KR20020012194A - Variants of TRAF2 which act as an inhibitor of TNF-alpha(TNF α) signaling pathway - Google Patents

Abstract

The present invention relates to TRAF2 variants exhibiting the ability to inhibit the TNF a signaling pathway. In particular, a splice variant of TRAF2, referred to herein as "TRAF2 cleavage" or "TRAF2TR", separates a TRAF2 expression construct that has been enhanced in its major negative capacity, called "TRAF2 cleaved deletion" or "TRAF2TD". Both TRAF2TR and TRAF2TD have the ability to inhibit the TNF α signaling pathway, and in the case of TRAF2TD this ability is greatly enhanced, significantly reducing the response to TNF α binding.

Description

Variants of TRAF2 which act as an inhibitor of TNF-alpha (TNF α) signaling pathway}

The general structure of the TRAF protein has been described and is generally as shown in FIG. 1A, which shows in schematic form the full-length TRAF2 (TRAF2-FL). These proteins have an N-terminal region with zinc ring finger motifs and subsequently an array of zinc finger like structures. Following the zinc finger region is a conservative (TRAF) domain consisting of two subdomains, the N-terminal domain and the C-terminal domain. C-terminal domains are involved in receptor binding and homologous and heterologous oligomerization of TRAF and serve as docking sites for various other signaling proteins.

TRAF2 follows the general structure of the TRAF protein described above. Various studies have been attempted to correlate the subdomain of the TRAF2 protein structure with its function.

Takeuchi et al. Conducted in-depth mutation analysis for TRAF2. Takeuchi et al., J. Biol. Chem., 271 (33) 19935-42 (1996). The study suggested that TRAF2 consists of a module domain that mediates distinct activities. In addition, an N-terminal ring finger and two adjacent zinc fingers of TRAF2 are required for NFκB activation, and distinct TRAF-N and TRAF-C subdomains in the TRAF domain mediate self-bonding and interaction with TRAF1, respectively. Demonstrated.

Song et al., Song et al., Proc. Natl. Acad. Sci. USA, 94, 9792-9796 (1997), has thoroughly elucidated studies demonstrating the activation of NFκB induced by TNF α and that C-jun N-terminal kinase (JNK / SAPK) requires TRAF2. This study demonstrated that TRAF2 is the bifurcation of two kinase cascades that induce activation of NFκB and JNK. This observation demonstrated a functional model of TRAF2 and other TRAF family components as adapter proteins with docking sites for additional signaling proteins that initiate parallel downstream reactions.

Min et al. (Min et al., J. Immunology, 159, 3508-3518 (1997)) used a transfection / overexpression strategy to analyze the role of TRAF proteins. It has been previously found that TRAF2, which includes the TRAF domain but has deleted amino terminal residues 1-80, inhibits TNF α-induced NFκB activation. This study demonstrated that TRAF2 variants block JNK activation by TNF α.

Brink et al., Brink et al., J. Biol. Chem., 273, 7, 4129-4134 (1998), described a splice variant of TRAF2 called "TRAF2A". The cDNA of TRAF2A is identical to TRAF2 except for the extra 21 bp sequence encoding the seven amino acid inserts present in the TRAF2A ring finger domain. In this study, we found that TRAF2A mRNA expression is regulated in a tissue-specific manner and that TRAF2A protein can bind to the cytoplasmic domain of TNFαR2. In addition, in contrast to TRAF2, it was found that TRAF2A cannot stimulate NFκB activity when overexpressed in 293 cells and acts as a major inhibitor of TNFαR2-dependent NFκB activation.

Many studies have linked inflammatory processes and TNF α to major cardiovascular diseases (Bryant et al., Circulation, 97 (14): 1375-81 (1998); Kubota et al., Circ. Res., 81 (4): 627-35 (1997); Muller Werdan et al., Eur. Cytokine Netw., 9 (4): 689-91 (1998); Aukrust et al., Am. J. Cardiol., 83 (3): 376-82 (1999). Local ischemia-reperfusion injury resulting from elevated local TNF α levels over the past five years results from (a) ischemia-reperfusion injury in the CNS after myocardial infarction, coronary artery bypass surgery, heart transplant or seizure; (b) progression and rupture of deeper coronary atherosclerotic plaques; (c) expression and progression of congestive heart failure; And (d) evidence suggesting that it is associated with endothelial cell damage following angioplasty with a balloon. It has also recently been discovered that apoptosis cell death may be an important factor in the pathophysiology of myocardial cell death during heart failure or cardiac infarction. It is known that TNF α can induce cardiac cell apoptosis.

In addition to the cardiovascular disease states described above, there are many other diseases whose etiology is related to TNF α. Such diseases include Crohn's disease, psoriasis, rheumatoid arthritis, graft-versus-host disease, inflammatory bowel disease, non-insulin dependent diabetes mellitus and neurodegenerative diseases such as Parkinson's disease.

The association between TNF α and the various diseases described above has been proposed, and it would be desirable in the art to provide compositions and methods for inhibiting and treating such disease states.

The gist of the invention

According to the invention, variants of TRAF2, in particular variants comprising naturally occurring splice variants (TRAF2TR) and variants comprising naturally occurring splice variants and deletions in the N-terminal region of TRAF2, are TNF α signals. It has been found to inhibit transduction and associated immune inflammatory responses.

According to one aspect of the present invention, a DNA sequence encoding TRAF2TR comprising a sequence as shown in FIG. 2A is provided.

According to another aspect of the invention, a DNA sequence encoding TRAF2TD comprising a sequence as shown in FIG. 3A is provided.

In a preferred embodiment, the TRAF2TR and TRAF2TD DNA is cDNA.

In another embodiment, the present invention comprises an amino acid sequence as shown in FIG. 2B, and a TRAF2TR polypeptide capable of inhibiting tumor necrosis factor α (TNF α) regulated pathway and an amino acid sequence as shown in FIG. 3B. It provides a TRAF2TD polypeptide that can include and inhibit the TNF α regulated pathway.

Another aspect of the invention provides an expression vector capable of expressing a TRAF2TR polypeptide, an expression vector capable of expressing a TRAF2TD polypeptide, a TRAF2TR polypeptide and a pharmaceutically acceptable carrier, or a TRAF2TD polypeptide and a pharmaceutically acceptable Provided are methods for inhibiting a TNF a regulated pathway in a patient, comprising administering a composition in the body of the patient that includes a carrier and capable of inhibiting the TNF a regulated pathway.

Another aspect of the invention includes an expression vector capable of expressing TRAF2TR, an expression vector capable of expressing TRAF2TD, a TRAF2TR polypeptide and a pharmaceutically acceptable carrier, or a TRAF2TD polypeptide and a pharmaceutically acceptable carrier A method of inhibiting a disease associated with overproduction of TNF α is provided, including administering to the patient a composition capable of inhibiting the TNF α regulated pathway.

Another aspect of the invention includes an expression vector capable of expressing TRAF2TR, an expression vector capable of expressing TRAF2TD, a TRAF2TR polypeptide and a pharmaceutically acceptable carrier, or a TRAF2TD polypeptide and a pharmaceutically acceptable carrier Provided are methods for inhibiting TNF α pathological conditions associated with overactivation of nuclear factor κB (NFκB) dependent genes, including administering to a patient a composition capable of inhibiting the TNF α regulated pathway.

The invention also includes an expression vector capable of expressing TRAF2TR, an expression vector capable of expressing TRAF2TD, a TRAF2TR polypeptide and a pharmaceutically acceptable carrier, or a TRAF2TD polypeptide and a pharmaceutically acceptable carrier and comprising TNF α Provided are methods for inhibiting the inflammatory process associated with tumor necrosis factor α, including administering to a patient a composition capable of inhibiting the regulated pathway.

In certain embodiments, the inflammatory process is selected from the group consisting of Crohn's disease, psoriasis, rheumatoid arthritis, graft versus host disease, inflammatory bowel disease, non-insulin dependent diabetes and neurodegenerative diseases.

In another embodiment, the inflammatory process may comprise (a) cardiac ischemia-reperfusion injury resulting from myocardial infarction, coronary artery bypass surgery, heart transplantation or seizure ischemia-reperfusion injury following a seizure; (b) progression and rupture of deeper coronary atherosclerotic plaques; (c) expression and progression of congestive heart failure; (d) endothelial cell damage following angioplasty with balun; And (e) apoptosis cell death of cardiomyocytes.

In another aspect of the invention, a DNA sequence encoding a TRAF2TR / 2TD variant is provided.

Another aspect of the invention provides a TRAF2TR / 2TD variant polypeptide capable of inhibiting the TNF α regulated pathway.

The present invention provides the advantage of being able to treat a variety of disease states using variants of natural proteins that interfere with early symptoms common to the disease states described above, ie TNF α signal transduction.

Tumor necrosis factor α (TNF α) is an intracellular mediator of immune responses produced by various cells, including activated macrophages and monocytes. Responses induced by TNF α are initiated through interaction with two distinct TNF α cell surface receptors, namely TNFαR1 and TNFαR2. TNF α binds to these cell surface receptors, leading to the activation of transcription factors such as nuclear factor κB (NFκB), which regulate the expression of various immune and inflammatory response genes.

Upon binding of TNF α, the TNF α receptor interacts with various intracellular signal transduction proteins through the cytoplasmic domain. A group of intracellular signal transduction proteins known to bind TNF a receptors is a tumor necrosis factor receptor binding factor known as the "TRAF" family of receptor proteins. The TRAF family consists of a number of homologous proteins that share common structural features and bind to the TNF α receptor protein to transduce signals from the TNF α receptor protein. The TRAF protein appears to act as an adapter protein that binds the receptor to the downstream signaling cascade instead of lacking the motif of enzymatic activity. TRAF2, a member of the TRAF family, binds to a number of TNF α receptor family proteins such as TNFαR1, TNFαR2, CD40 and CD30. In the case of TRAF2, direct binding of 8 or more intracellular molecules was confirmed. TRAF2 has been shown to play an important role in TNF α mediated activation of various transcription factors, in particular NFκB and C-jun N-terminal kinases (JNK / SAPK), which in turn result in the expression of immune / inflammatory responses. do.

There are various disease states associated with regulatory pathways controlled by TNF α binding. In certain instances, TNF α binding causes an inflammatory response and ultimately a disease state. Therefore, it would be desirable to develop means to prevent diseases associated with TNF α receptor binding. In particular, it would be desirable to identify a method for preventing activation of an inflammatory response that may be initiated by TNF α activation. The present invention provides a TRAF2-based polypeptide capable of inhibiting the TNF α signaling pathway in order to treat and prevent diseases associated with TNF α binding.

1 is a schematic structural diagram of full length TRAF2 (TRAF2-FL), and otherwise spliced variants, TRAF2TR.

2A and 2B show a nucleic acid sequence 2a of TRAF2TR and an amino acid sequence 2b of TRAF2TR.

3A and 3B show the nucleic acid sequence 3a of TRAF2TD and the amino acid sequence 3b of TRAF2TD.

4A and 4B show an alignment of spliced TRAF2 (TRAF2TR) with nucleic acid 4a and amino acid 4b of full length TRAF2.

5 shows the tissue distribution of TRAF2TR variant mRNAs. Lanes: 1-control TRAF2FL cDNA; Two-control TRAF2 spliced variant (TRAF2TR) cDNA; 3-Jurkat; 4-HeLa cell line; 5-thymus; 6-placental; 7-thymus; 8-spleen; 9-ovary; 10-control TRAF2FL.

6 shows the results of immunodetection of Myc-fused TRAF2FL and TRAF2TR in transfected HeLa cells. Lanes: 1-pcDNA3 vector; 2-myc-TRAF2FL; 3-myc-TRAF2TR.

FIG. 7 shows an electrophoretic mobility transfer assay (EMSA) conducted using an NFκB UAS probe. Nuclear extracts (lanes 3 and 4) from cells overexpressing FL TRAF2 show very significant TNF-alpha induced metastasis compared to controls (lanes 1 and 2). TRAF2-TR overexpression blocks the formation of NF-κB and as a result no metastasis was detected in cells stimulated by TNF α (lanes 5 and 6).

Hereinafter, definitions of terms used in the present specification and description of preferred embodiments of the present invention are given.

Justice

A "cloning vector" is a replicon, such as a plasmid, phage or cosmid, to which other DNA fragments can be attached, causing replication of the attached fragments. A "replicon" is any genetic factor (such as a plasmid, chromosome, virus) that acts as a spontaneous unit of DNA replication in vivo, that is, capable of replicating under its control. Cloning vectors replicate in one cell type and may be expressed in other cell types (“shuttle vectors”). In a preferred embodiment of the invention, the cloning vector is capable of expressing in a host cell and the "expression vector" is capable of expressing TRAF2TR or TRAF2TD at a level sufficient to interfere with the TNF a regulated pathway in this cell.

"Cassette" means a segment of DNA that can be inserted into a vector at one or more specific restriction sites. DNA fragments encode the polypeptide of interest, and the cassette and restriction sites are designed such that the cassette can be inserted under a reading frame suitable for transcription and translation.

A cell "transfected" by exogenous or heterologous DNA refers to the introduction of such DNA into the cell. A cell "transformed" by exogenous or heterologous DNA refers to the case where the transformed DNA affects the change in phenotype. The transforming DNA can be integrated (covalently linked) into the chromosomal DNA that makes up the genome of the cell.

A “nucleic acid molecule” is a ribonucleoside (adenosine, guanosine, uridine or cytidine; “RNA molecule”) or deoxyribonucleoside (deoxyadenosine, deoxy), which is in single-chain or double-stranded helix form. Guanosine, deoxythymidine or deoxycytidine; "DNA molecule"), or any phosphoester analogue thereof, such as phosphorothioate or phosphate ester polymer form of thioester. Double-stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term "nucleic acid molecule", in particular DNA or RNA molecule, refers only to the primary and secondary structures of the molecule and is not limited to any particular tertiary form. Thus, the term includes in particular double-stranded DNA found in linear or circular DNA molecules such as restriction fragments, plasmids and chromosomes. In discussing the structure of a particular double-stranded DNA molecule, the sequence is described herein according to the general practice of providing only sequences in the 5 'to 3' direction along the non-transcribed strand of DNA (ie, the strand having the same sequence as the mRNA). Will be described. A "recombinant DNA molecule" is a DNA molecule on which molecular biological manipulations have been performed.

Nucleic acid molecules are “hybridized” to other nucleic acid molecules, such as cDNA, genomic DNA or RNA, provided that the single stranded form of the nucleic acid molecule can anneal to other nucleic acid molecules under suitable conditions of temperature and ionic strength of the solution. Possible ”(Sambrook et al., Infra). The conditions of temperature and ionic strength determine the "stringency" of hybridization. Hybridization may allow for mismatch between bases, depending on the stringency of the hybridization, but requires that the two nucleic acids include complementary sequences. Stringency suitable for hybridization of nucleic acids depends on the length of the nucleic acid and the degree of complementarity, variables well known in the art.

As used herein, the term "oligonucleotide" refers to a nucleic acid that is capable of hybridizing to genomic DNA molecules, cDNA molecules, or mRNA molecules encoding TRAF2, and which is generally 18 or more nucleotides. Oligonucleotides may be labeled, for example, with nucleotides or ³² P-nucleotides covalently conjugated with a label such as biotin. In one aspect, labeled oligonucleotides can be used as probes to detect the presence of a nucleic acid encoding TRAF2. In another embodiment, oligonucleotides (which may be labeled on one or both sides) may be used as a PCR primer for cloning a full length TRAF2 or TRAF2 fragment or detecting the presence of a nucleic acid encoding TRAF2. In further embodiments, the oligonucleotides may form triple helices with the TRAF2 DNA molecule. In general, oligonucleotides are prepared synthetically, preferably with nucleic acid synthesizers. Thus, oligonucleotides can be prepared with non-natural phosphoester analogue bonds such as thioester bonds and the like.

DNA “coding sequences” are double-stranded DNA sequences that are transcribed and translated into polypeptides in cells in vivo or in vitro when placed under the control of suitable regulatory sequences. The DNA coding sequence and suitable regulatory sequences are preferably provided in an expression vector. The boundaries of the coding sequence are determined by the start codon at the 5 '(amino) terminus and the translation stop codon at the 3' (carboxyl) terminus. Coding sequences may include, but are not limited to, prokaryotic sequences, cDNAs from eukaryotic mRNAs, genomic DNA sequences from eukaryotic (eg mammalian) DNAs, and even synthetic DNA sequences. If the coding sequence is to be expressed in eukaryotic cells, the polyadenylation signal and transcription termination sequence will generally be located at 3 'of the coding sequence.

Transcriptional and translational regulatory sequences are promoters, enhancers, and terminators provided for expression of DNA regulatory sequences, eg, coding sequences in host cells. In eukaryotic cells, the polyadenylation signal is a regulatory sequence.

A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase intracellularly and initiating transcription of the downstream (3 'direction) coding sequence. For purposes of clarity of the invention, the promoter sequence is upstream (5) to include a transcription initiation site at its 3 'end and to contain the minimum number of bases or factors necessary to initiate transcription at detectable levels above the background level. Direction). Within the promoter sequence can be found not only the transcription initiation site (eg, conveniently defined by mapping with nuclease S1), but also the protein binding domain (consensus sequence) involved in the binding of RNA polymerase.

The coding sequence is "under control" of the transcriptional and translational regulatory sequences in the cell when the RNA polymerase transcribs the coding sequence into mRNA, and then spliced (if the coding sequence contains introns) by the coding sequence. It is translated into the encoded protein.

As used herein, the term “homology” refers to a relationship between proteins with “common evolutionary origin”. Such proteins (and their coding genes) have sequence homology, as can be seen through the high degree of sequence similarity. "Sequence similarity" means the degree of identity or equivalence between amino acid sequences or nucleic acids of proteins that share or do not share a common evolutionary origin. However, in general usage, the term “homology” as used herein refers to sequence similarity, especially when adverbs such as “altitude” are modified, but not common evolutionary origins.

The term “TNF α regulated pathway” and related terms refer to a signal transduction pathway involved in binding of TNF α to members of the tumor necrosis factor receptor family (TNFR).

As used herein, the term “corresponding to” refers to whether an analogous or homologous sequence is exactly the same or different from a molecule that measures similarity or homology. Nucleic acid or amino acid sequence alignments may include voids. Thus, the term "corresponding" does not mean the number of amino acid residues or nucleotide bases, but rather the similarity of the sequences.

The term “splice variant” refers to a poly encoded by mRNA produced by alternative processing of full-length full-length mRNA encoded by the gene (s) producing an mRNA comprising one or more deletions corresponding to the full-length mRNA for the gene. It means a peptide.

Aspect of invention

The present invention relates to two variants of TRAF2 that inhibit the TNF α signaling pathway. One embodiment is an RNA processing splice variant of TRAF2 called "TRAF2 cleavage" or "TRAF2TR". Another embodiment is based on TRAF2TR from which amino acid residues 1 to 87 are deleted in TRAF2TR, and is termed "TRAF2 truncated deletion" or "TRAF2TD". TRAF2TR and TRAF2TD have the ability to inhibit the TNF α signaling pathway. TRAF2TD is a particularly preferred embodiment because it has the ability to dramatically reduce the response to TNF α binding.

Hereinafter, a description of the structure of these two aspects, followed by a method for producing these aspects.

Structure and Preparation of the TRAF2TR Embodiment

The cDNA sequence of this splice variant is shown in FIG. 2A and the amino acid sequence is shown in FIG. 2B. Referring to FIG. 1, which schematically depicts TRAF2TR, amino acid residues 123-201 of TRAF2FL wherein the deletion comprises the C-terminus of Zn finger domain 1, all of Zn finger 2 and 3, and the N-terminal residue of Zn finger 4 You can see that you have removed.

TRAF2TR embodiments of the present invention may be prepared by any suitable method, including various methods known in the art. Teachings for isolation, cloning and sequencing of DNA can be found in various literatures. General molecular biology, microbiology and recombinant DNA techniques within the art can be found in Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (Hereinafter “Sambrook et al., 1989”); DNA Cloning: A Practical Approach, Volumes I and II (D.N. Glover ed. 1985); Oligonucleotide Synthesis (M. J. Gait ed. 1984); Nucleic Acid Hybridization [B.D. Hames & S.J. Higgins eds. (1985); Transcription and Translation [B.D. Hames & S.J. Higgins, eds. (1984); Animal Cell Culture [R.I. Freshney, ed. (1986); Immobilized Cells And Enzymes [IRL Press, (1986)]; B. Perbal, A Practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (Eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).

If information regarding the DNA sequence of TRAF2TR and methods known in the art for obtaining cDNA is presented herein, the nucleotide sequences encoding TRAF2TR and TRAF2TD can be easily cloned or prepared from wild-type TRAF2 and in vitro or in vivo. Can be inserted into a vector suitable for expressing the proteins in question. See Sambrook et al., 1989, supra for a description of methods for cloning cDNAs and for expression vectors.

Genes encoding TRAF2, whether or not genomic DNA or cDNA, can be isolated from human genome libraries or cDNA libraries. Methods of obtaining genes with DNA sequence information set forth herein are well known in the art. TRAF2 DNA can be obtained from cloned DNA (eg, a DNA "library") according to standard procedures known in the art. From tissues that express high levels of the protein (eg, human osteosarcoma SAOS-2 (ATCC No. HTB-85) expressing high levels of lymphoid origin cells, in particular B cells or osteosarcoma cell lines, such as TRAF2 or TRAF2TR). It is preferred that it is obtained from the prepared cDNA library. DNA can also be obtained by cloning genomic DNA or fragments thereof purified from cells of interest (see, eg, Sambrook et al., 1989, supra; Glover, D. M. (ed.), 1985, DNA Cloning: A Practical Approach, MRL Press, Ltd., Oxford, U.K. Vol. I, II] or by chemical synthesis. Clones derived from genomic DNA may include regulatory regions and intron DNA regions in addition to coding regions, but clones derived from cDNA do not include intron sequences. Although the present invention is based in part on the isolation of the full-length TRAF2 splice variant (TRAF2TR), it is preferred to obtain a cDNA encoding the TRAF2TR sequence.

Methods of obtaining cDNA are well known in the art. Briefly, the method includes separating a messenger RNA (mRNA) mixture from eukaryotic cells and synthesizing a double stranded DNA copy (cDNA) complementary to the isolated mRNA using a series of enzymatic reactions.

Reverse transcriptase-polymerase chain reaction (RT-PCR) cloning has been found to be an effective method for separating cDNAs containing TRAF2TR splice variants as shown in Example 1 below. RT-PCR includes reverse transcription of cellular mRNA with reverse transcriptase and amplification of the resulting DNA product using PCR.

Regardless of the method used to obtain the desired cDNA, the double-stranded cDNA mixture is inserted into the cloning vehicle using any of a variety of known techniques, depending at least in part on the specific vehicle used. Various insertion methods are discussed in great detail in Methods in Enzymology, 68, 16-18 (1980) and Sambrook et al., 1989, supra.

Once the DNA fragment is inserted into the cloning vehicle, the cloning vehicle is used to transform a suitable host. Such cloning vehicles generally impart antibiotic resistance to the host. Such hosts are generally prokaryotic and only a few of the host cells contain the desired cDNA. The transfected host cell constitutes a gene "library" and provides a representative sample of mRNA present in the cell from which the mRNA is isolated.

Given sequence information for TRAF2 provided herein, suitable oligonucleotide sequences can be prepared and preferably synthesized as described above and used to identify clones containing the TRAF2 sequence. To identify clones containing the TRAF2 sequence, transformed or transfected cells, respectively, are grown as colonies on nitrocellulose filter paper. The colonies are dissolved and the DNA is tightly bound to the filter paper by heating. The filter paper is then incubated with labeled oligonucleotide probes complementary to TRAF2. DNA fragments with significant homology to TRAF2 will hybridize to the probe. The greater the degree of homology, the more stringent hybridization conditions can be used.

The probe hybridizes with the complementary cDNA. This can be identified by chemical reactions or autoradiography to identify the presence of the probe. Corresponding clones are characterized to identify one clone or combination of clones containing all structural information about the protein of interest. The nucleic acid sequence encoding the protein of interest is isolated and reinserted into the expression vector. The expression vector places the cloned gene under the control of specific prokaryotic or eukaryotic cell regulatory factors that effectively express (transcribe and decode) ds-cDNA.

Depending on the nature of the gene, additional selection steps may be performed. For example, additional choices can be made when the gene encodes a protein product having an isoelectric, electrophoretic amino acid sequence or the partial amino acid sequence of a TRAF2 protein as disclosed herein. As such, the presence of the gene can be detected by an assay based on the physical, chemical or immunological properties of the expression product. For example, cDNA clones or DNA clones can be selected that produce proteins that are similar or identical in properties to TRAF2TR in terms of mobility, isoelectric point, non-equilibrium pH gel electrophoresis, proteolytic degradation, or antigenicity during electrophoresis.

Structure and Preparation of TRAF2TD Aspects

Compared to TRAF2TR, TRAF2TD has amino acids 1-87 and the deletion of the nucleotides corresponding to this amino acid. The DNA sequence of TRAF2TD is shown in Figure 3a and its amino acid sequence is shown in Figure 3b.

For the preparation of the TRAF2TD embodiment, any suitable method can be used, including various methods based on the information described above. In particular, there are a variety of methods for preparing truncated variants of TRAF2TR comprising a deletion from amino acids 1-87. As a preferred method of preparation, the 5 'primer corresponding to nucleotides 262 to 280 of the TRAF2 full-length coding sequence (ATGAGTTCGGCCTTCCCAGAT, wherein the ATG codon is inserted to prepare a translation initiation site) and the 3' primer (TTA TAG CCC TGT CAG GTC) TRAF2TR cDNA is used as a template for PCR using CAC). The resulting construct has amino acid number 88 of full length TRAF2 and deletions of amino acids 123-201 of TRAF2TR.

Additional variants of TRAF2TR can be prepared using the methods described above for the preparation of TRAF2TD.

TRAF2TR / 2TD Variants

The present invention is directed to allelic variants, substitutions, additions and deletion variants, analogs and derivatives of TRAF2TR or TRAF2TD (hereinafter referred to as "TRAF2TR / 2TD variants"), as well as from other species whose functional activity is identical or homologous to TRAF2TR. Homologs are included in the scope of the present invention. In a preferred embodiment, genes having deletions or substitutions that enhance the ability to inhibit the TNF α signaling pathway can be used in the practice of the present invention. Preparation or isolation of TRAF2TR / 2TD variants is within the scope of the present invention. Thus, the scope of the present invention includes TRAF2TR / 2TD variants that may exhibit functional activity, ie, one or more functional activities associated with TRAF2TR.

TRAF2TR / 2TD variants can be prepared by modifying the coding nucleic acid sequence through substitutions, additions, or deletions, which provide functionally equivalent molecules. Preferably, a TRAF2TR / 2TD embodiment is prepared which has increased or enhanced functional activity compared to TRAF2TR or TRAF2TD.

Due to the degeneracy of the nucleotide coding sequence, other DNA sequences encoding amino acid sequences that are nearly identical to TRAF2TR, including amino acid sequences comprising single amino acid variants, can also be used to practice the invention. These include, but are not limited to, alleles, homologous genes from different species, and nucleotide sequences comprising all or a portion of TRAF2TR that is modified by substitution of other codons encoding the same amino acid residues, resulting in potential changes. It is not. Similarly, the TRAF2TR / 2TD variant of the present invention is a whole or part of an amino acid sequence of a TRAF2TR protein containing a modified sequence which, as a primary amino acid sequence, replaces residues in the sequence with functionally equivalent amino acid residues to yield conservative amino acid substitutions. It includes, but is not limited to, amino acid sequences including. For example, one or more amino acid residues in the sequence may act as functional equivalents and be substituted with other amino acids having similar polarities resulting in latent modifications. Substitution of amino acids in the sequence may be selected from other members of the class to which the amino acid belongs. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. Amino acids comprising an aromatic ring structure are phenylalanine, tryptophan and tyrosine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine. Positively charged (basic) amino acids include arginine, lysine and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. This modification is expected to have no effect on the apparent molecular weight as measured by polyacrylamide gel electrophoresis or isoelectric point.

Particularly preferred substitutions are as follows:

-Mutual substitution of Lys and Arg for which a positive charge can be maintained

-Interchange of Glu and Asp, where negative charge can be maintained

-Replace Thr to Ser that can hold free -OH

Substituting Asn for Gln to maintain free CONH ₂ .

In addition, amino acid substitutions may be introduced for substitution with amino acids having particularly desirable properties. For example, Cys can introduce a site capable of disulfide bonds with other Cys. His can be introduced as a unique "catalyst" site (ie His is the most common amino acid for biochemical catalysis by acting as an acid or base). Pro can be introduced because it provides a special planar structure that induces β-turns in the structure of the protein.

Genes encoding TRAF2TR / 2TD variants of the invention can be prepared by a variety of methods known in the art. Manipulations for such preparations can be performed at the gene or protein level. For example, the cloned TRAF2 gene sequence can be modified by any of a number of strategies known in the art (Sambrook et al., 1989, supra). The sequence can be cleaved at the appropriate site using restriction endonuclease (s) and, if necessary, further enzymatic modifications can be followed by isolation and linkage in vitro. When preparing a gene encoding a TRAF2TR / 2TD embodiment, care must be taken to maintain the same reading frame as the TRAF2TR gene without the intervention of a translation termination signal in the region of the gene where the modified gene encodes the desired activity.

In addition, TRAF2TR / 2TD encoding nucleic acid sequences generate and / or destroy translation, initiation and / or termination sequences, generate mutations in coding regions, form new restriction endonuclease sites, or Restriction endonuclease sites can be disrupted and modified in vitro or in vivo to facilitate further in vitro modification. Such mutations preferably enhance the functional activity of the mutated TRAF2TR gene product. Any mutagenesis technique known in the art can be used, examples include in vitro site-directed mutagenesis (see Hutchinson, C., et al., 1978, J. Biol. Chem. 253: 6551; Zoller and Smith, 1984, DNA 3: 479-488; Oliphant et al., 1986, Gene 44: 177; Hutchinson et al., 1986, Prco. Natl. Acad. Sci. USA 83: 710), the use of “TAB” linkers (Pharmacia), and the like. PCR techniques are preferred for site-directed mutagenesis. Higuchi, 1989, "Using PCR to Engineer DNA", in PCR Technology: Principles and Applications for DNA Amplification , H. Erlich, ed., Stockton Press, Chapter 6, pp. 61-70.

With regard to the manipulation and expression of DNA encoding the polypeptide of interest, the discussions disclosed below are common to both TRAF2TR and TRAF2TD as well as TRAF2TR / 2TD variants.

Cloning of TRAF2TR, TRAF2TD, and TRAF2TR / 2TD Variants into Cloning / Expression Vectors

The identified and isolated DNA sequences can be inserted into a suitable cloning / expression vector (hereinafter “vector”) to facilitate expression of the protein or modification to the sequence. Such vectors typically include multiple cloning sites, promoters, sequences that facilitate replication in the host cell, and selection markers.

Any suitable vector can be used. Many examples are known in the art. Examples of vectors that can be used include, but are not limited to, plasmids or modified viruses. The vector is typically compatible with any host cell into which the vector is introduced to facilitate replication of the vector and expression of the encoded protein. Insertion of the DNA sequence into a given vector can be accomplished, for example, by linking the DNA fragment to a cloning vector having complementary adhesive ends. However, if the complementary restriction sites used to fragment the DNA are not present in the cloning vector, the ends of the DNA molecules can be enzymatically modified. Alternatively, the nucleotide sequence (linker) may be linked to a DNA terminus to prepare any desired site, which linker may comprise certain chemically synthesized oligonucleotides that encode restriction endonuclease recognition sequences. Can be. Useful vectors can consist of segments of chromosomal DNA, non-chromosomal DNA, and synthetic DNA sequences. Examples of specific vectors useful in the practice of the present invention are described in E. E. coli bacteriophages, for example lambda derivatives or plasmids, for example pBR322 derivatives or pUC plasmid derivatives, for example pmal-c, pFLAG, derivatives of SV40 and known bacterial plasmids, for example , This. E. coli plasmid colE1, pCR1, pMa1-C2, pET, pGEX (Smith et al., 1988, Gene 67: 31-40), plasmids such as pMB9 and derivatives thereof, RP4; Phage DNA, eg, various derivatives of phage 1, eg, NM989, and other phage DNA, eg, M13 and filamentous single stranded phage DNA; Yeast vectors such as 2 μm plasmid or derivatives thereof; Vectors useful for eukaryotic cells, eg, vectors useful for insect cells such as baculovirus vectors, vectors useful for mammalian cells; But are not limited to vectors derived from a combination of plasmid and phage DNA, plasmids modified to utilize phage DNA or other expression control sequences.

Yeast vectors that can be used according to the present invention include unfused pYES2 vectors (XbaI, SphI, ShoI, NotI, GstXI, EcoRI, BstXI, BamHI, ScaI, Kpn1 and HindIII cloning sites; Invitrogen) or fused pYESHisA, B, C (XbaI , SphI, ShoI, NotI, BstXI, EcoRI, BamHI, SacI, KpnI and HindIII cloning sites, N-terminal peptides purified by ProBond resin and cleaved with enterokinase; Invitrogen).

Baculovirus vectors that can be used to practice the invention include a variety of vectors, such as non-fusion delivery vectors, such as pVL941 (BamHI cloning site; Summers), pVL1393 (BamHI, SmaI, XbaI, EcoR1, NotI , XmaIII, BglII and PstI cloning sites; Invitrogen), pVL1392 (BglII, PstI, NotI, XmaIII, EcoRI, XbaI, SmaI and BamHI cloning sites; Summers and Invitrogen) and pBlueBacIII (BamHI, BglII, PstI, NcoI and HindIII cloning sites Blue / white recombinant selection is possible (Invitrogen); And fusion delivery vectors such as pAc700 (BamHI and KpnI cloning sites where the BamHI recognition site starts with the start codon; Summers), pAc701 and pAc702 (same as pAc700 except that the reading frame is different), pAc360 (polyhedrin 36 base pairs of BamHI cloning site downstream of the start codon; Invitrogen (195) and pBlueBacHisA, B, C (3 different reading frames, BamHI, BglII, PstI, NcoI and HindIII cloning sites, N- useful for ProBond purification) Blue / white recombinant selection of terminal peptides and plaques; Invitrogen) can be used.

Mammalian vectors contemplated for use in the present invention include, for example, any vector having an inducible promoter (eg, a dihydrofolate reductase (DHFR) promoter, eg, a DHFR expression vector). Expression vector, or a DHFR / methotrexate coamplification vector such as pED [PstI, SalI, SbaI, SmaI and EcoRI cloning sites, the vector expresses both the cloned gene and DHFR; see Kaufman, Current Protocols in Molecular Biology, 16.12 (1991), or a glutamine synthetase / methionine sulfoximine coamplification vector, eg, pEE14 (HindIII, XbaI, SmaI, SbaI, EcoRI and BclI cloning sites, the vector being a glutamine synthase And express the cloned gene, Celltech In another embodiment, a vector can be used that induces episomal expression under the control of the Epstein Barr Virus (EBV). Examples include pREP4 (BamHI, SfiI, XhoI, NotI, NheI, HindIII, NheI, PvuII and KpnI cloning sites, constitutive Ruth sarcoma virus long terminal repeat (RSV-LTR) promoter, hygromycin selection marker; Invitrogen ), pCEP4 (BamHI, SfiI, XhoI, NotI, NheI, HindIII, NheI, PvuII and KpnI cloning sites, constitutive human cytomegalovirus (hCMV) early expression gene, hygromycin selection marker; Invitrogen), pMEP4 (KpnI, PvuI, NheI, HindIII, NotI, XhoI, SfiI, BamHI cloning site, inducible metallothionein IIa gene promoter, hygromycin selection marker; Invitrogen), pREP8 (BamHI, XhoI, NotI, HindIII, NheI and KpnI cloning sites , RSV-LTR promoter, histidinol selection marker; Invitrogen), pREP9 (KpnI, NheI, HindIII, NotI, XhoI, SfiI and BamHI cloning sites, REV-LTR promoter, G418 selection marker; Invitrogen) and pEBVHis (RSV-LTR promoter, hygromycin selection marker, ProBond resin N-terminal peptides that are purified and cleaved by enterokinase (Invitrogen). Selective mammalian expression vectors useful in the present invention include pRc / CMV (HindIII, BstXI, NotI, SbaI and ApaI cloning sites, G418 selection; Invitrogen), pRc / RSV (HindIII, SpeI, BstXI, NotI, XbaI cloning site, G418 selection; Invitrogen), pcDNA3 (HindIII, KpnI, BamHI, BstXI, EcoRI, EcoRV, BstXI [Repeat], NotI, XhoI, XbaI, ApaI cloning site, G418, Ampicillin Selection, Invitrogen) and the like. Vaccinia virus mammalian expression vectors (Kaufman, 1991, supra) for use in accordance with the present invention include pSC11 (SmaI cloning site, TK- and β-gal selection); pMJ601 (SalI, SmaI, AflI, NarI, BspMII, BamHI, ApaI, NheI, SacII, KpnI and HindIII cloning sites; TK- and β-gal selection) and pTKgptF1S (EcoRI, PstI, SalI, AccI, HindIII, SbaI, BamHI And Hpa cloning site, TK or XPRT selection).

Various methods can be used to identify whether a target DNA sequence encoding a TRAF2TR, TRAF2TD or TRAF2TR / 2TD variant has been cloned into a vector. In general, one or more of the following approaches are used: (a) PCR amplification of the plasmid DNA or specific mRNA of interest, (b) nucleic acid hybridization, (c) the presence or absence of selection marker gene function, and (d) suitable restriction endogenes. Analysis with Clease and (e) Expression of Insertion Sequences. In a first approach, nucleic acids can be amplified by PCR to detect amplification products. In a second approach the presence of the heterologous gene inserted into the expression vector can be detected by nucleic acid hybridization using a probe comprising a sequence homologous to the inserted marker gene. In a third approach, the recombinant vector / host system is characterized by certain “selection marker” gene functions (eg β-galactosidase activity, thymidine kinase activity, resistance to antibiotics, transformation, caused by insertion of heterologous genes into the vector). Phenotype, formation of occlusion in baculovirus, etc.) can be identified and selected. As another example, when a nucleic acid encoding TRAF2TR is inserted into the "selection marker" gene sequence of a vector, a recombinant containing the TRAF2TR insert may be identified through loss of selection marker gene function. In a fourth approach, recombinant expression vectors are identified through digestion with suitable restriction enzymes. In a fifth approach, recombinant expression vectors can be identified by analyzing the activity, biochemical or immunological properties of the gene product expressed by the recombinant, provided that the expressed protein is assumed to be a functionally active form.

Promoter

Nucleotide sequences encoding TRAF2TR or TRAF2TD, or TRAF2TR / 2TD variants thereof, can be inserted into an expression vector containing factors necessary for the transcription and translation of the inserted protein coding sequence. Such factors are referred to herein as "promoters." As such, the nucleic acid encoding a polypeptide of the invention is operably linked with a promoter in the expression vector of the invention. Both cDNA and genomic sequences can be cloned and expressed under the control of such regulatory sequences. In addition, the expression vector preferably comprises an origin of replication. Necessary transcriptional and translational signals may also be provided on recombinant expression vectors or supplied by native genes encoding TRAF2 and / or contiguous regions thereof. Any of the aforementioned methods for inserting a DNA fragment into a cloning vector can be used to construct an expression vector containing genes consisting of suitable transcriptional / translational regulatory signals and protein coding sequences. Such methods include in vitro recombinant DNA and synthetic techniques and in vivo recombination (genetic recombination).

Expression can be regulated by any promoter / enhancer factor known in the art, but these regulatory factors must be functional in the host selected for expression. Promoters that can be used to modulate TRAF2TR gene expression include the SV40 early promoter region (Benoist and Chambon, 1981, Nature 290: 304-310), promoters included in the 3 'long term repeat of the Ruth sarcoma virus (Yamamoto). , et al., 1980, Cell 22: 787-797, herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78: 1441-1445], the regulatory sequence of the metallothionein gene (Brinster et al., 1982, Nature 296: 39-42); Expression vectors of prokaryotic cells, such as the β-lactamase promoter [Villa-Kamaroff, et al., 1978, Proc. Natl. Acad. Sci. U.S.A., 75: 3727-3731] or the tac promoter (DeBoer, et al., 1983, Proc. Natl. Acad. Sci. U.S.A., 80: 21-25; And "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242: 74-94; Yeast or other fungal derived promoter factors such as the Gal 4 promoter, ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter; And an elastase I gene regulatory region that exhibits tissue specificity and is active in animal transcriptional regulatory regions used in transgenic animals, ie, pancreatic acinar cells [Swift et al., 1984, Cell 38: 639-646; Ornitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol., 50: 399-409; MacDonald, 1987, Hepatology 7: 425-515; Insulin gene regulatory region active in pancreatic beta cells (Hanahan, 1985, Nature 315: 115-122), immunoglobulin gene regulatory region active in lymphoid cells [Grosschedl et al., 1984, Cell 38: 647 -658; Adames et al., 1985, Nature 318: 533-538; Alexander et al., 1987, Mol. Cell. Biol., 7: 1436-1444], mouse breast cancer virus regulatory regions that are active in testes, breast, lymphoid cells and mast cells [Leder et al., 1986, Cell 45: 485-495], which are active in the liver. Albumin gene regulatory region [Pinkert et al., 1987, Genes and Devel. 1: 268-276], an alpha-fetoprotein gene regulatory region that is active in the liver (Krumlauf et al., 1985, Mol. Cell. Biol., 5: 1639-1648; Hammer et al., 1987, Science 235: 53-58], alpha 1-antitrypsin gene regulatory region active in the liver (Kelsey et al., 1987, Genes and Devel., 1: 161-171), bone marrow Beta-globin gene regulatory regions active in both cells [Mogram et al., 1985, Nature 315: 338-340; Kollias et al., 1986, Cell 46: 89-94], myelin basic protein gene regulatory regions that are active in brain cells in the brain (Readhead et al., 1987, Cell 48: 703-712), active in skeletal muscle Myocin light chain-2 gene regulatory region (Sani, 1985, Nature 314: 283-286) and the gonadotropin releasing hormone gene regulatory region active in the hypothalamus [mason et al., 1986, Science 234: 1372-1378, but is not limited to such.

Introduction of vectors into host cells

The vector can be any suitable method, such as transfection, electroporation, microinjection, transduction, cell fusion, DEAD dextran, calcium phosphate precipitation, lipofection (lysosomal fusion) to generate multiple copies of the gene sequence. , Use of gene guns, or DNA vector transporters (see, eg, Wu et al., 1992, J. Biol. Chem. 267: 963-967; Wu and Wu, 1988, J. Biol. Chem. 263: 14621-14624; Hartmut et al., Canadian Patent Application No. 2,012,311, filed Mar. 15, 1990]. The cloned gene is Lee. It is desirable to include cloning cells such as E. coli in a shuttle vector plasmid that facilitates purification and can then be expanded and inserted into suitable expression cell lines. For example, a shuttle vector, which is a vector that can be replicated in one or more subjects, can The sequence derived from the coli plasmid and the sequence derived from the yeast 2 μm plasmid were linked to each other. It can be prepared for replication in Coli and Saccharomyces cerevisiae.

Host cell system

Potential host cell systems include mammalian host cell systems infected with viruses (eg vaccinia virus, adenovirus, etc.); Insect host cell systems infected with viruses (eg, baculovirus); Microorganisms such as yeast containing yeast vectors; Or bacteria transformed with bacteriophage DNA, plasmid DNA or cosmid DNA. The expression factors of the vectors differ in their strength and specificity. Any one of a number of suitable transcription and translation factors can be used depending on the host cell system used.

In addition, the host cell line may be chosen to control the expression of the insertion sequence or to modify and process the gene product in certain desired ways. Different host cells have unique and specific mechanisms for the translation and post-translational processing and modification of proteins. Suitable cell lines or host systems may be selected that preferably modify and process the expressed heterologous protein. Expression in yeast can produce biologically active products. Expression in eukaryotic cells can increase the likelihood of "natural" folding. In addition, expression in mammalian cells can provide a mechanism for constructing or reconstituting TRAF2TR inhibitory activity. In addition, different vector / host expression systems can have different degrees of impact on processing reactions such as proteolytic cleavage. The expression vector of the present invention can be used to transfect cells for selection or biological testing of modulators of TRAF2TR activity as described above.

Recombinant TRAF2TR, TRAF2TD or TRAF2TR / 2TD variants of the invention can be expressed on the chromosome after incorporation of the coding sequence by recombination. In this regard, any of a number of amplification systems can be used to achieve highly stable gene expression (Sambrook et al., 1989, supra).

Cells into which a recombinant vector containing a nucleic acid encoding TRAF2TR have been introduced are cultured in a suitable cell culture medium under conditions in which expression of TRAF2TR can be achieved by these cells.

Once suitable host systems and growth conditions have been established, recombinant expression vectors can be produced by multiplying in large quantities. Soluble forms of the protein can be obtained by dissolving the inclusion bodies by collecting cultures or treating with detergents and, if necessary, by ultrasonic or mechanical processes as described above. Solubilized or soluble proteins include polyacrylamide gel electrophoresis (PAGE), isoelectric focusing, two-dimensional gel electrophoresis, chromatography (e.g. ion exchange, affinity, immunoaffinity and size selection column chromatography), centrifugation. Can be isolated using any other standard technique for purification, differential solubility, immunoprecipitation or other protein purification.

As mentioned above, a "vector" is any means of transferring a nucleic acid according to the invention to a host cell. Preferred vectors are viral vectors such as retroviruses, herpes virus, adenoviruses and adeno-associated viruses. Thus, the genes encoding the protein or polypeptide domain fragments of the invention may be introduced in vivo, ex vivo or in vitro using viral vectors, or the DNA may be introduced directly. Expression in targeted tissues can be performed by targeting the mutant vector to specific cells, eg, using viral vectors or receptor ligands, using tissue specific promoters, or both.

Use of Viral Vector Systems for In Vitro and In Vivo Processing Methods

Viral vectors commonly used in in vivo or ex vivo targeting and treatment procedures are DNA based vectors and retroviral vectors. Methods of constructing and using viral vectors are well known in the art (see, eg, Miller and Rosman, BioTechniques 7: 980-990 (1992)). The viral vector is preferably replication defective, ie unable to spontaneously replicate in the target cell. In general, the genome of a replication defective viral vector used within the scope of the present invention is one in which one or more regions necessary for the replication of the virus in an infected cell are deleted. The region can be removed (in whole or in part) or made nonfunctional by any technique known in the art. Such techniques include total removal, substitution (substitution with other sequences, in particular substitution with inserted nucleic acids), partial deletion or addition of one or more bases to essential regions (regions necessary for replication). Such techniques can be carried out in vitro (for isolated DNA) or in situ using genetic engineering techniques or by treatment with a mutant. The replication defective virus preferably has the genomic sequence necessary for encapsulation of the viral particles.

DNA viral vectors are attenuated DNA viruses or defective DNA viruses such as herpes simplex virus (HSV), papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), vaccinia virus And the like, but are not limited thereto. Preference is given to a defective virus in which the viral gene has been completely or almost completely deleted. Defective viruses are incapable of replicating once introduced into cells and do not induce a productive viral infection. Using a defective viral vector allows cells to be administered to specific local areas without fear that the vector can infect other cells. Thus, specific tissues can be specifically targeted. Examples of specific vectors include the defective herpes virus 1 (HSV1) vector [Kaplitt et al., Molec. Cell. Neurosci. 2: 320-330 (1991)], a deleted herpes virus vector (patent publication RD 371005A) or other deleted herpes virus vector lacking a glycoprotein L gene [International Patent Publication WO94 / 21807, September 1994] Published on 29th; International Patent Publication WO92 / 05263, published April 2, 1994]; Attenuated adenovirus vectors, eg, Stratford-Perricaudet et al., Stratford-Perricaudet et al., J. Clin. Invest. 90: 626-630 (1992); La Salle et al., Science 259: 988-990 (1993); And defective adeno-associated viral vectors (Samulski et al., J. Virol. 61: 3096-3101 (1987); Samulski et al., J. Virol. 63: 3822-3828 (1989); Lebkowski et al., Mol. Cell. Biol. 8: 3988-3996 (1988), but is not limited to such.

For in vivo administration, it is desirable to use suitable immunosuppressive therapy in conjunction with viral vectors, such as adenovirus vectors, to avoid immunoinactivation of the viral vector and the transfected cells. To block humoral or cellular immune responses against viral vectors, immunosuppressive cytokines such as, for example, interleukin-12 (IL-12), interferon-g (IFN-g) or anti-CD4 antibodies may be administered [ See, Wilson, Nature Medicine (1995). It is also advantageous to use viral vectors engineered to express the minimum number of antigens.

Naturally, the present invention also contemplates delivery of a vector expressing a therapeutically effective amount of TRAF2TR for gene therapy. As used herein, the term “therapeutically effective amount” is an amount sufficient to reduce an immune response that yields clinically significant signs of a disease associated with TNF α binding, most preferably an amount sufficient to prevent such an immune response. It means. Alternatively, a therapeutically effective amount is an amount sufficient to ameliorate clinically significant symptoms in the host.

Preferred Viral Vector Systems for Use in In Vitro and In Vivo Treatment Methods

Certain viral vector systems have been sufficiently developed in the art and are suitable for the treatment methods of the present invention.

a. Adenovirus Vector System

In a preferred embodiment, the vector is an adenovirus vector. Adenoviruses are eukaryotic DNA viruses that can be modified to effectively deliver the nucleic acids of the invention to various cell types. There are various serotypes of adenoviruses. Among these serotypes, it is preferable to use type 2 or 5 human adenovirus (Ad2 or Ad5) or adenovirus of animal origin within the scope of the present invention (WO 94/26914). Adenoviruses of animal origin that can be used within the scope of the present invention include dogs, cattle, mice (e.g. Mav1, Beard et al., Virology 75 (1990) 81), sheep, pigs, birds and apes (e.g. SAV). Adenoviruses of origin. Adenoviruses of animal origin are preferably adenoviruses of dogs, more preferably CAV2 adenoviruses (eg, Manhattan or A26 / 61 strains (ATCC VR-800)).

The replication defective adenovirus vector of the invention preferably comprises an ITR, a capsidizing sequence and a nucleic acid of interest. More preferably, at least the El region of the adenovirus vector is nonfunctional. The deletion in the El region is preferably nucleotides 455 to 3329 (PvuII-BglII fragment) or 382 to 3446 (HinfII-Sau3A fragment) of the Ad5 adenovirus sequence. In addition, other regions, in particular the E3 region (WO95 / 02697), the E2 region (WO94 / 28938), the E4 region (WO94 / 28152, WO94 / 12649 and WO95 / 02697) or any of the later genes L1 to L5, may be modified. Can be.

In a preferred embodiment, the adenovirus vector has a deletion in the El region (Ad1.0). Examples of adenoviruses in which E1 has been deleted are disclosed in EP 185,573, which is incorporated herein by reference. In another preferred embodiment, the adenovirus vector has deletions in the El and E4 regions (Ad 3.0). Examples of adenoviruses in which E1 / E4 have been deleted are disclosed in WO95 / 02697 and WO96 / 22378, which are incorporated herein by reference. In another preferred embodiment, the adenovirus vector has a deletion in the E4 region and the E1 region into which the nucleic acid sequence is inserted (FR94 13355, incorporated herein by reference).

Replication-defective recombinant adenoviruses according to the invention can be prepared by any technique known in the art. See Levrero et al., Gene 101 (1991) 195, EP 195 573; Graham, EMBO J. 3 (1984) 2917]. In particular, it can be produced by homologous recombination between adenovirus and a plasmid carrying a DNA sequence of interest. Homologous recombination is performed after cotransfection of the adenovirus and the plasmid into a suitable cell line. The cell line used should preferably be capable of (i) be transformed by the adenovirus and plasmid, and (ii) a sequence capable of supplementing a portion of the replication-deficient adenovirus genome, preferably at risk of recombination. It must be included in an integrated form to avoid it. Examples of cell lines that can be used include human embryonic kidney cell line 293, which includes the left portion (12%) of the Ad5 adenovirus genome integrated into the genome. See, eg, Graham et al., J. Gen. Virol. 36 (1977) 59 and in WO94 / 26914 and WO95 / 02697, there are cell lines capable of supplementing El and E4 functions. Recombinant adenoviruses are recovered and purified using standard molecular biology techniques well known to those skilled in the art.

b. Adeno-associated Virus Vector System

Adeno-associated viruses (AAV) are relatively small sized DNA viruses that can be integrated into the genome of infected cells in a stable and site-specific manner. The virus can infect various cells without inducing any effect on the growth, morphology or differentiation of the cells and does not appear to be involved in human pathological conditions. The AAV genome has already been cloned, sequenced and characterized. It contains about 4700 bases and includes an inverted terminal repeat (ITR) region of about 145 bases at each end that serves as a viral replication origin. The rest of the genome is directed to two essential regions with encapsulation, namely the left side of the genome containing the rep gene involved in viral replication and viral gene expression and the right side of the genome containing the cap gene encoding the viral capsid protein. Divided.

The use of vectors derived from AAV for the delivery of genes in vitro and in vivo is described in WO91 / 18088; WO 93/09239; US Patent No. 4,797,368; US Patent No. 5,139,941, EP 488 528. These publications describe a variety of AAV-derived constructs in which the rep and / or cap genes have been deleted and replaced with the gene of interest and the construct in vitro (in cultured cells) or in vivo (directly into an organism). Disclosed are uses for use in delivering genes of interest. Replication-defective recombinant AAV according to the present invention is a plasmid containing a nucleic acid sequence of interest flanked by two AAV reverse satellite terminal repeat (ITR) regions and a plasmid carrying AAV encapsulation genes (rep and cap genes). Can be prepared by cotransfecting a cell line infected with a human helper virus (eg, adenovirus). The resulting AAV recombinant is then purified by standard techniques.

The invention thus also relates to a recombinant virus derived from AAV comprising a sequence in the genome encoding a TRAF2TR or TRAF2TD encoding nucleic acid flanked by AAV ITR. The invention also relates to plasmids containing sequences encoding TRAF2TR or TRAF2TD encoding nucleic acids flanked by two ITRs derived from AAV. Such plasmids can be used for the delivery of nucleic acid sequences, and if necessary the plasmids can be incorporated into liposome vectors (pseudo-virus).

c. Retrovirus Vector System

In another embodiment, the genes are described in Anderson et al., US Pat. No. 5,399,346; Mann et al., 1983, Cell 33: 153; Temin et al., US Pat. No. 4,650,764; Temin et al., US Pat. No. 4,980,289; Markowitz et al., 1988, J. Virol. 62: 1120; Temin et al., US Pat. No. 5,124,263; EP 453242, EP 178220; Bernstein et al., Genet. Eng. 7 (1985) 235; McCormick, BioTechnology 3 (1985) 689; International Patent Publication WO95 / 07358, published March 16, 1995, Dougherty et al .; And Kuo et al., 1993, Blood 82: 845. Retroviruses are integrated viruses that infect dividing cells. The retroviral genome contains two LTRs, encapsulation sequences and three coding regions (gag, pol and env). In recombinant retroviral vectors, the gag, pol, and env genes are generally deleted, either completely or partially, and substituted with heterologous nucleic acid sequences of interest. The vector may contain different kinds of retroviruses such as HIV, MoMuLV ("Mouse's Molecular Leukemia Virus" MSV ("Mouse's Molecular Sarcoma Virus"), HaSV ("Havey's Sarcoma Virus"); SNV ("Spleen) Necrosis virus "); RSV (" Loose Sarcoma Virus ") and Friend Viruses. Defective retroviral vectors are disclosed in WO95 / 02697.

In general, in order to construct a recombinant retrovirus containing a nucleic acid sequence, a plasmid containing an LTR, an encapsulation sequence and a coding sequence is constructed. This construct is used to transfect packaging cell lines capable of transfecting the plasmid with missing retroviral function. As such, packaging cell lines are generally capable of expressing the gag, pol and env genes. Such packaging cell lines, in particular cell line PA317 (US Pat. No. 4,861,719); PsiCRIP cell line (WO90 / 02806) and GP + envAm-12 cell line (WO89 / 07150) are described in the prior art. In addition, recombinant retroviral vectors may contain sufficient encapsulation sequences to contain a portion of the gag gene, as well as modifications within the LTR to inhibit transcriptional activity. See Bender et al., J. Virol. 61 (1987) 1639. Recombinant retroviral vectors are purified by standard techniques known in the art.

Retroviral vectors can be constructed to act as infectious particles or to perform one transfection. In the case of infected particles, the virus retains all genes except those involved in oncogene transformation properties and is modified to express heterologous genes. Non-infective viral vectors disrupt the viral packaging signal but are designed to contain the structural genes needed to package the co-introduced virus engineered to contain heterologous genes and packaging signals. Thus, the resulting viral particles cannot produce other viruses. Targeted gene delivery is disclosed in International Patent Publication WO95 / 28494 (October 1995).

Nonviral systems used in in vitro and in vivo therapeutic methods

Certain non-viral systems have also been used in the art and can also readily incorporate DNA encoding the polypeptides of the invention into the desired target cells.

a. Lipofection Delivery System

Vectors can be introduced in vivo by lipofection. In the past decade, there has been an increase in the use of liposomes to encapsulate and transfect nucleic acids in vitro. Synthetic cationic lipids designed to limit the difficulties and risks of liposome-mediated transfection can be used to prepare liposomes for in vivo transfection of genes encoding markers. Felgner et al., Proc. Natl. Acad. Sci. U.S.A. 84: 7413-7417 (1987); Mackey et al., Proc. Natl. Acad. Sci. U.S.A. 85: 8027-8031 (1988); Ulmer et al., Science 259: 1745-1748 (1993). The use of cationic lipids can promote encapsulation of negatively charged nucleic acids and also promote fusion with negatively charged cell membranes (Felgner and Ringold, Science 337: 387-388 (1989)). Particularly useful lipid compounds and compositions for nucleic acid delivery are disclosed in International Patent Publications WO95 / 18863 and WO96 / 17823, and US Pat. No. 5,459,127. Lipofections used to introduce exogenous genes into specific organs in vivo have particular practical advantages. Molecular targeting of liposomes to specific cells represents one benefit region. Direct transfection to specific cell types is particularly advantageous in the case of tissues with cell heterogeneity, such as the pancreas, liver, kidney and brain. Lipids can be chemically bound to other molecules for targeting purposes [Mackey et al., Supra]. Targeted peptides such as hormones or neurotransmitters, and proteins, antibodies, or nonpeptidyl molecules can be chemically bound to liposomes.

In addition, other molecules such as cationic oligopeptides (eg WO 95/21931), peptides derived from DNA binding proteins (eg WO 96/25508) may be used to facilitate transfection of nucleic acids in vivo. ) Or cationic polymers (e.g. WO 95/21931) may also be usefully used.

b. Naked DNA delivery system

It is also possible to use naked DNA plasmids to introduce vectors in vivo (see US Pat. Nos. 5,693,622, 5,589,466 and 5,580,859). Naked DNA vectors for gene therapy include methods known in the art, such as transfection, electroporation, microinjection, transduction, cell fusion, DEAD dextran, calcium phosphate precipitation, use of gene guns or DNA Use of vector transporters (see, eg, Wu et al., 1992, J. Biol. Chem. 267: 963-967; Wu and Wu, 1988, J. Biol. Chem. 263: 14621-14624; Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15, 1990; Williams et al., Proc. Natl. Acad. Sci. USA 88: 2726-2730 (1991)] can be introduced into a desired host cell. Receptor-mediated DNA delivery approaches can also be used. See Curiel et al., Hum. Gene Ther. 3: 147-154 (1992); Wu and Wu, J. Biol. Chem. 262: 4429-4432 (1987).

How to identify therapeutically useful variants of TRAF2TR

There are a variety of methods that can be used to determine whether TNF a regulated pathways are involved in disease states and to determine the effect of the polypeptides of the invention on these pathways. For example, to investigate the role of TRAF2TR in NFκB regulation, an electrophoretic mobility transfer assay (EMSA) was performed using NFκB UAS as a probe (FIG. 7). Nuclear extracts derived from cells overexpressing FL TRAF (lanes 3 and 4) showed stronger TNF α induced metastasis compared to controls (lanes 1 and 2). Overexpression of TRAF2TR blocks the formation of NFκB and consequently no metastasis was observed in cells stimulated by TNF α (lanes 5 and 6). This result, in which no transition band was observed in TNF α stimulated cells, suggests that NFκB formation is strongly inhibited. An increase in NFκB binding activity is present in cells that overexpress full length TRAF2 after stimulation with TNF α (lane 4).

Experiments of the type described above can be used to determine whether certain pathways associated with a disease state can be treated using the compositions of the invention. In general, the experiments described above can be used to determine whether the variants have the ability to inhibit TNF a regulated pathways by replacing TRAF2TR or TRAF2TD with the isolated or prepared variants of TRAF2.

Disease states associated with TNF α regulated pathways

As noted above, the present invention relates to the use of TRAF2TR and TRAF2TD and variants thereof used to inhibit TNF α regulated pathways. In particular, the present invention relates to the use of TRAF2TR and TRAF2TD and variants thereof used to effectively block the activation of several transcription factors induced by TNF α, such as NFκB and AP-1. TRAF2TR and TRAF2TD, and variants thereof, are useful for inhibiting TNF α signal transduction in pathological conditions associated with overproduction of TNF α and overactivation of NFκB dependent genes. Various diseases appear to be associated with TNF α regulated pathways and pathological reasons for these diseases may be associated with overproduction of TNF α or overactivation of NFκB dependent genes. The diseases can be treated using TRAF2TR and TRAF2TD proteins and variants thereof.

There is evidence that the inflammatory process is significantly involved in the pathological state of all major cardiovascular disease states, and if elevated TNF α levels are associated with this inflammatory process, various major cardiovascular disease states may be treated using the compositions and methods of the present invention. It is considered to be possible. Such diseases include cardiovascular disease states such as cardiac ischemia-reperfusion injury resulting from myocardial infarction, coronary artery bypass surgery, heart transplantation or ischemia-reperfusion injury in the CNS after a seizure; Progression and rupture of enhanced coronary atherosclerotic plaques; Expression and progression of congestive heart failure; And endothelial cell damage after angioplasty with balun. The invention can also be used to prevent apoptosis cell death of cardiomyocytes during heart failure or cardiac infarction and to prevent cardiomyocyte apoptosis.

By blocking TNF α receptor signaling, gene therapy approaches with TRAF2TR or TRAF2TD, or variants thereof, can be used to treat the disease. It is preferable to use TRAF2TD if it effectively inhibits the TNF α regulated pathway.

Similarly, by blocking TNF α receptor signaling, gene therapy with TRAF2TR, TRAF2TD or variants thereof can be used to treat any disease state in which TNF α is involved in the development. Such disease states include, but are not limited to Crohn's disease, psoriasis, rheumatoid arthritis, graft versus host disease, inflammatory bowel disease, non-insulin dependent diabetes mellitus and neurodegenerative diseases such as Parkinson's disease.

Alternatively, TRAF2TD can be used in a variety of assays to study the mechanism of the TRAF2 dependent signal transduction pathway.

Therapeutic Compositions and Dosages

All of the viral or nonviral vectors disclosed herein are preferably introduced in vivo in a pharmaceutically acceptable vehicle or carrier. The term "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically acceptable and that do not typically cause significant allergies or similar undesirable reactions, such as gastric peristalsis, dizziness, etc. when administered to a human. it means. Preferably, the term "pharmaceutically acceptable" as used herein means registered with the US Pharmacopoeia or other general pharmacopoeia recognized for animals, especially humans, or approved by the Federal or State Regulatory Authority. . The term "carrier" refers to a diluent, adjuvant, excipient or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including oils of petroleum, animal, plant or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or saline solution and aqueous dextrose and glycerol solutions are preferably used as carriers, in particular as carriers for injectable solvents. Suitable pharmaceutical carriers are described in E. W. Martin, Remington's Pharmaceutical Sciences ".

The present invention provides a method of treatment comprising administering an effective amount of a composition of the present invention to a human or other animal.

Effective amounts may vary with age, type and severity of symptoms to be treated, weight, desired duration of treatment, method of administration and other variables. Effective amounts are determined by a doctor or other qualified medical practitioner.

Polypeptides according to the invention are believed to be most widely used at dosages of from about 0.01 mg / kg body weight to about 100 mg / kg body weight per day. Preferred dosages are from about 0.1 mg / kg body weight to about 50 mg / kg body weight, more preferably from about 1 mg / kg body weight to about 10 mg / kg body weight.

Recombinant virus according to the present invention is generally administered in a dosage form of about 10 ⁴ to about 10 ¹⁴ pfu. In the case of AAV and adenovirus, it is preferred to use a dose of about 10 ⁶ to about 10 ¹¹ pfu. The term “pfu” (“plaque forming unit”) corresponds to the infectivity of a virion suspension and is determined by measuring the number of plaques formed by infecting a suitable cell culture. Techniques for measuring the pfu titer of viral solutions are well known in the art.

The following examples illustrate the invention.

Example 1 Isolation of cDNA Encoding TRAF2TR

MRNA from human osteosarcoma cell line (OSA1) is used to isolate TRAF2TR, a TRAF2 splice variant, during RT PCR cloning of full length TRAF2 ( Current Protocols in Molecular Biology , 1996). While using the primers to produce full length TRAF2 cDNA, smaller PCR products are observed. The fragments are cut and cloned respectively. The 5 'primer used for RT PCR is ATG GCT GCA GCT AGC GTG ACC and the 3' primer is TTA TAG CCC TGT CAG GTC CAC.

This smaller clone (TRAF2TR) was sequenced and identified in-frame deletions of the codons encoding amino acid residues 123-201. 4A and 4B compare nucleic acid and amino acid sequences of full length TRAF2 and TRAF2TR.

As a source of TRAF2TR mRNA, various tissues in the body have been identified and used to isolate TRAF2TR mRNA according to the protocol described above. To measure the tissue distribution of TRAF2TR, RT-PCR is performed using a pair of primers located outside of the spliced region. The primer on the 5 'side of the deletion portion is GGT GGA GAG GAG CCT GCC GGC CG, and the primer on the 3' side of the deletion portion is GGC AGC CGA TGG CGT GGA ATC TG, and cDNA uses oligo-dT primer derived from total RNA of various tissues. To create it. cDNA is separated by agar electrophoresis and transferred to nitrocellulose. Hybridization is performed using specific probes from the TRAF2 sequence adjacent to the 5 'end of the spliced region (5'-GAT GCA CCT GGA AGG GGA CCC TGA AAT-3'). The probe recognizes non-spliced and spliced variants of TRAF2. The expected size of the non-spliced variant (TRAF2FL) is 373 bp and the expected size of the splice variant (TRAF2TR) is 136 bp. The lane analytes of FIG. 5 are as follows: 1-control TRAF2-FL cDNA; 2-control TRAF2 spliced variant cDNA; 3-Jurkat; 4-HeLa cell line; 5-thymus; 6-placental; 7-thymus; 8-spleen; 9-ovary.

Western blot analysis of lysates from various cell sources did not clearly detect the presence of truncated TRAF2 variants at the level of expressed protein. High levels of expression and production of proteins appear to be regulated or developmentally or temporally limited by indefinite mechanisms in a cell type dependent manner (eg, B cell maturation in the embryonic center).

The deletion in the splice variant TRAF2TR has an open reading frame, and the 5 'splice boundary is equivalent to the standard splice donor sequence. The deletion removes amino acids residues 123-201 of WT TRAF2 comprising the C-terminus of zinc finger domain 1 and all of zinc fingers 2 and 3 as well as the N-terminal residue of zinc finger 4 (FIG. 1). This deletion more than likely destroys the function of the zinc finger region and has been reported to have a dominantly negative effect on TNF α-induced NFκB activation [Takeuchi et al., J. Biol. Chem. 271 (33), 19935-19942 (1996).

Example 2 Preparation of TRAF2TD

Deletion of the 87 amino acids at the N-amino terminus of TRAF2 (shown ring finger domain, see FIG. 1) is known to produce proteins that act as dominant inhibitors (dominantly negative) of TNF α dependent NFκB activation. Takeuchi et al., J. Biol. Chem. 271 (33), 19935-19942 (1996). In order to determine if the N-terminal deletion affects the activity of TRAF2TR, a construct is produced showing TRAF2TR from which the 87 amino acids (residues 1 to 87) are deleted from the N-terminus of the protein. To prepare such a variant of TRAF2TR, TRAF2TR cDNA was used as a template and nucleotides 262 to 280 of the TRAF2 full-length coding sequence (ATGAGTTCGGCCTTCCCAGAT; wherein the ATG codon was included to make the translation initiation site) and 3 as the 5 'primer. PCR is performed using TTA TAG CCC TGT CAG GTC CAC as a primer. The resulting construct starts at amino acid 88 of full length TRAF2 and includes 123-201 amino acids of TRAF2TR to provide a “double deletion” construct. The construct is identified by DNA sequencing and cloned into mammalian expression vector (pcDNA3, Invitrogen).

Example 3 Transfection of HeLa Cells with TRAF2TR

To determine the effect of TRAF2TR on NFκB activation, truncated TRAF2, as well as full length (FL) TRAF2, were constructed using N-Myc affinity tags in mammalian expression vectors (pcDNA3, Invitrogen). To prepare an N-myc fusion construct, a 5 'PCR primer containing the Myc tag sequence (MetGluGlnLysLeuIleSerGluGluAspLeuAsn) followed by the first 20 nucleotides of TRAF2 cDNA with starting methionine is synthesized: 5'-ATG GAG CAG AAA TTG ATT TCC GAG GAA GAT CTG AAC ATG GCT GCA GCT AGC GTG AC-3 '. The 3 'PCR primer sequence is as follows: 5'-TTAGAGCCCTGTCAGGTCCACAA-3'. Using standard techniques, the PCR products are purified and cloned into pcDNA3 vectors.

HeLa cells are transfected with the pcDNA3-myc TRAF2 construct using LipoFectamine (BRL, Gibco) reagents according to the protocol provided by this reagent supplier. Briefly, 4 ml of lipofectamine is mixed with 1 mg of DNA in 1 ml of serum-free DMEM (BRL) medium, with 3 × 10 ⁵ cells in a 5% CO ₂ incubator at 37 ° C. in a 60 mm Petri dish. Incubate overnight. After 24 hours of transfection, cells are washed with phosphate buffered saline and lysed in 200 ml of SDS electrophoretic sample buffer (SIGMA). 10 ml of lysate is separated by electrophoresis and western blotting on nitrocellulose membrane. Immunostaining and detection of ECL (AMERSHAM) should be done according to the antibody supplier's recommendations.

Anti-Myc antibodies (BABCO, Berkeley) detect proteins of expected size in HeLa cells transfected with pcDNA-TRAF2FL and pcDNA-TRAF2TR (FIG. 6).

The results presented in FIG. 6 show immunodetection of Myc fused TRAF2FL and TRAF2TR in transfected HeLa cells. HeLa cells are transfected with expression constructs of TRAF-FL and TRAF-TR using lipofectamine (Gibco BFL) and cells are lysed with SDS loading buffer after 24 hours. Myc-fusion proteins are detected using anti-myc Ab and ECL detection systems. Lanes: 1-pcDNA3 vector; 2-myc-TRAF2FL; 3-myc-TRAF2TR.

Example 4-NFκB Reporter System

To determine the effect of TRAF2TR, TRAF2TD or variants of these polypeptides on NFκB regulatory gene expression, the NFκB reporter system is described in Takeuchi et al., J. Biol. Chem. 271 (33), 19935-19942 (1996), can be used as the system described and described. The NFκB reporter activation system can be used with suitable cells, such as 293 cells, COS7 cells or HeLa cells. The cells can be transfected with various TRAF2 constructs, full length TRAF2, TRAF2TR and TRAF2TD, using the lipofectamine protocol described in Example 3. The effect of the various TRAF2 fragments on the activation of cotransfected NFκB reporters can then be compared to identify the most effective inhibitor species. As an example, 293 cells are transfected with TRAF2 constructs comprising full length TRAF2, TRAF2TR and TRAF2TD, as well as variants of TRAF2TR and TRAF2TD, and the level of NFκB reporter activity is monitored in the presence or absence of TNF α. Full length TRAF2 is expected to activate cotransfected NFκB reporters, while other TRAF2 constructs are expected to block TNF α mediated activation of the NFκB reporter to varying degrees.

Example 5 In Vitro Treatment Methods

In vitro gene therapy methods are known in the art and generally comprise four steps. As a first step, cells of the indicated type are collected from the patient to be treated. As a second step, the gene of interest is transfected into isolated cells. As a third step, cells which have absorbed the gene of interest are selected and grown. As a fourth step, the cells are injected or transplanted back into the patient to express the gene of interest and treat the disease.

In a first step of the ex vivo treatment method using the invention, the cells are obtained from a patient. Cells are selected based on a number of factors, mainly the particular disease to be treated. Blocking the activation of such target cells will inhibit the expression of proinflammatory cytokines and other proteins associated with inflammatory processes associated with signs of cardiovascular disease states.

In a second step, TRAF2TR or TRAF2TD, or variant cDNA, is cloned into a suitable mammalian expression vector. For transfection protocols including lipofection, expression vectors such as pcDNA3 can be used. In a preferred embodiment, TRAF2TD is cloned into pcDNA3 or another suitable mammalian expression vector, provided that enhanced ability to inhibit TNF α binding effects is provided. Promoters used in the expression vectors are selected according to the preferred method for controlling the type and expression level of the cells to be transfected. Suitable promoters can be selected from among the promoters described above. For gene therapy of heart disease, 2MHC [Palermo et al., Circ. Res., 78 (3), 504-9 (1996)], MLC2 (Sani, Nature, 314: 283-286 (1985)), CARP [Jeyaseelan et al., J. Biol. Chem., 272 (36), 22800-8 (1997)] are inserted upstream of TRAF2TD cDNA. An expression vector containing TRAF2TD cDNA is then used for liposome mediated transfection using lipofectamine (BRL, Gibco) reagents according to the supplier's protocol. For transfection protocols using viral transduction, a recombinant adenovirus vector system is used as the second step of the ex vivo treatment protocol. In this protocol, TRAF2TD cDNA is cloned into an adenovirus expression vector, for example adeno-quest pQBI-AdBN / NB (QUANTUM Biotechnologies Inc.). Next, an adenovirus delivery vector containing TRAF2TD cDNA is used with adenovirus virus DNA to cotransfect 293 cells. After plaque purification and positive clone selection, the recombinant adenovirus containing TRAF2TD cDNA is amplified and then purified by dialysis with conventional CsCl step gradient purification followed by appropriate buffer such as phosphate buffered saline. Next, the recombinant adenovirus is used to transfect the target cells ex vivo.

Recombinant virus according to the present invention is administered in a dosage form of about 10 ⁴ to about 10 ¹⁴ pfu. For AAV and adenoviruses it is preferred to use a dose of about 10 ⁶ to about 10 ¹¹ pfu. The term “pfu” (“plaque forming unit”) corresponds to the infectivity of a virion suspension and is determined by infecting a suitable cell culture and measuring the number of plaques formed. Techniques for determining the pfu titer of viral solutions are well known in the art.

In a third step, the transfected cells obtained by lipofection or recombinant adenovirus infection are selected from the transfected cells and grown in culture. The selection can be made in a variety of ways, including using drug markers to survive and grow only cells that have taken up the expression vector.

In the fourth step, the transfected cells are infused or implanted directly into the patient near the tissue to be treated or where the TRAF2TD cDNA product can be released into the bloodstream and interact with cells activated by TNF α binding. Delivery means include, but are not limited to, direct injection, delivery by catheter, infusion pump or stent.

Example 6-In Vivo Treatment Methods

In vivo treatment methods can utilize a variety of different viral vectors, including adenovirus vectors, adeno-associated viral vectors, and retroviral vectors. In a preferred in vivo treatment method of the invention, an adenovirus system is used to introduce TRAF2TR or TRAF2TD cDNA into host cells. If the TRAF2TD cDNA has a relatively high ability to inhibit TNF α binding activation, it is preferable to use TRAF2TD cDNA in the adenovirus expression vector. In this method, the TRAF2TD cDNA is cloned into an adenovirus delivery vector, such as adeno-quest pQBI-AdBN / NB (QUANTUM Biotechnologies Inc.) or another adenovirus vector from the foregoing. The promoter used in the expression vector is selected according to the preferred method of controlling the type and expression level of the cells to be transfected. Suitable promoters can be selected from among the promoters described above.

Next, an adenovirus delivery vector containing the desired promoter and TRAF2TD cDNA is cotransfected into 293 cells with adenovirus virus DNA. After plaque purification and positive clone selection, the recombinant adenovirus containing TRAF2TD cDNA is amplified and then purified by dialysis with conventional CsCl step gradient purification followed by appropriate buffer such as phosphate buffered saline.

Prior to transfecting cells in vivo, viral particle titers are measured and in vitro experiments are performed to determine the level of protein expression and tissue culture infectious dose (TCID50). Recombinant virus according to the present invention is administered in a dosage form between about 10 ⁴ and about 10 ¹⁴ pfu. For AAV and adenoviruses it is preferred to use a dose of about 10 ⁶ to about 10 ¹¹ pfu. The term “pfu” (“plaque forming unit”) corresponds to the infectivity of a virion suspension and is determined by measuring the number of plaques formed by infecting a suitable cell culture. Techniques for measuring the pfu titer of viral solutions are well known in the art.

The recombinant adenovirus is then used to infect the patient at a dose of about 10 ⁶ to about 10 ¹¹ pfu. Recombinant adenovirus can be introduced by inhalation, infusion, surgical implantation, direct injection or delivery by catheter, infusion pump or stent.

Claims (32)

DNA sequence encoding TRAF2TR comprising the sequence as shown in FIG. 2A. DNA sequence encoding TRAF2TD comprising the sequence as shown in FIG. 3A. The DNA sequence of claim 1, which is cDNA. The DNA sequence of claim 2, which is cDNA. An isolated and purified TRAF2TR polypeptide capable of inhibiting the TNF α regulated pathway and comprising an amino acid sequence as shown in FIG. 2B. TRAF2TD polypeptide capable of inhibiting the TNF a regulated pathway and comprising the amino acid sequence set forth in FIG. 3B. A method of inhibiting a TNF a regulated pathway in a patient, comprising introducing a composition into the patient's body that can inhibit the TNF a regulated pathway. 8. The method of claim 7, wherein the composition is an expression vector capable of expressing a TRAF2TR polypeptide. 8. The method of claim 7, wherein the composition is an expression vector capable of expressing a TRAF2TD polypeptide. 8. The method of claim 7, wherein the composition comprises a TRAF2TR polypeptide and a pharmaceutically acceptable carrier. 8. The method of claim 7, wherein the composition comprises a TRAF2TD polypeptide and a pharmaceutically acceptable carrier. A method of inhibiting a disease associated with overproduction of TNF α, comprising introducing into the body of a patient a composition capable of inhibiting the TNF α regulated pathway. The method of claim 12, wherein the composition comprises an expression vector capable of expressing TRAF2TR. The method of claim 12, wherein the composition comprises an expression vector capable of expressing TRAF2TD. The method of claim 12, wherein the composition comprises a TRAF2TR polypeptide and a pharmaceutically acceptable carrier. The method of claim 12, wherein the composition comprises a TRAF2TD polypeptide and a pharmaceutically acceptable carrier. A method of inhibiting TNF α pathological conditions associated with overactivation of nuclear factor κB (NFκB) dependent genes, including introducing a composition capable of inhibiting TNF α regulated pathways into a patient. The method of claim 17, wherein the composition is an expression vector capable of expressing TRAF2TR. The method of claim 17, wherein the composition is an expression vector capable of expressing TRAF2TD. The method of claim 17, wherein the composition comprises a TRAF2TR polypeptide and a pharmaceutically acceptable carrier. The method of claim 17, wherein the composition comprises a TRAF2TD polypeptide and a pharmaceutically acceptable carrier. A method of inhibiting the inflammatory process associated with TNF α, comprising introducing into the body of a patient a composition capable of inhibiting the TNF α regulated pathway. The method of claim 22, wherein the composition is an expression vector capable of expressing TRAF2TR. The method of claim 22, wherein the composition is an expression vector capable of expressing TRAF2TD. The method of claim 22, wherein the composition comprises a TRAF2TR polypeptide and a pharmaceutically acceptable carrier. The method of claim 22, wherein the composition comprises a TRAF2TD polypeptide and a pharmaceutically acceptable carrier. The method of claim 22, wherein the inflammatory process associated with TNF α is selected from the group consisting of Crohn's disease, psoriasis, rheumatoid arthritis, graft versus host disease, inflammatory bowel disease, non-insulin dependent diabetes mellitus, and neurodegenerative disease. The method of claim 22, wherein the inflammatory process associated with TNF α is cardiovascular disease. 29. The method of claim 28, wherein the cardiovascular disease comprises (a) cardiac ischemia-reperfusion injury resulting from myocardial infarction, coronary artery bypass surgery, cardiac transplantation or seizure ischemia-reperfusion injury after seizures; (b) progression and rupture of deeper coronary atherosclerotic plaques; (c) expression and progression of congestive heart failure; (d) endothelial cell damage following angioplasty with a balloon; And (e) apoptosis cell death of cardiomyocytes. DNA sequence encoding TRAF2TR / 2TD variant. The DNA sequence of claim 30 comprising conservative amino acid substitutions. TRAF2TR / 2TD variant polypeptides capable of inhibiting TNF α regulated pathways.