably use self inactivation carrier (SIN), the biological safety of improved carrier by disappearance HIV-1 long terminal repetition (LTR), Zufferey et al. for example, 1998, J.Virology 72 (12): 9873-9880 is described.Also can use the induction type carrier, as tet induction type LTR.

Hsv (HSV) produces extensive interest in the treatment nervous system disorders owing to its neurocyte tropism, but this carrier also can be used for other tissue in its extensive host range.Another factor that makes HSV become a kind of noticeable carrier is genomic size and group structure.Because HSV is bigger, therefore compares and mix a plurality of genes or expression cassette easily with other less viral system.In addition, compare with other system, the operability with different virus control sequence of different performance (time, intensity or the like) can be controlled it and is expressed to higher degree.Another advantage is that this virus has few relatively montage information, further is easy to genetic manipulation.

HSV is easy to handle relatively, and can grow to height and tire.Therefore, reach the volume of enough MOI and reduce to need repeat at needs and carry all to be out of question aspect the feed.See that as the summary of gene therapy vector Glorioso et al. (1995) is described about HSV.Those skilled in the art know the technology of HSV as carrier of using.

Vaccinia virus vector is widespread use, because it is easy to make up, obtain high-caliber relatively expression, host range and carry the large vol of DNA widely.Vaccinia virus contains the linear dsdna genome of an about 186kb, presents tangible A-T preference.Have the oppositely terminal repetition of about 10.5kb in the genome both sides.Most of indispensable genes seem to map in the central section, and it is that topnotch is conservative in poxvirus.Estimate that the open reading frame number is 150-200 in the vaccinia virus.Although these two chains all are coding strands, not frame extensive overlapping uncommon.

Other virus vector can be used as construct in the present invention.For example, can use derived from the carrier of virus as poxvirus.(Venezuelan equineencephalitis, VEE) Bing Du molecular cloning strain heredity is improved to and duplicates the competence vaccine carrier with expressing heterologous virus protein (Davis et al., 1996) Venezuelan equine encephalitis virus.Studies show that VEE infects the strong CTL of stimulation and replys, perhaps prompting VEE is an exceedingly useful carrier (Caley et al., 1997) that carries out immunity.The present invention expects that VEE virus can be used for the target dendritic cell.

Polynucleotide can be included in the virus vector of through engineering approaches expression specificity binding partner.Therefore this virion flows to cell with specificity in conjunction with the isoreceptor (cognatereceptor) of target cell and with content.Based on adding the lactose residue and retrovirus is carried out chemically modified, disclosed a kind of novel method that designs selectively targeted retroviral vector by chemistry in virus envelope protein.This modification can the specific infection liver cell by asialoglycoprotein receptor.

The another kind of method of design target recombinant retrovirus is wherein used at retroviral envelope protein and at the biotinylated antibody of specific cell acceptor.Use streptavidin by vitamin H composition coupling antibody (Roux et al., 1989).Use shows the somatic infection of various human (Roux et al., 1989) that has close those surface antigens of preferendum virus external at major histocompatibility complex I and the antigenic antibody of II class.

Be used to put into practice any carrier of the present invention and include the allos control sequence, as constitutive promoter, for example cytomegalovirus (CMV) immediate early promoter, RSV LTR, MoMLV LTR and PGK promotor; Tissue or cell type specificity promotor, comprise mTTR, TK, HBV, hAAT, can adjusting or inducible promoter, enhanser or the like.Preferred promotor comprises LSP promotor (III et al., Blood Coagul.Fibrinolysis 8S2:23-30,1997), EF1-α promotor (Kim et al., Gene 91 (2): 217-23,1990) and Guo et al., Gene Ther.3 (9): 802-10,1996).Most preferred promotor comprises that EF-1-α (elongation factor 1-alpha, EF1 α) promotor, phosphoglyceric kinase-1 (PGK) promotor, cytomegalovirus immediate early gene (CMV) promotor, chimeric liver specificity promotor (LSP), cytomegalovirus enhanser/chicken β Actin muscle (CAG) promotor, tsiklomitsin reply promotor (TRE), transthyretin promotor (TTR), simian virus 40 (SV40) promotor and CK6 promotor.The sequence of these and numerous other promotor is known in the art.Correlated series can be easy to derive from public database, and mixes in the carrier to be used to put into practice the present invention.

The present invention comprises that also gene regulatory system is to control the expression of two or more polypeptide of interest or proteinic encoding sequence.Gene regulatory system is used to regulate specific one or more expression of gene.In one approach, gene regulatory system or switch comprise a kind of chimeric transcription factor, and it has ligand binding domains, transcriptional activation domain and DNA binding domains.Described structural domain can derive from any source and can be combined in any way to obtain new protein.Adjustable genic system also comprises a DNA response element, and itself and chimeric transcription factor interact.This element is positioned at the vicinity of the gene that is conditioned.

Can be used for putting into practice example gene regulatory system of the present invention and comprise fruit bat moulting hormone system (Yao et al., Proc.Nat.Acad.Sci., 93:3346 (1996)); Silkworm moulting hormone system (Suhret al., Proc.Nat.Acad.Sci., 95:7999 (1998)); Valentis GeneSwitch.RTM. synthetic PgR system, it uses RU486 as inductor (Osterwalder et al., Proc Natl Acad Sci 98 (22): 12596-601 (2001)); Tet.TM.﹠amp; RevTet.TM. system (BD Biosciences Clontech), its use small molecules such as tsiklomitsin (Tc) or analogue for example doxycycline regulate (the Knott et al. that transcribes of (begin or close) target, Biotechniques 32 (4): 796,798,800 (2002)); The ARIAD regulation technology, based on using small molecules to make that molecule combines in two cells, each molecule is all with transcriptional activator or DNA is conjugated protein is connected.When these compositions gather together, activate transcribing of gene of interest.Ariad has two main systems: a system is based on homodimerization, and a system is based on heterodimerization (Rivera et al., Nature Med, 2 (9): 1028-1032 (1996); Ye et al., Science 283:88-91 (2000)), each system all can mix in the carrier of the present invention.

Being used to put into practice preferred gene regulation system of the present invention is ARIAD regulation technology and Tet.TM.﹠amp; RevTet.TM. system.

C. non-virus carrier

The invention still further relates to expression vector is shifted some non-viral methods in the cell into.These methods comprise calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen andOkayama, 1987; Rippe et al., 1990), DEAE-dextran (Gopal, 1985), electroporation (Tur-Kaspa et al., 1986; Potter et al., 1984), liposome (Nicolau and Sene, 1982 of direct microinjection (Harlandand Weintraub, 1985), load DNA; Fraley et al., 1979) and lipofectamine-DNA mixture, ultrasonic (the Fechheimeret al. of cell, 1987), use high speed particle to carry out gene bombardment (Yang et al., 1990), polycation (Bousssif et al., 1995) and receptor-mediated transfection (Wu and Wu, 1987; Wu andWu, 1988).These technology have some can successfully be applicable in the body or exsomatize and use.Those skilled in the art know the technology of using about non-virus carrier, and understand the non-virus carrier that other type except those carriers that disclose has been contained in the present invention.

In another embodiment of the invention, expression cassette can wrap in liposome or lipid formulations and carry (entrap).Liposome is the vesica shape structure that is characterised in that phospholipid bilayer film and inner aqueous phase substrate.Multilamellar liposome has by the isolating a plurality of lipid layers of aqueous phase substrate.When being suspended in the excessive aqueous solution, phosphatide forms naturally.Lipid composition experience self before closed structure forms is reset and Bao Zaishui and dissolved solute (Ghosh andBachhawat, 1991) between double-layer of lipoid.The present invention has also been contained a kind of and Lipofectamine (Gibco BRL) compound gene construct.Those skilled in the art know the technology of utilizing liposome and lipid formulations.

Non-virus formulation based on lipid provides another kind of adenoviral gene methods of treatment.Although it is many cell culture studies have confirmed to shift based on the non-viral gene of lipid, limited by systemic gene conveying based on the preparation of lipid.Gene based on non-viral lipid is carried the toxicity that mainly is subject to the cation lipid that comprises non-viral delivery vehicles.The toxicity in vivo of liposome has partly illustrated the difference between external and the vivo gene transfer result.Another factor owing to this contradiction data is the difference of liposome stability in the situation that has and do not exist serum protein.The stability features of the interaction partners liposome between liposome and the serum protein has remarkably influenced (Yang and Huang, 1997).Cationic-liposome attracts and in conjunction with the serum protein of negative charge.By the liposome dissolving of serum protein bag quilt or by macrophage phagocytic it is removed from blood circulation.At present body lipid body carrying method uses subcutaneous, intracutaneous or intracranial injection method, to avoid toxicity and the stability problem relevant with cation lipid in the blood circulation.The interaction of liposome and plasma proteins is to cause external (Felgneret al., 1987) and vivo gene transfer (Zhu et al., 1993; Solodin et al., 1995; Thierry et al., 1995; Tsukamoto et al., 1995; Aksentijevich et al., 1996) render a service between inconsistent reason.

The generation of lipid formulations is usually by carrying out ultrasonic or continuously extruded the realization to the liposome mixture after as the next stage: (I) anti-phase evaporation (II) dehydration-rehydration (III) detergent dialysis and (IV) film hydration.In case produce, lipid conformation can be used for toxicity in the blood circulation (chemotherapeutics) or unstable compound (nucleic acid) capsulation.Liposomes encloseization makes that the toxicity of this compound reduces and serum half-life is grown (Gabizon et al., 1990).The treatment of numerous disease is to use the gene transfer strategies based on lipid, to strengthen conventional treatments or to set up new methods of treatment, particularly treats excess proliferative disease.

D. the nucleic acid construct that comprises protein or polypeptid coding sequence is delivered to cell

The applicable vector construction body of the present invention can external, exsomatize or in vivo in the transfered cell in external or body, producing recombinant polypeptide by cell (for example somatocyte) expression in vivo allogeneic coding sequence or by the cell of carrier transduction, described vector construction body comprises the nucleotide sequence of coding heterologous protein or polypeptide and the sequence of the other proteolysis cleavage site of self processing cleavage site or assembly coding only.

Can use standard method known in the art with vector construction body of the present invention in external or stripped transfered cell.This technology comprises the transfection of using calcium phosphate, (Capecchi in the cultured cells is advanced in microinjection, Cell 22:479-488 (1980)), electroporation (Shigekawaet al., BioTechn., 6:742-751 (1988)), liposome-mediated transgenosis (Manninoet al., BioTechn., 6:682-690 (1988)), lipid mediated by protein transduction (Felgner et al., Proc.Natl.Acad.Sci.USA 84:7413-7417 (1987)) and use high speed particle bombardment carrying out nucleic acid to carry (Klein et al., Nature 327:70-73 (1987)).

For external or stripped expression, can use any cell of effective expression functional protein.The many cell of protein expression and examples of clone of being used for known in the art.For example, prokaryotic cell prokaryocyte and insect cell can be used for expressing.In addition, can use eukaryotic microorganisms, as yeast.Recombinant protein being expressed as in prokaryotic cell prokaryocyte, insect and Yeast system is known in the art, and goes for using the protein or the expression of polypeptides of the compositions and methods of the invention.

The example of the host cell that is used to express further comprises mammalian cell, as inoblast, non-human mammal cell such as sheep, pig, mouse and ox cell, insect cell or the like.The special example of mammalian cell comprises COS cell, VERO cell, HeLa cell, Chinese hamster ovary (CHO) cell, 293 cells, NSO cell, 3T3 inoblast, W138 cell, bhk cell, HEPG2 cell, DUX cell and mdck cell.

Host cell is cultivated in modified conventional nutritional medium, and described modification is to carry out at the gene that is fit to evoked promoter, selection transformant or the required sequence of amplification coding.Mammalian host cell can be cultivated in multiple substratum.Commercially available substratum such as Ham ' s F10 (Sigma), Minimal Essential Medium (MEM), Sigma), (DMEM, Sigma) typical case is suitable for cultivating host cell for RPMI1640 (Sigma) and Dulbecco ' s Modified Eagle ' s Medium.Given substratum is added hormone and/or other somatomedin (as Regular Insulin, transferrin or epidermal growth factor), salt (as sodium-chlor, calcium, magnesium and phosphoric acid salt), damping fluid (as HEPES), nucleosides (as adenosine and thymidine), microbiotic, trace element and glucose or energy source of equal value usually as required.Also can comprise proper concn any other must fill-in, these are that those skilled in the art are known.Appropriate incubation condition such as temperature, pH etc. for special cells system are known in the art, see the ATCC catalogue that for example can obtain at http://www.atcc.org/SearchCatalogs/AllCollections.cfm on the net about the suggestion culture condition of various kinds of cell system.

Carrier of the present invention can be in vivo gives (for example in intracutaneous, intravenously, the tumour, in the brain, in the portal vein, intraperitoneal, intramuscular, intravesical or the like) by number of ways, to carry a plurality of genes that connect by self processing cutting sequence to express two or more protein or polypeptide in animal model or human object.According to giving approach, therapeutic protein is brought into play its part (for example in brain or bladder) or whole body (other gives approach) effect.Use 5 ' tissue-specific promoter of the open reading frame of protein or polypeptide to can be used for feasible two or more protein or polypeptide tissue specific expression in the carrier of the present invention by this vector encoded.

With carry genetically modified recombinant vectors external, exsomatize or body in import that several different methods in the target cell has formerly been described and for known in the art.The invention provides by methods of treatment, vaccine and cancer treatment method with recombinant vectors transduction target cell of the present invention.

For example, carry in vivo recombinant vectors of the present invention can target in multiple organ type, include but not limited to brain, liver, blood vessel, muscle, the heart, lung and skin.

In ex vivo gene transfer, use recombinant vectors of the present invention and method well known in the art from the host, to obtain target cell and in the laboratory, carry out genetic modification.

Recombinant vectors of the present invention can use routine to give pattern and give, and includes but not limited to above-mentioned pattern.Recombinant vectors of the present invention can several formulations provide, but as the solution of liquor and suspension, microvesicle, liposome and injectable or infusion.Preferred form depends on the pattern of giving and treatment is used.Suitable transport way can use the common available knowledge of those skilled in the art really easily fixed.

The use of recognizing construction of recombinant vector body of the present invention produces numerous advantages in recombinant protein and the polypeptide in vivo and comprises that to give single carrier can be the patient medium-term and long-term and express two or multiple recombinant protein or polypeptide ORF constantly; Express two or multiple recombinant protein or polypeptide ORF in vivo with biologic activity; And the recombinant protein that in human body cell, produces or the natural posttranslational modification of polypeptide.

A preferred aspect is to use construction of recombinant vector body of the present invention at external generation recombinant protein and polypeptide.The method that produces recombinant protein is known in the art, uses this standard method can utilize the vector construction body surface of self processing cleavage site that contains of the present invention to reach recombinant protein and polypeptide.

In one aspect of the invention, carrier imported or give cell (transfection), undertaken by following one or more step:

(1) cultivates cells transfected under certain condition to select to express the cell of recombinant protein or polypeptide;

(2) described recombinant protein of assessment or polypeptide expression; And

(3) collect described recombinant protein or polypeptide.

The retrovirus of above-mentioned retroviral plasmid vector of therefrom can deriving includes but not limited to Moloney muroid leukemia virus, spleen necrosis virus, retrovirus such as Rous sarcoma virus, Harvey sarcoma virus, bird leukemia virus, ape leukemia virus, human immunodeficiency virus, adenovirus, myeloproliferative sarcoma virus and mammary tumour virus.In one embodiment, described retroviral plasmid vector is derived from Moloney muroid leukemia virus.

Described carrier comprises one or more promotor.Utilizable suitable promotor includes but not limited to retrovirus LTR, SV40 promotor, Miller, et al., Biotechniques, Vol.7, No.9, the described human cytomegalic inclusion disease virus of 980-990 (1989) (CMV) promotor, perhaps any other promotor (for example cell promotor such as eukaryotic cell promotor include but not limited to histone, pol III and beta-actin promotor).Adaptable other viral promotors includes but not limited to adenovirus promoter, thymidine kinase (TK) promotor and B19 parvovirus promotor.According to this paper instruction, those skilled in the art obviously can select suitable promotor.

The nucleotide sequence of code book invention polypeptide is under the control of suitable promotor.Adaptable suitable promotor includes but not limited to adenovirus promoter, as adenovirus major late promoter; Perhaps allogeneic promoter such as cytomegalovirus (CMV) promotor; Respiratory syncytial virus (RSV) promotor; Inducible promoter such as MMT promotor, metallothionein promoter; Heat-inducible promoter; Albumin promoter; The ApoAI promotor; The human immunoglobulin promotor; Viral thymidine kinase promoter is as the herpes simplex virus thymidine kinase promotor; Retrovirus LTR (the retrovirus LTR that comprises above-mentioned modification); The beta-actin promotor; With the human growth hormone promotor.Promotor also can be the natural promoter of the gene of control coding said polypeptide.

Use retroviral plasmid vector transduction package cell line to form production clone.The example of packing cell that can transfection includes but not limited to PE501, PA317, Ψ-2, Ψ-AM, PA12, T19-14X, VT-19-17-H2, Ψ CRE, Ψ CRIP, GP+E-86, GP+envAml2 and DAN clone, as Miller, Human Gene Therapy, Vol.1, pgs.5-14 (1990) is described, and it incorporates reference in full into.Described carrier can be by any method transduction packing cell known in the art.This method includes but not limited to electroporation, uses liposome and CaPO ₄Precipitation.Perhaps, retroviral plasmid vector can be in liposome capsulation, perhaps, give the host then with the lipid coupling.

Described production clone produces infectious retroviral vector particle, and it comprises the nucleotide sequence of coding said polypeptide.This retroviral vector particle is used in external or the interior transduction of body eukaryotic cell then.The eukaryotic cell of transduction will be expressed the nucleotide sequence of coding said polypeptide.The eukaryotic cell that can be transduceed includes but not limited to embryonic stem cell, embryo cancer cells and hemopoietic stem cell, liver cell, inoblast, sarcoplast, keratinocyte, endotheliocyte and bronchial epithelial cell.

IV. the host cell that contains the coding nucleic acid molecule that external source provides

The present invention further provides nucleic acid molecule transformed host cells with coding kidney zymoprotein.Described host cell can be prokaryotic cell prokaryocyte or eukaryotic cell.It is unrestricted to be used to express the proteinic eukaryotic cell of the present invention, as long as this clone is compatible with cell culture processes and compatible with the expression of the propagation of expression vector and gene product.Preferred eukaryotic host cell includes but not limited to yeast, insect and mammalian cell, preferred vertebrate cells such as mouse, rat, monkey or human cell line, and the clone of other infinite multiplication.Preferred eukaryotic host cell comprises and derives from the Chinese hamster ovary that the ATCC registration number is CCL61 (CHO) cell, deriving from the ATCC registration number is the NIH Switzerland mouse embryo cell NIH/3T3 of CRL 1658, the clone of baby hamster kidney cell eucaryon tissue culture cellss such as (BHK) system and other infinite multiplication.

Any prokaryotic cell prokaryocyte host all can be used for expressing code book and invents proteinic rDNA molecule.Preferred prokaryotic cell prokaryocyte host is intestinal bacteria (E.coli).

Transform suitable cell host by well-known process with rDNA molecule of the present invention, employed method typical case depends on the type of used carrier and host system.Conversion about prokaryotic host cell, typically used electroporation and salt processing method, see for example Cohen et al., Proc.Natl.Acad.Sci.USA 69:2110,1972 and Maniatis et al., Molecular Cloning, ALaboratory Mammal, Cold Spring Harbor Laboratory, Cold SpringHarbor, NY (1982) is described.About transforming vertebrate cells with the carrier that contains rDNA, typically used electroporation, cation lipid or salt processing method are seen for example Graham et al., Virol.52:456,1973; Wigler et al., Proc.Natl.Acad.Sci.USA 76:1373-76,1979 is described.

The success cell transformed promptly contains the cell of rDNA molecule of the present invention, can differentiate by the technology of knowing, and comprise and select selectable mark.For example, can clone the cell that imported rDNA of the present invention and obtained to produce single colony.Cell to these colonies can be gathered in the crops, cracking and detect its dna content according to the situation that exists of rDNA, use as Southern, J.Mol.Biol.98:503,1975 or Berent et al., Biotech.3:208,1985 described methods are carried out, and perhaps analyze the protein that this cell produces by immunological method.

V. antisense molecule, ribozyme and RNA interfering

The present invention further comprises a kind of reconstitution cell that comprises antisense nucleic acid, and this cell is to illustrate the useful model that the kidney enzyme acts in cell processes.Be the kidney enzyme at the blood vessel of air bag damage, particularly the expression level increase shows that the kidney enzyme participates in reinventing with feminine gender the relevant cell proliferation of (negativeremodeling) and arterial restenosis in its adventitia.Therefore, comprise with the complementation of kidney enzyme but a kind of useful tool of the methods of treatment of the effect that the transgenic cell of the antisense nucleic acid of antisense orientation is research kidney enzyme mechanism and the effect in cell thereof and discriminating improves the kidney expression of enzymes.

Those skilled in the art can recognize based on announcement provided by the invention and the nucleic acid complementary antisense nucleic acid of coding kidney enzyme can be used for transfectional cell, and study this cell and effectively treat and diagnostic method in order to the function and the discriminating of research kidney enzyme with the work that definite kidney expression of enzymes changes.

Further, expression and/or the active method of reduction kidney enzyme in cell can be the increase of kidney expression of enzymes, the level of kidney zymoprotein in cell increases or the kidney zymoprotein level of emiocytosis increases and/or the increase of kidney enzymic activity mediates or associated disease, obstacle or pathology provides effective diagnosis and/or methods of treatment.

Those skilled in the art recognize that a kind of mode that reduces cell middle kidney enzyme mRNA and/or protein level is to suppress this proteinic expression of nucleic acids of coding.The expression of kidney enzyme can be used for example antisense molecule inhibition, also can suppress by using ribozyme or double-stranded RNA, and for example Wianny and Kernicka-Goetz (2000, Nature Cell Biol.2:70-75) describes.

It is a kind of phenomenon that RNA disturbs (RNAi), and wherein double-stranded RNA (dsRNA) imports the degraded that causes complementary mRNA in inhomogeneous organism and the cell type.In cell, long dsRNA is cut into the siRNA (siRNA) of a short 21-25 Nucleotide by the rnase that is called Dicer.SiRNA and protein component are assembled into the reticent mixture of RNA inductive (RNA-induced silencing complex RISC), untwist in this process subsequently.Interact by the base pairing between siRNA antisense strand and the mRNA then, activated RISC combines with complementary transcript.Bonded mRNA is cut, and the sequence-specific degraded of mRNA causes gene silencing.See for example U.S. Patent No. 6,506,559; Fire et al., Nature (1998) 391 (19): 306-311; Timmons et al., Nature (1998) 395:854; Montgomery et al., TIG (1998) 14 (7): 255-258; David R.Engelke, Ed., RNA Interference (RNAi) Nuts ﹠amp; Bolts of RNAi Technology, DNAPress (2003); And Gregory J.Hannon, Ed., RNAi A Guide to GeneSilencing, Cold Spring Harbor Laboratory Press (2003) describes.Therefore, the present invention also comprises by using the RNAi technology to make the method for the gene silencing of coding kidney enzyme.

Antisense molecule and being applied as in inhibition of gene expression thereof (see for example Cohen, 1989, In:Oligodeoxyribonucleotides, Antisense Inhibitors ofGene Expression, CRC Press) known in the art.Explain that as this paper other places antisense nucleic acid is at least a portion complementary DNA or the RNA molecule (Weintraub, 1990, Scientific American 262:40) with special mRNA molecule.In cell, antisense nucleic acid and corresponding mRNA hybridization form double-stranded molecule, thus the translation of suppressor gene.

Being applied as of the antisense method of suppressor gene translation is known in the art, for example Marcus-Sakura (1988, Anal.Biochem.172:289) describe.This antisense molecule can use the DNA of this antisense molecule of coding to offer cell by genetic expression, instructs as Inoue (1993, U.S. Patent No. 5,190,931).

Perhaps, antisense molecule of the present invention can synthesize generation, offers cell then.Preferably approximately 10-30, the more preferably antisense oligomers of about 15 Nucleotide are because they are easy to synthetic and import in the target cell.The synthetic antisense molecule that the present invention is contained comprises oligonucleotide derivative known in the art, and it is compared the biologic activity with improvement and (sees Cohen, as preceding with the oligonucleotide of unmodified; Tullis, 1991, U.S. Patent No. 5,023,243, described document is incorporated into for referencial use with it in full).

The application of ribozyme and inhibition of gene expression thereof also for known in the art (see for example Cech etal., 1992, J.Biol.Chem.267:17479-17482; Hampel et al., 1989, Biochemistry 28:4929-4933; Eckstein et al., international publication WO 92/07065; Altman et al., U.S. Patent No. 5,168,053, described document is incorporated into for referencial use with it in full).Ribozyme is to have to cut the RNA molecule of the ability of other single stranded RNA with DNA restriction endonuclease similar manner specificity.By the nucleotide sequence of these RNA that encode is modified, molecular engineering can be turned in the identification RNA molecule specificity nucleotide sequence and cut its (Cech, 1988, J.Amer.Med.Assn.260:3030).The major advantage of this method is because it is sequence-specific, therefore only has the mRNA of particular sequence by inactivation.

The ribozyme that two kinds of base types are arranged, i.e. thermophilas type (Hasselhoff, 1988, Nature 334:585) and tup type.Thermophilas type ribozyme identification length is the sequence of four bases, and hammerhead ribozyme identification length is the base sequence of 11-18 base.Sequence is long more, and then the possibility that takes place in said target mrna species only of sequence is just big more.Therefore, for the special preferred hammerhead ribozyme of mRNA species of inactivation but not thermophilas type ribozyme, preferred 18 base recognition sequences but not the short recognition sequence that can in multiple uncorrelated mRNA molecule, take place at random.

The ribozyme that is used for suppressing the kidney expression of enzymes can design by target sequence being mixed basic ribozyme structure, and described target sequence and mRNA sequence complementation by the kidney enzyme of kidney enzyme coding perhaps have about at least 33% homology with SEQ ID NO:1.Preferably, this sequence and SEQID NO:1 have about at least 35%, more preferably 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% and 99% homology most preferably.The ribozyme of target kidney enzyme can use be purchased reagent (Applied Biosystems, Inc., Foster City, CA) synthetic or can genetic expression from its DNA of encoding.

V. reconstitution cell and transgenic nonhuman mammal

The present invention includes a kind of reconstitution cell, it comprises the isolating nucleic acid of coding kidney enzyme, combine the nucleic acid or the like of the antibody of kidney enzyme with its complementary antisense nucleic acid, the specificity of encoding.On the one hand, described reconstitution cell can be with the carrier of the part of the nucleic acid of fgs encoder kidney enzyme (for example plasmid etc.) transient transfection.Described nucleic acid does not need to be integrated in the cellular genome, need not express in cell yet.In addition, described cell can be prokaryotic cell prokaryocyte or eukaryotic cell, the invention is not restricted to any specific clone or cell type.This cell includes but not limited to inoblast, mouse stem cells, Amphibians ovocyte, scleroblast, smooth muscle cell, endotheliocyte or the like.

On the one hand, use the reconstitution cell of the isolating nucleic acid that comprises encoding mammalian kidney enzyme to produce transgenic nonhuman mammal.Be about to exogenous nucleic acid of the present invention or in " transgenosis " transfered cell that this paper is also referred to as, use this cell to produce the non-human transgenic Mammals then.Wherein imported preferably dried (ES) cell of embryo of genetically modified cell.Yet the present invention is non-to only limit to comprise genetically modified ES cell of the present invention, also is not limited to be used to produce the cell of transgenic animal.More properly, transgenic cell of the present invention includes but not limited to derived from any cell that comprises genetically modified transgenic animal, comprise genetically modified cell, and comprise and can be used for or be not useable for producing mammiferous genetically modified any other cell of non-human transgenic derived from the chimaeric animals of transgenosis ES cell.

In addition, be important to note that comprising genetically modified cell is that reconstitution cell should be not limited to produce transgene mammal.More properly, the present invention should be interpreted as comprising the cell of any kind of the nucleic acid that has wherein imported encoding mammalian kidney enzyme, includes but not limited to comprise the prokaryotic cell prokaryocyte and the eukaryotic cell of the isolating nucleic acid of encoding mammalian kidney enzyme.

When cell was eukaryotic cell, described cell can be any eukaryotic cell, and it wherein reaches and obtain benefit when no longer therefrom being expressed by the protein of required genes encoding when transgenosis of the present invention imports.A kind of system that provides can be provided this benefit, and wherein required expression of gene lacks and can study in the laboratory or in the Mammals that described cell exists external; A kind of system also is provided, and the cell that wherein comprises the genetically deficient of importing can be used as research, diagnosis and treatment tool; And a kind of system also is provided, wherein produce animal model and be used for disclosing for comprising for example ESRD and hypertensive new diagnosis and treatment tool in the disease of Mammals through selecting.

Perhaps, the present invention includes a kind of eukaryotic cell, it obtains benefit when transgenosis of the present invention imports when the protein that wherein reaches required genes encoding is therefrom expressed, described protein did not before exist in cell or did not express, perhaps described protein now in cell with level different before importing transgenosis or situation under express.A kind of system that provides can be provided this benefit, and wherein required expression of gene can be studied in the laboratory or in the Mammals that cell exists external; A kind of system also is provided, and the cell that wherein comprises the gene of importing can be used as research, diagnosis and treatment tool; And a kind of system also is provided, wherein produce animal model to be used for disclosing the new diagnosis and the treatment tool of the disease of selecting for Mammals.

The cell of the isolating nucleic acid of this expression coding kidney enzyme can be used for for cell, tissue or whole animal provide the kidney enzyme, and wherein the kidney enzyme of higher level can be used for treating or alleviates and low-level kidney expression of enzymes and/or active relevant disease, obstacle or pathology.This disease, obstacle or pathology include but not limited to ESRD, hypertension, cardiovascular disorder.Therefore, the extra expression of kidney enzyme can make blood pressure reduce.Therefore, the present invention includes a kind of cell of expressing the kidney enzyme, to increase or to induce kidney expression of enzymes, translation and/or activity, wherein increase kidney expression of enzymes, protein level and/or activity can be used for treatment or palliate a disease, obstacle or pathology.

Those skilled in the art recognize based on instruction provided herein, and " knocking in (knock-in) " of the present invention or " knocking out " carrier comprise respectively two homeologous at least two sequences with the nucleic acid of being replaced or lacking.The sequence homology of these two sequences and gene both sides; Promptly sequence is located at encoding sequence 5 ' part or its contiguous regional homology of the nucleic acid of coding kidney enzyme, and another sequence is in the downstream of first sequence.Those skilled in the art recognize based on instruction provided herein, the invention is not restricted to any special flank nucleotide sequence.On the contrary, targeting vector can comprise two sequences, and these two sequences are removed nucleic acid or its fragment (promptly " knocking out " carrier) of some or all coding kidney enzymes respectively or inserted nucleic acid or its fragment (promptly " knocking in " carrier) of the kidney enzyme of encoding in the mammalian genes group.The extremely important characteristics of targeting vector are that it is in the situation of knockout carrier, comprise enough rightabout two sequence parts that are positioned at, promptly be positioned at 5 ' and 3 ' end of kidney enzyme open reading frame (ORF), make and to produce disappearance/insertion by homologous recombination that the nucleic acid of all or part of thus coding kidney enzyme lacks or inserts from certain position in Mammals karyomit(e).

Transgenosis and knock in and knock out targeting vector be designed to known in the art, see for example Sambrook et al. (1989, Molecular Cloning:A Laboratory Manual, ColdSpring Harbor Laboratory, New York) and Ausubel et al. (1997, CurrentProtocols in Molecular Biology, John Wiley ﹠amp; Sons, New York) etc. describe.Both sides, kidney enzyme coding region of using in targeting vector or the part of upstream and downstream wherein can easily be selected based on currently known methods and instruction provided herein, and described instruction comprises the nucleic acid and the aminoacid sequence of rat and people's kidney enzyme.By means of these sequences, the technology of the present invention personnel can make up transgenosis of the present invention and knockout carrier.

The present invention further comprises a kind of targeting vector that knocks out, and it comprises the nucleic acid of the selectable mark of encoding, and neo for example encodes ^RThe nucleic acid of gene, thereby the nucleic acid of the kidney enzyme of can selecting wherein to encode or its part has lacked or with the transgenic cell of neomycin resistance gene displacement (existing the ability of growing under the situation of G418 to select by cell).Yet, but the invention is not restricted to neomycin resistance as selective marker.More properly, but other selective marker well known in the art can be used for knocking out in the targeting vector, make and can select its middle kidney enzyme gene to lack and/or inactivation and by the reconstitution cell of the replacement nucleic acid of the selectable mark of coding.But select selective marker and be known in the art its method of mixing in the carrier, see for example Sambrook et al. (1989, Molecular Cloning:A Laboratory Manual, ColdSpring Harbor Laboratory, New York) and Ausubel et al. (1997, CurrentProtocols in Molecular Biology, John Wiley ﹠amp; Sons, New York) describe.

As described herein, the present invention includes non-human transgenic Mammals (promptly knocking out transgenic animal), insert exogenous nucleic acid in the required site of its genome, thereby lacked the coding region of required endogenous target gene.The present invention further comprises a kind of genetically modified non-human mammal, and the exogenous nucleic acid of the kidney enzyme of wherein encoding is inserted in site in the genome, promptly " knocks in " transgene mammal.That inserts knocks in transgenosis and can comprise multiple nucleic acid, for example the nucleic acid of coded markings polypeptide, normally the nucleic acid of non-existent kidney enzyme operably is connected in cell or the nucleic acid of promotor/regulatory region of operably being connected with kidney enzyme atypia with coding.

The mammiferous generation of non-human transgenic of the present invention preferably uses method as herein described to realize.Yet, the invention is not restricted to make in this way, also can use other method to produce required knock-out mammals.In producing the mammiferous preferred method of non-human transgenic, generation comprises the genetically modified ES cell of the present invention, then this cell is used to produce knock-out animal, basic as Nagy and Rossant (1993, In:Gene Targeting, A Practical Approach, pp.146-179, Joyner ed., IRL Press) described.Send back to if the ES cell injected host's blastocyst embryo's environment or with the polymerization of blastomere stage embryo, then the ES cell shows as normal embryonic cell.When sending back to like this, cell has the abundant potentiality of growing along all pedigree of embryo.Therefore, also can obtain wherein to have imported the ES cell of required DNA, this cell be sent back to develop into sophisticated mammalian cell in embryo's environment then, wherein required DNA can express.

Produce transgenic mice really the butt case by Nagy and Rossant (1993, In:GeneTargeting, A Practical Approach, Joyner ed.IRL Press pp.146-179) discloses, and no longer repeats at this.Transfection or transduction ES cell use standard scheme to finish to import required DNA therein, Sambrook et al. (1989 for example, Molecular Cloning:ALaboratory Manual, Cold Spring Harbor Laboratory, New York) and Ausubel et al. (1997, Current Protocols in Molecular Biology, John Wiley﹠amp; Sons, New York) described.Preferably, the required DNA that comprises in the transgenosis of the present invention imports in the ES cell through electroporation, and as Soriano et al. (1991, Cell 64:693-702) this cell of described propagation.

With isolating nucleic acid import in the mammalian zygote by any standard transgenic technology finish (Hogan et al., 1986, Manipulating the Mouse Embryo:ALaboratory Manual, Cold Spring Harbor, NY).The most generally the mode of nucleic acid by microinjection imported among the embryo.

In case nucleic acid is imported in the ovum, then with this ovum short period of time insulation, move to then and obtain in the false pregnancy Mammals of this ovum same species, Hogan et al. (1986 for example, Manipulatingthe Mouse Embryo:A Laboratory Manual, Cold Spring Harbor, NY) described.Typically, a plurality of ovum of each experiment injection, about 2/3 ovum survival.Ovum with about 20 survivals moves in the false pregnancy animal then, and 4-10 viable eggs that so shifts grown the young baby who survives usually.

Can use any mammal kidney enzyme gene to produce to carry in the method for the present invention and comprise genetically modified transgene mammal or the transgenic cell that lacks all or part of mammal kidney enzyme gene.

Transgene mammal of the present invention can be the Mammals of any species.Therefore, the present invention should be interpreted as comprising the transgene mammal that produces the coding chimeric nucleic acid that this Mammals comprises mouse, hamster, rat, rabbit, pig, sheep and ox.The method of generation transgenic mice of the present invention can similarly be used for any mammalian species.Preferably, transgene mammal of the present invention is a rodent, and more preferably, transgene mammal of the present invention is a mouse.For example Lukkarinen et al. (1997, Stroke 28:639-645) instructs the gene construct that can produce transgenic mice also can produce other transgenosis rodent, comprises rat.Similarly, nullozygous gene (nullizygous) sudden change can be duplicated having in another species animal of locus with first species height homologous in the locus of a species animal.

In order to differentiate transgene mammal of the present invention, detect the situation that exists of isolating nucleic acid described in the young baby, use standard technique such as Southern blot hybridization, PCR and/or RT-PCR to carry out.The routine techniques evaluation that the expression of described nucleic acid in mammalian cell and tissue also uses the present invention to describe.Further, if the kidney zymoprotein is an excretory, then whether the existence of the blood circulation middle kidney enzyme of transgenic animal for example can be used the Western engram analysis or use the proteinic standard method of detection well known in the art to determine.

The cell that derives from transgene mammal of the present invention is thought " transgenic cell " at this paper, it comprises as deriving from those cells of kidney enzyme (+/-) and (/-) transgenic nonhuman mammal, be to change the relevant mammalian diseases and the effective system of symptom modeling to be sure oing with kidney expression of enzymes level, described disease such as ESRD, hypertension, cardiovascular disorder reach with kidney expression of enzymes level and change relevant any other disease, obstacle or pathology.

Specially suitable cell is derived from the inhuman cell that knocks out or knock in the transgene mammal tissue described herein, and the transgenosis that wherein comprises kidney enzyme gene expresses or suppress the expression of kidney enzyme in multiple tissue.For example, the cell type of this cell of therefrom deriving comprise (1) kidney enzyme (+/+), (+/-) and-/-) the mammiferous inoblast of non-human transgenic's life birth etc., (2) inoblast of kidney enzyme (+/+), (/-) or (+/-) animal embryo, and (3) derive from kidney enzyme (+/+), (/-) and (+/-) embryo and the mammiferous placenta cells of life birth and are.

Those skilled in the art recognize based on this paper instruction and comprise the cell that the horizontal kidney zymoprotein of reduction, the horizontal kidney enzymic activity of reduction or both cells include but not limited to express kidney expression of enzymes inhibitor (for example antisense or ribozyme molecule).

The method and composition that is used for keeping the mammalian cell of cultivation is known in the art, and wherein mammalian cell derives from Mammals, includes but not limited to derive from the mouse cell of transgenic mice as described herein.

Perhaps, in stripped and interior therapeutic method, can express the reconstitution cell of kidney enzyme, wherein give described reconstitution cell, thereby give cell, tissue and/or animal described protein.In addition, described reconstitution cell is used to disclose kidney enzyme part and kidney enzyme signal pathway.

Reconstitution cell of the present invention can be used for studying the effect that the kidney enzyme level increases or reduce pair cell stable state and cell proliferation and/or migration, the aspect such as reinvents in cell migration, adventitial fibrosis, arterial restenosis, feminine gender and works because inferred the kidney enzyme.

Reconstitution cell of the present invention also can be used for exsomatizing and the cells in vivo methods of treatment, wherein said cell has been engineered to does not express the kidney enzyme that kidney enzyme or expression lack the reduction or the change of biologic activity, the cell of the donor of cell of animal self (for example inoblast etc.) or homology coupling all carries out recombined engineeringization as described elsewhere herein (for example by inserting antisense nucleic acid or knockout carrier, reduce at reconstitution cell middle kidney expression of enzymes and/or protein level thus), give receptor with reconstitution cell.In this mode, the reconstitution cell of low expression level kidney enzyme can give the animal of himself cell expressing high level kidney enzyme, thus treatment or to alleviate this paper other places described relevant with the increase of kidney expression of enzymes or by disease, obstacle or the pathology of its mediation.

Make for the transgene mammal of the present invention such as the kidney enzyme knock-out mice of susceptibles such as adventitial fibrosis, arterial restenosis, can be used for studying the pathogenesis of these diseases and the latent effect of middle kidney enzyme thereof.

Further, transgene mammal of the present invention and/or cell can be used for further studying the Subcellular Localization of kidney enzyme.And, transgene mammal of the present invention (+/-and-/-life birth animal and embryo) and/or cell also can be used for studying the effect of kidney enzyme in the catecholamine circulation, to illustrate kidney enzyme target site and to combine its any acceptor and/or part that in cell, acts on of mediation with the kidney enzyme.

VI. antibody

The present invention comprises that also specificity is in conjunction with kidney enzyme or its segmental antibody.Those skilled in the art understand antibody and the of the present invention protein bound of specificity in conjunction with the kidney enzyme based on instruction provided herein, such as but not limited to combining with people's kidney enzyme or its immunogen part.In one embodiment, antibody comprises aminoacid sequence shown in the SEQ ID NO:2 at the kidney of rats enzyme.

Polyclonal antibody according to standard immunoassay well known in the art learn a skill by immunize rabbit produce (see for example Harlow et al., 1988, In:Antibodies, A Laboratory Manual, Cold Spring Harbor, NY).This technology comprises with a kind of chimeric protein immune animal, described chimeric protein comprises a part of another kind of protein, as maltose binding protein or gsh (GSH) labeling polypeptide part, and/or a kind of part, make the kidney enzyme partly be immunogenic (for example kidney enzyme of puting together with keyhole limpet hemocyanin KLH) and comprise separately rodent and/or the part of people's kidney enzyme amino-acid residue.Described chimeric protein is to clone in the plasmid vector that advances to be suitable for this purpose by the suitable nucleic acid of the kidney enzyme of will encoding (for example SEQ ID NO:1) to produce, and described carrier is such as but not limited to being pMAL-2 or pCMX.

Yet, the invention is not restricted to these antibody or these proteantigen parts.The present invention includes other antibody or its part of rat and people's kidney enzyme.Further, the present invention includes and kidney enzyme bonded antibody, these antibody are carrying out tissue in the immunohistochemical staining and in to the immunofluorescence microscopy with the cell of the nucleic acid transient transfection of coding at least a portion kidney enzyme, can be in conjunction with the kidney enzyme that exists on the Western trace, thus determine the position of kidney enzyme in tissue.

Those skilled in the art based on instruction provided herein recognize antibody can specificity in conjunction with described proteinic any part, full length protein can be used for producing the antibody that is specific to it.Yet, the invention is not restricted to use full length protein as immunogen.More properly, the present invention includes the described proteinic immunogenicity of use and partly produce the antibody of specificity in conjunction with the mammal kidney enzyme.Promptly the present invention includes the immunogenicity part or the antigenic determinant immune animal of using the kidney zymoprotein.Antibody can be by producing such as but not limited to rabbit or mouse with protein of the present invention or one partial immunity animal, perhaps by producing with the protein or the fusion protein immunization animal that comprise at least a portion kidney enzyme, described fusion rotein comprises the labeling polypeptide part that for example comprises with the covalently bound maltose binding protein labeling polypeptide part that comprises suitable kidney enzyme amino-acid residue.Those skilled in the art recognize that based on instruction provided herein these proteinicly also can be used to produce the antibody of specificity in conjunction with the kidney enzyme than small segment.

Those skilled in the art recognize that based on instruction provided herein the different piece of isolating kidney enzyme polypeptide all can be used for producing the antibody at the non-conservative region of kidney enzyme high conservative zone or this polypeptide.Disclose as this paper other places, the kidney enzyme comprises different conserved domains, includes but not limited to the signal peptide of inferring of N-terminal, FAD binding domains (from about 4-35 amino acids residue); Amine oxidase structural domain (from about 75-339 amino acids residue).

In conjunction with the detailed positioning analysis of the proteinic a plurality of conservative and non-conserved domains of the sequence of kidney enzyme and this, those skilled in the art understand the antibody that how to use method well known in the art and method as herein described to obtain to be specific to a plurality of parts of mammal kidney enzyme polypeptide based on instruction provided herein.

Further, those skilled in the art's non-conservative region of recognizing proteins of interest matter based on instruction provided herein has more immunogenicity with comparing in the conservative zone of different organism camber.Further, use nonconservative immunogenicity partly to carry out immunity and can produce the antibody that is specific to non-conservative region, guard the antibody of other not cross reaction of protein of part thereby produce with total one or more.Therefore, those skilled in the art recognize based on this paper instruction that the non-conservative region of each kidney enzyme molecule can be used for producing and only are specific to this kidney enzyme and do not have the antibody of specificity, not cross reaction with other kidney enzyme or other protein.

Perhaps, those skilled in the art understand that based on the instruction of this paper the use antibody that conservative zone produces in one or more kidney enzyme molecule can be used for producing the antibody that reacts with one or more kidney enzyme molecular specificity.The method that produces with the protein domain of guarding (this structural domain with proteinic other parts compare immunogenicity lower) specificity bonded antibody is known in the art, include but not limited to proteins of interest matter fragment and a kind of molecule (for example keyhole limpet hemocyanin etc.) are puted together, thereby make that this protein domain is immunogenic, perhaps by using adjuvant (for example Freund ' s fully and/or Freund etc.) or being undertaken by these two kinds of methods.Therefore, the present invention includes identification antibody of at least a kidney enzyme and specificity, comprise and the equal specificity bonded of all kidney enzymes antibody in conjunction with the antibody of more than one kidney enzymes.

Those skilled in the art recognize that based on the instruction of this paper other proteinic homology of part kidney enzyme and total conserved domain is lower.Yet, the invention is not restricted to any ad hoc structure territory; On the contrary, those skilled in the art's other non-conservative region of understanding kidney zymoprotein of the present invention also can be used for producing antibody of the present invention as herein described.

Therefore, those skilled in the art recognize the antibody (for example by suppressing essential kidney enzyme acceptor/ligand interaction) that the present invention includes neutralization and/or suppress the kidney enzymic activity based on instruction provided herein, described antibody can be discerned one or more kidney enzyme, includes but not limited to the kidney enzyme (for example mouse kidney enzyme) of people's kidney enzyme and different plant species.

The present invention is not limited only to antibody or the proteinic any specific immunogenicity part of the present invention that this paper discloses.More properly, the present invention includes other antibody or its part of kidney enzyme, perhaps the proteinic antibody that has about at least 15% homology with polypeptide with SEQ ID NO:2 aminoacid sequence.In other embodiments, described polypeptide and people's kidney enzyme have about at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or about at least 99% homology.In another embodiment, be people's kidney enzyme with the antibodies specific bonded polypeptide that is specific to the mammal kidney enzyme.

The present invention includes polyclonal antibody, monoclonal antibody, synthetic antibody or the like.It is that it combines with the kidney enzyme spcificity that those skilled in the art instruct the key feature of understanding antibody of the present invention based on this paper.Be antibody recognition kidney enzyme of the present invention or its fragment (for example its immunogenicity part or antigenic determinant), this confirms by the kidney enzyme on the antibodies Western trace in the cellular immunization dyeing of using standard method well known in the art to carry out and/or kidney enzyme immunoprecipitation.

Those skilled in the art instruct based on this paper and recognize that described antibody can be used for determining the position of related protein in cell, and are used for studying the effect of the antigen of its identification in the cell process.In addition, described antibody can be used for detecting or measuring the proteinic amount that exists in the biological sample, uses the method for knowing to carry out such as but not limited to Western trace and enzyme-linked immunosorbent assay (ELISA).In addition, described antibody can be used for using method immunoprecipitation well known in the art and/or its isoantigen of immunoaffinity purification.

In addition, described antibody can be used for reducing the level of cell middle kidney enzyme, thereby suppresses the effect of kidney enzyme in cell.Therefore, therefore the cell or tissue by giving animal or give animal self described antibody can suppress essential kidney enzyme acceptor/ligand interaction, and the signalling effect of kidney enzyme mediation also is suppressed thus.Those skilled in the art based on the instruction of this paper understand use that anti-kidney enzyme antibody suppresses that kidney enzyme ligand/receptor interactionally can detected effect can include but not limited to that cell proliferation reduction, cell migration reduction, feminine gender reinvent that reductions, adventitial fibrosis reduce, arterial restenosis reduces, the fibrosis of any organ or tissue reduces, ossified or bone forming reduction or the like.

The generation of polyclonal antibody is by with the required animal of antigen inoculation and separate specificity and realize in conjunction with this antigenic antibody, the antibody production method of use standard carries out, for example, Harlowet al. (1988, In:Antibodies, A Laboratory Manual, Cold Spring Harbor, NY) described.

Can use any method for preparing monoclonal antibody of knowing to prepare monoclonal antibody at full length protein or peptide or its peptide fragment, Harlow et al. (1988 for example, In:Antibodies, A Laboratory Manual, Cold Spring Harbor, NY) and Tuszynski et al. (1988, Blood, 72:109-115) described method.The amount of required peptide also can use chemical synthesising technology synthetic.Perhaps, DNA that can the required peptide of clones coding also expresses from suitable promoter sequence in being suitable for producing the cell of a large amount of peptides.Use standard method from producing the described peptide mice immunized at the monoclonal antibody of described peptide.

Use the nucleic acid of the coding monoclonal antibody of methods described herein acquisition can use available method clone in this area and order-checking, the method described in Wright et al. (1992, Critical Rev.Immunol.12:125-168) and the reference thereof for example.

Further, antibody of the present invention can be humanized, use the method for Wright et al. (as preceding) for example and reference and Gu et al. (1997, Thrombosis and Hematocyst 77:755-759) described method and other humanized antibody well known in the art to carry out.

In order to produce phage antibody library, at first for example obtain the cDNA library the mRNA of hybridoma from separating from cell, described cell is expressed the desired protein (for example antibody of Xi Wanging) that will be expressed on phage surface.The cDNA copy of described mRNA uses reversed transcriptive enzyme to produce.The cDNA of expression immunoglobulin fragment obtains by PCR, the gained dna clone is entered the phage DNA library that comprises the DNA that represents immunoglobulin gene in the suitable phage vector with generation.The method that generation comprises the phage library of allogeneic dna sequence DNA is known in the art, for example as described in Sambrook etc. (as preceding).

The phage of required antibody of encoding can carry out through engineering approaches, and described thus protein shows by this way in its surface, and it is conjugated protein accordingly that described mode is that it can be used in conjunction with it, for example this antibody at antigen.Therefore, when the phage of expression specificity antibody is incubated under the condition of the cell of existence expression corresponding antigens, this phage will combine with this cell.The not phage of expressing antibodies and this cell debond.This elutriation method is known in the art, for example as described in Wright etc. (as preceding).

As above-mentioned method used the M13 phage display produce people's antibody (Burton et al., 1994, Adv.Immunol.57:191-280).Basically, from the mRNA that derives from the antibody producing cells group, produce the cDNA library.The immunoglobulin gene that described mRNA coding is reset, so cDNA also encodes it.The cDNA of amplification clones into to produce in the M13 expression vector and expresses the segmental phage library of human Fab in its surface.The phage of showing antibody interested by antigen in conjunction with selecting, and in bacterium propagation to produce soluble human Fab's immunoglobulin (Ig).Therefore, different with the monoclonal antibody synthetic method of routine, this method makes the DNA immortalization of coding human normal immunoglobulin, rather than makes the cell immortalization of expressing human immunoglobulin (Ig).

Aforesaid method has been described the generation of the Fab phage partly of encoding antibody molecule.Yet, the non-phage that only limits to produce coding Fab antibody of the present invention.More properly, the present invention also comprises the phage of coding single-chain antibody (scFv/ phage antibody library).The Fab molecule comprises whole Ig light chains, and promptly it comprises the variable region and the constant region of light chain, but only comprises variable region and first constant region structural domain (CH1) of heavy chain.The single-chain antibody molecule comprises the segmental proteinic light chain of Ig Fv.Ig Fv fragment only comprises the variable region of the heavy chain and the light chain of antibody, does not wherein comprise constant region.Comprise scFv DNA phage library can (1991, J.Mol.Biol.222:581-597) described method produces according to Marks etal..The phage that elutriation so produces is to carry out with the similar manner of describing at the phage library that comprises Fab DNA to separate required antibody.

The present invention also comprises the synthetic phage display library, and wherein heavy chain and variable region of light chain can synthesize, and they comprise nearly all possible specificity (Barbas, 1995, NatureMedicine 1:837-839 thus; De Kruif et al.1995, J.Mol.Biol.248:97-105).

VII. composition

The present invention includes a kind of composition, it comprises nucleic acid or the isolating nucleic acid of its a part of complementary with encoding mammalian kidney enzyme, and it is an antisense orientation for transcribing.Preferably, described composition comprises a kind of medicine acceptable carrier.

The present invention includes a kind of composition, it comprises isolating mammal kidney enzyme polypeptide of the present invention.Preferably, described composition comprises a kind of medicine acceptable carrier.

The present invention also comprises a kind of composition, and it comprises the antibody of specificity in conjunction with the kidney enzyme.Preferably, described composition comprises a kind of medicine acceptable carrier.

The present invention further comprises a kind of composition, and it comprises a kind of isolating nucleic acid of encoding mammalian kidney enzyme.Preferably, described composition comprises a kind of medicine acceptable carrier.

Described composition can be used for giving cell, tissue or animal with the kidney enzyme, perhaps suppresses the expression of cell, tissue or animal middle kidney enzyme.Described composition is used for the treatment of disease, obstacle or the pathology that the kidney expression of enzymes changes mediation, and the reduction of cell, tissue or the expression of enzymes reduction of animal middle kidney or rising or protein level or rising are useful for animal thus.Promptly disease, obstacle or the pathology of animal be change by kidney expression of enzymes level or protein level mediated or relative situation in, said composition can be used for regulating this expression or the protein level of kidney enzyme.

In order to give Mammals, polypeptide or its nucleic acid and/or can be suspended in any medicine acceptable carrier of encoding with its all or part of complementary antisense nucleic acid, described carrier for example is that pH is about 7.8 HEPES buffer saline.

Available other medicines acceptable carrier includes but not limited to glycerine, water, salt solution, ethanol and the acceptable salts solution of other medicine, as phosphoric acid salt and organic acid salt.For the example of these and other medicine acceptable carrier well known by persons skilled in the art is described in Remington ' sPharmaceutical Sciences (1991, Mack Publication Co., New Jersey).

Described pharmaceutical composition can the sterile injectable aqueous solution or oil phase suspension or the preparation of solution form, packing or sale.This suspension or solution can be prepared according to means known in the art, also can comprise extra composition as herein described such as dispersion agent, moistening agent or suspension agent except activeconstituents.The preparation of this sterile injectable can use nontoxic parenteral acceptable diluent or solvent preparation, for example water or 1,3 butylene glycol.Other acceptable diluent and solvent include but not limited to Ringer ' s solution, isotonic sodium chlorrde solution and fixed oil such as synthetic monoglyceride or triglyceride.

Can be used for that pharmaceutical composition in the inventive method can be suitable in oral, rectum, vagina, parenteral, part, lung, the nose, oral cavity, eye or other preparation that gives approach give, prepare, pack and/or sell.Other preparation comprise plan nano particle (projectednanoparticle), liposome product, contain activeconstituents heavily sealing red corpuscle (resealederythrocyte) and based on immunologic preparation.

As used herein, " nano particle " is meant that diameter is the particulate of 1-1000 nanometer, any size, shape or form.Nano particle even can be " nanoshell (nanoshell) ", its be have discontinuous dielectric medium or semiconductive core part, on every side around the nano particle of one or more conduction shell." nanoshell " is the nano particle that is characterised in that discontinuous core/shell structure.Nanoshell and nano particle all can contain the doping agent in conjunction with for example negative charge molecule such as DNA, RNA etc.The example of positive charge doping agent commonly used comprises Pr ³, Er ³And Nd ³As used herein, " shell " is meant one or more shell that centers at least a portion of a core usually.In bigger nanoshell, can mix several cores.In one embodiment, use standard method to give animal with nano particle.

As used herein, term " conveying " nano particle is for example to be used for describing by intravenously nano particle being placed being attached to, being close to or enough near target location so that can with the granule amount maximization of the cells contacting of target position.

Composition of the present invention comprises and nano particle bonded nucleotide sequence and using method thereof.The bonded nano particle can be used for nucleotide sequence is delivered to a plurality of biology target position, as endotheliocyte.In one embodiment, described nucleic acid, for example the nucleic acid gene under genetic expression promotor control is attached to positive adulterated nanometer core, then by comprising that the shell that is specific to the target part of part target position on the cells of interest for example centers on.

One embodiment of the invention relate to and nano particle bonded nucleotide sequence.Described nano particle is that the assembling by " nanoparticle precursor " prepares.Nucleotide sequence can be any nucleotide sequence of selecting for being delivered into the biology target position usually.Described nucleotide sequence can be DNA, RNA, PNA or other synthetic or modify nucleotide sequence.In one embodiment, described nucleotide sequence is the dna sequence dna (GenBank registration number BC 005364) of coding people kidney enzyme.Described dna sequence dna can be the sequence of natural generation, the sequence of modified natural generation, perhaps composition sequence.In one embodiment, described nucleic acid is modified the codon use per-cent with maximization target host.The sequence of natural generation can be people, monkey, ox, pig, horse, cat, dog, rat, mouse, bear, rabbit, elk, fish, sheep or other animal sequence.Described sequence can be modified adds or the disappearance particular sequence.For example, dna sequence dna can be modified and for example remove restriction site, eliminates total cutting or mutational site, maximize the combining nano core.Described sequence can be further included the additional sequences that helps to transcribe, translate, locate, eliminate the protein cleavage site, adds cutting and/or processing site and adding or remove glycosylation site by modification.

In one embodiment, described nanoparticle precursor comprises the nucleotide sequence that combines with the nano particle polymkeric substance.Key between nanoparticle precursor and the nucleic acid can be non covalent bond or covalent linkage.The nano particle polymkeric substance can be any polymkeric substance that can be assembled into nano particle.For example, nucleotide sequence can with first kind of non-covalent combination of polymkeric substance.This first kind of polymkeric substance can be in conjunction with the cationic polymers of DNA such as polymine (PEI).Described first kind of polymkeric substance and second kind of polymkeric substance can covalent attachment.Second kind of polymkeric substance can be hydrophilic polymer, as polyoxyethylene glycol (PEG).For example, second kind of polymkeric substance can partly be puted together with the primary amine of PEI.

Described hydrophilic polymer can with part such as antibodies.Antibody can be polyclonal antibody or monoclonal antibody, preferred monoclonal antibody.Described antibody can be specific to the protein of biological receptor or other cell expressing.For example, low-density lipoprotein (LDL) acceptor-1 that described antibody can the oxidation of binding lectin sample, Lox-1.Antibody provides noticeable binding ability, but has high relatively space size.Less antibody fragment or other binding peptide or molecule can be used as part in a plurality of embodiments of the present invention.

When nanoparticle precursor self was assembled, nucleic acid molecule was encapsulated in the nano particle of formation, and antibody or part are present in the surface of nano particle.The nucleic acid molecule of capsulation is avoided the degraded of environment, enzyme, hydrolysis or other degradability by part or all-round protection.

The common mean diameter of nano particle of assembling is about 1nm-1000nm.More accurate diameter range is about 10nm-250nm, and about 40nm-100nm.

Another embodiment of the invention relates to the nano particle of assembling.The nano particle of assembling comprises the nanoparticle precursor of having assembled in solution.The nano particle of assembling preferably contains nucleotide sequence in the internal capacity of nano particle, have antibody or other binding peptide on the outside surface of nano particle.Nano particle can be Any shape usually, the preferably approximately spheric.Described antibody preferably keeps its native conformation, can combine with its natural target position.

The nano particle of assembling can the several formulations form exists, be included in the solution, anhydrous, in liposome or the like.The special example of preparation comprises the soccerballene nano particle, polymer poly ethyleneimine (PEI) and T 500 (DS) by opposite charges are formed, by the water nano particle of zinc as stablizer, calcium phosphate nanoparticles, the oligomer that adds cap derived from the end of Tris (methylol) aminomethane, have hydrogen or fluorine carbon tail, put together poly-(amino poly-(ethylene glycol) cyanoacrylate-altogether-hexadecyl cyanoacrylate (poly-(H (2) NPEGCA-is common-HDCA) nano particle, biodegradable nano particle, by poly-(D, L-lactide-co-glycolide) (PLGA) and the preparation of the degradable poly phosphate of water-soluble biological, poly-(2-aminoethyl propene phosphoric acid) be nano particle (PPE-EA).

The invention still further relates to the method for the nano particle of preparation assembling.Described method can comprise the formation polymer conjugate, and this polymer conjugate is contacted with nucleic acid to form nano particle.Described polymer conjugate comprises first kind of polymkeric substance, second kind of polymkeric substance and part.First kind of polymkeric substance is preferably with non-covalent mode bind nucleic acid.Preferred first kind of polymkeric substance is the cationic polymers in conjunction with DNA, as polymine (PEI).Second kind of polymkeric substance can be a kind of hydrophilic polymer, as polyoxyethylene glycol (PEG).Described part is antibody preferably.

The part of preferred described polymer conjugate connects by covalent linkage.The specific erection sequence of polymer conjugate can change.For example, first kind of polymkeric substance can be connected with second kind of polymkeric substance, and then be connected with part.Perhaps, second kind of polymkeric substance can be connected with part, and then be connected with first kind of polymkeric substance.Described method is separated or purification step after can further being included in contact procedure.The nano particle of described assembling can be used for multiple application.Described nano particle uses in can using in external or body.

The present invention also provides a kind of kidney enzyme pharmaceutical composition of microcrystalline form.Disclosed the several different methods that obtains protein crystal, comprise free interface method of diffusion (free interfacediffusion method) (Salemme, F.R. (1972) Arch.Biochem.Biophys.151:533-539), hanging drop or seat drip vapor diffusion method (vapor diffusion in the hanging orsitting drop method) (McPherson, A. (1982) Preparation and Analysis ofProtein Crystals, John Wiley and Son, New York, pp 82-127) and liquid dialysis (Bailey, K. (1940) Nature 145:934-935).Compare with noncrystal protein, crystal proteins provides remarkable improvement on proteinic stability and concentration, and making can oral and parenteral conveying protein.In some cases, the molecule of special crystalline form has more biologic activity, and dissolving more promptly is not easy to decompose and/or be easy to purifying.

Protein, glycoprotein, enzyme, antibody, hormone and peptide crystal or crystal formulations can be in composition capsulation, be delivered to humans and animals with biology.The well known method that makes crystallization of protein, use pharmaceutical cpd or vehicle to prepare the method for stabilization formulations, and optionally its capsulation in polymer support is produced composition and use this protein crystals formulation and composition carries out biomedical applications, comprises the method for delivering therapeutic protein and vaccine.For example, U.S. Patent No. 6,541,606 disclosed protein crystal or crystal formulations in comprising the matrix of polymer support capsulation to form composition.Described preparation and composition have strengthened the protein natural biological and have learned the preservation of active tertiary structure, and are created in the set storehouse that can slowly discharge active protein when needing part and needing.This polymer support comprises biocompatible and biodegradable polymkeric substance.Biologically active proteins matter discharges for some time with control mode subsequently, and this preparation condition crosslinked by special capsulation technology, polymer formulations, crystallogeometry, dissolution of crystals, crystal and that use determines.

Composition of the present invention can give by number of ways, includes but not limited to that oral, rectum, vagina, enteron aisle are outer, part, lung, nose are interior, oral cavity or eye give approach.The approach of giving is easy to those skilled in the art institute apparent, and depends on multiple factors such as the animal of the type of the disease that comprises treatment and seriousness, treatment or people patient's type and age.

The pharmaceutical composition that is used for the inventive method can oral solid formulation, medicament for the eyes, suppository, aerosol, part or other similar dosage form whole body give.Except compound such as Suleparoid or its biology Equivalent, this pharmaceutical composition can also contain medicine acceptable carrier and known enhancing and promote other composition that medicine gives.The method according to this invention also can be used other possible preparation, as nano particle, liposome, heavily seal red corpuscle and based on immunologic system, to give the nucleic acid of kidney enzyme and/or coding kidney enzyme.

Can prepare use the compound that any method of the present invention differentiates and give Mammals with treatment arterial restenosis, adventitial fibrosis, the fibrosis of any organ or tissue, feminine gender reinvent, over-drastic bone forming, over-drastic are ossified etc.

The present invention includes preparation of drug combination and application, described pharmaceutical composition comprises and is used for the treatment of compound that arterial restenosis, adventitial fibrosis, feminine gender reinvent etc. as activeconstituents.This pharmaceutical composition can only be made up of activeconstituents, gives object with suitable form, and perhaps described pharmaceutical composition can comprise activeconstituents and one or more medicine acceptable carrier, the combination of one or more other composition or these compositions.Activeconstituents can the acceptable ester of physiology or the form of salt be present in the pharmaceutical composition, as with acceptable positively charged ion of physiology or negatively charged ion combination, these are known in the art.

As used herein, term " medicine acceptable carrier " is meant a kind of chemical composition with the activeconstituents combination, can be used for giving object with activeconstituents after combination.

As used herein, term " physiology is acceptable " ester or salt are meant the ester or the salt form of the activeconstituents compatible with any other composition of pharmaceutical composition, and it has no adverse effect for the object that gives described composition.

The preparation of pharmaceutical composition as herein described can be by the method preparation of any currently known methods or field of pharmacology announcement after this.Generally speaking, this preparation method comprises activeconstituents and carrier or one or more other ancillary component combination, then if desired or wish then product to be shaped or to be packaged as required single or multiple doses unit.

Although the description for pharmaceutical composition provided by the invention mainly is at the pharmaceutical composition that is suitable for giving with prescription human body, those skilled in the art understand the animal that this composition is suitable for giving all kinds usually.Those skilled in the art fully understand and can modify can being fit to give multiple animal the pharmaceutical composition that is suitable for giving human body, and the experimental design that veterinary science pharmacologist can be by routine is also carried out this modification.The object that gives pharmaceutical composition of the present invention includes but not limited to people and other primate, and Mammals comprises commercial relevant Mammals such as ox, pig, horse, sheep, cat and dog.

Can be used for that pharmaceutical composition in the inventive method can be suitable in oral, rectum, vagina, parenteral, part, lung, the nose, in the oral cavity, medicament for the eyes, sheath or the preparation that gives of other approach prepare, pack or sell.Other preparation comprise plan nano particle, liposome product, contain activeconstituents heavily sealing red corpuscle and based on immunologic preparation.

Pharmaceutical composition of the present invention can single unitary dose or a plurality of single unitary dose volume preparation, packing or sale.As used herein, " unitary dose " is the pharmaceutical composition of discrete amount, and it comprises the activeconstituents of predetermined amount.The amount of activeconstituents is generally equal to the dosage of the activeconstituents that gives object or the suitable component of this dosage, as half or 1/3 this dosage.

The relative quantity of activeconstituents, medicine acceptable carrier and any other composition is according to characteristic, size and the condition of treatment target and further change according to the approach that gives of said composition in the pharmaceutical composition of the present invention.For example, described composition can comprise the activeconstituents of 0.1%-100% (w/w).

Except activeconstituents, pharmaceutical composition of the present invention can further comprise one or more other active constituents of medicine.Be particularly related to other preparation, comprise antiemetic and scavenging agent such as prussiate and cyanate scavenging agent.

The control of pharmaceutical composition of the present invention or sustained release preparation can use routine techniques to produce.The preparation that is suitable for oral pharmaceutical composition of the present invention can discrete solid dosage unit form prepare, pack or sell, described form includes but not limited to tablet, hard or soft capsule, flat jelly (cachet), lozenge (troche) or lozenge (lozenge), every kind of activeconstituents that all contains predetermined amount.Be suitable for other oral preparation and include but not limited to powder or granular preparation, water or oil suspension, water or oil solution, perhaps milk sap.

As used herein, " oil (oily) " liquid is the liquid that comprises the carbonaceous liquid molecule and present the polar character that is lower than water.

Comprise the tablet of activeconstituents can be for example by activeconstituents and optional one or more other composition compression together or compression molding are produced.The tablet of compression can as powder or particle product, be chosen wantonly and one or more wedding agent, lubricant, vehicle, tensio-active agent and dispersant by in suitable device the activeconstituents boil down to not being had the mobile form.The tablet of compression molding can be in suitable device to activeconstituents, medicine acceptable carrier and make the moistening enough mixtures of liquids of mixture carry out mold pressing and produce at least.Produce the pharmaceutically-acceptable excipients of using in the tablet and include but not limited to inert diluent, granulation and decomposition agent, wedding agent and lubricant.Known dispersion agent includes but not limited to yam starch and Explotab.Known tensio-active agent comprises but is not limited to sodium lauryl sulphate.Known thinner includes but not limited to lime carbonate, yellow soda ash, lactose, Microcrystalline Cellulose, calcium phosphate, secondary calcium phosphate and sodium phosphate.Known granulation and decomposition agent include but not limited to W-Gum and alginic acid.Known wedding agent includes but not limited to W-Gum, polyvinylpyrrolidone and the Vltra tears of gelatin, Sudan Gum-arabic, gelatinization in advance.Known lubricant includes but not limited to Magnesium Stearate, stearic acid, silicon-dioxide and talcum.

Tablet can be uncovered or can be to use decomposing with delay in the object gi tract of currently known methods bag quilt, thereby the lasting release and the absorption of activeconstituents are provided.For example, can use as Zerol or the agent of Stearic diglyceride material peridium patch.Again for example, tablet can use U.S. Patent No. 4,256, and 108,4,160,452 and 4,265,874 described method bag quilt is to form perviousness sustained release tablet.Tablet can further comprise sweeting agent, flavouring agent, pigment, sanitas, the perhaps combination of these materials, with provide pharmacology first-class with goods delicious food.

The hard capsule that comprises activeconstituents can use degradable composition of physiology such as gelatin to prepare.This hard capsule comprises activeconstituents, and can further comprise other composition, comprises for example inert solid diluent such as lime carbonate, calcium phosphate or kaolin.The soft gelatin capsule that comprises activeconstituents can use physiology degradable composition such as gelatin to prepare.This soft capsule comprises activeconstituents, itself and water or oily medium such as peanut oil, whiteruss or mixed with olive oil.

Being suitable for the liquid preparation of the pharmaceutical composition of the present invention of orally give can liquid form or with the preparation of exsiccant product form, packing with sell, water or other suitable vehicle are rebuild (reconstitution) before using.

Liquid suspension can use the ordinary method preparation, makes activeconstituents be suspended in water or the oily vehicle.The water transport carrier comprises for example water and isotonic saline solution.The oil vehicle comprises for example Prunus amygdalus oil, grease, ethanol, vegetables oil such as Peanut oil, sweet oil, sesame oil or Oleum Cocois, fractionated vegetables oil and mineral oil such as whiteruss.Liquid suspension can further comprise one or more extra composition, includes but not limited to suspension agent, dispersion agent or moistening agent, emulsifying agent, lubricant, sanitas, buffer reagent, salt, spices, pigment and sweeting agent.Oil suspension can further comprise thickening material.Known suspension agent includes but not limited to Sorbitol Powder syrup, hydrogenation edible-fat, sodiun alginate, polyvinylpyrrolidone, tragakanta, Sudan Gum-arabic and derivatived cellulose such as Xylo-Mucine, methylcellulose gum, Vltra tears.Known dispersion agent or moistening agent include but not limited to the phosphatide such as the Yelkin TTS of natural generation, oxyalkylene and lipid acid, long chain aliphatic alcohol, derived from the partial ester of lipid acid and hexitol or with condensation product derived from the partial ester (for example polyoxyethylene stearic acid ester, 17 carbon ethylene oxy cetyl alcohols, octadecanoic acid ester of polyethylene glycol and polyoxyethylene sorbitan monoleate) of lipid acid and hexitan.Known emulsifying agent comprises but is not limited to Yelkin TTS and Sudan Gum-arabic.Known preservatives includes but not limited to methyl, ethyl or n-propyl group-right-hydroxy benzoate/ester, xitix and Sorbic Acid.Known sweeting agent comprises for example glycerine, propylene glycol, Sorbitol Powder, sucrose and asccharin.Known thickeners for oil suspension comprises for example beeswax, paraffinum durum and cetyl alcohol.

The liquor of activeconstituents in water or Oil solvent can prepare with the essentially identical mode of liquid suspension, and main difference is that activeconstituents is dissolving rather than is suspended in the solvent.The liquor of pharmaceutical composition of the present invention can comprise about the described every kind of composition of liquid suspension, should understand the nonessential help activeconstituents of suspension agent and be dissolved in the solvent.Water solvent comprises for example water and isotonic saline solution.Oil solvent for example comprises Prunus amygdalus oil, grease, ethanol, vegetables oil such as Peanut oil, sweet oil, sesame oil or Oleum Cocois, fractionated vegetables oil, and mineral oil such as whiteruss.

The powder of pharmaceutical preparation of the present invention and granular preparation can use the currently known methods preparation.This preparation can directly give object, for example forms tablet, charges into capsule or by adding entry or oily vehicle prepares water or oil suspension gives object.Every kind of these preparation all can further comprise one or more dispersion agent or moistening agent, suspension agent and sanitas.Other vehicle also can be included in these preparations as filling agent and sweeting agent, spices or pigment.

Pharmaceutical composition of the present invention also can water external emulsion or the preparation of water-in-oil emulsion form, packing or sale.Oil phase can be vegetables oil such as sweet oil or Peanut oil, mineral oil such as whiteruss, the perhaps combination of these oil phases.This composition can further comprise natural gum such as the Sudan Gum-arabic or the tragakanta of one or more emulsifying agent such as natural generation, the phosphatide of natural generation such as soybean phospholipid or Yelkin TTS, derived from ester or the partial ester such as the dehydrating sorbitol monooleate of lipid acid and hexitan combination, and the condensation product such as the polyoxyethylene sorbitan monoleate of this partial ester and ethylene oxide.These milk sap also can contain other composition, comprise for example sweeting agent or spices.

Pharmaceutical composition of the present invention can be suitable for form preparation, the packing of rectal administration or sell.This composition can be the form of suppository, retention enema goods and rectum or coloclysis solution for example.

Suppository formulations can be by preparing activeconstituents and the combination of non-irritating pharmaceutically-acceptable excipients, and described vehicle is a solid in normal room temperature (being about 20 ℃), is liquid in object rectal temperature (promptly about 37 ℃ of healthy human body).Suitable pharmaceutically-acceptable excipients includes but not limited to theobroma oil, polyoxyethylene glycol and multiple glyceryl ester.Suppository formulations can further comprise various other components, includes but not limited to antioxidant and sanitas.

Retention enema goods or rectum or coloclysis solution can be by producing activeconstituents and the acceptable liquid vehicle combination of medicine.As known in the art, the enema goods can use or be packaged in and be suitable for giving in the anatomical e Foerderanlage of object rectum.The enema goods can further comprise various other components, include but not limited to antioxidant and sanitas.

Pharmaceutical composition of the present invention can be suitable for form preparation, the packing of vagina administration or sell.This composition can be suppository, dipping or the bag form that can be inserted the material of vagina such as tampon, wash goods or vagina lavation gel or emulsion or solution for example.

With a kind of chemical composition of material soaking or with the method for this chemical composition bag quilt is known in the art, include but not limited to chemical composition is deposited or the bonded method from the teeth outwards, between synthesis phase chemical composition mixed method in the material structure at material (promptly as the degradable material of physiology), and water or oil solution or suspension absorbed method in the absorbing material into, subsequently can or need not be dry.

The flushing goods or the solution that are used for the vagina lavation can be by preparing activeconstituents and the acceptable liquid vehicle combination of medicine.As known in the art, the flushing goods can use or be packaged in and be suitable for giving in the anatomical delivery vehicles of object vagina.The flushing goods can further comprise various other components, include but not limited to antioxidant, microbiotic, anti-mycotic agent and sanitas.

As used herein, " parenteral gives " of pharmaceutical composition comprises tissue that is characterised in that physical property breakthrough object and any approach that gives that gives pharmaceutical composition by the breach of tissue.Parenteral gives so includes but not limited to by injectable composition, gives described pharmaceutical composition by operative incision set of applications compound, non-operation wound set of applications compound etc. by penetrate tissue.Especially, parenteral includes but not limited to subcutaneous, intraperitoneal, intramuscular, breastbone inner injection and kidney dialysis infusion techniques (kidney dialytic infusion techniques).

The preparation that is suitable for parenteral administered agents composition comprises activeconstituents medicinal composition acceptable carrier, as sterilized water or sterile isotonic salt solution.Form preparation, packing or sale that this preparation can be suitable for injecting (bolus administration) or continue to give.Injectable preparation can prepare, pack or sell by unit dosage form, as in ampoule that contains sanitas or multi-dose container.The preparation that parenteral gives includes but not limited to suspension, solution, the milk sap in oil or water carrier, paste, implantable lasting release or biodegradable preparation.This preparation can further comprise one or more other composition, includes but not limited to suspension agent, stablizer or dispersion agent.Give in the embodiment of preparation at parenteral, activeconstituents provides (being powder or particle) with dried forms, and after rebuilding with suitable carriers (for example aseptic apirogen water), parenteral gives the composition of described reconstruction again.

Described pharmaceutical composition can sterile injectable water or oil suspension or the preparation of solution form, packing or sale.This suspension or solution can be according to technology preparations known in the art, and it also can comprise other composition except activeconstituents, dispersion agent as described herein, moistening agent or suspension agent.The preparation of this sterile injectable can use nontoxic parenteral acceptable diluent or solvent preparation, for example water or 1,3 butylene glycol.Other acceptable diluent and solvent include but not limited to Ringer ' s solution, isotonic sodium chlorrde solution and expressed oil such as synthetic monoglyceride or triglyceride.But the preparation that other parenteral of available gives comprise comprise microcrystalline form, in liposome product or as the formulations of active ingredients of the composition of Biodegradable polymeric system.The composition that continues release or implant can comprise acceptable polymeric material of medicine or hydrophobic material, as milk sap, ion exchange resin, slightly soluble polymkeric substance or slightly soluble salt.

The preparation that is suitable for topical administration includes but not limited to fluid or semi-fluid goods, as liniment, lotion, oil-in-water or water-in-oil emulsion such as emulsion, ointment or paste, and solution or suspension.But the preparation of topical administration can for example comprise the activeconstituents of about 1%-10% (w/w), but the concentration of activeconstituents can be high as the solubility limit of activeconstituents in solvent.The preparation of topical administration can further comprise one or more other composition described herein.

Pharmaceutical composition of the present invention can be suitable for by formulation preparation, packing or the sale of oral cavity through pulmonary administration.This preparation can comprise the dried particles of activeconstituents, and particle diameter is about 0.5-7 nanometer, preferably approximately 1-6 nanometer.This composition is dry powdered form expediently, the equipment that use comprises the dried powder reservoir gives, can in this reservoir, add propellant flow to disperse this powder, perhaps use self-propelled agent solvent/powder dispersion cup as dissolving or be suspended in the equipment of the activeconstituents in the lower boiling propelling agent in the container that is contained in sealing.Preferably, this powder comprises particle, calculates by weight at least 98% described particulate diameter greater than 0.5 nanometer, presses number and calculates at least 95% described particulate diameter less than 7 nanometers.More preferably, calculate by weight at least 95% described particulate diameter, press number and calculate at least 90% described particulate diameter less than 6 nanometers greater than 1 nanometer.The exsiccant powder composition preferably includes a kind of solid fine powder diluent, and is for example sugared, and provides with unit dosage form expediently.

Lower boiling propelling agent generally includes the liquid propellant that boiling point under atmospheric pressure is lower than 65 .Usually, propelling agent can be formed the 50-99.9% (w/w) of described composition, and activeconstituents can be formed the 0.1-20% (w/w) of composition.Described propelling agent can further comprise other composition, as liquid nonionic or solid anion surfactant or solid diluent (preferably having and the granular size that comprises the particle same order of activeconstituents).

Be formulated as through the pharmaceutical composition of the present invention of pulmonary administration can also solution or the small droplets form of suspension activeconstituents is provided.This preparation can comprise aseptic water activeconstituents, optional or alcoholic solution or suspension dilution preparation, packing or the sale of dilution, and can use any atomizing or atomize equipment to give expediently.This preparation can further comprise one or more other composition, includes but not limited to spices such as soluble saccharin, volatile oil, buffer reagent, tensio-active agent or sanitas such as methyl hydroxybenzoate.By this small droplets preferred average diameter that gives approach and provide is about 0.1-200 nanometer.

The preparation that can be used for pulmonary delivery described here also can be used for carrying in the nose pharmaceutical composition of the present invention.

The another kind of preparation that is suitable for giving in the nose is a meal, and it comprises activeconstituents and average grain is about 0.2-500 nanometer.This preparation is to give with the nasal meatus suction, promptly sucks rapidly from the close container that contains described powder in nostril by nose.

Be suitable for the preparation that intranasal gives and for example comprise activeconstituentss approximately few as 0.1% (w/w) and many as 100% (w/w), and can further comprise one or more other composition described herein.

Pharmaceutical composition of the present invention can be suitable for formulation preparation, packing or the sale that the oral cavity gives.This preparation can for example be to use the tablet or the lozenge form of ordinary method preparation, and can for example comprise 0.1-20% (w/w) activeconstituents, remaining oral solubilized or degradable composition and optional one or more other composition described herein of comprising.Perhaps, being suitable for the preparation that the oral cavity gives can be powder or atomizing or atomize solution or the suspension that comprises activeconstituents.This Powdered, vaporific or atomization preparation is when disperseing, and preferred average grain or droplet size are about 0.1-200 nanometer, and can further comprise one or more other composition described herein.

Pharmaceutical composition of the present invention can be suitable for formulation preparation, packing or the sale of dosing eyes.This preparation can for example be the eye drop form, for example 0.1-1.0% (w/w) solution or the suspension of activeconstituents in water or fluid body carrier.This eye drop can further comprise buffer reagent, salt or one or more other composition described herein.But the preparation of other dosing eyes of available comprises that comprising activeconstituents is microcrystalline form or those preparations in liposome product.

As used herein, " other composition " includes but not limited to one or more following composition: vehicle; tensio-active agent; dispersion agent; inert diluent; granulation and decomposition agent; wedding agent; lubricant; sweeting agent; spices; pigment; sanitas; degradable composition of physiology such as gelatin; water carrier and solvent; oil carrier and solvent; suspension agent; disperse or moistening agent; emulsifying agent; negative catalyst; buffer reagent; salt; thickening material; filling agent; emulsifying agent; antioxidant; microbiotic; anti-mycotic agent; stablizer; and acceptable polymeric material of medicine and hydrophobic material.Other that can comprise in the pharmaceutical composition of the present invention " other composition " seen for example Genaro for known in the art, and ed. (1985, Remington ' s Pharmaceutical Sciences, MackPublishing Co., Easton, PA) described, it is for referencial use that the document is incorporated this paper into.

Typically, the dosage that gives animal, preferred people's The compounds of this invention changes according to numerous factors, includes but not limited to the type of animal and the disease type for the treatment of, age of animal and give approach.

Described compound can one day give animal for several times, and perhaps low frequency gives, as once a day, weekly, whenever biweekly, January, once perhaps even more low frequency gave, as the several months once or even annually or still less.The frequency of administration is easily known for those skilled in the art, according to multiple factor decision, such as but not limited to the type and the seriousness of treatment disease, the type of animal and age or the like.

Be used to put into practice carrier of the present invention

VIII. method

A. treat or alleviate relevant with the kidney expression of enzymes or by the method for disease, obstacle or the pathology of its mediation

One aspect of the present invention provides a kind of treatment relevant with the mammal kidney enzyme or by the method for disease, obstacle and the pathology of its mediation.This disease, obstacle and pathology include but not limited to ESRD, chronic hypertension, systolic hypertension, isolatism systolic hypertension, diabetic hypertension, lung's hypertension, acute serious hypertension, asymptomatic type left ventricle dysfunction, chronic heart failure (CHF), myocardial infarction (MI), arrhythmia, apoplexy, atherosclerosis, depression, anxiety, manic and schizophrenia or the like.

Express crossing of the Notes of Key Data kidney enzyme of this announcement, the kidney enzyme of the kidney enzyme of the low expression of kidney enzyme, overactivity and inactivation is relevant with multiple disease, obstacle or pathology, therefore the method that reduces the kidney enzyme level, increases the kidney enzyme level, reduces the kidney enzymic activity and increase the kidney enzymic activity can obtain benefit potentially, wherein the method for Xuan Zeing depend on treatment special obstacle, pathology and/disease.Therefore, the present invention has disclosed the level that influences the kidney enzyme treating/to alleviate the method for multiple disease, obstacle or pathology, before the level of its middle kidney enzyme and the treatment level of cell middle kidney enzyme or with oneself know not suffer to change relevant with the kidney enzyme level or compare and reduce or increase by the mammiferous level of identical cell middle kidney enzyme in addition of disease, obstacle or the pathology of its mediation.

Whether the expression of kidney enzyme, the level of this polypeptide or its activity increase or reduce, and those skilled in the art recognize based on this paper instruction and reduce or induce the method for kidney enzyme to comprise the reconstitution cell that gives kidney enzyme, kidney enzyme inhibitors natural generation or that non-natural takes place or express or do not express the kidney enzyme.Therefore, those skilled in the art recognize the present invention includes based on this paper instruction known in the artly influence Mammals middle kidney expression of enzymes level or active the detection increases or the methods of treatment of reduction.

Composition of the present invention can be used for giving cell, tissue or animal with the kidney enzyme, perhaps is used for promoting the expression of kidney enzyme cell, tissue or animal.Described composition can be used for treating disease, obstacle or the pathology of mediation by the change of kidney expression of enzymes, and reduction or increase cell, tissue or animal middle kidney expression of enzymes or this protein level are useful to this animal thus.Promptly the disease in animal, obstacle or pathology are to be changed in situation mediation or associated by kidney expression of enzymes level or protein level, and described composition can be used for regulating this expression or the protein level of kidney enzyme.

Those skilled in the art instruct understanding can increase the level or the activity of cell middle kidney enzyme based on this paper.Be that the proof kidney expression of enzymes data relevant with hypertension that this paper discloses show that crossing of kidney enzymic activity expressed or increase can bring high blood pressure down.This can be used for treating or alleviates with expression, level or the activity of not suffering from the described same cell of disease, obstacle or pathology, tissue or animal middle kidney enzyme compares, with the expression of kidney enzyme, level or actively reduce relevant or, undertaken by giving kidney enzyme natural generation or the non-natural generation by disease, obstacle or the pathology (for example hypertension) of its mediation.This disease, obstacle or pathology include but not limited to ESRD, hypertension, cardiovascular disorder or mental disorder.

The data that this paper discloses show that the kidney enzyme can regulate systemic blood pressure.Therefore, the technician recognizes that based on instruction provided herein the kidney enzyme of metabolism catecholamine can be used for treating cardiovascular disorder.Therefore, the present invention includes a kind of method that increases catecholamine metabolism, comprise increasing the active of blood circulation middle kidney enzyme or improving the expression of kidney enzyme in cell.For example, ESRD can treat by the kidney enzyme that gives the Mammals significant quantity.This is because the data that this paper discloses show that the kidney enzyme is relevant with ESRD.Be that data show that the shortage of kidney expression of enzymes is relevant with ESRD.Further, the data that this paper discloses show that reorganization kidney enzyme is injected rat causes rat blood pressure to reduce, and prompting kidney enzyme can be used for treating ESRD inductive hypertension and other cardiovascular disorder.

In another embodiment, the present invention includes a kind of method that alleviates by disease, obstacle or the pathology of kidney expression of enzymes or activity change mediation, undertaken by giving Mammals a kind of inhibition kidney expression of enzymes and/or active inhibitor.Just as the MAO inhibitor, the kidney enzyme inhibitors also can be used for the treatment of CNS disease such as mental state obstacle.Therefore, the expression of the compound of use inhibition kidney enzyme, peptide mimics, small molecules, ribozyme, antisense nucleic acid, antibody and interior antibody (intrabody) reduction kidney enzyme or the activity of reduction kidney enzyme can increase the content of monoamine in the brain, can alleviate the symptom of these diseases.Therefore, those skilled in the art understand the kidney enzyme that can realize by several different methods described herein and suppress, and can be used for treating CNS disease, particularly mood disorder.

The CNS disease includes but not limited to dementia, alzheimer's disease, schizophrenia, psychosis, depression, headache and migraine.As used herein, term " depression " comprises dysthymia disorders, for example single episodic (single episodic) or recurrence severe depression and dysthymic disorder, depressive neurosis, neurotic depression; The inhibitable type dysthymia disorders comprises apocleisis, loses weight, insomnia, early awakening and psychomotor retardation; Atypia dysthymia disorders (perhaps reactive depression) comprises bulimia, and is drowsiness, psychomotor excitement or irritability, anxiety disorder and phobia; Seasonal affective disorder; Perhaps bipolar disorder or manic-depressive illness, for example two-phase I type mental disorder, two-phase II type mental disorder and circulation affective disorders.

Other mood disorder that term " depression " comprises comprises in early days or the dysthymic disorder that has or do not have atypical characteristics of late onset; The alzheimer's disease type dementia of the depressive mood of early stage or late onset; The vascular dementia of depressive mood; Alcohol, amphetamine, Cocaine, fantasy, inhalation, opioid, phencyclidine, tranquilizer, soporific, anxiolytic and other material inductive mood disorder; The schizophrenic mental disorder of depressed type; And the adjustment disorder of depressive mood.

Composition of the present invention can be used for treating anxiety disorder.As used herein, term " anxiety disorder " comprises the anxiety disorder disease, if any or do not have agoraphobia, a specific phobia disease of the panic disorder of agoraphobia, no panic disorder medical history, for example specificity Zoophpbia, social phobia, compulsive disorder, stress disorders, comprise stress disorders and acute stress disorder after the wound, and generalized-anxiety disorder.

" generalized-anxiety disorder " typical case has overanxiexty or worried symptom in most of dates of for some time (for example at least 6 months).Anxiety and worry are difficult to control, and can follow fidgety, be easy to fatigue, be difficult to focus one's attention on, irritability, musculartone and sleep disordered.

" panic disorder " is meant recurrent panic attack, and at least one moon is continuously next time panic attack and worries subsequently." panic attack " be the strong fear that breaks out discontinuously, fear or terrified.During panic attack, individuality can be experienced multiple symptom, comprises palpitaition, perspires, trembles, breathes hard, pectoralgia, feels sick and dizzy.Agoraphobia can appear or not occur in panic disorder.

" phobia " comprises agoraphobia, specific phobia disease and social phobia." agoraphobia " is characterised in that for being difficult to escape in the situation of panic attack or nervous or the place that can not obtain to help or the anxiety of situation.Agoraphobia can not have panic attack history." specific phobia disease " is characterised in that by being exposed to the anxiety disorder with remarkable clinical symptom that specific frightened target or situation cause.Specific phobia disease comprises following hypotype: animal-type, by animal or insect hint; The physical environment type is by the hint of the object in the physical environment, for example Storms, height or water; Blood-injection-damage type, by see blood or damage or see or accept the injection or other invasive medical approaches hinted; Environmental form is by particular environment such as public's transportation, tunnel, bridge, elevator, flight, driving or enclosed space hint; And by other frightened type of other stimulation hint.Specific phobia disease may also be referred to as simple phobia." social phobia " is characterised in that by being exposed to the clinical remarkable anxiety disorder that the social of some type or performance environment excite.Social phobia may also be referred to as social anxiety disorder.

Other anxiety disorder that term " anxiety disorder " is contained comprises by ethanol, amphetamine, caffeine, hemp, Cocaine, fantasy, inhalation, phencyclidine, tranquilizer, soporific, anxiolytic and other material inductive anxiety disorder, and the adjustment disorder with anxiety disorder or blended anxiety disorder and dysthymia disorders.

Anxiety disorder can have or not have other obstacle, mixes anxiety disorder and depressibility obstacle as dysthymia disorders.Therefore composition of the present invention can be used for treating the anxiety disorder of following or not following dysthymia disorders.

The present invention further provides a kind of method that changes disease, obstacle or the pathology of mediation by the kidney expression of enzymes that alleviates, undertaken by a kind of nucleic acid complementary antisense nucleic acid of patient that gives to compare kidney expression of enzymes level with kidney expression of enzymes level identical but healthy tissues and increase the disease, obstacle or the pathology that mediates with coding kidney enzyme, described identical but organize the tissue that does not promptly present any detectable clinical parameter relevant normally with disease, obstacle or the pathology for the treatment of or alleviate.The kidney expression of enzymes be can reduce by this method, thereby disease, obstacle or pathology alleviated by the unconventionality expression mediation of kidney enzyme.

Thereby although illustration by give the cell antisense nucleic acid suppress the kidney enzyme in cell expression and the kidney enzyme is suppressed, those skilled in the art recognize protein expression and/or active method in many inhibition cells.This method includes but not limited to use ribozyme to suppress the kidney expression of enzymes, thereby and by for example giving this protein active in the cell antibody inhibition cell, for example give the nucleic acid of the described antibody of cell coding, described thus antibody is expressed in cell, therefore this antibody is delivered in the cytosol.The intracellular reactive of using these " interior antibody " arrestin matter is known in the art.For example see Verma et al. (1997, Nature 389:239-242; Benhar ﹠amp; Pastan, 1995, J.Biol.Chem.270:23373-23380; Willuda et al., 1999, Cancer Res.59:5758-5767; And Worn et al., 2000, J.Biol.Chem.275:2795-2803).Therefore, the present invention has been contained to make and has been suppressed the active any method of proteins of interest matter in the cell in this way, and these methods are known in the art or are disclosing in the future.

In another embodiment of the invention, suffer from relevant or can be by replenishing, increase with the cell that does not have the kidney expression of enzymes and/or the displacement deficient cells being treated by the individuality of disease, obstacle or the pathology of its mediation with the kidney expression of enzymes.Described cell can be derived from deriving from normal homology coupling donorcells or deriving from the individual cell of treatment.Described cell can be genetically modified to suppress the kidney expression of enzymes.Perhaps, can use recombination method well known in the art that cell modification is increase kidney expression of enzymes.Equally, the present invention also comprises using to derive from not suffer from the normal cell that changes other identical donor of relevant any disease or obstacle with the kidney expression of enzymes, and this cell can need its Mammals.

In addition, the present invention includes stripped technology, wherein obtain cell, and it is modified to the kidney enzyme of expressing increase or reduction level, and then import in this Mammals from Mammals.In addition, can will change the kidney enzyme level of expressing in the identical mammiferous same cell of relevant any pathology with the kidney expression of enzymes and compare with derive from not suffer from, express the mammiferous cell growth and the expansion of normal level kidney enzyme, and significant figure purpose cell can be imported in this Mammals again.This method comprises and relates to cell and the gene therapy technology of using marrow stromal cell that this method is known in the art.Therefore, those skilled in the art recognize about the cell therapy and the gene therapy method that have or do not have a cell of detectable kidney expression of enzymes to be contained in the present invention, and wherein said cell is to give in the body.

Except using the cell or normal cell displacement deficient cells from the reparation of the donor of homology, immunology coupling, method of the present invention also can be used for promoting desired protein (when secreting in animal) to express, and has beneficial effect.Promptly can isolated cell, supply with the gene of coding kidney enzyme and import in the donor or import in the acceptor of homology coupling the wherein expression of external source kidney enzyme performance therapeutic action.

Those skilled in the art will understand the present invention based on instruction provided herein and expect that the kidney enzyme secretes in cell.Be that the technician recognizes that based on instruction provided herein it can be a kind of available methods of treatment that the kidney enzyme is secreted, and the present invention includes the secretion of kidney enzyme from cell in cell.The secretion of kidney enzyme in cell can realize according to standard method well known in the art and the following method that discloses.This method includes but not limited to the nucleic acid of the signal peptide of coding secretion molecule covalently bound with 5 ' end of the isolating nucleic acid of coding kidney enzyme.It is known in the art can be used for the numerous signal sequences of mediating protein excretory in cell, the present invention includes these and the sequence that discloses is in the future secreted in cell with kinesin matter.

This aspect of the present invention relates to gene therapy, wherein gives the kidney enzyme of individual treatment amount.Promptly according to certain aspects of the invention, can be used as cellular therapeutic agent with nucleic acid, the antisense nucleic acid of coding kidney enzyme of the present invention or the reconstitution cell that knocks out the targeting vector transfection, be characterised in that with treatment the kidney expression of enzymes changes disease, obstacle or the pathology of (comprising that the kidney expression of enzymes lacks).

Especially, will comprise in the gene construct transfered cell of heterologous gene of coding kidney enzyme.These reconstitution cells are used for the kidney enzyme of purifies and separates, and it gives animal.Those skilled in the art understand based on instruction provided herein and replace giving isolating kidney enzyme polypeptide, the kidney enzyme can be needed its Mammals by giving himself reconstitution cell of Mammals.This will benefit for the acceptor individuality, obtain benefit when protein is expressed by reconstitution cell and secreted in the receptor system.

According to the present invention, will comprise in the gene construct transfered cell of nucleotide sequence of the present invention.The cytogenetics that is about to be called " reconstitution cell " changes with the nucleic acid that imports coding kidney enzyme or suppresses that the kidney enzyme is expressed and/or excretory nucleic acid (for example the nucleic acid of antisense kidney enzymatic nucleic acid, the anti-kidney enzyme antibody of coding etc.) in reconstitution cell, thereby mediates the beneficial effect to the acceptor that gives reconstitution cell.According to certain aspects of the invention, can carry out hereditary change to the cell that derives from the identical treatment individuality or the cell that derives from another individual cell or derive from the non-human animal, with the kidney enzyme gene of displacement defective and/or import it and express the kidney enzyme gene that has beneficial effect for individuality, perhaps suppress the kidney expression of enzymes, this has beneficial effect to individuality.

In aspect more of the present invention, the isolating reconstitution cell of suffering from the gene construct that the individuality of disease, obstacle or pathology can be by providing the normal function copy that contains the nucleic acid that comprises coding kidney enzyme is by replenishing, increase and/or the nucleic acid of the coding kidney enzyme of displacement defective or shortage being treated.This aspect of the present invention relates to gene therapy, and the nucleic acid of the coding kidney enzyme of its existence and/or function shortage wherein is provided for individuality.The isolating nucleic acid of the coding kidney enzyme that is provided by cell has compensated the kidney expression of enzymes of individual bulk defects, because when nucleic acid is expressed in individuality, produces protein, and it can alleviate or treat disease, obstacle or the pathology of individuality.This nucleic acid optimized encoding is excretory kidney enzyme polypeptide in the cell of recombinating.

In all situations in the cell was advanced in the gene construct transfection of coding kidney enzyme, nucleic acid operably was connected with realizing its suitable promotor/adjusting sequence of expressing needs in reconstitution cell.This promotor/adjusting sequence includes but not limited to constitutive promoter and inducible promoter and/or tissue specificity and differentiation specificity promoter, and these promotors are discussed in this paper other places.Constitutive promoter includes but not limited to cytomegalovirus immediate early promoter and Rous sarcoma virus promoter.In addition, also can use house keeping promoter as regulating those promotors of house keeper's genetic expression.Other promotor is included in the central nervous system cell preferential those promotors of expressing, such as but not limited to the promotor of the gene of coding glial fibrillary acidic protein.In addition, can select promotor/regulatory element, genetic expression is derivable thus.For example, can use the tsiklomitsin inducible promoters (Freundlich et al., 1997, Meth.Enzymol.283:159-173).

Described gene construct preferably provides with the expression vector form, it comprises the encoding sequence of the mammal kidney enzyme of the present invention that operably is connected with essential promotor/adjusting sequence, when described carrier transfection was advanced in the cell, described encoding sequence was by cell expressing thus.Described encoding sequence is expressed essential promotor/regulatory element with this sequence and operably is connected in cell.The nucleotide sequence of coded protein can be cDNA, genomic dna, synthetic DNA or its hybrid or RNA molecule such as mRNA.The gene construct that comprises nucleotide sequence that operably be connected with promotor/regulatory element, coding kidney enzyme can be used as functional additive type molecule and remains resident in the cell, and perhaps it can be integrated in the chromosomal DNA of cell.Genetic material can transfered cell in, exist as genetic material independently with the plasmid form this its.Perhaps, can be integrated into linear DNA in the host cell chromosome can transfered cell in.In the time of in the DNA transfered cell, can add and promote DNA to be integrated into the reagent in the karyomit(e).Can be used for promoting that the dna sequence dna of integrating also can be included in the dna molecular.Perhaps, can be with in the RNA transfered cell.

For the genetic material in the expression vector is expressed, promotor/regulatory element must operably be connected with the nucleotide sequence of coded protein.In order to maximize generation protein, can select to be very suitable for gene expression promoter/adjusting sequence in required cell.In addition, be chosen in the most effective codon of transcribing of cell.Those skilled in the art can be created in play function in the required cell the genetic recombination material as expression vector.

The invention still further relates to and to select promotor/regulatory element to promote proteinic tissue specific expression.Therefore, for example can provide specificity promoter/adjusting sequence, heterologous gene is only expressed in the tissue of implanting reconstitution cell thus.In addition, the technician recognizes that based on instruction provided herein kidney enzyme promotor can operably be connected with interested nucleic acid, thereby instructs nucleic acid to express at the certain position of tissue or organ.Similarly, kidney enzyme promotor can drive expression of nucleic acids interested, and this to be expressed in the camber catecholamine circulation part of being a problem be useful.

The preferred tissue that those skilled in the art understand its middle kidney expression of enzymes of target or expression shortage based on instruction provided herein includes but not limited to skin ulcer, fracture etc.In addition, can select promotor/regulatory element, genetic expression is derivable thus, for example can use the tsiklomitsin inducible promoter (Freundlich et al., 1997, Meth.Enzymol.283:159-173).

Do not wish to be bound by any particular theory, the nucleic acid of coding kidney enzyme preferably includes as described elsewhere herein the signal sequence of the inferring amino acid of people's kidney enzyme N-terminal (for example), and it can instruct transhipment and secretion by the kidney enzyme of isolating nucleic acid encoding in the reconstitution cell.Described signal sequence is based on the secretion of ripe kidney zymoprotein in cell and processed probably and remove.Perhaps, do not wish to be bound by any particular theory, the signal sequence of inferring can not be cut, but can be membrane spaning domain.

Except providing for cell the genetic recombination material, described genetic recombination material is proofreaied and correct the hereditary defect in the cell, coding not with q.s and/protein that functional conditions exists, this genetic material is proofreaied and correct the hereditary defect in the individuality thus, and/or be coded in associated specified disease, helpful protein in the treatment of obstacle or pathology and the prevention, and the expression of inhibition kidney enzyme in cell (for example knocks out targeting vector, antisense nucleic acid or the like), genetic material also can import in the reconstitution cell that the present invention uses so that the mode of this cell that should terminate of selectivity termination to be provided.This target reconstitution cell can import in the reconstitution cell its destructive mode.

According to the present invention, can provide genetic material for reconstitution cell, make it to destroying special susceptible.The gene of the acceptor that a kind of coding can selectively targeted cytotoxic agents for example, can be provided for reconstitution cell.But the gene that can be used for the expression-form of induced selective necrocytosis can import in the reconstitution cell.In this system, express by the proteinic cell of this genes encoding under given conditions or particular formulations exist or non-existent condition under for the target killing susceptible.For example, but the herpes simplex virus thymidine kinase of expression-form (herpes tk) gene can import in the reconstitution cell and be used for the induced selective necrocytosis.When the genetic material of the importing that comprises herpes tk gene is imported in the individuality, produce herpes tk.If wish or must kill the reconstitution cell of implantation, then can give individual drugs gangcyclovir, the selectivity that causes producing any cell of herpes tk is killed.Therefore, can provide a system, make the reconstitution cell of can selective destruction implanting.

Those skilled in the art understand the generation that reconstitution cell has been contained in the present invention based on instruction provided herein, and this reconstitution cell is the kidney enzyme to be provided or to suppress its middle kidney expression of enzymes for Mammals.Promptly this cell can be used for giving animal kidney enzyme or delivery of molecules (for example knock out targeting vector, antisense nucleic acid, ribozyme is with kidney enzyme spcificity bonded antibody or the like).

Give animal kidney enzyme and can be used as the mechanism of action of model system with research kidney enzyme, perhaps generation is used to disclose the diagnosis of disease, obstacle or the pathology relevant with the kidney expression of enzymes and/or the model system of methods of treatment.

Further, by expressing and secrete the kidney enzyme being delivered to animal and also can being used for the treatment of or alleviating disease, obstacle or the pathology that its middle kidney enzyme level increases the mediation therapeutic action of reconstitution cell mediation of kidney enzyme.More particularly, the reconstitution cell of the nucleic acid by giving animal expression coding kidney enzyme gives the kidney enzyme and can be used for treating ESRD, hypertension, cardiovascular disorder etc.

Perhaps, the reconstitution cell that comprises nucleic acid (its expression inhibiting or reduce that the kidney enzyme is expressed in cell, active and/or secretion) can be used as to disclose and is used to diagnose and/or treatment and kidney expression of enzymes, activity and/or secrete relevant or by the model of disease, obstacle or the pathology of its mediation.The present invention includes described reconstitution cell and can produce the molecule that suppresses the kidney expression of enzymes, thereby this molecule is offered animal.Perhaps, do not wish to be bound by any particular theory, described reconstitution cell self also is a functioning cell except can not expressing the kidney enzyme, can carry out other function identical but non-reconstitution cell, does not carry out kidney enzyme signalling approach.

Derive from animal, commercially available or definite clone of disclosing or all can use technology transfection well known to those skilled in the art at the cell of the primary cell of vitro culture.Therefore, the invention is not restricted to obtain cell from donor animal or patient self.More properly, the present invention includes use and can use any cell of engineered nucleic acidization of the present invention, described thus reconstitution cell is expressed the kidney enzyme, and (cell was not expressed the kidney enzyme before through engineering approaches, perhaps cell produces in the situation of kidney enzyme with different levels before with described nucleic acid transfered cell), perhaps described reconstitution cell is not expressed the kidney enzyme or is expressed kidney enzyme (cell is expressed the kidney enzyme before in described nucleic acid transfered cell or expressed in the situation of kidney enzyme at different levels) with lower level.

Can use the standard method that is used for the gene construct transfered cell with in the nucleic acid transfered cell, it is expressed by the protein of this genes encoding or the molecule of expression inhibiting kidney expression of enzymes.Method transfectional cells such as the transfer by calcium phosphate precipitation transfection, deae dextran transfection, electroporation, microinjection, liposome-mediated transfer, chemistry mediation in some embodiments,, ligand-mediated transfer or recombinant viral vector transfer.

In some embodiments, recombinant adenoviral vector is used for and will has the DNA transfered cell of required sequence.In some embodiments, recombinant retroviral vector is used for and will has the DNA transfered cell of required sequence.In some embodiments, the rotaring dyeing technology of application standard calcium phosphate, deae dextran or liposome vectors mediation mixes required DNA in the splitted cell.Standard antibiotic resistance selection technology can be used for differentiating and selecting cells transfected.In some embodiments, DNA is by in the direct transfered cell of microinjection.Similarly, electroporation of knowing or particle bombardment technology can be used in the foreign DNA transfered cell.Second kind of gene knocks out targeting vector or antisense molecule cotransfection and/or covalently bound with the nucleic acid of coding kidney enzyme or its usually.Normally a kind of selectable antibiotics resistance gene of described second kind of gene.Select the reconstitution cell of transfection to be undertaken by cell is grown in killing the microbiotic with described cell of selecting gene.At described two kinds of genes is in the most applications of unconnected and cotransfection, and the cell of surviving under the antibiotic treatment condition contains and expresses this two kinds of genes.

This paper has disclosed the method (for example using anti-kidney enzyme antibody at Western trace or other in based on the analysis of immunity such as ELISA) of evaluation kidney enzyme level and/or the method (for example using Northern engram analysis, RT-PCR analysis, in situ hybridization etc.) of evaluation cell or tissue middle kidney expression of enzymes level, and these methods are well known to those skilled in the art.This analysis can be used for determining giving " significant quantity " (no matter using isolating nucleic acid, antibody, antisense nucleic acid, ribozyme, reconstitution cell etc.) of the kidney enzyme of animal, the kidney enzyme is reduced or increase to required level.

B. differentiate the method for available compound

The present invention comprises that further a kind of the discriminating influences that the kidney enzyme is expressed and/or the method for active compound in cell.Described method comprises cell contacted with test compounds, and expression and/or activity level and kidney enzyme other identical but expression and/or the activity level that do not contact in the cell of described compound of kidney enzyme in the cell of so contact compared.If compare with expression and/or activity level identical at other but that do not contact the kidney enzyme in the cell of described test compounds, the expression of kidney enzyme and/or activity level with cell that test compounds contacts in higher or lower, show that then this test compounds influences expression and/or the activity of kidney enzyme in cell.

Similarly, the present invention includes a kind of discriminating reduction kidney enzyme expresses in cell and/or active method.Described method comprises cell contacted with test compounds, and expression and/or the activity level of kidney enzyme in the cell of the described compound of contact compared with expression and/or activity level identical at other but that do not contact in the cell of described compound.If compare with the expression and/or the level of kidney enzyme in not contacting the cell of described compound, with cell that described compound contacts in level lower, show that then this test compounds reduces expression and/or the activity of kidney enzyme in cell.

The technician based on instruction provided herein recognize the kidney enzyme in cell expression and/or activity level can be by determining coding kidney enzyme expression and/or the activity level of mRNA measure.Perhaps, the expression of the mRNA of coding kidney enzyme and/or activity level can be determined by using immunological method, for example use anti-kidney enzyme antibody of the present invention to produce by the kidney enzyme of Western engram analysis evaluation from this mRNA.Further, can use detection method, as Northern trace and pcr analysis etc. based on nucleic acid.In addition, cell middle kidney enzyme activity level also can be evaluated by the level of a plurality of parameters of determining to be influenced by the kidney enzymic activity, and described parameter for example is expression and/or the activity level at middle kidney enzymes such as kidney, heart, skeletal muscle and small intestines.Perhaps, the kidney enzyme activity level can evaluation in amine oxidase is analyzed.Therefore, those skilled in the art recognize expression and/or the activity level that has many methods to can be used for evaluating cell middle kidney enzyme based on instruction provided herein, and these methods comprise those methods disclosed herein, method well known in the art and other method that will disclose in future.

Further, those skilled in the art based on instruction provided herein recognize such as among the embodiment hereinafter announcement, lacking endogenous kidney expression of enzymes and/or active cell can be with the carrier transfection of the isolating nucleic acid that comprises coding kidney enzyme, thereby influences the expression and/or the activity of cell middle kidney enzyme.Then cells transfected is contacted with test compounds, can determine so whether this compound influences the expression and/or the activity of kidney enzyme.Therefore, the comprehensive instruction of the present invention of those skilled in the art, but can differentiate that selectivity influences kidney expression of enzymes and/or active compound by using the cell of the carrier selectivity transfection shortage detection level kidney enzyme of expressing the kidney enzyme.

Those skilled in the art instruct based on this paper and recognize that but the isolating nucleic acid at the kidney enzyme of will encoding lacks endogenous detection level kidney expression of enzymes and/or active cell, described thus cell produces in the situation of detectable kidney enzyme, and described isolating nucleic acid can comprise for example other nucleic acid of labeling polypeptide of covalently bound with it coding.Like this by certification mark polypeptide expression and/or the active expression and/or the activity that can detect the kidney enzyme.Therefore, the present invention includes by expression and/or active detect kidney expression of enzymes and/or the active method of detection with another molecule of kidney enzyme coexpression.

The present invention includes a kind of discriminating and kidney enzyme spcificity bonded method of protein.Kidney enzyme and at least a other protein bound, thus this and other protein interactions can influence the biological function of kidney enzyme.Therefore, the present invention includes discriminating specificity and combination of kidney enzyme and/or related method of protein well known in the art or that will disclose in future.This method includes but not limited to the protein bound analysis, and wherein with target protein, promptly the kidney enzyme is fixed on the suitable upholder, is incubated under kidney enzyme and the kidney enzyme related protein matter bonded condition making.Can use standard method that the kidney enzyme is fixed on the upholder, described method comprises the kidney enzyme of following mark such as but not limited to generation: glutathione-S-transferase (GST) mark, maltose binding protein (MBP) mark or His ₆-mark, then with fusion rotein respectively with gsh-sepharose 4B, maltose post or nickel resin (His-Bind resin for example, Novagen, Madison, WI) combination.Wash this solid support removing the protein with its non-specific binding, any kidney enzyme related protein matter of from matrix, dissociating then, thus differentiate kidney enzyme related protein matter.

In addition, with kidney enzyme spcificity bonded protein, for example acceptor, part and/or other kidney enzyme related protein matter can use for example yeast two-hybrid analysis to differentiate.The yeast two-hybrid analytical procedure is known in the art, can use to be purchased test kit and to carry out (MATCHMAKER for example according to standard method ^TMSystem, Clontech Laboratories, Inc., Palo Alto, CA and other this test kit).Therefore, in case comprehensive instruction provided herein, " bait " protein for example, the whole amino acid and the nucleotide sequence of kidney enzyme, those skilled in the art can be easy to differentiate and kidney enzyme spcificity bonded protein, such as but not limited to kidney enzyme acceptor protein, kidney enzyme part or the like.

Those skilled in the art understand any molecule that the present invention includes the method discriminating of using the argumentation of this paper other places based on instruction provided herein.Promptly related molecule with the kidney enzyme, such as but not limited to kidney enzyme acceptor albumen, kidney enzyme ligandin or the two, can be used for disclosing treatment and diagnostic method by disease, obstacle or the pathology of the interaction mediation of kidney enzyme and kidney enzyme related protein, described disease for example is ESRD, hypertension, cardiovascular disorder or the like.Be that those skilled in the art recognize as specificity is discussed in conjunction with the fully elaboration of the antibody institute of kidney enzyme in this paper other places, kidney enzyme related protein matter can be used for disclosing the methods of treatment that suppresses cell middle kidney enzymic activity, is undertaken by suppressing essential kidney enzyme acceptor/ligand interaction and other kidney enzyme binding interactions of kidney enzymic activity needs.

The kidney enzyme related protein matter of differentiating by aforesaid method can be directly used in inhibition kidney enzyme interacting, undertaken by cell and kidney enzyme related protein or its part contacts, thereby perhaps they can be used for disclosing and can suppress related interaction inhibition kidney enzyme function with the kidney enzyme of kidney enzyme and active antibody and/or peptide mimics.Therefore, the present invention can with and comprise kidney enzyme related protein matter, comprise kidney enzyme acceptor/ligandin.

C. diagnose and determine the method for treatment

The present invention includes the method for diagnosis some disease, obstacle or pathology, described disease is such as but not limited to ESRD, chronic nephropathy, hypertension, cardiovascular disorder such as asymptomatic type left ventricle dysfunction, chronic heart failure and atherosclerosis.The kidney enzyme also can be used as the diagnostic flag of acute renal failure (being acute tubular necrosis or ATN) etc.

Described method comprises from Mammals acquisition biological sample, and (expression, amount, activity) level of sample middle kidney enzyme is compared with the level of taking from the people's who does not suffer from ephrosis sample middle kidney enzyme.With derive from do not suffer from ESRD, ANT or hypertensive people's sample middle kidney enzyme level compares, patient's sample middle kidney enzyme level is low to show that this patient suffers from ESRD, ANT or hypertension.

The present invention includes a kind of method that the ESRD treatment is renderd a service in the Mammals of evaluating.Described method comprises before the evaluation treatment ESRD, during and expression, amount and/or the activity level of kidney enzyme in the certain hour afterwards because ESRD hangs down relevant with the kidney expression of enzymes.This be because as indicated in the data that disclose of previous other places and this paper, the expression of kidney enzyme, amount and/or activity and catecholamine circular correlation or it is increased, this is the feature (for example ESRD and hypertension) of some disease.Therefore, render a service based on the expression/amount of kidney enzyme/activity assessment treatment and show if the expression of kidney enzyme, amount or activity level increase then this methods of treatment is successful.

Need not further describe, the embodiment of those skilled in the art's and following illustration according to preamble can produce and utilize compound of the present invention and put into practice the method for claim.Following embodiment just particularly points out the preferred embodiments of the invention, unrestricted the present invention's meaning.

Embodiment

Summary

Experiment among this embodiment can be summarized as follows.At first, differentiate the kidney enzyme.In order to separate the protein of this new renal secretion, utilize existing public database, particularly MammalianGene Collection Project (MGC).Differentiated the candidate gene of the secretory proteins that totally 114 codings are new based on following standard: (i) candidate gene of coding new protein has with existing protein in the database and to be lower than 20% similarity/homogeny; Predict that (ii) the protein of inferring has signal peptide sequence (using the method for two kinds of different prediction signal peptide sequences); The protein of (iii) inferring does not contain membrane spaning domain (because some membrane proteins such as I type membranin also have signal peptide sequence).

This strategy provides some special advantages: analyze and only limit to new gene; Avoided clone's program of trouble, cut down for gene of interest month by month or year by year search; Genetic expression in can confirming immediately to organize and biological chemistry and functional study.Use this algorithm, find a clone, MGC 12474 (seeing below) in the expression of kidney camber.Therefore, select this clone further to study.

Find that the MGC12474 coding has the active protein of monoamine oxidase (MAO).MAO is a kind of enzyme that contains flavine-adenosine-dinucleotides (FAD), and it changes biological monoamine into corresponding aldehyde.The oxidation of catalysis monoamine forms the imines product by the α-CH key of oxicracking substrate in this enzymatic reaction (Massey et al., 2000), follows the reduction of flavine cofactor.Then this imines product is hydrolyzed to corresponding aldehyde and ammonia.Reductive flavocoenzyme and oxygen reaction form the flavine of hydrogen peroxide and oxidised form, finish catalytic cycle.

Use identical synthetic peptide of 226-238 amino acids deutero-in people and mouse produces the anti-kidney enzyme of rabbit polyclonal antibody.The research of Western trace illustrates this antibody recognition and the same 37Kd kidney enzyme-HA fusion rotein of anti-HA antibody.

In addition, find that the kidney enzyme secretion advances (detailed description sees below) in the blood of human body, shows that further the kidney enzyme is a kind of character of secretory protein.

For the ease of the detection of protein, will be in the HA mark through engineering approaches of kidney enzyme C-terminal.Carry out the protein that the Western trace has disclosed 37Kd in the substratum of kidney deutero-HEK293 cell with anti-HA and anti-kidney enzyme antibody, show that the kidney enzyme has a functional N-terminal signal sequence, and secretion is advanced in the cell culture model of these research uses.

In addition, use kidney enzyme spcificity polyclonal antibody by western trace human body blood.Fig. 3 b shows that the kidney enzyme is easy to detect in blood.In order to determine whether kidney is the main source of circulation kidney enzyme, whether patient's middle kidney enzyme blood levels that we have tested in serious kidney disease and renal function reduction reduces.Shown in Fig. 3 b, in fact not having in the ESRD patient's who accepts hemodialysis blood can detected kidney enzyme.

The experiment of carrying out is described hereinafter in more detail.

Embodiment 1: the discriminating and the analysis of the gene of coding kidney enzyme

Material and method

The bioinformatic analysis of MGC database

The people of used all 12,563 uniquenesses of this experiment all-ORF cDNA derives from Mammalian Gene Collection Project MGC, it carried out three-wheel step sizing.Original M GC analyzes and carries out in December 24 calendar year 2001.At first, select do not have the gene of GenbankDefinition to analyze in more detail.Secondly, the predicted amino acid sequence of the genes encoding that will select in the first round uses BLAST to analyze (http://www.ncbi.nlm.nih.gov/BLAST), selects coding and known protein matter to be lower than proteinic those genes of 20% homogeny.The 3rd, SignalP V2.0 (www.cbs.dtu.dk/services/SignalP-2.0/) and SOSUI signal Beta_Version (http://sosui.proteome.bio.tuat.ac.jp) evaluation are used in the existence of the signal sequence of inferring.To use Pfam to carry out the structural domain search by the new protein with signal peptide sequence of these two kinds of method predictions then.Encode clone's interested cDNA clone available from ATCC, two chains are all checked order (Yale University, Keck Foundation Biotechnology Resource Laboratory) and use BLAST to analyze.

MGC

The MGC plan is a kind of new achievement of NIH, can produce the full-length cDNA resource so that people's gene is carried out functional study.The resource that this plan provides whole world research institution openly to obtain.The MGC plan needs to produce library, order-checking and database and repository, and at obtaining support (Rozanski et al., 1999 of whole people with the clone's of other Mammals total length (open reading frame) sequence and expressing gene library construction, order-checking and analytical technology; Tendera et al., 2001).Most important ground, MGC has established powerful information science instrument to guarantee the clone who the selects complete sequence of encoding potentially.The people that MGC produces 12,563 uniquenesses all-ORF cDNA, wherein about 20% is new gene (new gene definition is to be lower than 20% similarity/homogeny with known protein matter).

Dna sequence dna

The MGC12474 cDNA clone of coding kidney enzyme is available from ATCC, and two chain is checked order (Yale University Keck Foundation Biotechnology ResourceLaboratory), use the BLASTN analysis of state-run biotechnology information center website (www.ncbi.nlm.nih.gov/BLAST/) and the dna sequence dna homogeny/similarity of open sequence.

The Northern engram analysis

Obtain the Northern trace of a plurality of tissues of people from CLONTECH, with its with [α- ³²P] the kidney enzyme cDNA hybridization of dCTP mark.Hybridization is containing underlined probe (～2 * 10 ⁶Cpm/ml) carried out 1-2 hour or spent the night at 62-68 ℃ in the Rapid-hyb damping fluid (Amersham Pharmacia Biotech).Trace is washed and is exposed to the KodakXAR film under stringent condition.Glyceraldehyde-3-phosphate dehydrogenase cDNA equates RNA as the internal reference probe with load.

Statistical analysis

The paired Student ' s t-check of relatively using standard between two groups is carried out.The non-paired Student ' s t-check of standard is used for group relatively in the identical time.All data are mean value ± SE, and p value＜0.05 thinks to have statistical significant difference.

The result

In order to separate new protein with important biomolecule effect, existing public database, particularly Mammalian Gene Collection Project (MGC) are screened (Strausberget al., 1999), the algorithm of use design may be by the new protein of renal secretion with selection.The MGC plan is the new achievement of of NIH, produces the full-length cDNA resource so that gene product is carried out functional study (Strausberg et al., 1999 in people and mouse; Http:// mgc.nci, nih.gov).In order to select the proteinic candidate gene of excretory of encoding, all clones that MGC is announced all study.The people that MGC produces 12,563 uniquenesses all-ORF cDNA, wherein about 20% is new gene (new gene is defined as with known protein matter and is lower than 20% similarity/homogeny).The MGC data analysis was finished on August 1st, 2003, differentiated the candidate gene of totally 114 new secretory proteins of encoding based on following standard: (i) the new protein of candidate gene coding, be lower than 20% similarity/homogeny with existing protein in the database, predict that (ii) the protein of inferring has signal peptide sequence (using two kinds of different methods of prediction signal peptide sequence); The protein of (iii) inferring does not contain membrane spaning domain (because some membranins such as I type membranin also have signal peptide sequence).The tissue expression of each candidate gene is all evaluated by the Northern engram analysis, discloses one of these clones brute force in people's kidney and preferential expression (MGC12474, GenBank registration number BC005364) (Figure 1A).MGC12474 has 1,474 Nucleotide, and its longest open reading frame (22-1047 position Nucleotide) coding has 342 amino acid whose a kind of new proteins, and the molecular weight of calculating is 37.8kDa (Fig. 2 A).The people's gene that is called the kidney enzyme has to be crossed over approximately 311, and 7 exons of 000bp are positioned at No. 10 chromosomal q23.33 and go up (Fig. 2 B).The analysis of using MotifScan to carry out has disclosed a signal peptide at N-terminal, FAD binding site (4-35 amino acids) and at the amine oxidase structural domain (Figure 1B) of 11-339 amino acids.Kidney enzyme and monoamine oxidase A (MAO-A) have 13.2% amino acid homogeny (Fig. 1 C), have weak similarity (Fig. 2 C) with MAO-B.

Embodiment 2: the kidney enzyme is by renal secretion

The structure of expression casette (TAP fragment)

We use the scheme of PCR-based, after twice continuous P CR reaction, with 5 '-CMV promotor and 3 '-SV40pA add respectively 5 of each candidate clone '-and 3 '-end.Detailed methodology is by descriptions such as Liang.In brief, this method comprises two successive PCR steps.The first step uses the primer (0.4 μ g) that contains general TAP end and be specific to the sequence of target gene to carry out.5 ' general end sequence with contain the dna fragmentation complementation of CMV immediate early gene promotor, and be used for second PCR step the CMV promotor is attached to the gene of amplification.3 ' general end is overlapping with the dna fragmentation that contains SV40 early gene transcription terminator, also is used for second PCR step the Transcription Termination subsequence is attached to the gene of amplification.In order to produce the TAP fragment that contains the kidney enzyme, be used for that 5 of the first step PCR '-and 3 '-primer is as follows:

5′-oligo＝5′-

TGCAGGCACCGTCGTCGACTTAACAatgcgaccccagggccccgccg (SEQID NO:6, capitalization go on foot 5 of PCR '-TAP universal sequence as anchor to carry out second, and lowercase is at initial clone's 2 specific sequences of ATG initiation site); 3 '-oligo=5 ' CATCAATGTATCTTATCATGTCTGA TCAACCAGCTACCCATA CGATGTTCCAGATTACGCTTtttggtagttcttcaataag (SEQ ID NO:7, preceding 25 bases are 3 '-the TAP universal sequence, go on foot PCR as anchor to carry out second, meet terminator codon TGA behind the sequence encoding HA of underscore, lowercase is from deducting 3 ' terminal initial clone's kidney enzyme spcificity sequence of terminator codon).Be used to carry out 5 of the second step PCR '-and 3 '-primer and provide (Gene Therapy Systems, Inc.San Diego.CA) by manufacturer.

Gene is carried and is expressed

The program of using GenePORTER (Gene Therapy Systems, Inc.San Diego.CA) to recommend according to manufacturer is carried out in-vitro transfection.We obtain the 40-60% transfection efficiency consistently, use green fluorescent protein TAP fragment to evaluate in contrast.

External translation

Kidney enzyme cDNA cloned into inserting body 5 ' contain among the pDNR-LIB of T7 before terminal.MRNA transcribes to the kidney enzyme, and (Novagen CA) translates to use single tube protein  system 3 subsequently.Luciferase T7 cDNA is as positive control.Adding 50 μ Ci[ ³⁵S] (Amersham Pharmacia Biotech uses 1 μ g plasmid DNA to instruct according to manufacturer and carries out in-vitro transcription-translation methionine(Met) in 50 μ l reaction mixtures NJ).10 μ l products separate by the 10%SDS-polyacrylamide gel electrophoresis, carry out radioautograph and Western trace subsequently.

Gene is carried and is expressed

In-vitro transfection uses GenePORTER, and (Gene Therapy Systems, Inc.) program of recommending according to manufacturer is carried out.Use green fluorescent protein TAP fragment in contrast, we obtain the 40-60% transfection efficiency consistently.Whether in order to test the kidney enzyme is a kind of secretory protein, and the scheme of using PCR-based produces transcriptional activity PCR (TAP) fragment, and it is directly used in the expression in vivo experiment (Liang et al., 2002).

The generation of kidney enzyme antibody

Use reorganization GST-kidney enzyme fusion proteins as antigen, the anti-kidney enzyme of rabbit polyclonal antibody is by Proteintech Group, and Chicago produces.After 10 weeks, rabbit is strengthened with GST-kidney enzyme fusion proteins.6-8 week behind biphasic injection antigen, drainage blood from rabbit, and will resist kidney enzyme antibody affinity purification.

The Western engram analysis

HEK 239 cells are grown in having added 10% foetal calf serum, 2mM L-glutaminate and antibiotic Dulbecco ' s modified Eagle ' s substratum.Cell grows to 60-80% and is paved with in 6 hole flat boards, then with the TAP fragment transfection that contains kidney enzyme-HA fusion rotein, use Geneporter to instruct according to manufacturer and carry out.After the transfection 48-72 hour, will on the 10%SDS-polyacrylamide gel, separate from the protein of product of cell lysis, move on the nitrocellulose membrane, with anti-HA monoclonal antibody (Roche Chemicals) immunoblotting.

Use the secondary antibody of puting together to detect immunocomplex, and observe with SuperSignal West Pico Luminol/ toughener solution (Pierce) with horseradish peroxidase (Pierce).In order to detect secretion character, with the parallel Western engram analysis that carries out of substratum with product of cell lysis by candidate gene encoded protein matter.In order to detect human plasma kidney enzyme, use kidney enzyme spcificity antibody that 10 μ l blood plasma are carried out the Western engram analysis.

In situ hybridization

Carry out in situ hybridization as previously mentioned.In brief, digestion separates the 426-bp dna fragmentation that will clone #12474 from MGC with PstI by restriction enzyme HindIII.Then its subclone is advanced in pBluescript  II KS (+) carrier, become the rna probe of DIG mark, with DIG labelling kit (Roche Biochemicals) mark in in-vitro transcription.Use antisense strand to detect the kidney enzyme, sense strand is with comparing.These probes are used for and hybridize at the heart of paraffin embedding and the section of nephridial tissue.Become the popular feeling and nephridial tissue to get the postmortem that free family member agrees and clinical study ethics association of university is approved.4% Paraformaldehyde 96 that tissue is used in the phosphate buffered saline (PBS) (PBS) fixedly spends the night.The postmortem delay is 7 hours.To organize by the gradient ethanol dehydration, and with the dimethylbenzene clarification, be embedded in the paraffin, preparation thickness is the section of 5 μ m.

After dewaxing and hydration, will cut into slices with Proteinase K (20 μ g/ml) 37 ℃ of digestion 10 minutes.4% Paraformaldehyde 96 that is used in then among the PBS is fixed 10 minutes again at 37 ℃.In the hybridization buffer of 50 ℃ of probes that containing 4 * SSC, 10 % T 500,1 * Denhardt solution, 5mM EDTA, 0.1%CHAPS, 50% deionized formamide, 200 μ g/ml salmon sperm DNAs and 200ng/mlDIG-mark, hybridize.Slide is washed in 2 * SSC 4 times, each 15 minutes, then 50 ℃ of washed twice in 0.2 * SSC/0.1%SDS, each 15 minutes.Use the anti-DIG antibody of puting together with alkaline phosphatase to carry out colorimetric detection, with the insulation of NBT/BCIP chromogenic substrate, (Roche Germany) carries out to use the digoxygenin-kit for detecting nucleic acid subsequently.For people's kidney enzyme, in NBT/BCIP chromogenic substrate solution, need about 5 minutes generation colors.

The result

In order to determine the tissue distribution of kidney enzyme mRNA, to the identical Northern trace that carries out of tissue.The result that Figure 1A describes illustrates kidney enzyme mRNA and expresses at the kidney camber, and level is lower in other tissue.Carry out in situ hybridization research to determine the spatial distribution (Fig. 3) of kidney enzyme mRNA in the different human body tissue.In renal glomerulus, proximal tubule (Fig. 3 A, left side) and myocardial cell (Fig. 3 B, left side), detect special signal.This distribution situation is by the immunocytochemistry experiment confirm, as confirming by detecting renal glomerulus, proximal tubule (Fig. 3 C, left side) and myocardial cell's (Fig. 3 D, left side) middle kidney zymoprotein.These results show that it is tissue-specific that high-level kidney enzyme mRNA expresses, and points out it perhaps to have the function that is specific to kidney, skeletal muscle, heart and liver cell.

In order to test the candidate gene excretory protein of whether encoding, the scheme of using PCR-based produces PCR (TAP) fragment of transcriptional activity, and it is directly used in the expression in vivo experiment (6).For the ease of the detection of protein, the HA mark at kidney enzyme C-terminal is carried out through engineering approaches (avoid N-terminal be for the holding signal peptide integrity).Shown in Fig. 4 a, with 5 '-CMV promotor and 3 '-SV40pA and kidney enzyme-HA merge, the transfection of TAP fragment advanced in the HEK293 cell.The Western trace that uses anti-HA antibody to carry out has disclosed the expressed protein product (Fig. 4 b) of a kind of 37Kd of being contemplated in substratum, and this existence with the N-terminal signal peptide sequence of inferring is consistent.

With membrane-bound or to be limited to MAO-A, MAO-B and the PAO of intracellular region chamber different, the kidney enzyme secretion enters in the blood, can detect by the Western trace in blood.The amine oxidase activity is measured in human plasma, be sure of that it is mediated by vascular adhesion protein 1 (VAP-1), vascular adhesion protein 1 is by the responsive amine oxidase (Salmi et al., 2001) of unstriated muscle, adipocyte and endotheliocyte excretory cupric Urea,amino-(semicarbizide).The substrate specificity of VAP-1 is very different with the kidney enzyme with the inhibitor spectrum.Its metabolism benzylamine and methylamine, and by Urea,amino-and azanol inhibition.Therefore, the kidney enzyme is that unique known secretion enters in the blood circulation and the amine oxidase of metabolic cycles catecholamine.

The kidney expression of enzymes seems to be limited to kidney, heart, skeletal muscle and small intestine.Kidney presents high expression level, and seems relevant with a large amount of circulation kidney enzymes.The kidney enzyme level significantly reduces in the end-stage renal disease of dialysing (ESRD) patient really.This can not get rid of the possibility that the metabolic disturbance relevant with the severe renal nonfunction can reduce heart and skeletal muscle secretion kidney enzyme.Even so, but probably kidney is the important supplier of circulation kidney enzyme set.

Interesting ground, nearest studies show that blood plasma Dopamine HCL and noradrenaline levels and sympathetic tone continue to increase (Joles et al., 2004 in ESRD patient; Zoccali et al., 2002; Hausberg et al., 2002).Nearest research finds that also unexpected emotional stress can increase sympathetic stimulation, cause cardiac muscle (the Wittstein et al. that trembles, (2005) Neurohumoralfeatures of myocardial stunning due to sudden emotional stress, NewEngland Journal of Medicine.352,539-548).The sympathetic tone that raises can cause the generation of cardiovascular complication, as hypertension, left ventricular hypertrophy and dysfunction.These are upset and cause observed high mortality in ESRD patient probably.Therefore, low-level kidney enzyme may cause observed sympathetic tone rising in ESRD patient in the blood, gives generation and improvement existence that the kidney enzyme can reduce cardiovascular complication.

Embodiment 3: the kidney enzyme is at the external degradation catecholamine and regulate heart function and systemic blood pressure in vivo

In-vitro transcription/translation

MGC12474 clone clone was advanced before inserting body 5 ' end to contain among the pDNR-LIB of T7.MRNA transcribes with the kidney enzyme, uses single tube protein  system 3 (Novagen, Cat#70192) translation subsequently.Luciferase T7 cDNA is as positive control.In-vitro transcription-translation use 1 μ g plasmid DNA added 50 μ Ci [ ³⁵S] instruct according to manufacturer in the 50 μ l reaction mixtures of methionine(Met) (Amersham Pharmacia Biotech) and carry out.Separate 10 μ l products by the 10%SDS-polyacrylamide gel electrophoresis, carry out radioautograph and Western trace subsequently.

The generation of GST-kidney enzyme recombinant protein

With kidney enzyme coding region (nt 24-1052) with have adopted primer 5 '-TTTT GGA TCC ATGGCG CAG GTG CTG ATC GTG (SEQ ID NO:8) and antisense primer 3 '-TTTTGAA TTC CTA AAT ATA ATT CTT TAA AGC (SEQ ID NO:9) amplification.After with Bam HI and Eco RI digestion, the PCR fragment cloning is advanced among the pGEX-4T (Promega), make it and the same frame of N-terminal GST mark (26kDa).After examining correct clone by dna sequencing, the GST-kidney enzyme plasmid of will recombinating transforms into and produces with the fusion of recombinating in the e. coli bl21.After the conversion, the 6L bacterial cultures was grown 16 hours at 220rpm at 37 ℃, in last 3.5 hours, add IPTG (0.5mM).The FAD that when IPTG induces, also adds 10 μ M.The existence of kidney enzyme is carried out the Western trace by the total bacterial lysate protein with 40 μ g and is confirmed.

The kidney zymoprotein is purifying from bacterial lysate directly, uses the GSTrap post to carry out according to one step process.Binding buffer liquid contains PBS pH7.0 (140mM NaCl, 2.7mM KCl, 10mM Na ₂HPO ₄With 1.8mM KH ₂PO ₄, pH7.0.Elution buffer: 50mMTris ^TM-HCl and 10mM reductive gsh, pH8.0.In order to carry out specimen preparation, that 10g intestinal bacteria sample is centrifugal and be resuspended in binding buffer liquid on ice.To sample ultrasonic to discharge GST-kidney enzyme fusion proteins.The column purification program is as follows:

1) with the binding buffer liquid balance columns of 5 column volumes;

2) flow velocity with 0.2ml/min adds sample;

3) with the washing of the binding buffer liquid of 5-10 column volume or in effluent, there is not material;

4) the elution buffer wash-out of usefulness 5-10 column volume.

Influence gst fusion protein or other gsh conjugated protein with one of most important parameter of GSTrap bonded be flow velocity.Because the binding kinetics between GST and the gsh is relatively low, therefore importantly during adding, sample keeps low flow velocity so that binding ability reaches maximum.The volume that is used for wash-out can be different for the protein of different batches with the time.Perhaps need to use the gsh of higher concentration to carry out extra wash-out.Should monitor the material of the liquid of flowing through, washings and wash-out in post for gst fusion protein, use SDS-PAGE combination Western trace (if desired) to monitor.

GST-kidney enzyme denaturation

Urea makes that the sex change of kidney zymoprotein is a theme through further investigation and arguement.The research of kidney enzyme denaturation is following to be carried out:

1. prepare two kinds of protein examples, it is compared in containing the 50 μ l sample buffers of 50mM Tris-HCl (pH8), the protein final concentration is about 1mg/ml.

2. (from carrying out protein denaturation in the step 1) adding 18mg solid urea, the urea final concentration is 6M with 50 μ l samples.

3. the 100mM DTT that adds 5 μ l prepared fresh is (in high-level H ₂Prepare among the O) make protein reduce vortex mixed.Solution is incubated 1 hour in room temperature.

The refolding of GST-kidney enzyme

The effective refolding of sex change kidney enzyme.Generation and purifying are that the kidney enzyme of homogeneous uses 8M urea in the neutral pH sex change, and use multiple damping fluid rapid dilution.Rapid dilution with the neutral pH damping fluid produces low protein recovery.The not recovery of improved protein of the reduction of protein concn in refolding solution.Also producing low protein with the ealkaline buffer rapid dilution recovers.Yet, with the weak acidic buffer dilution quantitative protein with part enzymic activity is shown and recovers, show that the protein remains of recovery is trapped in the state of part refolding.Therefore, we have further studied effective refolding program of the part refolding kidney enzyme that forms at low temperature (4 ℃) in acidic buffer.The enzymic activity of kidney enzyme keeps constant at pH4.In identical pH titration but soaking time is less than 12 hours produces lower enzymic activity.The refolding experiment of carrying out in room temperature produces to be assembled, and activity is almost half of 4 ℃.We infer that urea-denatured kidney enzyme carries out rapid dilution at low temperature and produces the specificity conformation under acid pH, and it can be a physiological pH and changed into native state by titration then.This method is following carries out:

1. purifying kidney zymoprotein is as inclusion body and be dissolved in the 8M urea of neutral buffered.Replenish this damping fluid according to proteinic needs with DTT,

2. protein concn is adjusted to 0.1mg/ml,

3. successively to the dialysis buffer liquid every kind of protein of 1000 μ l of dialysing,

4. 1000 μ l protein solns are slowly added in each dialysis tubing, the while is mixing solutions gently,

5. dialysed 12 hours at 4 ℃ according to the damping fluid order,

6. pass through to collect in centrifugal 5 minutes the kidney enzyme,

7. with transfer pipet liquid is carefully moved in the clean test tube.This should contain the soluble protein of refolding,

8. the successful refolding of following evaluation:

Preferably carry out functional selection to determine whether to exist active protein.False folding or accumulative protein has and the correct folding different activity of protein.When in solvable fraction, obtaining＞30% input protein or when active, realizing successful refolding.

The damping fluid that uses in the experiment comprises following damping fluid:

Damping fluid 1:50mM MES pH 5.5,10mM NaCl, 0.4mM KCl, 2mMMgCl ₂, 2mM CaCl ₂, 0.75M Guanidinium hydrochloride, 0.5%Triton X-100,1mM DTT, 0.1mM FAD;

Damping fluid 2:50mM MES pH 5.5,10mM NaCl, 0.4mM KCl, 2mMMgCl ₂, 2mM CaCl ₂, 0.5M arginine, 0.05% polyoxyethylene glycol 3,550,1mM GSH, 0.1mM GSSH;

Damping fluid 3:50mM MES pH 5.5,10mM NaCl, 0.4mM KCl, 1mMEDTA, 0.4M sucrose, 0.75M Guanidinium hydrochloride, 0.5%Triton X-100,0.05% polyoxyethylene glycol 3,550,1mM DTT;

Damping fluid 4:50mM MES pH 5.5,200mM NaCl, 10mM KCl, 2mMMgCl ₂, 2mM CaCl ₂, 0.5M arginine, 0.5%TritonX-100,1mM GSH, 0.1mM GSSH;

Damping fluid 5:50mM MES pH 5.5,200mM NaCl, 10mM KCl, 1mMEDTA, 0.4M sucrose, 0.75M Guanidinium hydrochloride, 1mM DTT;

Damping fluid 6:50mM MES pH 5.5,200mM NaCl, 10mM KCl, 1mMEDTA, 0.5M arginine, 0.4M sucrose, 0.5%Triton X-100,0.05% polyoxyethylene glycol 3,550,1mM GSH, 0.1mM GSSH.

Amine oxidase is analyzed

The enzymatic analysis of kidney enzyme uses Amplex Red monoamine oxidase assay kit, and (Molecular Probes Cat#A-12214) carries out, and it provides a step fluorescence analysis to continue to measure the amine oxidase activity to use fluorescence small plate reader.This is analyzed based on detect H in the horseradish peroxidase reaction ₂O ₂, using 10-ethanoyl-3,7-dihydroxyl-phenoxazine (Amplex Red reagent) carry out, and this reagent is H ₂O ₂A kind of high sensitivity and stable probe.Experimental basis manufacturer instructs and carries out, and final concentration of substrate is 2mM.

The result

Structural analysis shows that the kidney enzyme contains the amino oxidase structural domain, points out it perhaps to work in the amine oxidation.Therefore, we use a series of amine to test it as substrate whether to have oxidase activity.Kidney enzyme fusion proteins in the intestinal bacteria produces by using the gst gene emerging system that kidney enzyme cDNA is cloned in the pGEX expression vector that into contains glutathione-S-transferase (GST).Shown in Fig. 4 a, kidney enzyme spcificity ground is the metabolism catecholamine in the following order: Dopamine HCL＞suprarenin＞norepinephrine.Its enzymic activity is not contained the amine oxidase MAO-A of FAD and the inhibitor of MAO-B influences (Fig. 4 b).

(Fig. 5 a) as homogeneous with GST-kidney enzyme fusion proteins purifying to use the glutathione agarose post.The fusion protein molecule amount of purifying is about 64KD, adds that with the molecular weight (26KD) of GST mark the summation of kidney enzyme molecular weight (37.8KD) of prediction is consistent.Because the kidney enzyme is expressed and is a kind of secretory protein at the kidney camber, therefore can imagine the kidney enzyme and be present in the blood circulation, and the kidney enzyme of ESRD patient with reduction level.When passing through Western engram analysis plasma sample (Fig. 5 B), find that in fact the kidney enzyme level in the ESRD patient who carries out hemodialysis can not detect, and the blood circulation kidney enzyme concn of normal individual is about 7mg/l with kidney enzyme spcificity antibody.

We use a series of amine to detect the kidney enzyme as substrate whether to have oxidase activity subsequently.As shown in Figure 6, when Dopamine HCL, norepinephrine and suprarenin (2mM) were used as substrate, GST-kidney enzyme fusion proteins had significant oxidase activity.Therefore, can infer that the kidney enzyme is a kind of metabolism Dopamine HCL, norepinephrine and adrenergic new protein.

Embodiment 4: the kidney enzyme is regulated systemic blood pressure

Hemodynamic measurement

Sprague Dawley rat (150-250g) is anaesthetized with inactin (100mg/kg).Place tracheae with the protection air flue and place left jugular vein (PE-50) to keep solution in one conduit (PE-240) to inject through intravenously by what normal salt solution and 6.25% bovine albumin were formed, flow velocity be the 1.5ml/100g body weight/hour.By rectal thermometer monitoring basal temperature, and use heating cushion that body temperature is remained on 37 ℃.By be inserted in the left neck artery and with pressure transmitter (ADInstruments, CO, USA) the PE-50 conduit continuous monitoring arteriotony and the heart rate of Lian Jieing.Use PowerLab/8SP data collecting system (ADIntruments) that the Hemodynamics record is carried out digitized processing, storage and analysis.After finishing operative procedure, rat kept somewhere 1 hour recovering, 30 minutes subsequently phases in contrast.Experimental group is accepted the 0.5mg reorganization kidney enzyme of intravenous push in 0.5ml PBS then.Control group is injected in 0.5mgBSA or the 0.5mg reorganization Thiadiazolidine isomerase among the 0.5ml PBS.Continue to measure blood pressure and heart rate and record.

Blood pressure is the function of cardiac output and peripheral vascular resistance, is regulated by sympathetic nervous system.The tonus of catecholamine control heart rate, myocardial contraction and resistance vessel in the circulation.Because the kidney enzyme circulates in blood and the catecholamine of degrading, so we detect it in vivo to the effect of hemodynamic parameter.In 30 seconds of an intravenous push reorganization kidney enzyme, systolic pressure, diastolic pressure and mean arterial blood pressure reduce by 23.5 ± 1.3%, 32.6 ± 2.9% and 28.9 ± 2.7% (n=4, p＜0.001) respectively.Shown in Fig. 7 A, (go up group), blood pressure restored in 2 minutes, reduced touching the bottom (in 60-90 minute) afterwards gradually, and systolic pressure, diastolic pressure and mean arterial blood pressure are lower than baseline 16.5 ± 1.5%, 14.3 ± 1.2% and 14.8 ± 1.1% (n=4, p＜0.01) (Fig. 7 A, following group).Heart rate remained unchanged at first, reduced (6.4%) (Fig. 7 A, following group) slightly at 60 minutes.In control group, albumin that blood pressure and heart rate are not injected or the influence of GST (Fig. 7 B).These data show that the hypotensive activity of kidney enzyme is likely the result of the catecholamine degraded of acceleration, and it prevents that the pulse of expecting from increasing (replying ypotension) and reducing myocardial contraction and the minimizing vascular resistance.Perhaps, the kidney enzyme can be in conjunction with related acceptor and directly adjusting myocardial contraction and vascular resistance.

Table 1

	Contrast	The kidney enzyme	n	p
					Mean arterial pressure (mmHg)	106.4±4.7	65.3±3.5	8	＜0.0001
End-systole is pressed (mmHg)	127.7±8.1	92.7±2.7	5	＜0.004
					EDP (mmHg)	11.3±1.8	9.3±1.5	5	NS
Heart rate (inferior/minute)	342±6	304±9	5	＜0.004
					Cardiac output (ml/min)	45.8±2.8	33.2±1.5	3	＜0.03
dP/dt(mmHg/sec)	8604±728	5235±442	5	＜0.001
					Arterial elasticity (mmHg/uL)	0.94±0.09	0.8±0.04	3	NS
Body vascular resistance (mmHg/L/min)	2323±196	1966±183	3	NS

Embodiment 5: animal model

The residual kidney model of rat (rat remnant kidney model, RRKM)

Can be as (Wada, M et al; J Clin Invest 1997 Dec 15; 100 (12): 2977-83) described use rat part (5/6) nephrectomy or the residual kidney model of rat.At first male rat (2-3 monthly age, the about 150-200g of body weight) is carried out unilateral nephrectomy (left kidney or right kidney).Make the 2.0cm skin incision at the belly medullary ray, the otch head end is apart from sword bone tail end 1.0cm.Make 2.0cm muscle otch along medullary ray.Separate right kidney and remove fat and reticular tissue on every side, clearly to observe the Renal artery and vein and ureter, because they enter the hilus renalis.Carefully separate so that minimum adrenal destruction.Thread (3/0silk) is placed around the Renal artery, vein and the ureter.At disconnected these tube chambers of nearly kidney end-grain cutting, take out kidney then, careful operation is not so that suprarenal gland is destroyed.Second step of operative procedure is included in carries out after the first step 7-10 days 2/3 of remaining kidney being excised.Because the forfeiture of kidney entity and function causes plasma creatinine (Cr) and BUN level significantly to raise.After ensuing several weeks, the plasma C r of surviving animals and BUN level descend slightly towards normal value, but are still rising.Renal function shows as constant or stable for some time of relative maintenance then.Afterwards, animal enters the chronic renal failure stage, and wherein the renal function substantial linear reduces until death.

As operating comparison, the rat that age, body weight are mated carries out " vacation " operation technique, and the tunicle of wherein removing kidney does not still excise nephridial tissue.

The intervention model of model renal failure

In this model, carry out the rat of nephrectomy and the rat of sham-operation and after operation, all raised 5-6 month.At this time point, the nephrectomy animal of survival enters the chronic renal failure stage.

Rat is divided into 8 groups, every group of 15 rats.The rat of two groups of nephrectomys is not wherein accepted processing for one group with comparing (Nx contrast), and another winding is subjected to only to inject the vehicle damping fluid.In addition, two groups of sham-operation with comparing (false contrast), wherein only accepts the vehicle damping fluid for one group, and another group is accepted solvable kidney enzyme with 100 μ g/kg body weight.Also use 4 nephrectomy rat experiment groups, accept the kidney enzyme of 10,100,500 μ g/kg body weight by the SQ injection.That the kidney enzyme is handled and only the rat of vehicle treated accept double injection every day, carry out 4-8 week altogether.

In all groups, carrying out the kidney enzyme handle before and during detect blood plasma BUN, Cr.Expection kidney enzyme provides treatment benefit (slowing down the progress of chronic renal failure) for the Nx rat.When finishing, the processing of kidney enzyme carries out Histological research to detect glomerular sclerosis, little tube damage, matter sclerosis and microaneurysm sign.

The prophylaxis model of chronic renal failure

In order to detect the depleted ability that takes place of kidney enzyme (kidney therapeutical agent) prevention, inhibition or delaying chronic kidney, rat is carried out aforesaid partial nephrectomy or sham-operation.After second step of operation, rat is being recovered about 2 weeks before the beginning kidney enzyme treatment.At this time point, the animal via of survival is spent the acute renal failure stage and is not entered chronic renal failure.Rat is divided into two groups, every group of 12 rats.Only accept vehicle damping fluid (Nx contrast) for one group, and another winding is handled by the kidney enzyme of 100 μ g/kg body weight, give twice through SQ every day.Give kidney enzyme or vehicle and continue about 8-9 week.

In all groups before the injection kidney enzyme and during all detect blood plasma BUN and Cr.Expection kidney enzyme prevents, the generation of inhibition or delaying chronic kidney depletion.When finishing, the processing of kidney enzyme also carries out Histological research, to detect glomerular sclerosis, little tube damage, matter sclerosis and microaneurysm sign.

Hypertension model

Usually use spontaneous type hypertension outbreeding rat (SHR) in essential hypertension and the cardiovascular research.Male, 12 week ages or older rat present average systolic credibly and be higher than 200mmHg.The antihypertensive function of kidney enzyme can be tested in SHR.

The SHR rat is divided into two groups, every group of 12 rats.Only accept the vehicle damping fluid for one group, and another winding is subjected to the kidney enzyme of 100 μ g/kg body weight, give twice through SQ every day.Continue to give kidney enzyme or vehicle about 2-6 week.Detect rat blood pressure every day by implantable telemetering system.

The congestive heart failure model

Congestive heart failure (CHF) model is fully described in the literature, comprises large animal and animalcule.The technician can use the prevention and the therapeutic action of these model measurement kidney enzymes.For example, as Delehanty et al (Delehanty JM et al., Am J Physiol.1994 Mar; 266 (3 Pt 2): H930-5) described, can use the rapid ventricular pacing model in dog class (being dog), to induce CHF.Dog is carried out pace-making 225 times/minute, continue to produce in 8 weeks in heart failure, this can by with compare the left atrium blood pressure that increases with the dog in 100 times/minute 8 weeks of pace-making, show with respect to the first order derivative (first derivative) of the left ventricular blood drops of time and the cardiac output that reduces.The dog of rapid pacing also presents the plasmal NE that increases and the myocardium NE content of reduction.

Also can use other CHF animal model.For example, as previously mentioned male Sprague-Dawley (SD) rat is carried out arteria coroaria sinistra ligation (Greenen, D.L.et al., J.Appl.Physiol.63:92-96 (1987); Buttrick, P.et al., Am.J.Physiol.260:11473-11479 (1991)) to induce myocardial infarction.With vetanarcol (60) mg/kg, ip) anesthesia by the tracheotomy intubate, and is taken a breath by respirator with rat.Carrying out left side thoracotomy postoperative, with arteria coroaria sinistra from apart from the about 2mm part of its root with the thread suture line ligation of 7-0.The sham-operation animal carries out identical program, still suture line is passed then under coronary artery and removes.4-6 is in week after ligation, and the myocardial infarction of rat can develop into heart failure.In clinical patients, myocardial infarction or coronary heart disease are to cause the most common factor in heart failure.The congestive heart failure in most patient is simulated in congestive heart failure better in this model.

The apoplectic stroke model

Apoplexy (stroke) is because the burst afunction that the blood supply of brain causes unusually.Apoplexy exists " transient ischemic attack " or " TIA " (impermanency anergy), " the non-SIE of part ", " completed stroke " types such as (permanent calamitous neurological handicaps) according to the different levels of severity.

There is spontaneously hypertensive (SHR-SP) rat of apoplexy tendency to be generally used for apoplexy model.This experiment can be used for testing the possible beneficial effect of kidney enzyme in the preventing/treating of apoplexy.With male 8 the week age SHR-SP rat be divided into two groups at random.The water that control rats gives common food and contains 1%NaCl is as drinkable solutions, and control group is accepted the vehicle injection.The treatment winding is subjected to continue 4-8 week through the kidney enzyme (100 μ g/kg, twice of every day) of SQ injection.Systolic pressure is measured by the tail-cuff method conscious animal, and the apoplexy rate in these two groups uses nuclear magnetic resonance (MRI), histopathology and neurobehavioral to measure.

The arthrosclerosis model

Known catecholamine causes blood vessel injury, and exist cause under the situation of hyperlipidaemia quickening with the atherosclerosis (Kukreja RS et al, the Atherosclerosis. (1981) 40 (3-4): 291-8.) that worsen.Therefore, but kidney enzyme preventing/treating atherosclerosis.As Kukreja etal (Kukreja RS et al, Atherosclerosis.1981 Nov-Dec; 40 (3-4): 291-8.) described, late period Aorta and coronary atherosclerosis can utilize two programs to produce in rhesus monkey: (a) give 7 months higher fatty acid and high-cholesterol diet, and (b) with this diet in conjunction with i.v. injection every day suprarenin (50 μ g/kg body weight).It is atherosis that the monkey that has carried out program (b) will obviously produce late arterial, and there to be the form performance of fibrous spot in Aorta and the coronary artery, it is very low that these infringements are expected at other group medium frequency.The ratio of total serum cholesterol and free serum cholesterol significantly increases, and the Aorta cholesterol level is very high in the monkey that causes atheromatous diet and epinephrine injection.These models can be used for testing the kidney enzyme for preventing and treat atherosclerotic effect.

The another kind of model of test kidney enzyme comprises apoE knock-out mice (Zhang SH, ReddickRL, Piedrahita JA, Maeda N., (1992) Spontaneous hypercholesterolemiaand arterial lesions in mice lacking apolipoprotein E, Science, 258,468-471).The apoE knock-out mice destroys the apoE gene by the gene target technology and produces in embryonic stem cell.ApoE is a kind of glycoprotein, is the constituent by liver synthetic vldl (VLDL) and enteron aisle synthetic chylomicron.It also is the composition that participates in the active high-density lipoprotein (HDL) of cholesterol transport (HDL) subclass in the cell.One of most important functions of apoE is that mediation chylomicron and the VLDL particle that contains apoE combine with the high affinity of low-density lipoprotein (LDL) acceptor.Like this can be so that liver specificity absorb these particles, this is that cholesterol transport is necessary, prevents that the residue that is rich in cholesterol from gathering in blood plasma.The inactivation that isozygotys of apoE gene causes there is not apoE in the animal serum.Mouse seems to grow normal, but the plasma cholesterol that they present is 5 times of the normal serum plasma cholesterol, and presents spontaneous atherosclerotic lesions.This with have with the variant form apoE gene of ldl receptor binding deficient and be in plasma triglyceride that the dangerous neutralization of early stage generation atherosclerosis increases and the human body of cholesterol levels in the disease that produces consistent.The apoE knock-out mice is widely used as Atherosclerosis Model and causes the therapeutic intervention scheme of Atherosclerosis with the research modification, and can be used for testing the effect of this treatment plan that uses the kidney enzyme in the present invention.

Embodiment 6: further research

Except previous embodiment, the inventor also plans or has carried out some researchs.Research is included in the relation between the clinical evaluation kidney enzyme level and renal function in about 300 objects.70 people registration is arranged so far.Approximately 6-7 week can obtain PRELIMINARY RESULTS.In another research, the inventor will estimate in the rat model of chronic renal failure, give the progress of kidney enzyme for chronic nephropathy and the effect of the generation of cardiovascular complication for a long time by subcutaneous injection.In another research, the inventor will estimate the effectiveness of intramuscularly CMV-kidney enzyme carrier in rat model.

Discuss

The third monoamine oxidase that the kidney enzyme that the present invention differentiates is to use functioning gene group database to differentiate in human body.Similar with MAO-B to MAO-A, kidney enzymes metabolism catecholamine is as Dopamine HCL (DA), norepinephrine (NA) and suprarenin (EP).The kidney enzyme has some important specific characteristics different with MAO-A and MAO-B.At first, compare with MAO-B with MAO-A, the kidney enzyme is mainly expressed in kidney, has unique effect in all outside metabolism catecholamines of prompting kidney enzyme.The metabolism that it is believed that the round-robin monoamine is carried out (Eisenhofer et al., 2001) by many intracellular enzymes, comprises MAO-A, MAO-B, catechol-O-methyltransferase (COMT) and sulfotransferase.Because these enzymes have location in the born of the same parents, the main mechanism in the life-span of restriction circulation catecholamine is to absorb to cell by active transport, is not by enzymes metabolism.The main effect of this and MAO-A and MAO-B depends on storage identical of views of amine in the adjusting of the metabolism of amine and neurotransmitter levels and the born of the same parents.

Secondly, different with MAO-A that is arranged in mitochondrial outer membrane and MAO-B, the kidney enzyme is a kind of secretory protein, and the prompting catecholamine is removed and can be occurred in extracellular space, and having challenged catecholamine must be absorbed to carry out catabolic traditional idea by cell.The kidney enzyme circulates in blood, at this its katabolism serum catecholamine.Possible kidney enzyme is " fine setting " blood plasma catechlolamine level constantly.

The 3rd, the kidney enzyme is expressed at the kidney camber, and the prompting kidney participates in the catecholamine degraded by the kidney enzymatic pathway.Data provided herein and kidney enzyme are in whole body level and consistent in the hypothesis of local kidney horizontal adjustment catecholamine.Can imagine, with the MAO-A and the MAO-B associating of amine in the katabolism born of the same parents, the kidney enzyme is a kind of important enzyme of the outer catecholamine of oxidation born of the same parents, therefore helps to regulate comprehensive sympathetic tone.

The kidney enzyme is enrichment in proximal tubule, it exists in the blood circulation of normal individual, kidney zymoprotein in the prompting proximal tubule can be secreted in the into blood circulation by basilar membrane, at its substrate of this katabolism, therefore in whole body horizontal adjustment catecholamine stable state.

Possible kidney enzyme is also brought into play its biological function in the uriniferous tubules chamber, because the kidney enzyme is a small protein, can be easy to filter to nephron chamber.In addition, the kidney enzyme can reach substrate such as the Dopamine HCL (Wang et al., 2001) that is produced again once more by renal tubular cell in this its metabolism by proximal tubule by top film direct secretion by glomerular filtration.The kidney enzyme is to regulate the inner chamber catecholamine levels in the meaning of inner chamber metabolism catecholamine, regulates the absorption again of salt and water thus.

Recent research has illustrated blood plasma Dopamine HCL (Cuche et al., 1986; Prinseau etal., 1986) and norepinephrine (Zoccalie et al., 2002) lasting rising in ESRD patient.These changes of catecholamine levels are extremely important for the morbidity of cardiovascular disorder, described cardiovascular disorder such as asymptomatic type left ventricle dysfunction (Benedict et al., 1996), chronic heart failure (Rouleau et al., 1994) and atherosclerosis (Rozanskiet-al., 1999).The importance of cardiovascular complication camber sympathetic tone is also supported (Tendera et al., 2001) by intervention study.In ESRD patient, the circulation catecholamine of increase can be so that a series of cardiovascular complications of uremic patient susceptible comprise left ventricular hypertrophy and arrhythmia (Zoccali et al., 2002).The mechanism that catecholamine raises among the ESRD patient is also not clear.The present invention can explain the pathogenesis of catecholamine disorder among these patients about the announcement of kidney enzyme (kidney enzyme katabolism catecholamine and express at the kidney camber), because these patients lose its kidney entity (reducing similar to secretable erythropoietin among the ESRD patient).

Significantly reduction is not wondrous to observe the kidney enzyme in ESRD patient, because the kidney enzyme is mainly expressed in kidney, this is the organ of ESRD patient's loss of function.The fact that kidney enzyme katabolism catecholamine increases in conjunction with catecholamine levels among the ESRD patient, obviously prompting kidney enzyme is a kind of key protein matter of keeping the catecholamine stable state, and MAO-C causes that catecholamine is disorderly and causes hypertension, cardiovascular disorder such as asymptomatic type left ventricle dysfunction, chronic heart failure and the atherosclerotic omission factor (missing factor).

The detailed description that preamble carries out is just in order more to be expressly understood the present invention, and do not have any restriction the present invention's meaning, and those skilled in the art can make amendment to the present invention.

The present invention is described in conjunction with its specificity embodiment, should understand and further to revise the present invention, the application contains any variation, application or the adjustment that principle according to the present invention has been done, comprise and run counter to that the present invention discloses but any adjustment in known in the art or customary practice, the present invention can be applied according to basic special disease mentioned above and the requirement of appended claims subsequently.

Reference

The disclosing of each patent, patent application and the publication that this paper quotes includes but not limited to the document hereinafter listed, and it incorporates reference in full with it.

1.Brenner，B.M.，Deen，W.M.& Robertson，C.R.Determinants ofglomerular filtration rate.Annu Rev Physiol 38，11-19(1976).

2.Lin，F.K.et al.Cloning and expression of the human erythropoietingene.Proc Natl Acad Sci USA 82，7580-4(1985).

3.Jacobs，K.et al.Isolation and characterization of genomic andcDNAclones of human erythropoietin.Nature 313，806-10(1985).

4.Humes，H.D.Acute renal failure：prevailing challenges and prospectsfor the future.Kidney Int Suppl 50，S26-32(1995).

5.Wolfe，R.A.et al.Comparison of mortality in all patients on dialysis，patients on dialysis awaiting transplantation，and recipients of a firstcadaveric transplant.N Engl J Med 341，1725-30(1999).

6.Oberg，B.P.et al.Increased prevalence of oxidant stress andinflammation in patients with moderate to severe chronic kidneydisease.Kidney Int 65，1009-16(2004).

7.Koomans，H.A.，Blankestijn，P.J.& Joles，J.A.Sympathetichyperactivity in chronic renal failure：a wake-up call.J Am SocNephrol 15，524-37(2004).

8.Joles，J.A.& Koomans，H.A.Causes and consequences of increasedsympathetic activity in renal disease.Hypertension 43，699-706(2004).

9.Strausberg，R.L.，Feingold，E.A.，Klausner，R.D.& Collins，F.S.Themammalian gene collection.Science 286，455-7(1999).

10.Binda，C.，Mattevi，A.& Edmondson，D.E.Structure-functionrelationships in flavoenzyme-dependent amine oxidations：acomparison of polyamine oxidase and monoamine oxidase.J BiolChem 277，23973-6(2002).

11.Jalkanen，S.& Salmi，M.Cell surface monoamine oxidases：enzymesin search of a function.Embo J 20，3893-901(2001).

12.Binda，C.，Newton-Vinson，P.，Hubalek，F.，Edmondson，D.E.&Mattevi，A.Structure of human monoamine oxidase B，a drug targetfor the treatment of neurological disorders.Nat Struct Biol 9，22-6(2002).

13.Liang，X.et al.Transcriptionally active polymerase chain reaction(TAP)：high throughput gene expression using genome sequence data.JBiol Chem 277，3593-8(2002).

14.Salmi，M.& Jalkanen，S.VAP-1：an adhesin and an enzyme.TrendsImmunol 22，211-6(2001).

15.Zoccali，C.et al.Norepinephrine and concentric hypertrophy inpatients with end-stage renal disease.Hypertension 40，41-6(2002).

16.Zoccali，C.et al.Plasma norepinephrine predicts survival and incidentcardiovascular events in patients with end-stage renal disease.Circulation 105，1354-9(2002).

17.Hausberg，M.et al.Sympathetic nerve activity in end-stage renaldisease.Circulation 106，1974-9(2002).

18.Tian，S.et al.Regulation of the voltage-gated K(+)channelKCNA10byKCNA4B，a novel beta-subunit.Am J Physiol Renal Physiol 283，F142-9.(2002).

19.Yao，X.，Tian，S.，Chan，H.-Y.，Biemesderfer，D.& Desir，G.Expression of KCNA10，a voltage-gated K channel，in glomerularendothelium and at the apical membrane of the renal proximal tubule.JAm Soc Nephrol 13，2831-2839(2002).

20.Massey，V.(2000)The chemical and biological versatility ofriboflavin.Biochem.Soc.Trans.28，283-296.

21.Weyler，W.，Hsu，Y.P.，and Breakfield，X.(1990)Biochemistry andgenetics of monoamine oxidase.Pharmacol.Ther.47，391-417 12.

22.Shih，J.C.，Chen，K.，and Ridd，M.J.(1999)Monoamine oxidase：from genes to behavior.Annu.Rev.Neurosci.22，197-217.

23.Cesura，A.M.，and Pletscher，A.(1992)The new generation ofmonoamine oxidase inhibitors.Prog.Drug.Res.38，171-297.

24.Kearney，E.B.，Salach，J.I.，Walker，W.H.，Seng，R.L.，Kenney，W.，Zeszotek，E.，and Singer，T.P.(1997)The covalently-bound flavin ofhepatic monoamine oxidase.1.Isolation and sequence of a flavinpeptide and evidence for binding at the 8 alpha position.Eur.J.Biochem.24，321-327.

25.Xiaowu Liang，Andy Teng，Dawn M.Braun，Jiin Felgner，Yan Wang，Scott I.Baker，Shizong Chen，Olivier Zelphati，and Philip L.Felgner.Transcriptionally Active Polymerase Chain Reaction(TAP)J.Biol.Chem.，277：3593-3598.(2002).

26.Yao X，Tian S，Chan HY，Biemesderfer D，Desir GV. ExpressionofKCNA10，a Voltage-Gated K Channel，inGlomerular Endothelium andat the Apical Membrane of the Renal Proximal Tubule.J Am SocNephrol.(2002)13(12)：2831-9.

27.Strausberg，R.L.，Feingold，E.A.，Klausner，R.D.，& Collins，F.S.The mammalian gene collection.Science 286，455-457.(1999).

28.Stroud，R.M.，and Walter，P.(1999)Signal sequence recognition andprotein targeting.Curr.Opin.Struct.Biol.9，754-759.

29.Henrik Nielsen and Anders Krogh：Prediction of signal peptides andsignal anchors by a hidden Markov model.In Proceedings of the SixthInternational Conference on Intelligent Systems for Molecular Biology(ISMB 6)，AAAI Press，Menlo Park，California，pp.122--130(1998).

30.Falquet L，Pagni M，Bucher P，Hulo N，Sigrist CJ，Hofmann K &Bairoch A.(2002)The PROSITE database，its status in 2002.NucleicAcids Res.30：235-238.

31.Eisenhofer G，Huynh TT，Hiroi M，Pacak K.Understandingcatecholamine metabolism as a guide to the biochemical diagnosis ofpheochromocytoma Rev Endocr Metab Disord.2001 Aug；2(3)：297-311.

32.Zoccali C，Mallamaci F，Parlongo S，Cutrupi S，Benedetto FA，TripepiG，Bonanno G，Rapisarda F，Fatuzzo P，Seminara G，Cataliotti A，Stancanelli B，Malatino LS，Cateliotti A.Plasma norepinephrinepredicts survival and incident cardiovascular events in patients withend-stage renal disease.Circulation 2002 19；105(11)：1354-9.

33.Benedict CR，Shelton B，Johnstone DE，et al，for the SOLVDInvestigators.Prognostic significance of plasma norepinephrine inpatients with asymptomatic left ventricular dysfunction.Circulation.1996；94：690-697.

34.Rouleau JL，Packer M，Moye L，et al.Prognostic valueofneurohormonal activation in patients with an acute myocardialinfarction：effect of captopril.J Am Coll Cardiol.1994；24：583-591.

35.Rozanski A，Blumenthal JA.Kaplan J.Impact of psychologicalfactors on the pathogenesis of cardiovascular disease and implicationsfor therapy.Circulation.(1999)99：2192-2217.

36.Tendera M，Ochala A.Overview of the results of recent beta blockertrials.Curr Opin Cardiol.(2001)16：180-185.

37.Graham FL，Smiley J，Russell WC，Nairn R.Characteristics of ahuman cell line transformed by DNA from humanadenovirus type 5.JGen Virol 1977 36(1)：59-74.

38.Wang Y，Berndt TJ，Gross JM，Peterson MA，So MJ，Knox FG.Effectof inhibition of MAO and COMT on intrarenal dopamine and serotoninand on renal function.Am J Physiol Regul Integr Comp Physiol.2001280(1)：R248-54.

39.Excerpts from United States Renal Data System.Annual Data Report.Am.J.Kidney Dis.32(suppl 1)，569-580.(1998).

40.Humes，H.D.Acute renal failure：prevailing challenges and prospectsfor the future.Kidney Int.48，S-26-S-32.(1995).

41.Wolfe，R.，V.Ashby，E.Milord，et al.Comparison of mortality in allpatients on dialysis，patients on dialysis N Engl.J.Med.341：1725-1730.(1999).

42.Yagi，N.& Paganini E.P.Acute dialysis and continuous renalreplacement：the emergence of new technology involving thenephrologist in the intensive care setting.Semin.Nephrol.17，306-320.(1997).

43.Mehta，R.L.Therapeutic alternatives to renal replacement forcritically ill patients in acute renal failure.Semin.Nephrol.14，64-82.(1994).

44.Zarowitz，B.J.，Anandan，J.V.，Dumler，F.，Jayashankar，J.& Levin，N.Continuous arteriovenous hemofiltration of aminoglycosideantibiotics in critically ill patients.J.Clin.Pharm.26，686-689.(1986).

45.Jacobs K，Shoemaker C，Rudersdorf R，Neill SD，Kaufman RJ，Mufson A，Seehra J，Jones SS，Hewick R，Fritsch EF，et al.Isolationand characterization of genomic andcDNA clones of humanerythropoietin.Nature 313：806-10.(1985).

46.Lin FK，Suggs S，Lin CH，Browne JK，Smalling R，Egrie JC，ChenKK，Fox GM，Martin F，Stabinsky Z，et al.Cloning and expression ofthe human erythropoietin gene.Proc Natl Acad Sci USA.82(22)：7580-4.(1985).

47.Frangioni，J.V.and Neel，B.G.，Solubilization and purification ofenzymatically active glutathione S-transferase(pGEX)fusion proteins.Anal.Biochem.210，179-187(1993).

48.Zhuang Z，Hogan M，McCauley R.The in vitro insertion ofmonoamine oxidase B into mitochondrial outer membranes.FEBS Lett238：185-190.(1988).

49.Cuche JL，Prinseau J，Selz F，Ruget G，Baglin A.Plasma free，sulfo-and glucuro-conjugated catecholamines inuremic patients.Kidney Int.30(4)：566-72.(1986).

50.Prinseau J，Ruget G，Selz F，Baglin A，Fritel D，Cuche JL.Plasmacatecholamines，free and conjugated，in the hemodialyzed chronic renalfailure patient.Arch Mal Coeur Vaiss.79(6)：835-9.(1986).

51.Zoccali C，Mallamaci F，Parlongo S，Cutrupi S，B enedetto FA，TripepiG，Bonanno G，Rapisarda F，Fatuzzo P，Seminara G，Cataliotti A，Stancanelli B，Malatino LS，Cateliotti A.Plasma norepinephrinepredicts survival and incident cardiovascular events in patients withend-stage renal disease.Circulation 19；105(11)：1354-9.(2002).

52.Benedict CR，Shelton B，Johnstone DE，et al，for the SOLVDInvestigators.Prognostic significance of plasma norepinephrine inpatients with asymptomatic left ventricular dysfunction.Circulation.94：690-697.(1996).

53.Rouleau JL，Packer M，Moye L，et al.Prognostic valueofneurohormonal activation in patients with an acute myocardialinfarction：effect of captopril.J Am Coll Cardiol.24：583-591.(1994).

54.Rozanski A，Blumenthal JA.Kaplan J.Impact of psychologicalfactors on the pathogenesis of cardiovascular disease and implicationsfor therapy.Circulation.99：2192-2217.(1999).

55.Tendera M，Ochala A.Overview of the results of recent beta blockertrials.Curr Opin Cardiol.16：180-185.(2001).

Sequence table

＜110〉Yale University

＜120〉detection, separation and the application of kidney enzyme (monoamine oxidase C)

<130>044574-5132-WO

<150>US 60/554,552

<151>2004-03-19

<150>US 60/615,452

<151>2004-10-01

<160>13

<170>PatentIn version 3.2

<210>1

<211>1477

<212>DNA

<213>Homo sapiens

<220>

<221>CDS

<222>(24)..(1052)

<400>1

gcggatcgct gctccctctc gcc atg gcg cag gtg ctg atc gtg ggc gcc ggg 53

Met Ala Gln Val Leu Ile Val Gly Ala Gly

1 5 10

atg aca gga agc ttg tgc gct gcg ctg ctg agg agg cag acg tcc ggt 101

Met Thr Gly Ser Leu Cys Ala Ala Leu Leu Arg Arg Gln Thr Ser Gly

15 20 25

ccc ttg tac ctt gct gtg tgg gac aag gct gac gac tca ggg gga aga 149

Pro Leu Tyr Leu Ala Val Trp Asp Lys Ala Asp Asp Ser Gly Gly Arg

30 35 40

atg act aca gcc tgc agt cct cat aat cct cag tgc aca gct gac ttg 197

Met Thr Thr Ala Cys Ser Pro His Asn Pro Gln Cys Thr Ala Asp Leu

45 50 55

ggt gct cag tac atc acc tgc act cct cat tat gcc aaa aaa cac caa 245

Gly Ala Gln Tyr Ile Thr Cys Thr Pro His Tyr Ala Lys Lys His Gln

60 65 70

cgt ttt tat gat gaa ctg tta gcc tat ggc gtt ttg agg cct cta agc 293

Arg Phe Tyr Asp Glu Leu Leu Ala Tyr Gly Val Leu Arg Pro Leu Ser

75 80 85 90

tcg cct att gaa gga atg gtg atg aaa gaa gga gac tgt aac ttt gtg 341

Ser Pro Ile Glu Gly Met Val Met Lys Glu Gly Asp Cys Asn Phe Val

95 100 105

gca cct caa gga att tct tca att att aag cat tac ttg aaa gaa tca 389

Ala Pro Gln Gly Ile Ser Ser Ile Ile Lys His Tyr Leu Lys Glu Ser

110 115 120

ggt gca gaa gtc tac ttc aga cat cgt gtg aca cag atc aac cta aga 437

Gly Ala Glu Val Tyr Phe Arg His Arg Val Thr Gln Ile Asn Leu Arg

125 130 135

gat gac aaa tgg gaa gta tcc aaa caa aca ggc tcc cct gag cag ttt 485

Asp Asp Lys Trp Glu Val Ser Lys Gln Thr Gly Ser Pro Glu Gln Phe

140 145 150

gat ctt att gtt ctc aca atg cca gtt cct gag att ctg cag ctt caa 533

Asp Leu Ile Val Leu Thr Met Pro Val Pro Glu Ile Leu Gln Leu Gln

155 160 165 170

ggt gac atc acc acc tta att agt gaa tgc caa agg cag caa ctg gag 581

Gly Asp Ile Thr Thr Leu Ile Ser Glu Cys Gln Arg Gln Gln Leu Glu

175 180 185

gct gtg agc tac tcc tct cga tat gct ctg ggc ctc ttt tat gaa gct 629

Ala Val Ser Tyr Ser Ser Arg Tyr Ala Leu Gly Leu Phe Tyr Glu Ala

190 195 200

ggt acg aag att gat gtc cct tgg gct ggg cag tac atc acc agt aat 677

Gly Thr Lys Ile Asp Val Pro Trp Ala Gly Gln Tyr Ile Thr Ser Asn

205 210 215

ccc tgc ata cgc ttc gtc tcc att gat aat aag aag cgc aat ata gag 725

Pro Cys Ile Arg Phe Val Ser Ile Asp Asn Lys Lys Arg Asn Ile Glu

220 225 230

tca tca gaa att ggg cct tcc ctc gtg att cac acc act gtc cca ttt 773

Ser Ser Glu Ile Gly Pro Ser Leu Val Ile His Thr Thr Val Pro Phe

235 240 245 250

gga gtt aca tac ttg gaa cac agc att gag gat gtg caa gag tta gtc 821

Gly Val Thr Tyr Leu Glu His Ser Ile Glu Asp Val Gln Glu Leu Val

255 260 265

ttc cag cag ctg gaa aac att ttg ccg ggt ttg cct cag cca att gct 869

Phe Gln Gln Leu Glu Asn Ile Leu Pro Gly Leu Pro Gln Pro Ile Ala

270 275 280

acc aaa tgc caa aaa tgg aga cat tca cag gtt aca aat gct gct gcc 917

Thr Lys Cys Gln Lys rrp Arg His Ser Gln Val Thr Asn Ala Ala Ala

285 290 295

aac tgt cct ggc caa atg act ctg cat cac aaa cct ttc ctt gca tgt 965

Asn Cys Pro Gly Gln Met Thr Leu His His Lys Pro Phe Leu Ala Cys

300 305 310

gga ggg gat gga ttt act cag tcc aac ttt gat ggc tgc atc act tct 1013

Gly Gly Asp Gly Phe Thr Gln Ser Asn Phe Asp Gly Cys Ile Thr Ser

315 320 325 330

gcc cta tgt gtt ctg gaa gct tta aag aat tat att tag tgcctatatc 1062

Ala Leu Cys Val Leu Glu Ala Leu Lys Asn Tyr Ile

335 340

cttattctct atatgtgtat tgggttttta ttttcacaat tttctgttat tgattatttt 1122

gttttctatt ttgctaagaa aaattactgg aaaattgttc ttcacttatt atcatttttc 1182

atgtggagta taaaatcaat tttgtaattt tgatagttac aacccatgct agaatggaaa 1242

ttcctcacac cttgcacctt ccctactttt ctgaattgct atgactactc cttgttggag 1302

gaaaagtggt acttaaaaaa taacaaacga ctctctcaaa aaaattacat taaatcacaa 1362

taacagtttg tatgccaaaa acttgattat ccttatgaaa atttcaattc tgaataaaga 1422

ataatcacat tatcaaagcc ccatcaaaaa aaaaaaaaaa aaaaaaaaaa aaaaa 1477

<210>2

<211>342

<212>PRT

<213>Homo sapiens

<400>2

Met Ala Gln Val Leu Ile Val Gly Ala Gly Met Thr Gly Ser Leu Cys

1 5 10 15

Ala Ala Leu Leu Arg Arg Gln Thr Ser Gly Pro Leu Tyr Leu Ala Val

20 25 30

Trp Asp Lys Ala Asp Asp Ser Gly Gly Arg Met Thr Thr Ala Cys Ser

35 40 45

Pro His Asn Pro Gln Cys Thr Ala Asp Leu Gly Ala Gln Tyr Ile Thr

50 55 60

Cys Thr Pro His Tyr Ala Lys Lys His Gln Arg Phe Tyr Asp Glu Leu

65 70 75 80

Leu Ala Tyr Gly Val Leu Arg Pro Leu Ser Ser Pro Ile Glu Gly Met

85 90 95

Val Met Lys Glu Gly Asp Cys Asn Phe Val Ala Pro Gln Gly Ile Ser

100 105 110

Ser Ile Ile Lys His Tyr Leu Lys Glu Ser Gly Ala Glu Val Tyr Phe

115 120 125

Arg His Arg Val Thr Gln Ile Asn Leu Arg Asp Asp Lys Trp Glu Val

130 135 140

Ser Lys Gln Thr Gly Ser Pro Glu Gln Phe Asp Leu Ile Val Leu Thr

145 150 155 160

Met Pro Val Pro Glu Ile Leu Gln Leu Gln Gly Asp Ile Thr Thr Leu

165 170 175

Ile Ser Glu Cys Gln Arg Gln Gln Leu Glu Ala Val Ser Tyr Ser Ser

180 185 190

Arg Tyr Ala Leu Gly Leu Phe Tyr Glu Ala Gly Thr Lys Ile Asp Val

195 200 205

Pro Trp Ala Gly Gln Tyr Ile Thr Ser Asn Pro Cys Ile Arg Phe Val

210 215 220

Ser Ile Asp Asn Lys Lys Arg Asn Ile Glu Ser Ser Glu Ile Gly Pro

225 230 235 240

Ser Leu Val Ile His Thr Thr Val Pro Phe Gly Val Thr Tyr Leu Glu

245 250 255

His Ser Ile Glu Asp Val Gln Glu Leu Val Phe Gln Gln Leu Glu Asn

260 265 270

Ile Leu Pro Gly Leu Pro Gln Pro Ile Ala Thr Lys Cys Gln Lys Trp

275 280 285

Arg His Ser Gln Val Thr Asn Ala Ala Ala Asn Cys Pro Gly Gln Met

290 295 300

Thr Leu His His Lys Pro Phe Leu Ala Cys Gly Gly Asp Gly Phe Thr

305 310 315 320

Gln Ser Asn Phe Asp Gly Cys Ile Thr Ser Ala Leu Cys Val Leu Glu

325 330 335

Ala Leu Lys Asn Tyr Ile

340

<210>3

<211>2107

<212>DNA

<213>Homo sapiens

<400>3

aaaagcccgg gccgaacggc cccgccgcag agactcagcg cggatcgctg ctccctctcg 60

ccatggcgca ggtgctgatc gtgggcgccg ggatgacagg aagcttgtgc gctgcgctgc 120

tgaggaggca gacgtccggt cccttgtacc ttgctgtgtg ggacaaggct gaggactcag 180

ggggaagaat gactacagcc tgcagtcctc ataatcctca gtgcacagct gacttgggtg 240

ctcagtacat cacctgcact cctcattatg ccaaaaaaca ccaacgtttt tatgatgaac 300

tgttagccta tggcgttttg aggcctctaa gctcgcctat tgaaggaatg gtgatgaaag 360

aaggagactg taactttgtg gcacctcaag gaatttcttc aattattaag cattacttga 420

aagaatcagg tgcagaagtc tacttcagac atcgtgtgac acagatcaac ctaagagatg 480

acaaatggga agtatccaaa caaacaggct cccctgagca gtttgatctt attgttctca 540

caatgccagt tcctgagatt ctgcagcttc aaggtgacat caccacctta attagtgaat 600

gccaaaggca gcaactggag gctgtgagct actcctctcg atatgctctg ggcctctttt 660

atgaagctgg tacgaagatt gatgtccctt gggctgggca gtacatcacc agtaatccct 720

gcatacgctt cgtctccatt gataataaga agcgcaatat agagtcatca gaaattgggc 780

cttccctcgt gattcacacc actgtcccat ttggagttac atacttggaa cacagcattg 840

aggatgtgca agagttagtc ttccagcagc tggaaaacat tttgccgggt ttgcctcagc 900

caattgctac caaatgccaa aaatggagac attcacaggt accaagtgct ggtgtgattc 960

taggatgtgc gaagagcccc tggatgatgg cgattggatt tcccatctga cttcctggaa 1020

attggagcac acagtcaggt tttatttgat tttttttttt aaggatacca cttcacagcc 1080

tttaggatag ctattattta gaagcaaaac agaagataaa tgttggcaag gatgtggaga 1140

tattggattc ccttgtgcag tgccggtggg aatgtaaaat gatgtagcta ctatggaaaa 1200

tgatacggca atttctttag aaatgaaata tagaattgcc gtatgatctg cagttccaca 1260

tctggatatc tatccaaaag aagtgaaagt agggacttga acgaacattt gtacaccaat 1320

gttcacagcg gctttattca caacagccaa aaggtggaag caacccagtg tccatggata 1380

gatgaataga taaataaaat gtggtataaa catacaatgg gctattgttt agccttaaaa 1440

gggaaggaaa ttctgacatg ctgcaatatg gatgaagctt aaagtcatta tgcaaagtgg 1500

aataagccta tcacaaaaaa taatattaca taattctact tatatgagga atctagagca 1560

gtcagtttca cagagacaga aaatagaatg gtggttgcca agggctggga gaagagggca 1620

atggagagtg agtgtttagt gggtcagagt tttagtttgg gaaggtaaaa agttctggag 1680

atggatgatg gttatgggtg ctcaacagtg tgaatgtact taatgccaca gaactgcaca 1740

tttaaatgtg gttaaaatca tcacttttat gttatgtata tttaccacaa taaataaaga 1800

agttgatatt tcttatactt acaaagagga gaagggcatt tgcaaatcaa caagaagtgt 1860

gaggcccctc tctctagcag aaaaatagac taaatctatt tctttatctt ttaacatcct 1920

gtttaaggga aatgccaaaa caaatgggaa aaaatacaca cacacaaata tatatgaaca 1980

tgttttgcct catgagtaat caaaatgtgt acatatgtat gtttatgtat gtgtgtttat 2040

atttaaaatc gtgttctgcc ttatgagtaa acaaaaagta tacaaattaa aaactataat 2100

gaaacgt 2107

<210>4

<211>2107

<212>DNA

<213>Homo sapiens

<400>4

aaaagcccgg gccgaacggc cccgccgcag agactcagcg cggatcgctg ctccctctcg 60

ccatggcgca ggtgctgatc gtgggcgccg ggatgacagg aagcttgtgc gctgcgctgc 120

tgaggaggca gacgtccggt cccttgtacc ttgctgtgtg ggacaaggct gaggactcag 180

ggggaagaat gactacagcc tgcagtcctc ataatcctca gtgcacagct gacttgggtg 240

ctcagtacat cacctgcact cctcattatg ccaaaaaaca ccaacgtttt tatgatgaac 300

tgttagccta tggcgttttg aggcctctaa gctcgcctat tgaaggaatg gtgatgaaag 360

aaggagactg taactttgtg gcacctcaag gaatttcttc aattattaag cattacttga 420

aagaatcagg tgcagaagtc tacttcagac atcgtgtgac acagatcaac ctaagagatg 480

acaaatggga agtatccaaa caaacaggct cccctgagca gtttgatctt attgttctca 540

caatgccagt tcctgagatt ctgcagcttc aaggtgacat caccacctta attagtgaat 600

gccaaaggca gcaactggag gctgtgagct actcctctcg atatgctctg ggcctctttt 660

atgaagctgg tacgaagatt gatgtccctt gggctgggca gtacatcacc agtaatccct 720

gcatacgctt cgtctccatt gataataaga agcgcaatat agagtcatca gaaattgggc 780

cttccctcgt gattcacacc actgtcccat ttggagttac atacttggaa cacagcattg 840

aggatgtgca agagttagtc ttccagcagc tggaaaacat tttgccgggt ttgcctcagc 900

caattgctac caaatgccaa aaatggagac attcacaggt accaagtgct ggtgtgattc 960

taggatgtgc gaagagcccc tggatgatgg cgattggatt tcccatctga cttcctggaa 1020

attggagcac acagtcaggt tttatttgat tttttttttt aaggatacca cttcacagcc 1080

tttaggatag ctattattta gaagcaaaac agaagataaa tgttggcaag gatgtggaga 1140

tattggattc ccttgtgcag tgccggtggg aatgtaaaat gatgtagcta ctatggaaaa 1200

tgatacggca atttctttag aaatgaaata tagaattgcc gtatgatctg cagttccaca 1260

tctggatatc tatccaaaag aagtgaaagt agggacttga acgaacattt gtacaccaat 1320

gttcacagcg gctttattca caacagccaa aaggtggaag caacccagtg tccatggata 1380

gatgaataga taaataaaat gtggtataaa catacaatgg gctattgttt agccttaaaa 1440

gggaaggaaa ttctgacatg ctgcaatatg gatgaagctt aaagtcatta tgcaaagtgg 1500

aataagccta tcacaaaaaa taatattaca taattctact tatatgagga atctagagca 1560

gtcagtttca cagagacaga aaatagaatg gtggttgcca agggctggga gaagagggca 1620

atggagagtg agtgtttagt gggtcagagt tttagtttgg gaaggtaaaa agttctggag 1680

atggatgatg gttatgggtg ctcaacagtg tgaatgtact taatgccaca gaactgcaca 1740

tttaaatgtg gttaaaatca tcacttttat gttatgtata tttaccacaa taaataaaga 1800

agttgatatt tcttatactt acaaagagga gaagggcatt tgcaaatcaa caagaagtgt 1860

gaggcccctc tctctagcag aaaaatagac taaatctatt tctttatctt ttaacatcct 1920

gtttaaggga aatgccaaaa caaatgggaa aaaatacaca cacacaaata tatatgaaca 1980

tgttttgcct catgagtaat caaaatgtgt acatatgtat gtttatgtat gtgtgtttat 2040

atttaaaatc gtgttctgcc ttatgagtaa acaaaaagta tacaaattaa aaactataat 2100

gaaacgt 2107

<210>5

<211>1924

<212>DNA

<213>Homo sapiens

<400>5

ggggaagtct tgtgagatct gatggttttg taaagggcag ttgtacatat gctatcttgc 60

ctgccaccac taattagtga atgccaaagg cagcaactgg aggccgtgag ctactcctct 120

cgatatgctc tgggcctctt ttatgaagct ggtacgaaga ttgatgtccc ttgggctggg 180

cagtacatca ccagtaatcc ctgcatacgc ttcgtctcca ttgataataa gaagcgcaat 240

atagagtcat cagaaattgg gccttccctc gtgattcaca ccactgtccc atttggagtt 300

acatacttgg aacacagcat tgaggatgtg caagagttag tcttccagca gctggaaaac 360

attttgccgg gtttgcctca gccaattgct accaaatgcc aaaaatggag acattcacag 420

attttgtttg gtgggggaag tggatgtgca cacagaagag cttgagacca cccgtacgtt 480

tacattatcc cctcatgaga ttaatttctg gttacaaatg ctgctgccaa ctgtcctggc 540

caaatgactc tgcatcacaa acctttcctt gcatgtggag gggatggatt tactcagtcc 600

aactttgatg gctgcatcac ttctgcccta tgtgttctgg aagctttaaa gaattatatt 660

tagtgcctat atccttattc tctacatgtg tattgggttt ttattttcac aattttctgt 720

tattgattat tttgttttct attttgctaa gaaaaattac tggaaaattg ttcttcactt 780

attatcattt ttcatgtgga gtataaaatc aattttgtaa ttttgatagt tacaacccat 840

gctagaatgg aaattcctca caccttgcac cttccctact tttctgaatt gctatgacta 900

ctccttgttg aaggaaaagt ggtacttaaa aaataacaaa cgactctctc aaaaaaatta 960

cattaaatca caataacagt ttgtatgcca aaaacttgat tatccttatg aaaatttcaa 1020

ttctgaataa agaataatca cattatcaaa gccccatctt aagtcttcgg atgtgtcctt 1080

gaatcaataa ttttgcaaat tatacaaaac aagatttttc caaaatgtag gtaacagagt 1140

gtaattctta tttctcattt atcccccaag ttattaagtg atcctgaatt gtaggtcata 1200

tatgtcatca tcttagtgtg gagggcaact tgactgataa agagaccttc cttcagattt 1260

tcagaaagta taagattcca catgattttc ccagccacac agtacttttt aactttcaaa 1320

caaattccag tcctaatatg aaagataaaa attaaataga aacagagaga aagtatatcg 1380

atccttacct tttgctatat tttatagctg ttgctgttac tttatgggct ctccagtatg 1440

tgctgtggca tttagactgt gtcgagttta atgaatttaa cacaacaaaa aatttactga 1500

accagaaaat agatgcactt aaaatagttc aatatttgcc aagttggtgg ttcagcatat 1560

cacccacatg cttcagtgac ctgaccccac gacttgctag ctggagagaa atcaatctcc 1620

agccttccaa accagctacc tgttgctaat ttgaaaagca aaatgatgag ttctatttca 1680

gcattttgaa aggagaaaaa tcattgcagc ctctcaaact aacaaaagtt caacaaaaga 1740

cttcttactg taatagtgtt taaagtttca cacttacatg tccactgtca tacatacaca 1800

tacacaggca caggcagaac ttgcttctat agctgcaaag tgggttttat gaccctatag 1860

catattatta tatgtttcct cttagcaata aattggtgaa aaacttaaat gccaaaaaaa 1920

aaaa 1924

<210>6

<211>47

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer

<400>6

tgcaggcacc gtcgtcgact taacaatgcg accccagggc cccgccg 47

<210>7

<211>82

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer

<400>7

catcaatgta tcttatcatg tctgatcaac cagctaccca tacgatgttc cagattacgc 60

tttttggtag ttcttcaata ag 82

<210>8

<211>31

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer

<400>8

ttttggatcc atggcgcagg tgctgatcgt g 31

<210>9

<211>31

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer

<400>9

ttttgaattc ctaaatataa ttctttaaag c 31

<210>10

<211>4090

<212>DNA

<213>Homo sapiens

<220>

<221>CDS

<222>(182)..(1765)

<400>10

gggcgctccc ggagtatcag caaaagggtt cgccccgccc acagtgcccg gctccccccg 60

ggtatcaaaa gaaggatcgg ctccgccccc gggctccccg ggggagttga tagaagggtc 120

cttcccaccc tttgccgtcc ccactcctgt gcctacgacc caggagcgtg tcagccaaag 180

c atg gag aat caa gag aag gcg agt atc gcg ggc cac atg ttc gac gta 229

Met Glu Asn Gln Glu Lys Ala Ser Ile Ala Gly His Met Phe Asp Val

1 5 10 15

gtc gtg atc gga ggt ggc att tca gga cta tct gct gcc aaa ctc ttg 277

Val Val Ile Gly Gly Gly Ile Ser Gly Leu Ser Ala Ala Lys Leu Leu

20 25 30

act gaa tat ggc gtt agt gtt ttg gtt tta gaa gct cgg gac agg gtt 325

Thr Glu Tyr Gly Val Ser Val Leu Val Leu Glu Ala Arg Asp Arg Val

35 40 45

gga gga aga aca tat act ata agg aat gag cat gtt gat tac gta gat 373

Gly Gly Arg Thr Tyr Thr Ile Arg Asn Glu His Val Asp Tyr Val Asp

50 55 60

gtt ggt gga gct tat gtg gga cca acc caa aac aga atc tta cgc ttg 421

Val Gly Gly Ala Tyr Val Gly Pro Thr Gln Asn Arg Ile Leu Arg Leu

65 70 75 80

tct aag gag ctg ggc ata gag act tac aaa gtg aat gtc agt gag cgt 469

Ser Lys Glu Leu Gly Ile Glu Thr Tyr Lys Val Asn Val Ser Glu Arg

85 90 95

ctc gtt caa tat gtc aag ggg aaa aca tat cca ttt cgg ggc gcc ttt 517

Leu Val Gln Tyr Val Lys Gly Lys Thr Tyr Pro Phe Arg Gly Ala Phe

100 105 110

cca cca gta tgg aat ccc att gca tat ttg gat tac aat aat ctg tgg 565

Pro Pro Val Trp Asn Pro Ile Ala Tyr Leu Asp Tyr Asn Asn Leu Trp

115 120 125

agg aca ata gat aac atg ggg aag gag att cca act gat gca ccc tgg 613

Arg Thr Ile Asp Asn Met Gly Lys Glu Ile Pro Thr Asp Ala Pro Trp

130 135 140

gag gct caa cat gct gac aaa tgg gac aaa atg acc atg aaa gag ctc 661

Glu Ala Gln His Ala Asp Lys Trp Asp Lys Met Thr Met Lys Glu Leu

145 150 155 160

att gac aaa atc tgc tgg aca aag act gct agg cgg ttt gct tat ctt 709

Ile Asp Lys Ile Cys Trp Thr Lys Thr Ala Arg Arg Phe Ala Tyr Leu

165 170 175

ttt gtg aat atc aat gtg acc tct gag cct cac gaa gtg tct gcc ctg 757

Phe Val Asn Ile Asn Val Thr Ser Glu Pro His Glu Val Ser Ala Leu

180 185 190

tgg ttc ttg tgg tat gtg aag cag tgc ggg ggc acc act cgg ata ttc 805

Trp Phe Leu Trp Tyr Val Lys Gln Cys Gly Gly Thr Thr Arg Ile Phe

195 200 205

tct gtc acc aat ggt ggc cag gaa cgg aag ttt gta ggt gga tct ggt 853

Ser Val Thr Asn Gly Gly Gln Glu Arg Lys Phe Val Gly Gly Ser Gly

210 215 220

caa gtg agc gaa cgg ata atg gac ctc ctc gga gac caa gtg aag ctg 901

Gln Val Ser Glu Arg Ile Met Asp Leu Leu Gly Asp Gln Val Lys Leu

225 230 235 240

aac cat cct gtc act cac gtt gac cag tca agt gac aac atc atc ata 949

Asn His Pro Val Thr His Val Asp Gln Ser Ser Asp Asn Ile Ile Ile

245 250 255

gag acg ctg aac cat gaa cat tat gag tgc aaa tac gta att aat gcg 997

Glu Thr Leu Asn His Glu His Tyr Glu Cys Lys Tyr Val Ile Asn Ala

260 265 270

atc cct ccg acc ttg act gcc aag att cac ttc aga cca gag ctt cca 1045

Ile Pro Pro Thr Leu Thr Ala Lys Ile His Phe Arg Pro Glu Leu Pro

275 280 285

gca gag aga aac cag tta att cag cgg ctt cca atg gga gct gtc att 1093

Ala Glu Arg Asn Gln Leu Ile Gln Arg Leu Pro Met Gly Ala Val Ile

290 295 300

aag tgc atg atg tat tac aag gag gcc ttc tgg aag aag aag gat tac 1141

Lys Cys Met Met Tyr Tyr Lys Glu Ala Phe Trp Lys Lys Lys Asp Tyr

305 310 315 320

tgt ggc tgc atg atc att gaa gat gaa gat gct cca att tca ata acc 1189

Cys Gly Cys Met Ile Ile Glu Asp Glu Asp Ala Pro Ile Ser Ile Thr

325 330 335

ttg gat gac acc aag cca gat ggg tca ctg cct gcc atc atg ggc ttc 1237

Leu Asp Asp Thr Lys Pro Asp Gly Ser Leu Pro Ala Ile Met Gly Phe

340 345 350

att ctt gcc cgg aaa gct gat cga ctt gct aag cta cat aag gaa ata 1285

Ile Leu Ala Arg Lys Ala Asp Arg Leu Ala Lys Leu His Lys Glu Ile

355 360 365

agg aag aag aaa atc tgt gag ctc tat gcc aaa gtg ctg gga tcc caa 1333

Arg Lys Lys Lys Ile Cys Glu Leu Tyr Ala Lys Val Leu Gly Ser Gln

370 375 380

gaa gct tta cat cca gtg cat tat gaa gag aag aac tgg tgt gag gag 1381

Glu Ala Leu His Pro Val His Tyr Glu Glu Lys Asn Trp Cys Glu Glu

385 390 395 400

cag tac tct ggg ggc tgc tac acg gcc tac ttc cct cct ggg atc atg 1429

Gln Tyr Ser Gly Gly Cys Tyr Thr Ala Tyr Phe Pro Pro Gly Ile Met

405 410 415

act caa tat gga agg gtg att cgt caa ccc gtg ggc agg att ttc ttt 1477

Thr Gln Tyr Gly Arg Val Ile Arg Gln Pro Val Gly Arg Ile Phe Phe

420 425 430

gcg ggc aca gag act gcc aca aag tgg agc ggc tac atg gaa ggg gca 1525

Ala Gly Thr Glu Thr Ala Thr Lys Trp Ser Gly Tyr Met Glu Gly Ala

435 440 445

gtt gag gct gga gaa cga gca gct agg gag gtc tta aat ggt ctc ggg 1573

Val Glu Ala Gly Glu Arg Ala Ala Arg Glu Val Leu Asn Gly Leu Gly

450 455 460

aag gtg acc gag aaa gat atc tgg gta caa gaa cct gaa tca aag gac 1621

Lys Val Thr Glu Lys Asp Ile Trp Val Gln Glu Pro Glu Ser Lys Asp

465 470 475 480

gtt cca gcg gta gaa atc acc cac acc ttc tgg gaa agg aac ctg ccc 1669

Val Pro Ala Val Glu Ile Thr His Thr Phe Trp Glu Arg Asn Leu Pro

485 490 495

tct gtt tct ggc ctg ctg aag atc att gga ttt tcc aca tca gta act 1717

Ser Val Ser Gly Leu Leu Lys Ile Ile Gly Phe Ser Thr Ser Val Thr

500 505 510

gcc ctg ggg ttt gtg ctg tac aaa tac aag ctc ctg cca cgg tct tga 1765

Ala Leu Gly Phe Val Leu Tyr Lys Tyr Lys Leu Leu Pro Arg Ser

515 520 525

agttctgttc ttatgctctc tgctcactgg ttttcaatac caccaagagg aaaatattga 1825

caagtttaaa ggctgtgtca ttgggccatg tttaagtgta ctggatttaa ctacctttgg 1885

cttaattcca atcattgtta aagtaaaaac aattcaaaga atcacctaat taatttcagt 1945

aagatcaagc tccatcttat ttgtcagtgt agatcaactc atgttaattg atagaataaa 2005

gccttgtgat cactttctga aattcacaaa gttaaacgtg atgtgctcat cagaaacaat 2065

ttctgtgtcc tgtttttatt cccttcaatg caaaatacat gatgatttca gaaacaaagc 2125

atttgacttt ctgtctgtgg aggtggagta ggtgaaggcc cagcctgtaa ctgtcctttt 2185

tcttccctta ggcaatggtg aactgtcatt acagagccta gaggctcaca gcctcctgga 2245

ggaagcagcc tccactttgg atcaggaaat agtaaaggaa agcagtgttg ggggtagcgg 2305

catgcagacc ctcagaccag aatggggaca tcttgtggtc tgctgcctca ggaatctcct 2365

gaccacttgt agtccctccg acttctctag acatctagtc tcagtgctag cttatttgta 2425

tttttcctct ttcacttctt atggaggaga gtgtttaact gagttagaat gttgaaactg 2485

acttgctgtg acttatgtgc agctttccag ttgagcagag gaaaatagtg gcaggactgt 2545

cccccaggag gactccctgc ttagctctgt gggagaccaa ctacgactgg catcttctct 2605

tccccctgga aggcagctag acaccaatgg atccttgtca gttgtaacat tctatttcaa 2665

cttcaggaaa gcagcagttt tcttttaatt tttcctatga ccataaaatt agacatacct 2725

ctcaacttac atatgtcttc aacatggtta cctctgcata aatattagca aagcatgcca 2785

atttctctta agtactgaaa tacatatgat aaatttgact gttatttgtt gagactatca 2845

aacagaaaag aaattagggc tctaatttcc ttaaagcaag ctcacttgct ttagttgtta 2905

agttttataa aagacatgaa attgagtcat tttatatatg aaaactaagt tctctatctt 2965

aggagtaatg tcggcccaca agggtgccca cctcttgttt tcccctttta aaaactcaga 3025

tttttaaaag ccctttccaa aggtttcaac tgtaaaatac ttctttttac aatgtatcaa 3085

catattttta tttaagggga attaacaatt gccagggaaa ccagccaacc caagtttatt 3145

atatcattaa ccttatcata aattcaaacc taagttgctg gaccctggtg tgaggacata 3205

aatcttccaa agttttgcct atcctaagag ctgcattttt ctactgctct ttaccttgca 3265

ttttagctaa tttaggagtt ttgagaatgt attggatacg ctccagtaca taaggagttg 3325

ccgcatatta tatcagactg ctttgagaaa tctcatccct agtctattgc agttgtttct 3385

attagcttac tgattaactc agtcctgaca caccttttgg gaaatgctga tttaaacttc 3445

ttaactggca acagttggaa cagtaatcag tttgctaaca tatttaaagt cttgaatgtt 3505

gaagaactca tgtgatttac ccttttcaac tttttggaaa acgatttaat ttattctaat 3565

tagattaacc ctattaatct atggattggg tatcaaaatg aatgccagtc cagatgtgcc 3625

tagacacgaa attggagctg aggactctca cgatatgcaa gttcatccaa cgtgaagata 3685

ccataagctt tttctctgaa ccagagaaat gaaagtcagt ttaagaggct gatagatctt 3745

ggccctgtta aggcatccac ttcacagttc tgaaggctga gtcagcccca ctccacagtt 3805

aggccaagaa ttagatttta aaacttcatc tgtctgtccc agttaactgt taaataaggc 3865

ctcatcctcc actgaagagt atggattgaa ggattgtgaa ctatgtttag tgtgattgtg 3925

aacttggtgc ctaatgttcc atgtctgaag tttgccccag tgctacacgt tggagtatac 3985

ctatgtgtgt gctttgccac tgaagtaaga ttttgcctgt atggtactgt tttgtttgtt 4045

aataaagtgc actgccaccc ccaatgcaaa aaaaaaaaaa aaaaa 4090

<210>11

<211>527

<212>PRT

<213>Homo sapiens

<400>11

Met Glu Asn Gln Glu Lys Ala Ser Ile Ala Gly His Met Phe Asp Val

1 5 10 15

Val Val Ile Gly Gly Gly Ile Ser Gly Leu Ser Ala Ala Lys Leu Leu

20 25 30

Thr Glu Tyr Gly Val Ser Val Leu Val Leu Glu Ala Arg Asp Arg Val

35 40 45

Gly Gly Arg Thr Tyr Thr Ile Arg Asn Glu His Val Asp Tyr Val Asp

50 55 60

Val Gly Gly Ala Tyr Val Gly Pro Thr Gln Asn Arg Ile Leu Arg Leu

65 70 75 80

Ser Lys Glu Leu Gly Ile Glu Thr Tyr Lys Val Asn Val Ser Glu Arg

85 90 95

Leu Val Gln Tyr Val Lys Gly Lys Thr Tyr Pro Phe Arg Gly Ala Phe

100 105 110

Pro Pro Val Trp Asn Pro Ile Ala Tyr Leu Asp Tyr Asn Asn Leu Trp

115 120 125

Arg Thr Ile Asp Asn Met Gly Lys Glu Ile Pro Thr Asp Ala Pro Trp

130 135 140

Glu Ala Gln His Ala Asp Lys Trp Asp Lys Met Thr Met Lys Glu Leu

145 150 155 160

Ile Asp Lys Ile Cys Trp Thr Lys Thr Ala Arg Arg Phe Ala Tyr Leu

165 170 175

Phe Val Asn Ile Asn Val Thr Ser Glu Pro His Glu Val Ser Ala Leu

180 185 190

Trp Phe Leu Trp Tyr Val Lys Gln Cys Gly Gly Thr Thr Arg Ile Phe

195 200 205

Ser Val Thr Asn Gly Gly Gln Glu Arg Lys Phe Val Gly Gly Ser Gly

210 215 220

Gln Val Ser Glu Arg Ile Met Asp Leu Leu Gly Asp Gln Val Lys Leu

225 230 235 240

Asn His Pro Val Thr His Val Asp Gln Ser Ser Asp Asn Ile Ile Ile

245 250 255

Glu Thr Leu Asn His Glu His Tyr Glu Cys Lys Tyr Val Ile Asn Ala

260 265 270

Ile Pro Pro Thr Leu Thr Ala Lys Ile His Phe Arg Pro Glu Leu Pro

275 280 285

Ala Glu Arg Asn Gln Leu Ile Gln Arg Leu Pro Met Gly Ala Val Ile

290 295 300

Lys Cys Met Met Tyr Tyr Lys Glu Ala Phe Trp Lys Lys Lys Asp Tyr

305 310 315 320

Cys Gly Cys Met Ile Ile Glu Asp Glu Asp Ala Pro Ile Ser Ile Thr

325 330 335

Leu Asp Asp Thr Lys Pro Asp Gly Ser Leu Pro Ala Ile Met Gly Phe

340 345 350

Ile Leu Ala Arg Lys Ala Asp Arg Leu Ala Lys Leu His Lys Glu Ile

355 360 365

Arg Lys Lys Lys Ile Cys Glu Leu Tyr Ala Lys Val Leu Gly Ser Gln

370 375 380

Glu Ala Leu His Pro Val His Tyr Glu Glu Lys Asn Trp Cys Glu Glu

385 390 395 400

Gln Tyr Ser Gly Gly Cys Tyr Thr Ala Tyr Phe Pro Pro Gly Ile Met

405 410 415

Thr Gln Tyr Gly Arg Val Ile Arg Gln Pro Val Gly Arg Ile Phe Phe

420 425 430

Ala Gly Thr Glu Thr Ala Thr Lys Trp Ser Gly Tyr Met Glu Gly Ala

435 440 445

Val Glu Ala Gly Glu Arg Ala Ala Arg Glu Val Leu Asn Gly Leu Gly

450 455 460

Lys Val Thr Glu Lys Asp Ile Trp Val Gln Glu Pro Glu Ser Lys Asp

465 470 475 480

Val Pro Ala Val Glu Ile Thr His Thr Phe Trp Glu Arg Asn Leu Pro

485 490 495

Ser Val Ser Gly Leu Leu Lys Ile Ile Gly Phe Ser Thr Ser Val Thr

500 505 510

Ala Leu Gly Phe Val Leu Tyr Lys Tyr Lys Leu Leu Pro Arg Ser

515 520 525

<210>12

<211>2566

<212>DNA

<213>Homo sapiens

<220>

<221>CDS

<222>(137)..(1699)

<400>12

cgaggcgctg gtgcacgggg gcagcgcgca gcaggccggc gggcaggcgg gcgggctggc 60

tggcaggcag gactgggatc gaggcccaga aaacggagca gcgggcacca gggaggcctg 120

gaacggggcg agcgcc atg agc aac aaa tgc gac gtg gtc gtg gtg ggg ggc 172

Met Ser Asn Lys Cys Asp Val Val Val Val Gly Gly

1 5 10

ggc atc tca ggt atg gca gca gcc aaa ctt ctg cat gac tct gga ctg 220

Gly Ile Ser Gly Met Ala Ala Ala Lys Leu Leu His Asp Ser Gly Leu

15 20 25

aat gtg gtt gtt ctg gaa gcc cgg gac cgt gtg gga ggc agg act tac 268

Asn Val Val Val Leu Glu Ala Arg Asp Arg Val Gly Gly Arg Thr Tyr

30 35 40

act ctt agg aac caa aag gtt aaa tat gtg gac ctt gga gga tcc tat 316

Thr Leu Arg Asn Gln Lys Val Lys Tyr Val Asp Leu Gly Gly Ser Tyr

45 50 55 60

gtt gga cca acc cag aat cgt atc ttg aga tta gcc aag gag cta gga 364

Val Gly Pro Thr Gln Asn Arg Ile Leu Arg Leu Ala Lys Glu Leu Gly

65 70 75

ttg gag acc tac aaa gtg aat gag gtt gag cgt ctg atc cac cat gta 412

Leu Glu Thr Tyr Lys Val Asn Glu Val Glu Arg Leu Ile His His Val

80 85 90

aag ggc aaa tca tac ccc ttc agg ggg cca ttc cca cct gta tgg aat 460

Lys Gly Lys Ser Tyr Pro Phe Arg Gly Pro Phe Pro Pro Val Trp Asn

95 100 105

cca att acc tac tta gat cat aac aac ttt tgg agg aca atg gat gac 508

Pro Ile Thr Tyr Leu Asp His Asn Asn Phe Trp Arg Thr Met Asp Asp

110 115 120

atg ggg cga gag att ccg agt gat gcc cca tgg aag gct ccc ctt gca 556

Met Gly Arg Glu Ile Pro Ser Asp Ala Pro Trp Lys Ala Pro Leu Ala

125 130 135 140

gaa gag tgg gac aac atg aca atg aag gag cta ctg gac aag ctc tgc 604

Glu Glu Trp Asp Asn Met Thr Met Lys Glu Leu Leu Asp Lys Leu Cys

145 150 155

tgg act gaa tct gca aag cag ctt gcc act ctc ttt gtg aac ctg tgt 652

Trp Thr Glu Ser Ala Lys Gln Leu Ala Thr Leu Phe Val Asn Leu Cys

160 165 170

gtc act gca gag acc cat gag gtc tct gct ctc tgg ttc ctg tgg tat 700

Val Thr Ala Glu Thr His Glu Val Ser Ala Leu Trp Phe Leu Trp Tyr

175 180 185

gtg aag cag tgt gga ggc aca aca aga atc atc tcg aca aca aat gga 748

Val Lys Gln Cys Gly Gly Thr Thr Arg Ile Ile Ser Thr Thr Asn Gly

190 195 200

gga cag gag agg aaa ttt gtg ggc gga tct ggt caa gtg agt gag cgg 796

Gly Gln Glu Arg Lys Phe Val Gly Gly Ser Gly Gln Val Ser Glu Arg

205 210 215 220

ata atg gac ctc ctt gga gac cga gtg aag ctg gag agg cct gtg atc 844

Ile Met Asp Leu Leu Gly Asp Arg Val Lys Leu Glu Arg Pro Val Ile

225 230 235

tac att gac cag aca aga gaa aat gtc ctt gtg gag acc cta aac cat 892

Tyr Ile Asp Gln Thr Arg Glu Asn Val Leu Val Glu Thr Leu Asn His

240 245 250

gag atg tat gag gct aaa tat gtg att agt gct att cct cct act ctg 940

Glu Met Tyr Glu Ala Lys Tyr Val Ile Ser Ala Ile Pro Pro Thr Leu

255 260 265

ggc atg aag att cac ttc aat ccc cct ctg cca atg atg aga aac cag 988

Gly Met Lys Ile His Phe Asn Pro Pro Leu Pro Met Met Arg Asn Gln

270 275 280

atg atc act cgt gtg cct ttg ggt tca gtc atc aag tgt ata gtt tat 1036

Met Ile Thr Arg Val Pro Leu Gly Ser Val Ile Lys Cys Ile Val Tyr

285 290 295 300

tat aaa gag cct ttc tgg agg aaa aag gat tac tgt gga acc atg att 1084

Tyr Lys Glu Pro Phe Trp Arg Lys Lys Asp Tyr Cys Gly Thr Met Ile

305 310 315

att gat gga gaa gaa gct cca gtt gcc tac acg ttg gat gat acc aaa 1132

Ile Asp Gly Glu Glu Ala Pro Val Ala Tyr Thr Leu Asp Asp Thr Lys

320 325 330

cct gaa ggc aac tat gct gcc ata atg gga ttt atc ctg gcc cac aaa 1180

Pro Glu Gly Asn Tyr Ala Ala Ile Met Gly Phe Ile Leu Ala His Lys

335 340 345

gcc aga aaa ctg gca cgt ctt acc aaa gag gaa agg ttg aag aaa ctt 1228

Ala Arg Lys Leu Ala Arg Leu Thr Lys Glu Glu Arg Leu Lys Lys Leu

350 355 360

tgt gaa ctc tat gcc aag gtt ctg ggt tcc cta gaa gct ctg gag cca 1276

Cys Glu Leu Tyr Ala Lys Val Leu Gly Ser Leu Glu Ala Leu Glu Pro

365 370 375 380

gtg cat tat gaa gaa aag aac tgg tgt gag gag cag tac tct ggg ggc 1324

Val His Tyr Glu Glu Lys Asn Trp Cys Glu Glu Gln Tyr Ser Gly Gly

385 390 395

tgc tac aca act tat ttc ccc cct ggg atc ctg act caa tat gga agg 1372

Cys Tyr Thr Thr Tyr Phe Pro Pro Gly Ile Leu Thr Gln Tyr Gly Arg

400 405 410

gtt cta cgc cag cca gtg gac agg att tac ttt gca ggc acc gag act 1420

Val Leu Arg Gln Pro Val Asp Arg Ile Tyr Phe Ala Gly Thr Glu Thr

415 420 425

gcc aca cac tgg agc ggc tac atg gag ggg gct gta gag gcc ggg gag 1468

Ala Thr His Trp Ser Gly Tyr Met Glu Gly Ala Val Glu Ala Gly Glu

430 435 440

aga gca gcc cga gag atc ctg cat gcc atg ggg aag att cca gag gat 1516

Arg Ala Ala Arg Glu Ile Leu His Ala Met Gly Lys Ile Pro Glu Asp

445 450 455 460

gaa atc tgg cag tca gaa cca gag tct gtg gat gtc cct gca cag ccc 1564

Glu Ile Trp Gln Ser Glu Pro Glu Ser Val Asp Val Pro Ala Gln Pro

465 470 475

atc acc acc acc ttt ttg gag aga cat ttg ccc tcc gtg cca ggc ctg 1612

Ile Thr Thr Thr Phe Leu Glu Arg His Leu Pro Ser Val Pro Gly Leu

480 485 490

ctc agg ctg att gga ttg acc acc atc ttt tca gca acg gct ctt ggc 1660

Leu Arg Leu Ile Gly Leu Thr Thr Ile Phe Ser Ala Thr Ala Leu Gly

495 500 505

ttc ctg gcc cac aaa agg ggg cta ctt gtg aga gtc taa agagagaggg 1709

Phe Leu Ala His Lys Arg Gly Leu Leu Val Arg Val

510 515 520

tgtctgtaat cacactctct tcttactgta tttgggatat gagtttgggg aaagagttgc 1769

agtaaagttc catgaagaca aatagtgtgg agtgaggcgg ggagcatgaa gataaatcca 1829

actctgactg taaaatacat ggtatctctt tctccgttgt ggcccctgct tagtgtccct 1889

tacctggctt agcgttctgt ttcaccagtt tccaagttta ttgccctcaa aatctttaga 1949

atagttaaat tggcttgttt aaggttcttg ctgccccaca acacaccttg cccatgcaca 2009

aggaatgaat tttttcctac cattatggct ttgtgcttgt tcttcctctt acctgtaata 2069

gcctcacctt ccctagttct ttgcattcgt ccttagaata ctgtattgtt acagctgaaa 2129

gacagtaaag accatttagt cctcaccttc tgttttagag ttgagcaaac tgaagcccac 2189

agaggtggaa cttaattacc taagagccac aataagccac tggtatctgg gggactagaa 2249

cacaaatcca acgcttttcc cacctctttg gatgttttcc ccaattatcc tccttcactc 2309

cctgtcatag ttaccgatgg tgtcccgttg tgtgggttta ctctgtgcta agttgtctta 2369

cacttctcaa atgctactca gtatatagcc ttaagtctta ctgttttgtg cggtgtgtct 2429

ccagctgatt ttaacttttt tgatggtaga aattttatct cttcttcctt ttgtatcctc 2489

cattgtatct tcatacaaag gacagtacac acttgggtaa ttaaaaataa aagttgattg 2549

accataaaaa aaaaaaa 2566

<210>13

<211>520

<212>PRT

<213>Homo sapiens

<400>13

Met Ser Asn Lys Cys Asp Val Val Val Val Gly Gly Gly Ile Ser Gly

1 5 10 15

Met Ala Ala Ala Lys Leu Leu His Asp Ser Gly Leu Asn Val Val Val

20 25 30

Leu Glu Ala Arg Asp Arg Val Gly Gly Arg Thr Tyr Thr Leu Arg Asn

35 40 45

Gln Lys Val Lys Tyr Val Asp Leu Gly Gly Ser Tyr Val Gly Pro Thr

50 55 60

Gln Asn Arg Ile Leu Arg Leu Ala Lys Glu Leu Gly Leu Glu Thr Tyr

65 70 75 80

Lys Val Asn Glu Val Glu Arg Leu Ile His His Val Lys Gly Lys Ser

85 90 95

Tyr Pro Phe Arg Gly Pro Phe Pro Pro Val Trp Asn Pro Ile Thr Tyr

100 105 110

Leu Asp His Asn Asn Phe Trp Arg Thr Met Asp Asp Met Gly Arg Glu

115 120 125

Ile Pro Ser Asp Ala Pro Trp Lys Ala Pro Leu Ala Glu Glu Trp Asp

130 135 140

Asn Met Thr Met Lys Glu Leu Leu Asp Lys Leu Cys Trp Thr Glu Ser

145 150 155 160

Ala Lys Gln Leu Ala Thr Leu Phe Val Asn Leu Cys Val Thr Ala Glu

165 170 175

Thr His Glu Val Ser Ala Leu Trp Phe Leu Trp Tyr Val Lys Gln Cys

180 185 190

Gly Gly Thr Thr Arg Ile Ile Ser Thr Thr Asn Gly Gly Gln Glu Arg

195 200 205

Lys Phe Val Gly Gly Ser Gly Gln Val Ser Glu Arg Ile Met Asp Leu

210 215 220

Leu Gly Asp Arg Val Lys Leu Glu Arg Pro Val Ile Tyr Ile Asp Gln

225 230 235 240

Thr Arg Glu Asn Val Leu Val Glu Thr Leu Asn His Glu Met Tyr Glu

245 250 255

Ala Lys Tyr Val Ile Ser Ala Ile Pro Pro Thr Leu Gly Met Lys Ile

260 265 270

His Phe Asn Pro Pro Leu Pro Met Met Arg Asn Gln Met Ile Thr Arg

275 280 285

Val Pro Leu Gly Ser Val Ile Lys Cys Ile Val Tyr Tyr Lys Glu Pro

290 295 300

Phe Trp Arg Lys Lys Asp Tyr Cys Gly Thr Met Ile Ile Asp Gly Glu

305 310 315 320

Glu Ala Pro Val Ala Tyr Thr Leu Asp Asp Thr Lys Pro Glu Gly Asn

325 330 335

Tyr Ala Ala Ile Met Gly Phe Ile Leu Ala His Lys Ala Arg Lys Leu

340 345 350

Ala Arg Leu Thr Lys Glu Glu Arg Leu Lys Lys Leu Cys Glu Leu Tyr

355 360 365

Ala Lys Val Leu Gly Ser Leu Glu Ala Leu Glu Pro Val His Tyr Glu

370 375 380

Glu Lys Asn Trp Cys Glu Glu Gln Tyr Ser Gly Gly Cys Tyr Thr Thr

385 390 395 400

Tyr Phe Pro Pro Gly Ile Leu Thr Gln Tyr Gly Arg Val Leu Arg Gln

405 410 415

Pro Val Asp Arg Ile Tyr Phe Ala Gly Thr Glu Thr Ala Thr His Trp

420 425 430

Ser Gly Tyr Met Glu Gly Ala Val Glu Ala Gly Glu Arg Ala Ala Arg

435 440 445

Glu Ile Leu His Ala Met Gly Lys Ile Pro Glu Asp Glu Ile Trp Gln

450 455 460

Ser Glu Pro Glu Ser Val Asp Val Pro Ala Gln Pro Ile Thr Thr Thr

465 470 475 480

Phe Leu Glu Arg His Leu Pro Ser Val Pro Gly Leu Leu Arg Leu Ile

485 490 495

Gly Leu Thr Thr Ile Phe Ser Ala Thr Ala Leu Gly Phe Leu Ala His

500 505 510

Lys Arg Gly Leu Leu Val Arg Val

515 520

Claims (69)

1. isolated polypeptide, it comprises the aminoacid sequence that has about at least 15% sequence homogeny with aminoacid sequence shown in the SEQ ID NO:2.

2. isolated polypeptide, it comprises aminoacid sequence shown in the SEQ ID NO:2.

3. isolated polypeptide, it comprises the aminoacid sequence of the 17-342 amino acids residue of SEQ ID NO:2.

4. the isolated polypeptide of claim 1, wherein said polypeptide is not included in the signal peptide of N-terminal.

5. the isolated polypeptide of claim 1, wherein said polypeptide comprises the FAD binding site.

6. the isolated polypeptide of claim 1, wherein said polypeptide is active kidney zymoprotein.

7. the isolated polypeptide of claim 1, wherein said polypeptide is the mammal kidney zymoprotein.

8. the isolated polypeptide of claim 1, wherein said polypeptide is people's kidney zymoprotein.

9. each isolated polypeptide of claim 1-3, wherein said polypeptide further comprises cofactor.

10. the isolated polypeptide of claim 9, wherein said cofactor is flavin adenine dinucleotide (FAD) or its analogue.

11. the isolated polypeptide of claim 9, wherein said cofactor are flavin adenine dinucleotide (FAD).

12. a composition, it comprises or is made up of each isolated polypeptide and a kind of medicine acceptable carrier, thinner or vehicle of claim 1-11 basically.

13. the composition of claim 12, wherein said composition give mode at oral or injectable and prepare.

14. the composition of claim 12, wherein said composition are to discharge immediately or sustained release formulation form.

15. the composition of claim 12, wherein said polypeptide is a microcrystalline form.

16. the composition of claim 12, wherein said polypeptide is encapsulated within the nano particle.

17. composition, it comprises or is made up of a peptide species and a kind of medicine acceptable carrier, thinner or vehicle substantially, and wherein said polypeptide has the aminoacid sequence of the 17-342 position residue of aminoacid sequence shown in the SEQ ID NO:2 or SEQ ID NO:2.

18. a method that produces active kidney enzyme polypeptide comprises each isolated polypeptide of flavin adenine dinucleotide (FAD) and claim 1-8 is combined.

19. the method for claim 18, wherein said cofactor are flavin adenine dinucleotide (FAD) or its analogue.

20. the method for claim 19, wherein said enzyme cofactor are flavin adenine dinucleotide (FAD).

21. a method that obtains the kidney zymoprotein comprises isolated protein from least a body fluid, thereby obtains the kidney zymoprotein.

22. the method for claim 21, wherein said body fluid are selected from blood, serum, blood plasma, saliva, urine, lymph liquid, whole blood, cerebrospinal fluid tissue culture medium (TCM) and cell extract.

23. the method for claim 21, it further comprises by using ion exchange chromatography, adsorption chromatography, part binding affinity chromatography, gel permeation chromatography or its arbitrary combination to be further purified the kidney zymoprotein of acquisition.

24. a method that obtains the kidney zymoprotein comprises isolated protein from the cell, cell culture, tissue, tissue culture, organ or the organ cultures that produce described kidney zymoprotein, thereby obtains the kidney zymoprotein.

25. a method that obtains the kidney zymoprotein is included in culturing cell in the substratum, produces described kidney zymoprotein thus, separates described protein from described cell and/or substratum, thereby obtains the kidney zymoprotein.

26. an antibody, each isolated polypeptide specificity of itself and claim 1-11 combines.

27. an antibody, it combines with mammal kidney zymoprotein or its fragments specific.

28. the antibody of claim 26 or 27, wherein said antibody is selected from polyclonal antibody, monoclonal antibody and synthetic antibody.

29. a prevention, treat or improve the method for pathology, obstacle or the disease of the mediation of Mammals middle kidney enzyme, comprise each the isolated polypeptide of claim 1-8 that gives described Mammals treatment significant quantity.

30. the method for claim 29, wherein said pathology, obstacle or disease are selected from renal lesions, obstacle or disease; Cardiovascular pathological changes, obstacle or disease; Heart change, obstacle or disease; Central nervous system (CNS) pathology, obstacle or disease; And arbitrary combination.

31. the method for claim 30, wherein said cardiovascular pathological changes, obstacle or disease are selected from hypertension, asymptomatic type left ventricle dysfunction, chronic heart failure (CHF), myocardial infarction (MI), arrhythmia, apoplexy, atherosclerosis, and arbitrary combination.

32. the method for claim 31, wherein said hypertension are selected from chronic hypertension, systolic hypertension, isolated systolic hypertension, diabetic hypertension, pulmonary hypertension, acute serious hypertension and arbitrary combination thereof.

33. the method for claim 30, wherein said renal lesions, obstacle or disease are selected from end-stage renal disease (ESRD), chronic renal failure and arbitrary combination thereof.

34. the Mammals for needs treatments provides the method for kidney enzyme treatment, described method comprises each the isolated polypeptide of claim 1-8 that gives Mammals treatment significant quantity.

35. a prevention, treat or alleviate the method for ESRD, described method comprises each the isolated polypeptide of claim 1-8 of the Mammals treatment significant quantity that needs treatment.

36. a prevention, treat or alleviate the method for CNS pathology, obstacle or disease, described method comprises the kidney enzyme inhibitors of the Mammals treatment significant quantity that needs treatment.

37. the method for claim 36, wherein said CNS pathology, obstacle or disease are selected from dysthymia disorders, anxiety, mania, schizophrenia and arbitrary combination thereof.

38. the method for claim 36, wherein said kidney enzyme inhibitors is selected from micromolecular inhibitor, antibody, ribozyme, disturbance ribonucleic acid, antisense nucleic acid molecule, and combination.

39. each method of claim 36-38, wherein said Mammals is the people.

40. a prevention, treat or alleviate the gene therapy methods of pathology, obstacle or the disease of the Mammals middle kidney enzyme mediation that needs treatment, described method comprises and gives the Mammals isolated nucleic acid molecule that described nucleic acid molecule comprises nucleotide sequence shown in the SEQ ID NO:1 or comprises the nucleotide sequence of the 24-1049 position residue of SEQ ID NO:1.

41. the method for claim 40, wherein said isolating nucleic acid further comprise with nucleotide sequence shown in the SEQID NO:1 or comprise the promotor that the nucleotide sequence of the 24-1049 position residue of SEQ ID NO:1 operably is connected.

42. the method for claim 40, wherein said isolating nucleic acid uses virus vector to give.

43. a prevention, treat or alleviate the gene therapy method of pathology, obstacle or the disease of the Mammals middle kidney enzyme mediation that needs treatment, described method comprises: (a) with nucleotide sequence shown in the SEQ IDNO:1 or comprise that the nucleotide sequence of 24-1049 position residue of SEQ ID NO:1 is stripped to carry out through engineering approaches to mammalian cell; And (b) will be transmitted back to through the cell of through engineering approaches in this Mammals.

44. a prevention, treat or alleviate hypertensive method in the Mammals that needs treatment, described method comprises the kidney enzyme agonist that gives Mammals treatment significant quantity, thus improve the kidney enzyme expression and prevention, treat or alleviate Mammals hypertension.

A 45. prevention, treat or alleviate the method for ESRD in the Mammals that needs treatment, described method comprises the kidney enzyme agonist that gives Mammals treatment significant quantity, thereby the kidney expression of enzymes that increases and prevent, treat or alleviate Mammals ESRD.

A 46. diagnosis or help to diagnose mammiferous pathology, obstacle or disease, perhaps diagnose or help the diagnosis Mammals to pathology, the method of obstacle or disease susceptibility, wherein said pathology, obstacle or disease change relevant with Mammals middle kidney expression of enzymes, described method comprises the Mammals middle kidney expression of enzymes level that detects, and with the level of kidney expression of enzymes described in the described Mammals with do not suffer from described pathology, the Mammals middle kidney expression of enzymes level of obstacle or disease compares, thus the diagnosis or help to diagnose Mammals to suffer from described pathology, obstacle or disease or to its susceptibility.

47. the method for claim 46, wherein said pathology, obstacle or disease are selected from ESRD, hypertension, ANT, cardiovascular disorder and combination thereof.

48. the method for claim 46, wherein said pathology, obstacle or disease are CNS pathology, obstacle or disease.

49. method of differentiating the compound that increase kidney enzyme is expressed in cell, described method comprises that the cell that the kidney enzyme is expressed therein contacts with compound, and will compare with the same cell middle kidney expression of enzymes level that contact with described compound in addition with the kidney expression of enzymes level in the described cell that described compound contacts, wherein be higher than the other same cell middle kidney expression of enzymes level that does not contact and show the expression of described compound increase kidney enzyme in described cell with described compound in the cell middle kidney expression of enzymes level that contact with described compound.

50. differentiate for one kind and reduce the method that the kidney enzyme is expressed in cell, described method comprises that the cell that the kidney enzyme is expressed therein contacts with a kind of compound, the described cell middle kidney expression of enzymes level that will contact with described compound compares with the same cell middle kidney expression of enzymes level that does not contact with described compound in addition, wherein is lower than the same cell middle kidney expression of enzymes level that does not contact with described compound in addition in the cell middle kidney expression of enzymes level that contacts with described compound and shows that described compound reduces the expression of kidney enzyme in described cell.

51. compound of differentiating by the method for claim 49 or 50.

52. differentiate each the method for binding partners of isolated polypeptide of claim 1-8 for one kind, described method comprises: (a) described isolated polypeptide is contacted with a kind of potential binding partners; And (b) determine whether described potential binding partners influences the activity of described polypeptide, thereby differentiate binding partners.

53. an isolated nucleic acid molecule, it comprises nucleotide sequence shown in the SEQ ID NO:1 that operably is connected with the nucleic acid that comprises promotor/adjusting sequence.

54. an isolated nucleic acid molecule, it comprises the 24-1049 position residue of nucleotide sequence shown in the SEQ ID NO:1 that operably is connected with the nucleic acid that comprises promotor/adjusting sequence.

55. an isolated nucleic acid molecule, its comprise operably be connected with the nucleotide sequence of coding promotor/adjustings sequence, and SEQ ID NO:1 shown in nucleotide sequence have the nucleotide sequence of about at least 40% sequence homogeny.

56. the isolated nucleic acid molecule of claim 55, wherein said nucleic acid molecule further comprises the nucleotide sequence of the covalently bound with it labeling polypeptide of coding.

57. carrier that comprises the nucleic acid molecule of claim 55 or 56.

58. a reconstitution cell, it comprises the nucleic acid molecule of claim 55, the nucleic acid molecule of claim 56 or the carrier of claim 57.

59. method that produces the kidney enzyme polypeptide, described method comprises that cultivation can express the reconstitution cell of described kidney enzyme polypeptide, described kidney enzyme polypeptide is by a kind of nucleic acid molecule encoding, and this nucleic acid molecule has the nucleotide sequence that has about at least 40% sequence homogeny with nucleotide sequence shown in the SEQ ID NO:1.

60. an isolating kidney enzyme polypeptide, its method by claim 59 produces.

61. the method for claim 59, wherein said nucleic acid molecule encoding kidney zymoprotein, this proteic aminoacid sequence is identical with aminoacid sequence about at least 95% shown in the SEQ ID NO:2.

62. an isolating kidney zymoprotein, its method by claim 61 produces.

63. a method that produces the kidney enzyme polypeptide, described method comprises: (a) making culture bag under the condition that nucleic acid molecule is expressed contain the reconstitution cell that right requires 53 isolated nucleic acid molecule; And (b) the described kidney zymoprotein that produces by described cell of results.

64. an isolating kidney enzyme polypeptide, its method by claim 63 produces.

65. an isolated nucleic acid molecule, itself and a kind of nucleic acid array complementation, nucleotide sequence has about at least 40% sequence homogeny shown in described nucleotide sequence and the SEQ ID NO:1, and wherein said complementary nucleic acid molecule is an antisense orientation.

66. the isolated nucleic acid molecule of claim 65, it further comprises the promotor/regulatory region that operably is connected with it.

67. method that produces the kidney enzyme polypeptide, described method comprises that cultivation can express the reconstitution cell of the nucleic acid of coding kidney enzyme polypeptide, described kidney enzyme polypeptide is by a kind of nucleic acid molecule encoding, this nucleic acid molecule has the nucleotide sequence that has about at least 40% sequence homogeny with nucleotide sequence shown in the SEQ ID NO:1, and wherein said complementary nucleic acid is an antisense orientation.

68. the method for claim 67, wherein said nucleotide sequence further comprises the promotor/regulatory region that operably is connected with it.

69. an isolating kidney enzyme polypeptide, its method by claim 67 or 68 produces.

Images