CN1309830C - Variants of TRAF2 which act as an inhibitor of TNF-alpha (TNF alpha) signaling pathway - Google Patents

Abstract

The present invention relates to variants of TRAF2 which demonstrate the ability to inhibit the TNF alpha signaling path-way. In particular, applicants have isolated a splice variant of TRAF2 referred to hereinafter as ''TRAF2 truncated'' or ''TRAF2TR'' and a TRAF2 expression construct with enhanced dominant negative properties, hereafter referred to as ''TRAF2 truncated-deleted'' or ''TRAF2TD''. Both TRAF2TR and TRAF2TD have the ability to inhibit the TNF alpha signaling pathway and in TRAF2TD, this ability is greatly enhanced, greatly reducing the response to TNF alpha binding.

Description

TRAF2 variant as TNF-signal pathway inhibition

Invention field

Tumor necrosis factor alpha (TNF α) is the iuntercellular mediator in the immunne response that produces of various kinds of cell, comprises activatory scavenger cell and monocyte.By the TNF α cell surface receptor of replying of exciting of TNF α by it and two uniquenesses: the interaction between TNF α R1 and the TNF α R2 starts.TNF α and these cell surface receptors combine and excite the activation of transcription factor, for example, nf κ B (NF κ B), their regulate panimmunity and inflammatory response expression of gene.

Rely on the combination of TNF α, TNF α acceptor interacts by their cytoplasmic structure territory and the interior signal translated protein of various kinds of cell.The signal translated protein is a TNF (tumor necrosis factor) receptor associated factor in known one group of cell relevant with TNF α acceptor, promptly is known as " TRAF " family of receptor protein.TRAF family is made up of many homologous proteins with common structure feature, and they and TNF α receptor protein interrelate and conducted signal therefrom.As if TRAF albumen lacks the enzymatic activity primitive, and shows the proteinic function of joint, and it can be coupled to carrier in the downstream signal transduction cascade.A member of this family, TRAF2 interrelates with many TNF α receptor family protein, comprises TNF α R1, TNF α R2, CD40 and CD30.For TRAF2, identified to have at least the interior molecule of 8 cells directly to combine with it.The activation that TRAF2 has demonstrated for the alpha mediated various transcription factors of TNF is crucial, and especially to NF κ B and the terminal kinases (JNK/SAPK) of C-jun N-, these transcription factors are responsible for the expression of immunity/inflammatory response successively.

There is multiple disease relation to be arranged with the institute's adjusting approach that is subjected to TNF α to combine control.In some cases, TNF α is in conjunction with having excited the inflammatory response that finally causes disease.Therefore, the method that needs the exploitation prevention disease relevant with TNF α receptors bind.Especially prevention inflammatory response activated method is found in expectation, and described replying originally can be caused by the activation of TNF α.In order to treat and prevention and the relevant disease of TNF α combination, the invention provides with TRAF2 is basis and the polypeptide that can suppress TNF signal pathway.

The progress of having reported

The proteic general structure of TRAF has been described and has carried out general description in Fig. 1 (a), the figure illustrates the total length TRAF2 (TRAF-FL) of diagrammatic form.These protein have the N-end region of band zinc fourth finger primitive, are a row class zinc fingers subsequently.Conservative (TRAF) structural domain of forming by two subdomains after zinc refers to distinguish: N-end structure territory and C-end structure territory.C-end structure territory relates to the combination of acceptor and homology and the oligomeric of TRAF turns usefulness into, and it is the docking site of various other signal transduction protein.

TRAF2 follows the general structure of above-mentioned traf protein.Existing many researchs are attempted the subdomain of TRAF2 protein structure is interrelated with this proteic function.

Takeuchi etc. have carried out mutation analysis (Takeuchi etc., journal of biological chemistry J.Biol.Chem., 271 (33) 19935-42 (1996)) widely to TRAF2.These studies show that TRAF2 is made up of the modular construction territory of mediation unique activity.It is needed that the author determines that the terminal fourth finger of the N-of TRAF2 and two adjacent zinc refer to be that NF κ B activates, and the TRAF-N of the uniqueness in the TRAF structural domain and TRAF-C subdomain it seems be independent mediation self in conjunction with and with the interaction of TRAF1.

Song etc. (institute of NAS newspaper (Proc.Natl.Acad.Sci.USA), 94,9792-9796 (1997)) studies show that TNF α inductive NF κ B and the terminal kinases of c-jun N-(JNK/SAPK) activation subsequently needs TRAF2.The author shows that TRAF2 is that the reaction of two kinase cascades causes NF κ B and JNK activated tapping point.This report has supported TRAF2 and other member of TRAF family as the proteinic functional model of joint, wherein has the proteinic docking site of additional signal of replying in initial parallel downstream.

The strategy that Min etc. (Journal of Immunology (J.Immunology), 159,3508-3518 (1997)) express with transfection/mistake is analyzed the effect of traf protein.Before shown that the TRAF2 that contains the TRAF structural domain but lack n terminal residue 1-80 can suppress the activation that TNF α induces NF κ B.The author confirms that this TRAF2 variant also blocks the activation of TNF α to JNK.

Brink etc. (journal of biological chemistry (J.Biol.Chem.), 273,7,4129-4134 (1998)) have described the splice variant of a kind of TRAF2, and they are referred to as " TRAF2A ".The cDNA of TRAF2A is except having additional 21bp sequence, and rest part is identical with TRAF2, in 7 aminoacid insertion TRAF2A ring finger territories of this 21bp sequence encoding.The author finds that the expression of TRAF2AmRNA is conditioned in tissue-specific mode, and TRAF2A albumen can combine with the cytoplasmic structure territory of TNF α R2.They find that also opposite with TRAF2, when TRAF2A crossed expression in 293 cells, it can not stimulate the NF kB activity, but serves as the main inhibition of TNF α R2 dependent form NF kB activation.

Many researchs connect (Bryant etc., circulation (Circulation), 97 (14): 1375-81 (1998) with inflammatory process and TNF α and main cardiovascular disorder; Kubota etc., circulating research (Circ.Res.), 81 (4): 627-35 (1997); Muller Werdan etc., European cytokine net (Eur.Cytokine Netw.), 9 (4): 689-91 (1998); Aukrust etc., the cardiovascular magazine of the U.S. (Am.J.Cardiol.), 83 (3): 376-82 (1999)).In in the past 5 years, the evidence of accumulation shows the raising of local T NF alpha levels and following disease-related: (a) ischemia-reperfusion injury among the CNS after cardiac ischemia-reperfusion injury after myocardial infarction, coronary bypass, the heart transplantation or the apoplexy; (b) serious coronary atherosclerotic score increases the weight of and ruptures; (c) development of congestive heart failure and increasing the weight of; And (d) endothelial cell damage after the sacculus angioplasty.In addition, nearest discovery showed cell program death may be in heart failure or infraction during a important factor in the physiopathology of cardiomyocyte cell death.

Except that above-mentioned cardiovascular disorder, also have the pathogeny of many other diseases relevant with TNF α.These diseases comprise the diabetes and the neurodegenerative disease (as parkinsonism) of rejection (graft versus host disease) in crohn (Crohn ' s disease), psoriasis, rheumatoid arthritis, the transplanting, inflammatory bowel disease, non-insulin-depending type.

Because the mutual relationship between TNF α and the multiple all diseases as indicated above, so wish to provide composition and method for suppressing and treating these diseases.

Summary of the invention

According to the present invention, found the TRAF2 variant, especially the variant (TRAF2TD) that contains the variant (TRAF2TR) of natural montage variation and contain natural montage variation and lack in the TRAF2N-end region can suppress signal conduction and the relevant immunoinflammatory of TNF α and reply.

According to embodiment of the present invention, the dna sequence dna of coding TRAF2TR is provided, comprise the sequence shown in Fig. 2 a.

According to another embodiment of the present invention, the dna sequence dna of coding TRAF2TD is provided, comprise the sequence shown in Fig. 3 a.

In preferred embodiments, TRAF2TR and TRAF2TD DNA are cDNA.

In other embodiment, the invention provides the TRAF2TR polypeptide that contains shown in Fig. 2 b aminoacid sequence and can suppress tumor necrosis factor alpha (TNF α) institute adjusting approach, and contain shown in Fig. 3 b aminoacid sequence also can suppress tumor necrosis factor alpha (TNF α) the TRAF2TD polypeptide of adjusting approach.

Another aspect of the present invention provides the method that suppresses the approach that TNF α regulates among the patient, comprise that said composition comprises can express TRAF2TR polypeptide expression carrier, can express TRAF2TD polypeptide expression carrier, TRAF2TR polypeptide and pharmaceutical acceptable carrier or TRAF2TD polypeptide and pharmaceutical acceptable carrier in the composition introducing patient body that can suppress TNF approach that α regulates.

Another aspect of the present invention has provided and has suppressed the method that TNF α excessively produces related disease, comprise that the composition that can suppress TNF approach that α regulates is applied to the patient, said composition comprises can express TRAF2TR polypeptide expression carrier, can express TRAF2TD polypeptide expression carrier, TRAF2TR polypeptide and pharmaceutical acceptable carrier or TRAF2TD polypeptide and pharmaceutical acceptable carrier.

The present invention provides the method that suppresses TNF α pathology in addition on the other hand, said pathology relates to nf κ B (NF κ B) dependent form gene superactivation, this method comprises that the composition that can suppress TNF approach that α regulates is applied to the patient, and said composition comprises can express TRAF2TR polypeptide expression carrier, can express TRAF2TD polypeptide expression carrier, TRAF2TR polypeptide and pharmaceutical acceptable carrier or TRAF2TD polypeptide and pharmaceutical acceptable carrier.

The present invention also provides inhibition to relate to the method for the inflammatory process of tumor necrosis factor alpha, comprise that the composition that can suppress TNF approach that α regulates is applied to the patient, said composition comprises can express TRAF2TR polypeptide expression carrier, can express TRAF2TD polypeptide expression carrier, TRAF2TR polypeptide and pharmaceutical acceptable carrier or TRAF2TD polypeptide and pharmaceutical acceptable carrier.

In certain embodiments, described inflammatory process is selected from following disease: the diabetes of the rejection in crohn, psoriasis, rheumatoid arthritis, the transplanting, inflammatory bowel disease, non-insulin-depending type and neurodegenerative disease.

In other embodiments, inflammatory process is to be selected from following cardiovascular disorder: (a) cardiac ischemia-reperfusion injury that the ischemia-reperfusion injury among the CNS causes after myocardial infarction, coronary bypass, heart transplantation or the apoplexy; (b) serious coronary atherosclerotic score increases the weight of and ruptures; (c) development of congestive heart failure and increasing the weight of; (d) endothelial cell damage after the sacculus angioplasty; And (e) myocardial cell's apoptosis.

Another aspect of the present invention provides coding TRAF2TR/2TD the dna sequence dna of variant.

Another aspect of the present invention provides the TRAF2TR/2TD variant polypeptide that can suppress TNF approach that α regulates.

Product provided by the present invention has the advantage that can treat multiple disease, and it utilizes naturally occurring proteinic variant to disturb these disease common early process, i.e. TNF signal conduction.

Summary of drawings

Fig. 1 is the schematic construction of total length TRAF2 (TRAF2-FL) and splice variant TRAF2TR thereof.

Fig. 2 a and 2b are the nucleotide sequence (2a) of TRAF2TR cDNA and the aminoacid sequence (2b) of TRAF2TR.

Fig. 3 a and 3b are the nucleotide sequence (3a) of TRAF2TD cDNA and the aminoacid sequence (3b) of TRAF2TD.

Fig. 4 a and 4b are that the TRAF2 (TRAF2TR) of montage and nucleic acid (4a) and the amino acid (4b) of total length TRAF2 are arranged.

Fig. 5 has illustrated the tissue distribution of TRAF2TR variant mRNA.Swimming lane: 1-contrast TRAF2FL cDNA; 2-contrast TRAF2 splice variant (TRAF2TR) cDNA; 3-Jurkat; 4-HeLa clone; 5-thymus gland; The 6-placenta; 7-thymus gland; The 8-spleen; The 9-ovary; 10-contrasts TRAF2FL.

Fig. 6 has described the TRAF2FL of Myc-fusion in transfected HeLa cell and the immunodetection of TRAF2TR.Swimming lane: 1-pcDNA3 carrier; 2-myc-TRAF2FL; 3-myc-TRAF2TR.

Fig. 7 illustrates the electrophoretic mobility fluctuation measurement (EMSA) that carries out with NFKB UAS probe.Nuclear extract (swimming lane 3 and 4) from FL TRAF2 overexpressing cell shows that TNF-α inductive migration change obviously is better than contrast ( swimming lane 1 and 2).TRAF2-TR crosses and expresses the formation of having blocked NF-κ B, and does not therefore detect migration change band (swimming lane 5 and 6) in TNF-α stimulated cells.

Detailed Description Of The Invention

Below be the definition of term used herein and the description of the preferred embodiment of the invention.

Definition

" cloning vector " is a replicon, for example, plasmid, phage or clay, thus another dna fragmentation can connect institute's junction fragment is duplicated." replicon " is any genetic elements (as plasmid, karyomit(e), virus) as DNA self-replicating unit in the body, can duplicate under himself is controlled.Cloning vector can duplicate in a kind of cell type and expression (" shuttle vectors ") in another kind of cell.In a preferred embodiment of the invention, cloning vector can be expressed in host cell, and " expression vector " can express TRAF2TR and the TRAF2TD that is enough to the amount of TNF-approach that α regulates in the interference cell.

" box " refers to insert at one or more special restriction sites the dna fragmentation of carrier.Dna fragmentation coding desired polypeptides, and the design of box and restriction site will guarantee that box inserts at the proper reading frame frame place that transcribes and translate.

When external source or allogeneic dna sequence DNA be introduced in the cell, cell just " transfection " by said DNA.When institute's transfection DNA caused phenotypic alternation, this cell was just by external source or allogeneic dna sequence DNA " conversion ".The DNA that transforms can be integrated into (covalently bound) and form in the chromosomal DNA of cellular genome.

" nucleic acid molecule " refers to ribonucleoside (adenosine, guanosine, uridine or cytidine; " RNA molecule ") or dezyribonucleoside (Desoxyadenosine, pancreatic desoxyribonuclease, deoxythymidine or Deoxyribose cytidine; " dna molecular ") the phosphoric acid ester polymerized form or their any phosphoric acid ester analogue, as thiophosphatephosphorothioate and thioesters, can be single stranded form or double-stranded spiral.Double-stranded DNA-DNA, DNA-RNA and RNA-RNA spiral are possible.Term " nucleic acid molecule ", particularly DNA or RNA molecule only refer to the firsts and seconds structure of this molecule, it are not limited to the form of any tertiary structure.Therefore, this term comprises in many molecules, especially the double-stranded DNA in linearity or ring-shaped DNA molecule (as restricted fragment), plasmid and the karyomit(e).In the discussion to special double chain DNA molecule structure, sequence can be described by normal convention at this, and what promptly provide is along the non-sequence (that is, institute's tool sequence and mRNA homologous chain) of translating 5 ' to 3 ' direction of chain of DNA." recombinant DNA molecules " is the dna molecular through the molecular biology operation.

When the single stranded form of nucleic acid molecule can be under suitable temperature and ionic strength conditions during with other nucleic acid molecule such as cDNA, genomic dna or RNA annealing, then for this another nucleic acid molecule, this nucleic acid molecule is exactly " interfertile " (sees Sambrook etc., see below).Temperature and ionic strength conditions have determined hybridization " preciseness ".Hybridization requires to contain complementary sequence between two nucleic acid, although depend on the preciseness of hybridization, the mispairing between the base is possible.For nucleic acid hybridization, appropriate preciseness depends on length nucleic acid and complementary degree, and these variablees are well-known in the art.

When being used for herein, term " oligonucleotide " refer to can with genomic dna molecule, cDNA molecule or the mRNA molecular hybridization of coding TRAF2 and common at least 18 nucleic acid that Nucleotide are long.Oligonucleotide can be labeled, and for example, uses ³²The covalently bound Nucleotide on it of P-Nucleotide or marker (such as vitamin H) carries out mark.In one embodiment, the oligonucleotide behind the mark can be used as the existence of the nucleic acid of probe in detecting coding TRAF2.In another embodiment, oligonucleotide (one of them or two all can be labeled) can be used as the PCR primer, is used to clone the TRAF2 of total length or partial-length, or is used to detect the existence of the nucleic acid of coding TRAF2.In further embodiment, oligonucleotide can form triple helix with the TRAF2 dna molecular.In general, oligonucleotide can synthesize preparation, preferably uses the nucleic acid synthesizer.Therefore, the similar key of phosphide that available non-natural exists prepares oligonucleotide, such as thioester bond etc.

DNA " encoding sequence " is meant when placing suitable adjusting sequence to control following time, is translated and translate into the double chain DNA sequence of polypeptide in external or cells in vivo.Dna encoding sequence and proper regulation sequence preferably are provided in the expression vector.The border of encoding sequence is decided by terminal translation stop codon of the terminal initiator codon and 3 ' (carboxyl) of 5 ' (amino).Encoding sequence can include, but are not limited to, protokaryon sequence, from the cDNA of eukaryotic mrna, from the genomic dna sequence of eucaryon (as Mammals) DNA, or even synthetic dna sequence dna.Express if the encoding sequence expection is used for eukaryotic cell, then polyadenylation signal and transcription termination sequence will be positioned at 3 ' end of encoding sequence usually.

Transcribing and translate control sequence is that DNA regulates sequence, as expression promoter, enhanser and the terminator of encoding sequence in host cell is provided.In eukaryotic cell, polyadenylation signal is a control sequence.

" promoter sequence " is the DNA regulatory region that can transcribe in conjunction with the RNA polymerase in the cell and initial downstream (3 ' direction) encoding sequence.For the present invention will be described, promoter sequence 3 ' terminal limited by transcription initiation site and upstream (5 ' direction) extend, but comprise the above detection level of initial background transcribe necessary minimal number base or element.In promoter sequence, can find transcription initiation site (can determine easily, for example, map) with s1 nuclease, and responsible RNA polymerase bonded protein bound structural domain (consensus sequence).

When RNA polymerase is translated into mRNA with encoding sequence, by montage (containing intron as encoding sequence) and when translating into encoding sequence encoded protein matter, then encoding sequence is in " control down " of transit cell record and translation control sequence then.

The mutual relationship that when being used for herein, has " the common origin of evolving " between term " homology " finger protein matter.Such protein (and their encoding sequence) has sequence homology, and the sequence that is reflected in them has the similarity of height.Term " sequence similarity " refers to have or do not have the protein nucleic acid of common evolution origin or the identical or consistent degree between aminoacid sequence.But, usually using and herein, when using that adverbial word is modified such as " highly ", term " homologous " may refer to sequence similarity and noncomitant evolution source.

Term " TNF α institute adjusting approach " and relational language reference and TNF α and the member of Tumor Necrosis Factor Receptors family (TNFR) bonded signal institute adjusting approach.

Term " is equivalent to " to be used for to be meant that similar or homologous sequence determining that the position is whether identical or different with the molecule that similarity or homology have been measured herein.Nucleic acid or aminoacid sequence are arranged and can be comprised at interval.Therefore, term " is equivalent to " refer to sequence similarity but not the numbering of amino-acid residue or nucleotide base.

Term " splice variant " refers to that by such mRNA encoded polypeptides this mRNA is produced through after the other processing by the full length mRNA of one or more genes encodings, causes mRNA to contain one or more disappearances with respect to the full length mRNA of protogene.

Embodiment of the present invention

The present invention relates to suppress two variants of the TRAF2 of TNF signal pathway.One embodiment is the TRAF2 RNA processing splice variant that is called as " TRAF2 of brachymemma " or " TRAF2TR " hereinafter.Another embodiment is based on the TRAF2TR that disappearance is equivalent to TRAF2TR 1-87 amino acids residue, and it is called as " TRAF2 of brachymemma and disappearance " or " TRAF2TD ".TRAF2TR and TRAF2TD have the ability that suppresses TNF signal pathway.Because TRAF2TD significantly reduces TNF α in conjunction with it ability of replying, so it is especially preferred embodiment.

Hereinafter being the description of these two embodiment structures, is about how preparing the discussion of these embodiments subsequently.

The structure of TRAF2TR embodiment and preparation

The cDNA sequence of this splice variant is seen Fig. 2 a, and aminoacid sequence is seen Fig. 2 b.As for Fig. 1 of the demonstration TRAF2TR of summary, visible disappearance has been removed the 123-201 amino acids residue of TRAF2FL, comprise that the C-terminal portions of Zinc finger domain 1 and all zinc refer to 2 and 3, and zinc refers to 4 N-terminal residue.

The TRAF2TR of available prepared by any suitable process this area comprises the known the whole bag of tricks of those skilled in the art.Can find the teaching material of separation, clone and dna sequencing through various channels.Common molecular biology, microbiology and recombinant DNA technology have sufficient explanation in the literature in the art technology.Consult, as, Sambrook, Fritsch﹠amp; Maniatis, molecular cloning: laboratory manual (Molecular Cloning:A Laboratory Manual), press of second edition (1989) cold spring harbor laboratory, cold spring port, New York (herein being " Sambrook etc., 1989 "); Dna clone: practical approach (DNA Cloning:A Practical Approach), I and II volume (D.N.Glover edits, 1985); Oligonucleotide synthesizes (Oligonucleotide Synthesis) (M.J.Gait edits, 1984); Nucleic acid hybridization (Nucleic Acid Hybridization) [B.D.Hams ﹠amp; S.J.Higgins edits (1985)]; Transcribe and translate (Transcription And Translation) [B.D.Hames﹠amp; S.J.Higgins, editor (1984)]; Animal cell culture (Animal Cell Culture) [R.I.Freshney edits (1986)]; Immobilized cell and enzyme (Immobilized CellsAnd Enzymes) [IRL press, (1986)]; B.Perbal, practical instruct (A Practical Guide To Molecular Cloning) (1984) of molecular cloning; F.M.Ausubel etc. (editor), the general handbook of molecular biology (Current Protocols in MolecularBiology), John Wiley ﹠amp; Sons, company limited (1994).

Based on described herein about the information of TRAF2TR dna sequence dna and the method for acquisition cDNA known in the art, the nucleotide sequence of coding TRAF2TR and TRAF2TD can clone or prepare from wild-type TRAF2 easily and insert appropriate carrier, at external or these protein of expression in vivo.Describe referring to document about the method that relates to clone cDNA and expression vector, Sambrook etc., together above.

No matter the gene of coding TRAF2 is genomic dna or cDNA, all separable from people's gene group library or the cDNA library.The method that obtains the gene of the given dna sequence dna information of tool this paper is well-known in the art.Available standard step known in the art obtains TRAF2 DNA from cloned DNA (being DNA " library ").Preferably by the cDNA library that from the tissue of this protein of high level expression, prepares (as, the cell in lymph source, especially, B cell or osteosarcoma cell line, for example, the human osteosarcoma SAOS-2 (ATCCNo.HTB-85) that presents TRAF2 or TRAF2TR high level expression) obtain.DNA also can by purifying from expect the genomic dna of cell or its fragment cloning obtain (consult, for example, Sambrook etc., 1989, the same; Glover, D.M. (editor) 1985, dna clone: practical approach, MRL press, Ltd., Oxford, Britain, I, II volume) or with the acquisition of the method for chemosynthesis.The clone who derives from genomic dna also can comprise adjusting and introne DNA district except that the coding region; Clone from cDNA will not contain intron sequences.Because the present invention's part is with the basis that is separated into of total length TRAF2 splice variant (TRAF2TR), so wish to obtain the cDNA of coding TRAF2TR sequence.

The method that obtains cDNA is well-known in the art.Say that briefly these methods comprise the mixture that separates messenger RNA(mRNA) (mRNAs) from eukaryotic cell, and use the synthetic and separating mRNA complementary double-stranded DNA copy (cDNAs) of a series of enzymatic reactions.

As proposing among the embodiment 1 hereinafter, found that reverse transcriptase polymerase chain reaction (RT-PCR) clone is the effective ways that separate the cDNA that contains the TRAF2TR splice variant.RT-PCR comprises with reversed transcriptive enzyme reverse transcription cell mRNA, the DNA product that produces with pcr amplification subsequently.

No matter be that with where formula obtains purpose cDNA, all can be with in many known technologies any with double-stranded cDNA mixture insertion cloning vector, this depends in part on used special carrier at least.In following document, multiple insertion method has been carried out quite detailed discussion: Enzymology method (Methods in Enzymology), 68,16-18 (1980), and Sambrook etc., 1989, the same.

In case dna fragmentation inserts cloning vector, cloning vector just is used to transform appropriate host.These cloning vectors are given the proterties of host's antibiotin resistance usually.Such host is prokaryotic cell prokaryocyte and have only some host cells to contain purpose cDNA normally.Transfected host cell has been formed gene " library ", becomes the representative sample of existing mRNA in the cell of isolating mRNA.

According to the sequence information of the TRAF2 that this paper provided, can prepare suitable oligonucleotide sequence, preferably synthetic as mentioned above, and be used to differentiate the clone who contains the TRAF2 sequence.In order to identify the clone who contains the TRAF2 sequence, single conversion or cells transfected are grown up to bacterium colony on nitrocellulose filter.The dissolving bacterium colony and by the heating DNA closely is fixed on the filter paper.Then with filter paper be labeled oligonucleotide probe with the TRAF2 complementary and be incubated.To hybridize on probe with the basic homologous dna fragmentation of TRAF2.The homology degree is big more, and spendable hybridization conditions is rigorous more.

Probe and its complementary cDNA hybridization.Can identify maybe that with radioautograph the chemical reaction that probe exists can identify.In order to identify the one or more clones that contain all structural informations of target protein matter, carry out qualitative to the clone.The nucleotide sequence of separation coding target protein is laid equal stress on and is inserted in the expression vector.Expression vector places the regulation and control of special protokaryon or eucaryon controlling elements down with clone gene, makes ds-DNA effective expression (transcribe and translate).

Further screening can genetic characteristics be that carry out on the basis.For example, whether gene is encoded and is had protein that amino acid identical on, the electrophoresis isoelectric with TRAF2 forms or the protein with TRAF2 protein portion aminoacid sequence as mentioned above.Therefore, by with its expression product physics, chemistry or immunological characteristic being existing of the analysis detectable gene that carries out of basis.For example, by its protein that produces on electrophoretic migration, isoelectrofocusing, lack of balance pH gel electrophoresis, proteolysis or antigenicity, whether have the characteristic similar or identical and select cDNA clone or dna clone with TRAF2TR.

The structure of TRAF2TD and preparation

With respect to TRAF2TR, TRAF2TD lacks 1-87 amino acids and these amino acid whose corresponding nucleotides of coding.The dna sequence dna of TRAF2TD is seen Fig. 3 a, and aminoacid sequence is seen Fig. 3 b.

Any suitable method all can be used for preparing TRAF2TD, for example, comprises the whole bag of tricks based on above-mentioned information.There are many methods to can be used for producing the TRAF2TR of the clipped form that lacks the 1-87 amino acids.In preferred manufacturing procedure, TRAF2TR cDNA is as pcr template, and 5 ' used primer contains the 262-280 position Nucleotide (ATGAGTTCGGCCTTCCCAGAT) of TRAf2 complete encoding sequence, comprising the initiation site of ATG with the foundation translation; 3 ' primer is TTA TAG CCC TGT CAG GTC CAC.The construct that produces starts from the 88th amino acids of total length TRAF2, the 123-201 amino acids of disappearance TRAF2TR.

Other variant that can prepare TRAF2TR with the mode of method of the above-mentioned TRAF2TD of preparation and so on.

The TRAF2TR/2TD variant

Allele variant, replacement, interpolation and deletion mutant, analogue and the derivative (hereinafter being referred to as " TRAF2TR/2TD variant ") that comprise TRAF2TR or TRAF2TD in the scope of the invention, and from other species, have the homologue with the same or similar functionally active of TRAF2TR.In preferred embodiments, the present invention puts into practice the gene of having used the tool disappearance or having replaced, and described sudden change has improved the ability of protogene product inhibition TNF signal pathway.The preparation of TRAF2TR/2TD variant or separation are also within the scope of the invention.Therefore, scope of the present invention comprises the TRAF2TR/TRAF2TD variant of tool functionally active, promptly presents one or more functionally activies relevant with TRAF2TR.

Change nucleic acid sequence encoding to provide function suitable molecule by replacing, add or lacking, can prepare the TRAF2TR/2TD variant.Preferred preparation has the TRAF2TR/2TD albumen of the functionally active that strengthens or improve with respect to TRAF2TR or TRAF2TD.

Because the degeneracy of nucleotide coding sequence, other dna sequence dna of the aminoacid sequence substantially the same with TRAF2TR of encoding (comprising the aminoacid sequence that contains the single amino acids variation) also can be applicable in the practice of the present invention.These comprise, but be not limited to, allelotrope, from the homologous gene of other species and the nucleotide sequence that contains all or part of TRAF2TR, said nucleotide sequence changes by replacing with the different codons of same amino acid residue in the former sequence of coding, therefore produces reticent variation.Same, TRAF2TR/2TD variant of the present invention comprises, but be not limited to, from the one-level aminoacid sequence, the variant that contains all or part of aminoacid sequence of TRAF2TR comprises with the residue that causes conserved amino acid to replace in the sequence and comes the suitable amino-acid residue of alternative functions and reformed sequence.For example, the one or more amino-acid residues like the available polar phase in another aminoacid replacement sequence, it can be used as the function coordinator, produces reticent change.Amino acid whose replacement can be selected from other member of the affiliated type of this amino acid in the sequence.For example, nonpolar (hydrophobicity) amino acid comprises L-Ala, leucine, Isoleucine, Xie Ansuan, proline(Pro), phenylalanine, tryptophane and methionine(Met).The amino acid of band aromatic ring structure is phenylalanine, tryptophane and tyrosine.Polar neutral amino acid comprises glycine, Serine, Threonine, halfcystine, tyrosine, l-asparagine and glutamine.(alkalescence) amino acid of positively charged comprises arginine, Methionin and Histidine.Electronegative (acidity) amino acid comprises aspartic acid and L-glutamic acid.Expect apparent molecular weight or the iso-electric point that such change can impact polypropylene acrylamide gel cataphoretic determination.

Especially preferred replacement is:

-replace arginine with Methionin, vice versa, thereby keep positive charge;

-replace aspartic acid with L-glutamic acid, vice versa, thereby keep negative charge;

-replace Threonine with Serine, thus keep free hydroxyl group; And

-replace l-asparagine with glutamine, thus keep free CONH ₂

Also can import aminoacid replacement, with the aminoacid replacement of the special preferred characteristics of closet.For example, halfcystine can be introduced a site that may form disulfide linkage with other halfcystine.Histidine can be introduced as the site (that is, Histidine can be used as acid or alkali, is amino acid the most frequently used in the biochemical catalysis) that catalytic activity is arranged especially.The introducing of proline(Pro) is that this structure can be induced β-corner in protein structure owing to its special two dimensional structure.

The gene of code book invention TRAF2TR/2TD variant can produce with several different methods known in the art.The operation that causes them to produce can occur in gene or protein level.For example, the TRAF2 gene order that any modification in available many strategies known in the art is cloned (Sambrook etc., 1989, the same).The available constraints restriction endonuclease cuts this sequence in suitable site, if needs also can carry out further enzymatically modifying, separation is connected with external.When producing the gene of coding TRAF2TR/2TD, the gene after care should be used to guarantees to modify is retained in the translation reading frame identical with TRAF2TR and is not translated termination signal interrupts in the active gene regions of coding expection.

In addition, the nucleotide sequence of coding TRAF2TR/2TD can be external or vivo mutations to set up and/or to destroy translation, initial and/or terminator sequence, or set up the variation in the coding region and/or form new restriction endonuclease sites or destroy the former site that pre-exists, thereby convenient further external modification.Preferably, such sudden change has strengthened the functionally active of mutation T RAF2TR gene product.Any induced-mutation technique known in the art all can use, includes, but are not limited to, external site-directed mutagenesis (Hutchinson, C., etc., 1978, journal of biological chemistry (J.Biol.Chem.) 253:6551; Zoller and Smith, 1984, DNA3:479-488; Oliphant etc., 1986, gene 44:177; Hutchinson etc., 1986, institute of NAS newspaper (Proc.Natl.Acad.Sci.U.S.A.) 83:710), the use of " TAB " joint (Pharmacia), or the like.Round pcr is preferred in the site-directed mutagenesis (see Higuchi, 1989, " using the PCR processed dna ", in " round pcr: the principle of DNA cloning and application ", H.Erlich, editor, Stockton Press, the 6th palm, 61-70 page or leaf).

Below about the discussion of the operation of the DNA of coding expection polypeptide and expression all be general for TRAF2TR and TRAF2TD and TRAF2TR/2TD variant.

TRAF2TR, TRAF2TD and TRAF2TR/2TD variant are cloned into clone/expression vector

Can with identify with separates after dna sequence dna insert suitable clone/expression vector (title " carrier " after this), thereby make things convenient for sequence modification or protein expression.These carriers generally comprise multiple clone site, promotor, convenient sequence and selective marker of duplicating in host cell.

Any suitable carriers all can be used.Known in the art just have many.Spendable carrier includes, but are not limited to, for example, and the virus after plasmid or the modification.Carrier usually with for the host cell of its introducing to make things convenient for duplicating of carrier compatible with the expression of coded protein.For example, thus can by the cloning vector that dna fragmentation is inserted with complementary cohesive end finish dna sequence dna insert the work of given carrier.But, if the used complementary restriction site of dna fragmentationization is not present in the cloning vector, but the end enzymatically modifying of dna molecular then.Perhaps, by nucleotide sequence (joint) is connected to the site that the DNA end can produce any expection; The joint of these connections can comprise the special chemical synthetic oligonucleotide of the restriction endonuclease recognition sequence of encoding.Useful carrier can be made up of karyomit(e), non-chromosome and synthetic dna sequence dna section.The special carrier example that can be used in the present invention's practice includes, but are not limited to coliphage, for example, λ derivative, or plasmid, for example, pBR322 derivative or pUC plasmid derivative thing are as pmal-c, pFLAG, SV40 derivative and known bacterial plasmid, as escherichia coli plasmid colE1, pCR1, pMa1-C2, pET, pGEX (Smith etc., 1988, gene 67:31-40), pMB9 and their derivative, the plasmid such as RP4; Phage DNA, as many derivatives of phage 1, as NM989, and other phage DNA, as M13 and thread single stranded phage DNA; Yeast vector or derivatives thereof such as 2 μ m plasmids; Can be used for eukaryotic carrier, for example, can be used for the carrier of insect cell, baculovirus vector for example can be used for the carrier of mammalian cell; Plasmid and phage DNA are united the carrier of formation, and be modified so that use the plasmid of phage DNA or other expression control sequenc; Or the like.

Can include, but are not limited to non-pattern of fusion pYES2 carrier (XbaI, SphI, ShoI, NotI, BstXI, EcoRI, BamHI, SacI, KpnI and HindIII cloning site by the yeast vector that the present invention uses; Invitrogen) or pattern of fusion pYESHisA, B, C (XbaI, SphI, ShoI, NotI, BstXI, EcoRI, BamHI, SacI, KpnI and HindIII cloning site are with the ProBond resin purification and with the N-terminal peptide of enteropeptidase cutting; Invitrogen).

The available baculovirus vector comprises various carriers in the present invention's practice, and non-pattern of fusion transfer vector and pattern of fusion transfer vector all can use, and wherein non-pattern of fusion transfer vector has: for example, and pVL941 (BamHI cloning site; Summers), pVL1393 (BamHI, SmaI, XbaI, EcoRI, NotI, XmaIII, BglII and PstI cloning site; Invitrogen), pVL1392 (BglII, PstI, NotI, XmaIII, EcoRI, XbaI, SmaI and BamHI cloning site; Summers and Invitrogen) and pBlueBacIII (BamHI, BgIII, PstI, NcoI and HindIII cloning site, available indigo plant/white recombinant screen; Invitrogen); The pattern of fusion transfer vector has: for example, pAc700 (BamHI and KpnI cloning site, wherein the BamHI recognition site starts from initiator codon; Summers), (there is the BamHI cloning site at 36 base pair places, polyhedrin initiator codon downstream to pAc701 with pAc702 (identical with pAc700, as to have different reading frames), pAc360; Invitrogen (195)) (three kinds of different reading frames have BamHI, BglII, PstI, NcoI and HindIII cloning site, are used for the N-terminal peptide and the indigo plant/hickie recombinant screen of ProBond purifying with pBlueBacHisA, B, C; Invitrogen).

The present invention considers that the Mammals carrier that uses comprises, for example, the tool inducible promoters is the carrier of Tetrahydrofolate dehydrogenase (DHFR) promotor for example, any expression vector as tool DHFR expression vector, or DHFR/ methotrexate coamplification carrier, for example, (PstI, SalI, SbaI, SmaI and EcoRI cloning site, this carrier be cloning by expression gene but also express DHFR not only for pED; Consult Kaufman, the general handbook of molecular biology, 16.12 (1991)).Perhaps use glutamine synthetase/methionine(Met) sulfo group oxime coamplification carrier, for example, pEE14 (HindIII, XbaI, SmaI, SbaI, EcoRI and BclI cloning site, vector expression glutamine synthetase wherein and by cloned genes; Celltech).In another embodiment, can use the carrier that under EpsteinBarr virus (EBV) control, instructs episome genetic expression, for example, pREP4 (BamHI, SfiI, XhoI, NotI, NheI, HindIII, NheI, PvuII and KpnI cloning site, long terminal repetition fragment (RSV-LTR) promotor of composing type Rous sarcoma virus, hygromycin selectable marker; Invitrogen), pCEP4 (BamHI, SfiI, XhoI, NotI, NheI, HindIII, NheI, PvuII and KpnI cloning site, composing type human cytomegalic inclusion disease virus (hCMV) immediate early gene, hygromycin selectable marker; Invitrogen), pMEP4 (KpnI, PvuI, NheI, HindIII, NotI, XhoI, SfiI, BamHI cloning site, derivable metallothionein(MT) IIa gene promoter, hygromycin selectable marker; Invitrogen), pREP8 (BamHI, XhoI, NotI, HindIII, NheI and KpnI cloning site, RSV-LTR promotor, histidinol selective marker; Invitrogen), pREP9 (KpnI, NheI, HindIII, NotI, XhoI, SfiI and BamHI cloning site, RSV-LTR promotor, G418 selective marker; Invitrogen) and pEBVHis (RSV-LTR promotor, hygromycin selectable marker, can be by the ProBond resin purification and with the N-terminal peptide of enteropeptidase cutting; Invitrogen).Be used for the mammalian expression vector of selecting of the present invention and comprise pRc/CMV (HindIII, BstXI, NotI, SbaI and ApaI cloning site, G418 selection; Invitrogen), pRc/RSV (HindIII, SpeI, BstXI, NotI, XbaI cloning site, G418 selection; Invitrogen), pcDNA3 (HindIII, KpnI, BamHI, BstXI, EcoRI, EcoRV, BstXI[repeat], NotI, XhoI, XbaI, ApaI cloning site, G418, penbritin screening, Invitrogen) and other.The vaccinia virus mammalian expression vector that the present invention uses (is seen, Kaufman, 1991, the same) comprise, but be not limited to pSC11 (SmaI cloning site, TK-and β-gal screening), pMJ601 (SalI, SmaI, AflI, NarI, BspMII, BamHI, ApaI, NheI, SacII, KpnI and HindIII cloning site; TK-and β-gal screens) and pTKgptF1S (EcoRI, PstI, SalI, AccI, HindIII, SbaI, BamHI and Hpa cloning site, TK or XPRT screening).

The target DNA sequence that confirms coding TRAF2TR, TRAF2TD or TRAF2TR/2TD variant that ins all sorts of ways is cloned in the carrier.Usually can use following one or more methods: (a) pcr amplification of purpose plasmid DNA or special mRNA, (b) nucleic acid hybridization, (c) existence of selectable marker gene function or disappearance (d) are analyzed with suitable restriction enzyme, and (e) expression of insertion sequence.In first method, available pcr amplification nucleic acid is to detect amplified production.In the second approach, the existence that available probe inserts the foreign gene of expression vector by the nucleic acid hybridization detection, used probe contains and inserts marker gene homologous sequence.In the third method, can foreign gene insert carrier and some " selective marker " gene function of causing (as, betagalactosidase activity, thymidine kinase activity, to antibiotic resistance, transform the formation of inclusion body in phenotype, the baculovirus, or the like) existence or to lose be that identify and screening recombinant vectors/host system on the basis.In another embodiment, if the nucleic acid of coding TRAF2TR inserts in " selective marker " gene order of carrier, can identify that by the disappearance of selectable marker gene function containing TRAF2TR inserts segmental recon.In the 4th kind of method, by identifying recombinant expression vector with suitable Restriction Enzyme digestion.In the 5th kind of method,, can identify recombinant expression vector by activity, biochemistry or the immunological characteristic of check recon expressed gene product if marking protein presents the functionally active conformation.

Promotor

The nucleotide sequence of coding TRAF2TR or TRAF2TD or its TRAF2TR/2TD variant can insert contain be inserted into protein coding sequence transcribe and translate institute must the expression vector of element in.Such element is referred to herein as " promotor ".Therefore, the nucleic acid of code book invention polypeptide in expression vector of the present invention with being connected of promotor operability.CDNA and genome sequence all can clone and expression under such adjusting sequence control.Expression vector also preferably includes replication orgin.Essential transcribing with translation signals can be provided on the recombinant expression vector, or provided by natural gene and/or its flanking region of coding TRAF2.Aforementioned any method that dna fragmentation is inserted cloning vector all can be used for making up the expression carrier that contains that tool is suitable and transcribe/translate control signal and protein coding sequence.These methods can comprise extracorporeal recombinant DNA and synthetic technology, and reorganization (genetic recombination) in the body.

Express available any promotor known in the art/enhancer element control, but these regulatory elements must there be function the selected host who is used for expressing.The promotor that can be used for controlling TRAF2TR genetic expression comprises, but be not limited to, SV40 early promoter district (Benoist and Chambon, 1981, nature (Nature) 290:304-310), contained promotor (Yamamoto etc. in Rous sarcoma virus 3 ' the long terminal repetition fragment, 1980, cell 22:787-797), herpesvirus thymine deoxyriboside kinase promotor (Wagner etc., 1981, newspaper (Proc.Natl.Acad.Sci.U.S.A.) 78:1441-1445 of institute of NAS), adjusting sequence (the Brinster etc. of metallothionein gene, 1982, natural 296:39-42); Prokaryotic expression carrier, for example, the β-Nei Xiananmei promotor (Villa-Kamaroff etc., 1978, institute of NAS newspaper, 75:3727-3731) or the tac promotor (DeBoer etc., 1983, institute of NAS newspaper, 80:21-25); Also can consult " from the useful proteins matter of recombinant bacteria " literary composition among the scientific and technological American (ScientificAmerican), 1980,242:74-94; From the promoter element of yeast or other fungi, for example, Gal4 promotor, ADC (alcoholdehydrogenase) promotor, PGK (phosphoglycerokinase) promotor, alkaline phosphatase promoter; With present tissue specificity and be used for the animal transcripting controling areas of transgenic animal: activated elastoser I gene-controlled area (Swift etc., 1984, cell 38:639-646 in the pancreas cystencyte; Ornitz etc., 1986, Cold Spring Harbor Symp.Quant.Biol., 50:399-409; MacDonald, 1987, hepatology (Hepatology) 7:425-515); Activated insulin gene control region in the pancreas beta cell (Hanahan, 1985, natural 315:115-122), in lymphocyte activated immunoglobulin gene control region (Grosschedl etc., 1984, cell 38:647-658); Adames etc., 1985, natural 318:533-538; Alexander etc., 1987, cellular elements biology Mol.Cell。Biol。7:1436-1444), activated mouse mammary tumor virus control region (Leder etc. in testis, breast, lymph and mastocyte, 1986, cell 45:485-495), activated albumin gene control region (Pinkert etc. in liver, 1987, gene and growth (Geneand Devel.) 1:268-276), activated a-fetoprotein gene control region (Krumlauf etc., 1985, cellular elements biology 5:1639-1648 in liver cell; Hammer etc., 1987, science (Science) 235:53-58), activated alpha1 Anti-trypsin gene-controlled area (Kelsey etc. in liver cell, 1987, gene and growth, 1:161-171), activated beta globin genes control region (Mogram etc., 1985, natural 315:338-340 in medullary cell; Kollias etc., 1986, cell 46:89-94), activated MBP gene control region (Readhead etc. in the oligodendrocyte of brain, 1987, cell 48:703-712), in skeletal muscle activated myosin light chain 2 gene-controlled areas (Sani, 1985, natural 314:283-286) and in hypothalamus activated gonadotropin releasing hormone gene-controlled area (Mason etc., 1986, science 234:1372-1378).

Carrier is introduced host cell

Carrier can be introduced host cell with any suitable method, comprise, dying (lysosome fusion), particle gun or dna vector transporter as transfection, electroporation, microinjection, transduction, cytogamy, deae dextran, calcium phosphate precipitation, fat (consults, as Wu etc., 1992, biochemical magazine (J.Biol.Chem.) 267:963-967; Wu and Wu, 1988, biochemical magazine 263:14621-14624; Hartmut etc., Canadian patent application 2,012,311, submit to March 15 nineteen ninety), produce many gene copies thus.Preferred clone gene for expanding in clone cell such as intestinal bacteria, and makes things convenient for purifying to be used for inserting subsequently suitable express cell system on shuttling expression plasmid vector.For example, shuttle vectors is the carrier that can duplicate in the organism of more than one types, can can in intestinal bacteria, duplicate by being connected preparation with sequence, again the shuttle vectors that can in yeast saccharomyces cerevisiae, duplicate from the sequence of intestinal bacteria plasmid from yeast 2 μ m plasmids.

Host cell systems

Possible host cell systems includes, but are not limited to: the mammalian host cell line system that has infected virus (as vaccinia virus, adenovirus etc.); Infected the insect host cell system of virus (as baculovirus); Microorganism is such as the yeast that comprises yeast vector; Or the bacterium that transforms with phage, DNA, plasmid DNA or cosmid DNA.The vector expression element all changes on intensity and specificity to some extent.Depend on used host cell systems, can use multiple suitable in the element any transcribed and translate.

In addition, can select the appropriate host cell strain, it can regulate the expression of insertion sequence, or modifies and the processed gene product in the special mode of expection.Different host cells has its characteristic and unique protein translation and translation post-treatment and modified mechanism.Can select suitable clone or host system to modify and processing with the expection that guarantees expressed exogenous protein.In yeast, express and to produce bioactive product.In eukaryotic cell, express and to improve " nature " folding possibility.In addition, in mammalian cell, express to can be reorganization or to constitute TRAF2TR and suppress activity instrument is provided.And different carrier/host expression systems can influence the processing reaction in various degree, cuts such as proteolysis.As noted above, expression vector of the present invention all can be used for screening or the biological detection of transfectional cell for the active regulon of TRAF2TR.

Behind the recombination and integration encoding sequence, reorganization TRAF2TR of the present invention, TRAF2TD or TRAF2TR/2TD variant can be expressed on karyomit(e).In this, there are some amplification systems to can be used for obtaining to stablize the high level expression (see Sambrook etc., 1989, the same) of gene.

The cell of having introduced the recombinant vectors that contains the TRAF2TR coding nucleic acid is incubated in the suitable cell culture medium under the condition for cell expressing TRAF2TR.

In case set up appropriate host system and growth conditions, just can breed and prepare a certain amount of recombinant expression vector.As mentioned above, by collecting the protein that nutrient solution or dissolving inclusion body can obtain soluble form, as, use detergent-treatment, if needs can also be with supersonic method or other mechanical workout.With separable dissolved of multiple technologies or soluble protein, comprise polyacrylamide gel electrophoresis (PAGE), isoelectrofocusing, two dimensional gel electrophoresis, chromatography (as ion-exchange, affine, the affine and size-exclusion column chromatography of immunity), centrifugal, difference solubleness, immunoprecipitation or be used for any other standard technique of protein purification.

As mentioned above, " cutting body " is any instrument that is used for nucleic acid of the present invention is transferred to host cell.Preferred carrier is a virus vector, for example, and retrovirus, simplexvirus, adenovirus and adeno associated virus.Thus, with virus vector or the direct importing by DNA with in the segmental genosome of code book invention protein or polypeptide structure territory, exsomatize or external introducing.Can reach the purpose of in target tissue, expressing by transgene carrier being oriented to specific cell, as with virus vector or receptor-ligand, or use tissue-specific promotor, or the two be used in combination.

The use of virus carrier system in the interior treatment process of stripped and body

The virus vector that is generally used for interior or stripped orientation of body and treatment step is carrier and the retroviral vector based on DNA.The method that makes up and use virus vector is [sees, as Miller and Rosman, BioTechniques7:980-990 (1992)] known in the art.Preferred virus vector is a replication defect type, that is, they can not self-replicating in target cell.In general, the replication-defective virus vector gene group of using in the scope of the invention lacks at least one virus duplicate necessary zone in cells infected.The known any technology of these regional available those skilled in the art or deleted (all or part of) or make its no function.These technology comprise fully removing, replacing (using other sequences, the nucleic acid that especially is inserted into), part deletion or one or more bases are added into essential (for duplicating) to be distinguished.Handle and to finish such technology in external (on separated DNA) or original position with genetic manipulation method or with mutagenic compound.Preferred replication-defective virus keeps the necessary genome sequence of packaging virus particle.

That dna viral vector comprises attenuation or defective type dna virus, such as following virus, but be not limited to this: hsv (HSV), human papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno associated virus (AAV), vaccinia virus, or the like.The preferred defective virus that lacks virogene fully or almost completely.Defective virus does not have replication after introducing cell, thereby can not cause issuable virus infection.Use the defective virus carrier to enter cell, and do not worry that this carrier can infect other cells at special regional area.

Therefore can specially be oriented to particular tissues.The example of concrete carrier comprises, but be not limited to, defective herpesvirus 1 (HSV1) carrier [Kaplitt etc., molecular cell neuroscience (Molec.Cell.Neurosci.) 2:320-330 (1991)], [the open WO94/21807 of international patent application is published on September 29th, 1994 for the defective herpesvirus carrier [patent disclosure RD371005A] of disappearance glycoprotein L gene or other defect type herpesvirus vector; The open WO92/05263 of international patent application is published on April 2nd, 1994]; The adenovirus carrier of attenuation is such as described carriers such as Stratford-Perricaudet [Journal of Clinical Investigation (J.Clin.Invest.) 90:626-630 (1992); Also visible La Salle etc., science (Science) 259:988-990 (1993)]; And defective type adeno-associated virus vector [Samulski etc., Journal of Virology (J.Virol.) 61:3096-3101 (1987); Samulski etc., Journal of Virology (J.Virol.) 63:3822-3828 (1989); Lebkowski etc., molecular cytobiology (Mol.Cell.Biol.) 8:3988-3996 (1988)].

When using in the body, preferably suitable immunosuppressant therapy is used in combination to avoid the immune inactivation of virus vector and cells infected with virus vector (as adenovirus carrier).For example, available such as il-1 2 (IL-12), the immunosuppressant cell factor of Interferon, rabbit-g (IFN-g) or anti-CD 4 antibodies and so on is blocked the body fluid of virus vector or cellullar immunologic response [referring to, as Wilson, natural medical science (Nature Medicine) (1995)].In addition, use and to be transformed into that to express the antigenic virus vector of minimum quantity be favourable.

Nature, the present invention relates to sending of carrier and pass, its TRAF2TR with the expression treatment significant quantity is used for gene therapy.Be used for that herein phrase " treatment significant quantity " refers to be enough to reduce or most preferably prevention cause the amount of TNF α in conjunction with the immunne response of the obvious clinical manifestation of relative disease.Perhaps, the treatment significant quantity is the amount that is enough to improve the tangible clinical symptom of host.

Exsomatize and reach the preferred virus carrier system that uses in the interior therapeutic method

Methods of treatment of the present invention is well set up and be applicable to some virus carrier system in the art.

A. adenovirus system

In preferred embodiments, carrier is an adenovirus carrier.Adenovirus is an eukaryotic DNA virus, it can be modified the back with effective transmission nucleic acid of the present invention to the broad variety cell.The adenovirus that has multiple serotype.Within the scope of the present invention, preferably 2 types in these serotypes or the adenovirus (seeing WO94/26914) of 5 type adenovirus hominiss (Ad2 or Ad5) or animal-origin.The adenovirus that can be used for those animal-origins in the scope of the invention (for example: SAV) Lai Yuan adenovirus comprises dog, ox, mouse (for example: Mayl, Beard etc., virusology 75 (1990) 81), sheep, pig, fowl and ape.Preferred animal source adenovirus is a hepatitis infectiosa canis virus, more preferably CAV2 adenovirus (as Manhattan or A26/61 strain (ATCC VR-800)).

Preferred replication-defective adenoviral vector of the present invention comprises ITR, capsidation sequence and purpose nucleic acid.More preferably the E1 district right and wrong of adenovirus are functional at least.Disappearance in the E1 district is preferably the 455-3329 position Nucleotide (PvuII-BglII fragment) or the 382-3446 position Nucleotide (HinfII-Sau3A fragment) of Ad5 adenoviral sequence.Other zone also can be modified, especially any among E3 district (WO95/02697), E2 district (WO94/28938), E4 district (WO94/28152, WO94/12649 and WO95/02697) or the late gene L1-L5.

In preferred embodiments, adenovirus carrier has disappearance (Ad1.0) in the E1 district.The adenovirus example of E1-disappearance is published in EP185, and 573, its content is incorporated into own forces as a reference at this.In another preferred embodiment, adenovirus carrier has disappearance (Ad3.0) at E1 and E4 district.The adenovirus example of E1/E4-disappearance is published in WO95/02697 and WO96/22378, and its content is incorporated into own forces as a reference at this.In another embodiment preferred, adenovirus carrier has disappearance in the E1 district, and has inserted E4 district and nucleotide sequence (see FR94 13355, its content is incorporated into own forces as a reference at this) therein.

All can prepare duplicate deficit type recombinant adenovirus of the present invention (Levero etc., gene 101 (1991) 195, EP185 573 with the known any technology of those skilled in the art; Graham, EMBO J.3 (1984) 2917).Especially, they can be by adenovirus and the homologous recombination of wherein carrying between the plasmid of target DNA sequence prepare.After going into suitable clone, adenovirus and plasmid co-transfection can finish homologous recombination.The clone that adopts preferably (i) is that described element is transformable, and (ii) contain can with replication-defective adenoviral genome part complementary sequence, it preferably is present in the clone with integration form, thereby has avoided producing the risk of recombinating.As described in patent application WO94/26914 and WO95/02697, available clone example is that the human embryonic kidney cell is 293 (Graham etc., J.Gen.Virol.36 (1997) 59), it contains the Ad5 adenovirus left-hand part genome (12%) that is integrated in its genome, and the clone that can remedy E1 and E4 function.Reclaim and the purification of Recombinant adenovirus with the well-known standard molecular biological technique of this area routine techniques personnel.

B. adeno-associated virus vector system

Adeno associated virus (AAV) is relatively little dna virus, and they can be integrated in the genome of cells infected with stable locator means.The cell that they can infect wide spectrum does not influence cell growth, form or differentiation, and they look the pathology problem that does not relate to the people.The AAV genome is cloned, order-checking and qualitative.It comprises about 4700 bases, and two ends contain 145 bases of having an appointment oppositely terminal repetition (ITR) district, it can be used as virus replication orgin.Genomic remainder is divided into the base region of two tool capsidation functions: genomic left-hand part contains the rep gene that relates to virus replication and viral gene expression; Genomic right hand portion contains the cap gene of the viral capsid proteins of encoding.

Relevant be used to from the carrier of AAV in vitro and in vivo in the example document of metastatic gene existing report (referring to WO91/18088; WO93/09239; US4,797,368, US5,139,941, EP488 528).The document description that these are delivered the construct in many AAV-sources, wherein rep and/or cap genetically deficient and substituted by goal gene are utilized these constructs (directly to enter organism) in external (entering culturing cell) or body and are shifted described goal gene.There are the plasmid in two AAV oppositely terminal repetition (ITR) district and the plasmid co-transfection that carries AAV capsidation gene (rep and cap gene) to go into the clone that is infected by people helper virus (for example adenovirus) by containing purpose nucleotide sequence and this sequence flank, can prepare replication defect type reorganization AAV of the present invention.Use the AAV recon of standard technique purifying generation subsequently.

Therefore, the invention still further relates to the recombinant virus in AAV-source, it is the nucleotide sequence of AAV ITR that its genome comprises coding TRAF2TR or TRAF2TD and flank.The invention still further relates to and contain coding TRAF2TR or TRAF2TD and flank is the plasmid of the nucleotide sequence of two AAV ITR.Such plasmid can be used for the transfer nucleic acid sequence, and in appropriate circumstances, nucleotide sequence mixes liposome vectors (pseudovirus) with plasmid.

C. retroviral vector system

In another embodiment, gene can be introduced in the retroviral vector, for example consults following document: Anderson etc., United States Patent (USP) 5399346; Mann etc., 1983, cell 33:153; Temin etc., United States Patent (USP) 4650764; Temin etc., United States Patent (USP) 4980289; Markowitz etc., 1988, Journal of Virology 62:1120; Temin etc., United States Patent (USP) 5124263; EP453242, EP178220; Bernstein etc., genetic engineering (Genet.Eng.) 7 (1985) 235; McCormick, biotechnology (BioTechnlogy) 3 (1985) 689; The open WO95/07358 of international monopoly is published in March 16 nineteen ninety-five, applicant Dougherty etc.; And Kuo etc., 1993, hematology (Blood) 82:845.Retrovirus is the integration virus that infects somatoblast.The reverse transcription virus gene group comprises two LTR, capsidation sequence and three coding regions (gag, pol and env).In recombinant retroviral vector, the common all or part of disappearance of gag, pol and env gene, and alternative with allogenic purpose nucleotide sequence.These carriers can be from dissimilar retroviral constructs, as HIV, MoMuLV (" mouse Moroni leukosis virus "), MSV (" mouse Moroni sarcoma virus "), HaSV (" Harvey sarcoma virus "); SNV (" SNV "); RSV (" Rous sarcoma virus ") and Friend virus.The defective type retroviral vector is published in the document WO 95/02697.

In general, in order to make up the recombinant retrovirus that contains nucleotide sequence, made up the plasmid that contains LTR, capsidation sequence and encoding sequence earlier.This construct is used for the transfection package cell line, and this clone can the trans retrovirus function that defective in the plasmid is provided.Usually, such package cell line can be expressed gag, pol and env gene.Such package cell line is existing in the prior art to be described, especially clone PA317 (US4861719); PsiCRIP clone (WO90/02806) and GP+envAm-12 clone (WO89/07150).In addition, recombinant retroviral vector can have modification to suppress transcriptional activity in LTR, also can contain the capsidation sequence (Bender etc., Journal of Virology 61 (1987) 1639) that wherein can comprise part gag gene.But with the known standard method purification of Recombinant of this area routine techniques personnel retroviral vector.

Can make up retroviral vector is used as infectious particles or carries out the single-wheel transfection.In the case in the past, virus is modified keeping the every other gene the gene that wherein removes responsible oncogenic transformation characteristic, and expression of heterologous genes.Preparation non-infectious virus carrier is packed the required structure gene of cotransfection virus with the break virus packaging signal but keep, and described virus contains heterologous gene and packaging signal after transforming.Therefore, the virion of generation can not be produced other virus.Targeted gene delivery is published in October nineteen ninety-five referring to the open WO95/28494 of international monopoly.

Exsomatize and the external treatment method in used non-viral system

Some non-viral system has been used for this area and can have promoted the DNA of code book invention polypeptide to enter in the expection target cell.

A. delivery system is sent in the fat transfection

Can introduce carrier in vivo by the fat transfection.In the past decade, more and more external packing and transfections that liposome are used for nucleic acid.For solving the difficult and dangerous synthesizing cationic lipid that designs that is in distress in the liposome-mediated transfection, can be used for preparing liposome, [Felgner etc., institute of NAS report 84:7413-7417 (1987) for the gene of transfection coded markings in vivo; Referring to Mackey etc., institute of NAS reports 85:8027-8031 (1988); Ulmer etc., science 259:1745-1748 (1993)].Use positively charged ion lipid can promote the packing of electronegative nucleic acid, also promote the fusion [Felgner and Ringold, science 337:387-388 (1989)] between it and the electronegative cytolemma.Be used for the especially effectively lipoid substance of transfer nucleic acid and composition referring to international patent document WO95/18863 and WO96/17823, and United States Patent (USP) 5459127.Using the fat transfection in vivo introduces special organ with foreign gene and has some actual benefit.The molecular orientation of liposome is one of advantage in specific cell.Known that directed transfection to special cells type is especially favourable in the tissue of tool cell heterogeneity, for example, in pancreas, liver, kidney and brain.For the purpose of orientation, but the lipid chemical coupling [is seen Mackey etc., the same] to other molecules.Direction-sense peptide (as hormone or neurotransmitter) and protein (as antibody) are arranged but or non-peptide molecule all chemical coupling to liposome.

Other molecule also can be used for promoting the interior transfection of body of nucleic acid, for example positively charged ion oligomeric peptide (as, international patent document WO95/21931), from the peptide (as international patent document WO96/25508) or the cationic polymers (as international patent document WO95/21931) of dna binding protein dna.

B. naked DNA send delivery system

Can also carrier be imported in the body with the form of naked DNA plasmid and (see United States Patent (USP) 5693622,5589466 and 5580859).Naked DNA carrier for gene therapy can be introduced in the expection host cell by means known in the art, [see as transfection, electroporation, microinjection, transduction, cytogamy, deae dextran, calcium phosphate precipitation, particle gun or dna vector translator, Wu etc., journal of biological chemistry 267:963-967 (1992); Wu and Wu, journal of biological chemistry 263:14621-14624 (1988); Hartmut etc., Canadian patent application 2012311, file an application March 15 nineteen ninety; Williams etc., institute of NAS report 88:2726-2730 (1991)].Also can use receptor-mediated DNA to send the method for passing [Curiel etc., human gene therapy (Hum.Gene Ther.) 3:147-154 (1992); Wu and Wu, journal of biological chemistry 262:4429-4432 (1987)].

Identify the upward method of useful TRAF2TR variant of treatment

Have many methods to can be used for determining whether TNF α institute adjusting approach relates to certain disease, and definite polypeptide of the present invention is to the effect of these approach.For example, in order to study the effect of TRAF2TR in NF κ B regulates, be that probe carries out electrophoretic mobility change check (EMSA) analysis (Fig. 7) with NF κ B UAS.Show that from the nuclear extract (swimming lane 3 and 4) of crossing the cell of expressing FL TRAF the change of TNF α inductive obviously is better than contrast ( swimming lane 1 and 2).TRAF2TR crosses and expresses the formation of having blocked NF κ B, and therefore detects less than change (swimming lane 5 and 6) in TNF α institute irritation cell.Owing to do not show the mobility shifting band in TNF α institute irritation cell, these results have shown the strong restraining effect that NF κ B is formed.Cross in the cell of expressing total length TRAF2 NF kB activity increase (swimming lane 4) stimulating the back with TNF α.

The above-mentioned type experiment can be used for measuring the approach that involves in certain morbid state, and whether the available present composition is treated.Substantially, replace TRAF2TR or TRAF2TD, determine that whether this variant has the ability that suppresses TNF approach that α regulates, and can carry out above-mentioned experiment thus with the TRAF2 variant that separates or prepare.

The disease that relates to TNF approach that α regulates

As mentioned above, the present invention relates to suppress the purposes of TNF approach that α regulates with TRAF2TR and TRAF2TD and variant thereof.Especially, the present invention relates to effectively block the activation of several transcription factors of TNF α inductive, comprise NF κ B and AP-1 with aforesaid method.TRAF2TR and TRAF2TD and variant thereof can be used for suppressing relating to the TNF signal transduction pathway in the pathology of superactivation of the excessive generation of TNF α and NF κ B dependent form gene.As if multiple disease relates to TNF α institute adjusting approach, and the pathologic basis of these diseases may comprise that crossing of TNF α produced or the superactivation of NF κ B dependent form gene.Can treat these diseases with TRAF2TR and TRAF2TD protein and their variant.

Evidence show that inflammatory process and the cardiovascular disorder that all are main all have important relationship, and the raising of TNF alpha levels is relevant with these inflammatory process, therefore thinks and to treat various main cardiovascular disordeies with the compositions and methods of the invention.These diseases include, but are not limited to cardiovascular disorder, the ischemia-reperfusion injury among the CNS that causes as the cardiac ischemia-reperfusion injury after the myocardium infarct, coronary bypass, heart transplantation or apoplexy; The increasing the weight of and break of serious coronary atherosclerotic score; The development of congestive heart failure and increasing the weight of; Endothelial cell damage after the sacculus angioplasty.In addition, the present invention can be used for the apoptosis of myocardial cell in prophylaxis of heart failure or the infraction, and the apoptosis of avoiding the myocyte.

By the signal conduction of blocking-up TNF α acceptor, application TRAF2TR or TRAF2TD or its variant carry out the approach of gene therapy can treat these diseases.The preferred TRAF2TD that uses is because its efficient TNF α institute adjusting approach that suppresses.

Same, by the signal conduction of blocking-up TNF α acceptor, application TRAF2TR or TRAF2TD or its variant carry out the approach of gene therapy can treat the other diseases that relates to TNF α on the pathology.These diseases include, but are not limited to: the diabetes of the rejection in crohn, psoriasis, rheumatoid arthritis, the transplanting, inflammatory bowel disease, non-insulin-depending type and neurodegenerative disease (as parkinsonism).

In addition, TRAF2TD can be used for the mechanism of research TRAF2-dependent form signal transduction path in the kinds of experiments.

Therapeutic composition and dosage

In use, any carrier of the present invention no matter be virus or non-virus type, all preferably imports in the body in pharmaceutical acceptable carrier or instrument.Phrase " pharmacy is acceptable " refers to that molecular entity and composition are endurable under the physiological status when being applied to human body, and does not generally cause tangible allergy or similarly uncomfortable reaction, such as have a stomach upset, dizzy or the like.When being used for herein, term " pharmacy is acceptable " is preferably represented what federation or responsible institution of state government were ratified, or list in American Pharmacopeia or other usually approval be used in the pharmacopeia on animal, the especially person.Term " carrier " refers to thinner, adjuvant, vehicle or the instrument of using with compound.Such pharmaceutical carrier can be a sterile liquid, and for example, water or oil comprise oil, animal, plant or synthetic oil of originating, for example peanut oil, soybean oil, mineral oil, sesame oil or the like.Preferably water or salt brine solution and D/W and glycerine solution are as carrier, especially for injectable solution.Suitable pharmaceutical carrier is found in " pharmaceutical science of Remington " " Remington ' s Pharmacertical Sciences " book, author E.W.Martin.

The invention provides and comprise the present composition of using significant quantity methods of treatment to people or other animals.

Significant quantity can change, and depends on by curer's age, disease type and the degree that is in a bad way, body weight, expection course of treatment, application method and other parameters.Doctor in charge or other titular medical professions can determine significant quantity.

Think that at present the most widely used dosage of polypeptide of the present invention is about 0.01mg/kg body weight/day-100mg/kg body weight/day.Preferred dosage is about 0.1mg/kg body weight/day-50mg/kg body weight/day, and more preferred dose is about 1mg/kg body weight/day-10mg/kg body weight/day.

Recombinant virus of the present invention is usually with about 10 ⁴-10 ¹⁴Dosage form between the pfu is prepared and is used.With AAV and adenovirus is example, and the preferred dosage that uses is about 10 ⁶-10 ¹¹Pfu.Term " pfu " (" plaque forming unit ") is corresponding to the infection ability of virion suspension, by infecting suitable cell culture and detecting the plaque number that forms and measure pfu.The technology of measuring viral solution pfu titre has good record in the prior art.

Following examples have been carried out illustrative explanation to the present invention.

Embodiment

The separation of the cDNA of embodiment 1-coding TRAF2TR

In the RT of total length TRAF2 PCR clone (the general handbook of molecular biology, 1996), use the splice variant TRAF2TR that separates TRAF2 from the mRNA of human osteosarcoma cell line (OSA1).When utilizing primer to produce the cDNA of total length TRAF2, observed less PCR product.Independently cut out this fragment and clone.5 ' the primer that is used for RT PCR is ATG GCT GCA GCT AGC GTGACC, and 3 ' primer is TTA TAG CCC TGT CAG GTC CAC.

By this less clone (TRAF2TR) is checked order, identify the codon disappearance of coding 123-201 amino acids residue in the framework.Fig. 4 a and 4b have compared nucleotide sequence and the aminoacid sequence of total length TRAF2 and TRAF2TR.

The multiple source that is accredited as TRAF2TR mRNA of organizing in the health, and can be by above-mentioned flow process separation TRAF2TR mRNA wherein.In order to measure the tissue distribution of TRAF2TR, carry out RT-PCR with a pair of primer outside the montage district.The primer of disappearance district's 5 ' side is: GGT GGA GAG CCTGCC GGC CG, and the primer of disappearance district 3 ' side is: GGC AGC CGA TGG CGT GGA ATCTG, and with the cDNA of the total RNA of oligomerization dT primer generation different tissues.Separate cDNA and be transferred on the nitrocellulose filter with agarose electrophoresis.Use from the specific probe (5 '-GAT GCA CCT GGA AGG GGA CCC TGA AAT-3 ') of the TRAF2 sequence of being close to montage district 5 ' end and hybridize.Non-montage and the splice variant of this probe identification TRAF2.For non-splice variant (TRAF2FL), the expection size is 373bp; For splice variant (TRAF2TR), the expection size is 136bp.Referring now to Fig. 5, swimming lane: 1-contrast TRAF2-FL cDNA; 2-contrast TRAF2 splice variant cDNA; 3-Jurkat; 4-HeLa clone; 5-thymus gland; The 6-placenta; 7-thymus gland; The 8-spleen; The 9-ovary.

To the western blot analysis of various kinds of cell source lysate fail clear and definite detect to have by the TRAF2 variant of brachymemma in the marking protein level exist.As if the mode that relies on cell type of this proteinic high level expression and producing is on growing or be restricted on the time, or be subjected to a kind of not clear and definite as yet mechanism control (as, in the B of the germinal center cell maturation stage).

Disappearance among the splice variant TRAF2TR has kept open reading frame, and the donor splicing site sequence of 5 ' montage border meet the specifications.Disappearance has been removed the 123-201 amino acids residue of wild-type TRAF2, refer to 2 and 3 comprising C-terminal portions and all zinc of Zinc finger domain 1, and zinc refers to 4 N-terminal residue (Fig. 1).This disappearance more may be destroyed zinc and refer to the function distinguished, is similar to people such as Takeuchi at journal of biological chemistry 271 (33), and the disappearance of being set up among the 19935-19942 it is reported that they present the dominant effect to TNF α inductive NF kB activation.

The preparation of embodiment 2-TRAF2TD

87 amino acid of known TRAF2N-N-terminal (are represented the ring finger territory, see Fig. 1) disappearance produced the protein (Takeuchi etc. of the dominance inhibitor (dominant) that can be used as TNF α dependent form NF kB activation, journal of biological chemistry 271 (33), 19935-19942 (1996)).For whether the disappearance of determining the N-end can influence the activity of TRAF2TR, prepared the construct of representative TRAF2TR tool protein N-87 aminoacid deletion of end (residue 1-87).In order to prepare this TRAF2TR variant, be pcr template with TRAF2TR cDNA, 5 ' primer contains the 262-280 position Nucleotide (ATGAGTTCGGCCTTCCCAGAT) of TRAF2 complete encoding sequence, wherein contains the ATG codon as translation initiation site; 3 ' primer is TTA TAG CCC TGT CAG GTC CAC.The construct that produces starts from the 88th amino acids of total length TRAF2, comprises the 123-201 amino acids disappearance of TRAF2TR, is the construct of " two disappearance ".This construct through dna sequencing confirm and be cloned into mammalian expression vector (pcDNA3, Invitrogen) in.

Embodiment 3-TRAF2TR transfection HeLa cell

In order to determine the effect of TRAF2TR to the NF kB activation, (pcDNA3 has made up the brachymemma and total length (FL) TRAF2 of band N-Myc affinity tag in INVITROGEN) at mammalian expression vector.In order to prepare the N-Myc fusion constructs, synthetic 5 ' PCR primer, this primer contains Myc sequence label and initial methionine (MetGluGlnLysLeuIleSerGluGluAspLeuAsn), is 20 initial Nucleotide of TRAF2 cDNA afterwards: 5 '-ATG GAG CAG AAA TTGATT TCC GAG GAA GAT CTG AAC ATG GCT GCA GCT AGC GTG AC-3 '.3 ' PCR primer sequence is: 5 '-TTAGAGCCCTGTCAGGTCCACAA-3 '.With the standard technique purified pcr product and be cloned in the pcDNA3 carrier.

(BRL, Gibco) reagent is pressed the specification sheets of reagent suppliers with pcDNA3-myc TRAF2 construct transfection HeLa cell with LipoFectamine.Saying briefly, is exactly that 4mlLipoFectamine is mixed with 1mg DNA in 1ml serum-free DMEM (BRL) substratum, with this mixture and 3 * 10 ⁵The petri dish that individual cell places 60mm in 5% CO2gas incubator 37 ℃ spend the night.After the transfection 24 hours, clean cell and be dissolved in the 200ml SDS electrophoresis sample loading buffer (SIGMA) with phosphate buffered saline buffer.Electrophoretic separation 10ml lysate is also transferred on the nitrocellulose filter by Western blotting.Carry out immunostaining and ECL (AMERSHAM) detection by the method that antibody supplier recommends.

(BABCO Berkeley) detects with the big or small protein (Fig. 6) of expection in the HeLa cell of pcDNA-TRAF2FL and pcDNA-TRAF2TR transfection anti-Myc antibody.

Result among Fig. 6 has shown the TRAF2FL of Myc-fusion in infected HeLa cell and the immunoassay result of TRAF2TR.With the expression construct of lipofectamine (Gibco BFL), after 24 hours cell is dissolved in the SDS sample-loading buffer TRAF-FL and TRAF-TR on the HeLa cell transfecting.Detect the Myc-fused protein with anti-myc antibody and ECL detection system.Swimming lane: 1-pcDNA3 carrier; 2-myc-TRAF2FL; 3-myc-TRAF2TR.

Embodiment 4-NF κ B reporting system

In order to measure the effect that TRAF2TR, TRAF2TD or these variant polypeptides are expressed NF κ B institute regulatory gene, can use NF κ B reporting system, as document Takeuchi etc., the system that institute utilizes and describes in the journal of biological chemistry 271 (33), 19935-42 (1996).NF κ B report activation system can be used in combination with suitable cell, as 293 cells, COS7 cell or HeLa cell.Make cell by different TRAF2 construct institute transfections, i.e. total length TRAF2, TRAF2TR and TRAF2TD with the lipofectamine method described in the embodiment 3.More different then TRAF2 fragments are to the influence of the NF κ B reporter molecules activated of cotransfection, thereby identify effective inhibitors kind.In fact, the TRAF2 construct that contains total length TRAF2, TRAF2TR and TRAF2TD and TRAF2TR and TRAF2TD variant can be transfected into 293 cells for example, and the active level of NF κ B reporter molecules under the condition of monitoring TNF α existence or shortage.Estimate that total length TRAF2 can activate the NF κ B reporter molecules of cotransfection, and the alpha mediated NF κ B reporter molecules activation of blocking-up TNF that other TRAF2 construct can be in various degree.

The embodiment 5-methods of treatment that exsomatizes

Stripped gene therapy method is known in the art, and it generally includes 4 stages.In the fs, from patient to be treated, collect the cell of required type.Subordinate phase, with the goal gene transfection in isolated cells.Phase III, collect and cultivate the cell that has obtained goal gene.The quadravalence section with cell or perfusion or transplant back in patient's body, thereby is expressed the expection gene and is treated disease.

In the fs of using stripped methods of treatment of the present invention, from the patient, obtain cell.The selection of cell is based on many factors, mainly the special disease of being treated.Blocking-up to these target cell activations can suppress related inflammatory cytokine and other protein expression before in the cardiovascular disorder state related inflammatory process.

Subordinate phase is cloned into TRAF2TR or TRAF2TD or variant cDNA in the suitable mammalian expression vector.Expression vector, for example pcDNA3 can be used for comprising in the transfection method of fat transfection.In preferred embodiments, TRAF2TD is cloned in pcDNA3 or other the suitable mammalian expression vector because its inhibition ability to TNF α keying action strengthens to some extent.Regulate the expection method of expression level based on transfected cell type and being used for and select the used promotor of expression vector.Suitable promotor can be selected from the promotor mentioned above.Gene therapy for heart disease, promotor, for example, 2MHC (sees Palermo etc., circulation science research (Circ.Res.), 78 (3), 504-9 (1996)), MLC2 (seeing Sani, natural 314:283-286 (1985)), CARP (see Jeyaseelan etc., journal of biological chemistry, 272 (36), 22800-8 (1997)) is inserted into the upstream of TRAF2TD cDNA.(BRL, Gibco) the reagent expression vector that will contain TRAF2TDcDNA is used for liposome-mediated transfection to use lipofectamine by the method that provides then.For the transfection method that uses the virus transduction, the subordinate phase of the methods of treatment that exsomatizes has adopted the recombinant adenoviral vector system.In this method, TRAF2TD cDNA is cloned in the adenovirus expression carrier, for example, and gland demand pQBI-AdBN/NB (QUANTUM biotech company).To contain the adenovirus transfer vector of TRAF2TD cDNA and the viral DNA cotransfection of adenovirus then goes in 293 cells.After plaque purification and positive colony were selected, amplification contained the recombinant adenovirus of TRAF2TD cDNA and carries out purifying with traditional cesium chloride gradient purification process, dialyse with suitable damping fluid subsequently, for example, phosphate buffered saline buffer.Recombinant adenovirus is used to the transfection target cell of exsomatizing afterwards.

With about 10 ⁴-10 ¹⁴Dosage form preparation between the pfu is also used recombinant virus of the present invention.With AAV and adenovirus is example, and preferred using dosage is about 10 ⁶-10 ¹¹Pfu.Term " pfu " " plaque forming unit ") corresponding to the infection ability of virus particle suspension, measures by the quantity that infects suitable culturing cell and the detection plaque that forms.The technology of measuring viral solution pfu titre has detailed description in the prior art.

In the phase III, in substratum, cultivate the transfectional cell that obtains with fat transfection or recombinant adenovirus mode of infection, select transfected cell.Available multiple mode is selected, and comprises that use only obtained the drug labelling that those cells of expression vector could be survived or grow.

In the quadravalence section, perfusion of the cell after the transfection or directly transplanting to be gone in patient's body, the input site can be near tissue to be treated or allowing TRAF2TD cDNA product to be released into the round-robin position, so that combine the activated cell interaction with being subjected to TNF α.Send the method for passing to include, but are not limited to, direct injection or by conduit, filling pump or support (stent).

Embodiment 6-interior therapeutic method

The interior therapeutic method can comprise adenovirus carrier, adeno-associated virus vector and retroviral vector with in the multiple different virus vector.In the preferred interior therapeutic method of the present invention, TRAF2TR or TRAF2TD cDNA are introduced in the host cell with adenovirus system.Because the higher relatively inhibition TNF α of TRAF2TD cDNA in conjunction with the ability of activation, preferably uses TRAF2TD cDNA in adenovirus expression carrier.In this method, TRAF2TD cDNA is cloned in the adenovirus transfer vector, for example, and gland demand pQBI-AdBN/NB (QUANTUM biotech company) or other above-mentioned adenovirus carrier.Based on transfected cell type and the used promotor of expection method selection expression vector that is used for regulating expression level.Suitable promotor can be selected from the promotor mentioned above.

Can go in 293 cells containing expection promotor and the adenovirus transfer vector of TRAF2TD cDNA and the viral DNA cotransfection of adenovirus then.After plaque purification and positive colony were selected, amplification contained the recombinant adenovirus of TRAF2TD cDNA and carries out purifying with traditional cesium chloride gradient purification process, dialyse with suitable damping fluid subsequently, for example, phosphate buffered saline buffer.

Before the transfectional cell, measure the virion titre, and carry out experiment in vitro and determine the infective dose of protein expression level and tissue culture (TCID50) in vivo.With about 10 ⁴-10 ¹⁴Dosage form preparation between the pfu is also used recombinant virus of the present invention.With AAV and adenovirus is example, and preferred using dosage is about 10 ⁶-10 ¹¹Pfu.Term " pfu " (" plaque forming unit ") is measured by the quantity that infects suitable culturing cell and the detection plaque that forms corresponding to the infection ability of virus particle suspension.The technology of measuring viral solution pfu titre has detailed description in the prior art.

Then with recombinant adenovirus with about 10 ⁶-10 ¹¹The dosage infected patient of pfu.Recombinant adenovirus can be introduced in the following manner: suction, perfusion, surgery implantation, direct injection or send by conduit, filling pump or support and to pass.

Sequence table

<110>Searfoss?III，George?H.

Pagnoni，Marco?F.

Ivashchenko，Yuri?D.

Guo，Kun

clark，Kenneth?L.

＜120〉as the TRAF2 variant of TNF-signal pathway inhibition

<130>22816?PCT

＜140〉do not transfer the possession of as yet

<141>2000-04-06

<150>60/131940

<151>1999-04-30

<160>5

<170>PatentIn?Ver.2.0

<210>1

<211>1269

<212>DNA

＜213〉people (Homo sapiens)

<400>1

atggctgcag?ctagcgtgac?cccccctggc?tccctggagt?tgctacagcc?cggcttctcc 60

aagaccctcc?tggggaccaa?gctggaagcc?aagtacctgt?gctccgcctg?cagaaacgtc 120

ctccgcaggc?ccttccaggc?gcagtgtggc?caccggtact?gctccttctg?cctggccagc 180

atcctcagct?ctgggcctca?gaactgtgct?gcctgtgttc?acgagggcat?atatgaagaa 240

ggcatttcta?ttttagaaag?cagttcggcc?ttcccagata?atgctgcccg?cagggaggtg 300

gagagcctgc?cggccgtctg?tcccagtgat?ggatgcacct?ggaaggggac?cctgaaagaa 360

tacgagtttc?aggaccacgt?caagacttgt?ggcaagtgtc?gagtcccttg?cagattccac 420

gccatcggct?gcctcgagac?ggtagagggt?gagaaacagc?aggagcacga?ggtgcagtgg 480

ctgcgggagc?acctggccat?gctactgagc?tcggtgctgg?aggcaaagcc?cctcttggga 540

gaccagagcc?acgcggggtc?agagctcctg?cagaggtgcg?agagcctgga?gaagaagacg 600

gccacttttg?agaacattgt?ctgcgtcctg?aaccgggagg?tggagagggt?ggccatgact 660

gccgaggcct?gcagccggca?gcaccggctg?gaccaagaca?agattgaagc?cctgagtagc 720

aaggtgcagc?agctggagag?gagcattggc?ctcaaggacc?tggcgatggc?tgacttggag 780

cagaaggtct?tggagatgga?ggcatccacc?tacgatgggg?tcttcatctg?gaagatctca 840

gacttcgcca?ggaagctcca?ggaagctgtg?gctggccgca?tacccgccat?cttctcccca 900

gccttctaca?ccagcaggta?cggctacaag?atgtgtctgc?gtatctacct?gaacggcgac 960

ggcaccgggc?gaggaacaca?cctgtccctc?ttctttgtgg?tgatgaaggg?cccgaatgac 1020

gccctgctgc?ggtggccctt?caaccagaag?gtgaccttaa?tgctgctcga?ccagaataac 1080

cgggagcacg?tgattgacgc?cttcaggccc?gacgtgactt?catcctcttt?tcagaggcca 1140

gtcaacgaca?tgaacatcgc?aagcggctgc?cccctcttct?gccccgtctc?caagatggag 1200

gcaaagaatt?cctacgtgcg?ggacgatgcc?atcttcatca?aggccattgt?ggacctgaca 1260

gggctctaa 1269

<210>2

<211>422

<212>PRT

＜213〉people

<400>2

Met?Ala?Ala?Ala?Ser?Val?Thr?Pro?Pro?Gly?Ser?Leu?Glu?Leu?Leu?Gln

1 5 10 15

Pro?Gly?Phe?Ser?Lys?Thr?Leu?Leu?Gly?Thr?Lys?Leu?Glu?Ala?Lys?Tyr

20 25 30

Leu?Cys?Ser?Ala?Cys?Arg?Asn?Val?Leu?Arg?Arg?Pro?Phe?Gln?Ala?Gln

35 40 45

Cys?Gly?His?Arg?Tyr?Cys?Ser?Phe?Cys?Leu?Ala?Ser?Ile?Leu?Ser?Ser

50 55 60

Gly?Pro?Gln?Asn?Cys?Ala?Ala?Cys?Val?His?Glu?Gly?Ile?Tyr?Glu?Glu

65 70 75 80

Gly?Ile?Ser?Ile?Leu?Glu?Ser?Ser?Ser?Ala?Phe?Pro?Asp?Asn?Ala?Ala

85 90 95

Arg?Arg?Glu?Val?Glu?Ser?Leu?Pro?Ala?Val?Cys?Pro?Ser?Asp?Gly?Cys

100 105 110

Thr?Trp?Lys?Gly?Thr?Leu?Lys?Glu?Tyr?Glu?Phe?Gln?Asp?His?Val?Lys

115 120 125

Thr?Cys?Gly?Lys?Cys?Arg?Val?Pro?Cys?Arg?Phe?His?Ala?Ile?Gly?Cys

130 135 140

Leu?Glu?Thr?Val?Glu?Gly?Glu?Lys?Gln?Gln?Glu?His?Glu?Val?Gln?Trp

145 150 155 160

Leu?Arg?Glu?His?Leu?Ala?Met?Leu?Leu?Ser?Ser?Val?Leu?Glu?Ala?Lys

165 170 175

Pro?Leu?Leu?Gly?Asp?Gln?Ser?His?Ala?Gly?Ser?Glu?Leu?Leu?Gln?Arg

180 185 190

Cys?Glu?Ser?Leu?Glu?Lys?Lys?Thr?Ala?Thr?Phe?Glu?Asn?Ile?Val?Cys

195 200 205

Val?Leu?Asn?Arg?Glu?Val?Glu?Arg?Val?Ala?Met?Thr?Ala?Glu?Ala?Cys

210 215 220

Ser?Arg?Gln?His?Arg?Leu?Asp?Gln?Asp?Lys?Ile?Glu?Ala?Leu?Ser?Ser

225 230 235 240

Lys?Val?Gln?Gln?Leu?Glu?Arg?Ser?Ile?Gly?Leu?Lys?Asp?Leu?Ala?Met

245 250 255

Ala?Asp?Leu?Glu?Gln?Lys?Val?Leu?Glu?Met?Glu?Ala?Ser?Thr?Tyr?Asp

260 265 270

Gly?Val?Phe?Ile?Trp?Lys?Ile?Ser?Asp?Phe?Ala?Arg?Lys?Leu?Gln?Glu

275 280 285

Ala?Val?Ala?Gly?Arg?Ile?Pro?Ala?Ile?Phe?Ser?Pro?Ala?Phe?Tyr?Thr

290 295 300

Ser?Arg?Tyr?Gly?Tyr?Lys?Met?Cys?Leu?Arg?Ile?Tyr?Leu?Asn?Gly?Asp

305 310 315 320

Gly?Thr?Gly?Arg?Gly?Thr?His?Leu?Ser?Leu?Phe?Phe?Val?Val?Met?Lys

325 330 335

Gly?Pro?Asn?Asp?Ala?Leu?Leu?Arg?Trp?Pro?Pne?Asn?Gln?Lys?Val?Thr

340 345 350

Leu?Met?Leu?Leu?Asp?Gln?Asn?Asn?Arg?Glu?His?Val?Ile?Asp?Ala?Pne

355 360 365

Arg?Pro?Asp?Val?Thr?Ser?Ser?Ser?Phe?Gln?Arg?Pro?Val?Asn?Asp?Met

370 375 380

Asn?Ile?Ala?Ser?Gly?Cys?Pro?Leu?Phe?Cys?Pro?Val?Ser?Lys?Met?Glu

385 390 395 400

Ala?Lys?Asn?Ser?Tyr?Val?Arg?Asp?Asp?Ala?Ile?Phe?Ile?Lys?Ala?Ile

405 410 415

Val?Asp?Leu?Thr?Gly?Leu

420

<210>3

<211>1011

<212>DNA

＜213〉people

<400>3

atgagttcgg?ccttcccaga?taatgctgcc?cgcagggagg?tggagagcct?gccggccgtc 60

tgtcccagtg?atggatgcac?ctggaagggg?accctgaaag?aatacgagtt?tcaggaccac 120

gtcaagactt?gtggcaagtg?tcgagtccct?tgcagattcc?acgccatcgg?ctgcctcgag 180

acggtagagg?gtgagaaaca?gcaggagcac?gaggtgcagt?ggctgcggga?gcacctggcc 240

atgctactga?gctcggtgct?ggaggcaaag?cccctcttgg?gagaccagag?ccacgcgggg 300

tcagagctcc?tgcagaggtg?cgagagcctg?gagaagaaga?cggccacttt?tgagaacatt 360

gtctgcgtcc?tgaaccggga?ggtggagagg?gtggccatga?ctgccgaggc?ctgcagccgg 420

cagcaccggc?tggaccaaga?caagattgaa?gccctgagta?gcaaggtgca?gcagctggag 480

aggagcattg?gcctcaagga?cctggcgatg?gctgacttgg?agcagaaggt?cttggagacg 540

gaggcatcca?cctacgatgg?ggtcttcatc?tggaagatcc?cagacttcgc?caggaagctc 600

caggaagctg?tggctggccg?catacccgcc?atcttctccc?cagccttcta?caccagcagg 660

tacggctaca?agatgtgtct?gcgtatctac?ctgaacggcg?acggcaccgg?gcgaggaaca 720

cacctgtccc?tcttctttgt?ggtgatgaag?ggcccgaatg?acgccctgct?gcggtggccc 780

ttcaaccaga?aggtgacctt?aatgctgctc?gaccagaata?accgggagca?cgtgattgac 840

gccttcaggc?ccgacgtgac?ttcatcctct?tttcagaggc?cagtcaacga?catgaacatc 900

gcaagcggct?gccccctctt?ctgccccgtc?tccaagatgg?aggcaaagaa?ttcctacgtg 960

cgggacgatg?ccatcttcat?caaggccatt?gtggacctga?cagggctcta?a 1011

<210>4

<211>336

<212>PRT

＜213〉people

<400>4

Met?Ser?Ser?Ala?Phe?Pro?Asp?Asn?Ala?Ala?Arg?Arg?Glu?Val?Glu?Ser

1 5 10 15

Leu?Pro?Ala?Val?Cys?Pro?Ser?AsP?Gly?Cys?Thr?Trp?Lys?Gly?Thr?Leu

20 25 30

Lys?Glu?Tyr?Glu?Phe?Gln?Asp?His?Val?Lys?Thr?Cys?Gly?Lys?Cys?Arg

35 40 45

Val?Pro?Cys?Arg?Phe?His?Ala?Ile?Gly?Cys?Leu?Glu?Thr?Val?Glu?Gly

50 55 60

Glu?Lys?Gln?Gln?Glu?His?Glu?Val?Gln?Trp?Leu?Arg?Glu?His?Leu?Ala

65 70 75 80

Met?Leu?Leu?Ser?Ser?Val?Leu?Glu?Ala?Lys?Pro?Leu?Leu?Gly?Asp?Gln

85 90 95

Ser?His?Ala?Gly?Ser?Glu?Leu?Leu?Gln?Arg?Cys?Glu?Ser?Leu?Glu?Lys

100 105 110

Lys?Thr?Ala?Thr?Phe?Glu?Asn?Ile?Val?cys?Val?Leu?Asn?Arg?Glu?Val

115 120 125

Glu?Arg?Val?Ala?Met?Thr?Ala?Glu?Ala?Cys?Ser?Arg?Gln?His?Arg?Leu

130 135 140

Asp?Gln?Asp?Lys?Ile?Glu?Ala?Leu?Ser?Ser?Lys?Val?Gln?Gln?Leu?Glu

145 150 155 160

Arg?Ser?Ile?Gly?Leu?Lys?Asp?Leu?Ala?Met?Ala?Asp?Leu?Glu?Gln?Lys

165 170 175

Val?Leu?Glu?Met?Glu?Ala?Ser?Thr?Tyr?Asp?Gly?Val?Phe?Ile?Trp?Lys

180 185 190

Ile?Ser?Asp?Phe?Ala?Arg?Lys?Leu?Gln?Glu?Ala?Val?Ala?Gly?Arg?Ile

195 200 205

Pro?Ala?Ile?Phe?Ser?Pro?Ala?Phe?Tyr?Thr?Ser?Arg?Tyr?Gly?Tyr?Lys

210 215 220

Met?Cys?Leu?Arg?Ile?Tyr?Leu?Asn?Gly?Asp?Gly?Thr?Gly?Arg?Gly?Thr

225 230 235 240

His?Leu?Ser?Leu?Phe?Phe?Val?Val?Met?Lys?Gly?Pro?Asn?Asp?Ala?Leu

245 250 255

Leu?Arg?Trp?Pro?Phe?Asn?Gln?Lys?Val?Thr?Leu?Met?Leu?Leu?Asp?Gln

260 265 270

Asn?Asn?Arg?Glu?His?Val?Ile?Asp?Ala?Phe?Arg?Pro?Asp?Val?Thr?Ser

275 280 285

Ser?Ser?Phe?Gln?Arg?Pro?Val?Asn?Asp?Met?Asn?Ile?Ala?Ser?Gly?Cys

290 295 300

Pro?Leu?Phe?Cys?Pro?Val?Ser?Lys?Met?Glu?Ala?Lys?Asn?Ser?Tyr?Val

305 310 315 320

Arg?Asp?Asp?Ala?Ile?Phe?Ile?Lys?Ala?Ile?Val?Asp?Leu?Thr?Gly?Leu

325 330 335

<210>5

<211>2262

<212>DNA

＜213〉people

<220>

<221>misc_feature

<222>()..)

＜223〉the TRAF2 truncated sequence contains the right disappearance of 421-657 bit base

<400>5

gaattccggc?gcgctgcgac?cgttggggct?ttgttcgcgg?gggtcacagc?tctcatggct 60

gcagctagcg?tgaccccccc?tggctccctg?gagttgctac?agcccggctt?ctccaagacc 120

ctcctgggga?ccaagctgga?agccaagtac?ctgtgctccg?cctgcagaaa?cgtcctccgc 180

aggcccttcc?aggcgcagtg?tggccaccgg?tactgctcct?tctgcctggc?cagcatcctc 240

agctctgggc?ctcagaactg?tgctgcctgt?gttcacgagg?gcatatatga?agaaggcatt 300

tctattttag?aaagcagttc?ggccttccca?gataatgctg?cccgcaggga?ggtggagagc 360

ctgccggccg?tctgtcccag?tgatggatgc?acctggaagg?ggaccctgaa?agaatacgag 420

agctgccacg?aaggccgctg?cccgctcatg?ctgaccgaat?gtcccgcgtg?taaaggcctg 480

gtccgccttg?gtgaaaagga?gcgccacctg?gagcacgagt?gcccggagag?aagcctgagc 540

tgccggcatt?gccgggcacc?ctgctgcgga?gcagacgtga?aggcgcacca?cgaggtctgc 600

cccaagttcc?ccttaacttg?tgacggctgc?ggcaagaaga?agatcccccg?ggagaagttt 660

caggaccacg?tcaagacttg?tggcaagtgt?cgagtccctt?gcagattcca?cgccatcggc 720

tgcctcgaga?cggtagaggg?tgagaaacag?caggagcacg?aggtgcagtg?gctgcgggag 780

cacctggcca?tgctactgag?ctcggtgctg?gaggcaaagc?ccctcttggg?agaccagagc 840

cacgcggggt?cagagctcct?gcagaggtgc?gagagcctgg?agaagaagac?ggccactttt 900

gagaacattg?tctgcgtcct?gaaccgggag?gtggagaggg?tggccatgac?tgccgaggcc 960

tgcagccggc?agcaccggct?ggaccaagac?aagattgaag?ccctgagtag?caaggtgcag 1020

cagctggaga?ggagcattgg?cctcaaggac?ctggcgatgg?ctgacttgga?gcagaaggtc 1080

aggcccttcc?aggcgcagtg?tggccaccgg?tactgctcct?tctgcctggc?cagcatcctc 1140

aggaagctcc?aggaagctgt?ggctggccgc?atacccgcca?tcttctcccc?agccttctac 1200

accagcaggt?acggctacaa?gatgtgtctg?cgtatctacc?tgaacggcga?cggcaccggg 1260

cgaggaacac?acctgtccct?cttctttgtg?gtgatgaagg?gcccgaatga?cgccctgctg 1320

cggtggccct?tcaaccagaa?ggtgacctta?atgctgctcg?accagaataa?ccgggagcac 1380

gtgattgacg?ccttcaggcc?cgacgtgact?tcatcctctt?ttcagaggcc?agtcaacgac 1440

atgaacatcg?caagcggctg?ccccctcttc?tgccccgtct?ccaagatgga?ggcaaagaat 1500

tcctacgtgc?gggacgatgc?catcttcatc?aaggccattg?tggacctgac?agggctctaa 1560

ctgcccccta?ctggtgtctg?ggggttgggg?gcagccaggc?acagccggct?cacggagggg 1620

ccaccacgct?gggccagggt?ctcactgtac?aagtgggcag?gggccccgct?tgggcgcttg 1680

ggagggtgtc?ggcctgcagc?caagttcact?gtcacggggg?aaggagccac?cagccagtcc 1740

tcagatttca?gagactgcgg?aggggcttgg?cagacggtct?tagccaaggg?ctgtggtggc 1800

attggccgag?ggtcttcggg?tgcttcccag?cacaagctgc?ccttgctgtc?ctgtgcagtg 1860

aagggagagg?ccctgggtgg?gggacactca?gagtgggagc?acatcccagc?agtgcccatg 1920

tagcaggagc?acagtggatg?gccttgtgtc?cctcgggcat?gacaggcaga?aacgagggct 1980

gctccaggag?aagggcctcc?tgctggccag?agcaaggaag?gctgagcagc?ttggttctcc 2040

cctctggccc?ctggagagaa?gggagcattc?ctagacccct?gggtgcttgt?ctgcacagag 2100

ctctggtctg?tgccaccttg?gccaggctgg?ctgtgggagg?gtctggtccc?acgccgcctc 2160

tgctcagaca?ctgtgtggga?gggcacagca?cagctgcggg?taaagtgtga?gagcttgcca 2220

tccagctcac?gaagacagag?ttattaaacc?attacaaatc?tc 2262

Claims (14)

1. the separated DNA sequence of the TRAF2TR polypeptide of encoding, wherein said dna sequence dna comprises sequence shown in Fig. 2 a.

2. the separated DNA sequence of claim 1, wherein said dna sequence dna is the cDNA sequence.

3. separate and the TRAF2TR polypeptide of purifying, it can suppress TNF α institute adjusting approach and comprise aminoacid sequence shown in Fig. 2 b.

4. the composition that can suppress TNF approach that α regulates is used for suppressing the purposes of the medicine of TNF approach that α regulates in patient's body in preparation, wherein said composition is to express TRAF2TR polypeptide expression carrier, and described TRAF2TR polypeptide comprises the aminoacid sequence shown in Fig. 2 b.

5. the composition that can suppress TNF approach that α regulates is used for suppressing the purposes of the medicine of TNF approach that α regulates in patient's body in preparation, wherein said composition comprises TRAF2TR polypeptide and pharmaceutically acceptable carrier, and described TRAF2TR polypeptide comprises the aminoacid sequence shown in Fig. 2 b.

6. the composition that can suppress TNF approach that α regulates is used for the treatment of purposes in the medicine that relates to the disease that TNF α excessively produces among the patient in preparation, wherein said composition comprises can express TRAF2TR polypeptide expression carrier, and described TRAF2TR polypeptide comprises the aminoacid sequence shown in Fig. 2 b.

7. the composition that can suppress TNF approach that α regulates is used for the treatment of purposes in the medicine that relates to the disease that TNF α excessively produces among the patient in preparation, wherein said composition comprises TRAF2TR polypeptide and pharmaceutically acceptable carrier, and described TRAF2TR polypeptide comprises the aminoacid sequence shown in Fig. 2 b.

8. the composition that can suppress TNF approach that α regulates is used for the treatment of purposes in the medicine of the disease that relates to nf κ β dependent form gene superactivation among the patient in preparation, wherein said composition is to express TRAF2TR polypeptide expression carrier, and described TRAF2TR polypeptide comprises the aminoacid sequence shown in Fig. 2 b.

9. the composition that can suppress TNF approach that α regulates is used for the treatment of purposes in the medicine of the disease that relates to nf κ β dependent form gene superactivation among the patient in preparation, wherein said composition comprises TRAF2TR polypeptide and pharmaceutically acceptable carrier, and described TRAF2TR polypeptide comprises the aminoacid sequence shown in Fig. 2 b.

10. the composition that can suppress TNF approach that α regulates is used for suppressing or treats the patient relating to purposes in the medicine of inflammatory process of TNF α in preparation, wherein said composition is to express TRAF2TR polypeptide expression carrier, and described TRAF2TR polypeptide comprises the aminoacid sequence shown in Fig. 2 b.

11. the composition that can suppress TNF approach that α regulates is used for suppressing or treats the patient relating to purposes in the medicine of inflammatory process of TNF α in preparation, wherein said composition comprises TRAF2TR polypeptide and pharmaceutical acceptable carrier, and described TRAF2TR polypeptide comprises the aminoacid sequence shown in Fig. 2 b.

12. the purposes of claim 10 or 11, the inflammatory process of the wherein said TNF of relating to α is selected from: the diabetes of crohn, psoriasis, rheumatoid arthritis, graft versus host disease, inflammatory bowel disease, non-insulin-depending type and neurodegenerative disease.

13. the purposes of claim 10 or 11, the inflammatory process of the wherein said TNF of relating to α is a cardiovascular disorder.

14. the purposes of claim 13, wherein said cardiovascular disorder is selected from: (a) ischemia-reperfusion injury among the CNS after the heart ischemia-reperfusion injury after the myocardial infarction, coronary bypass, heart transplantation or the apoplexy; (b) the height coronary atherosclerotic score increases the weight of and ruptures; (c) development of congestive heart failure and increasing the weight of; (d) endothelial cell damage after the sacculus angioplasty; And (e) myocardial cell's apoptosis.

Images