CN101037709A - Corn authenticity detecting kit and its detecting method - Google Patents
Corn authenticity detecting kit and its detecting method Download PDFInfo
- Publication number
- CN101037709A CN101037709A CN 200610065734 CN200610065734A CN101037709A CN 101037709 A CN101037709 A CN 101037709A CN 200610065734 CN200610065734 CN 200610065734 CN 200610065734 A CN200610065734 A CN 200610065734A CN 101037709 A CN101037709 A CN 101037709A
- Authority
- CN
- China
- Prior art keywords
- upstream
- downstream
- primer
- pcr
- primers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention provides testing reagent case for corn factuality and testing method therefor, belongs to plant breed factuality determining technique field, which for solving problem of primers distributing unevenly on chromosome and unfiting for need of combining multi PCR in present testing reagent case for corn factuality, through particular design, providing a reagent case containing twenty primers which distributing evenly and reasonably according with requirement of multi PCR reaction, thereby the primer assembly has high amplifying efficiency, shorts greatly testing time and advance testing level.
Description
Technical field
The present invention relates to a kind of test kit that detects the plant variety verity, more particularly, the present invention relates to a kind of test kit that detects corn authenticity.
Background technology
Corn authenticity identifies it is the foundation of corn seed quality control and the protection of kind power.Along with increasing year by year of corn variety in the present society, dragons and fishes jumbled together, and phenomenon is serious, uses conventional form to differentiate and is difficult to judge accurately, causes the difficulty of management.
Corn authenticity is identified still based on identification of morphology, with reference to isozyme and seed storage protein electrophoretogram both at home and abroad at present.The performance of morphological characters is affected by environment bigger, identifies that workload is big, the cycle long, is subject to seasonal restrictions; Isozyme and seed storage protein polymorphism are abundant inadequately, and isozyme exists tissue and organ specificity in addition, and the strict coherence request of drawing materials is so qualification result is stable inadequately.The inventor has studied and has utilized SSR (simple sequence repeat) primer to detecting the authentication method of corn authenticity, Chinese patent application has been proposed No. 200310117180.3 in 2003, in this test kit (after this also it being called existing test kit sometimes), 20 primers have been comprised, these 20 primers are primer sequences of directly downloading from network, do not carry out special design, therefore their greatest problem of existing are that selected primer is not equally distributed on karyomit(e), cause to have in various degree chain between some primer sites; Next is the requirement that primer is not suitable for making up multiplex PCR (Multiplex Polymerase Chain Reaction, multiple polymerase chain reaction), and these primers need individually carry out pcr amplification and detection, cause workload big.
Summary of the invention
The present invention is not suitable for making up the problem of the requirement of multiplex PCR for the primer skewness on karyomit(e) that solves existing corn authenticity detection kit and exist is even, primer screening through a large amount of provides a kind of test kit and detection method thereof that comprises 20 primers.
Concrete technical scheme is as follows.
Corn authenticity detection kit provided by the invention comprises following 20 primers:
| Numbering | The primer title | Chromosome position | Sequence |
| P01 | bnlg439w1 | 1.03 | Upstream: AGTTGACATCGCCATCTTGGTGAC downstream: GAACAAGCCCTTAGCGGGTTGTC |
| P02 | bnlg125k1 | 2.02 | Upstream: GGGTACGGTTTCGTTTCCTTTGG downstream: TGCATCTAACAGCATCCCTTGAGC |
| P03 | bnlg1754k5 | 3.09 | Upstream: CGGTTGCCATCTTGTTCACG downstream: ACCACGCTGTCGTAGTGCTCC |
| P04 | phi072k4 | 4.00 | Upstream: GCTCGTCTCCTCCAGGTCAGG downstream: CGTTGCCCATACATCATGCCTC |
| P05 | umc1705k2 | 5.03 | Upstream: GTTCAGCCCCGTCCGTCTC downstream: CACGTACGGCAATGCAGACAAG |
| P06 | bnlg161k6 | 6.00 | Upstream: CAGCTCCTGCTTATTGCTTTCGTC downstream: ACTCGTCATCAACTCTGCCCATC |
| P07 | bnlg1792k8 | 7.02 | Upstream: CCCCAAAATTCCAGGTGCC downstream: CCTCGTCGTCTCCTACCAGAATG |
| P08 | umc1741k8 | 8.03 | Upstream: GCGCTTGGCATCTCCATGTATATC downstream: CGAACCGACCATCATCTTTCCC |
| P09 | phi065k9 | 9.03 | Upstream: CGCCTTCAAGAATATCCTTGTGCC downstream: GGACCCAGACCAGGTTCCACC |
| P10 | bnlg1450k2 | 10.07 | Upstream: GCACTGAAATCTCCCATCATGTACG downstream: TACAGCTCTTCTTGGCATCGTCG |
| P11 | bnlg2331k6 | 1.11 | Upstream: GGGGCAGCAAGAACAGGAGG downstream: TTTGCACAGGAATGCCAAGAGC |
| P12 | mmc0191k5 | 2.07 | Upstream: GGGCAGCTCCTGAGAATGGTG downstream: CCGATCAAGATTTCCGCAAGG |
| P13 | umc2105k3 | 3.00 | Upstream: GAAGGGCAATGAATAGAGCCATGAG downstream: ATGGACTCTGTGCGACTTGTACCG |
| P14 | bnlg2291k4 | 4.06 | Upstream: GCACACCCGTAGTAGCTGAGACTTG downstream: CATAACCTTGCCTCCCAAACCC |
| P15 | umc1225k5 | 5.08 | Upstream: TGAGGGAGGACGACGCAGC downstream: AGAAGGGTGGGTGGGTGGG |
| P16 | phi299852k1 | 6.07 | Upstream: AGCAAGCAGTAGGTGGAGGAAGG downstream: GGCTACGGCAGAGGAGGAGAC |
| P17 | phi116k3 | 7.06 | Upstream: AACTCCCTGCCGGGACTCCT downstream: CGGCCATGGATGGGATACAAATAC |
| P18 | phi080k7 | 8.03 | Upstream: GAACCAGTGAACCACCCGATGC downstream: GTACGGTACGTTGCGGACGAGG |
| P19 | bnlg1191k6 | 9.07 | Upstream: GCCGATCCAGAGGGTCCATTC downstream: CCTTGCATTGGGAGCGACTTTC |
| P20 | umc2163w3 | 10.04 | Upstream: CAAGCGGGAATCTGAATCTTTGTTC downstream: CTTCGTACCATCTTCCCTACTTCATTGC |
The preparation method of primer used in the present invention does not have special requirement, can adopt known ordinary method synthetic.According to above-mentioned primer sequence provided by the invention, can utilize dna synthesizer synthetic.If oneself has equipment, can oneself be synthetic, if do not have, can directly allow primer Synesis Company, synthetic by primer Synesis Company, that is to say, as long as know primer sequence, just can obtain this primer.If adopt plain polypropylene acrylamide gel electrophoresis, then get final product according to primer sequence is directly synthetic.If adopt capillary electrophoresis five colors fluorescence detecting system, then be required to be four kinds of different fluorescence on every cover primer sequence mark.
It is by a large amount of primer screenings is determined that corn variety verity of the present invention detects with SSR combination of primers test kit, in order to guarantee that primer is evenly distributed on maize chromosome, respectively choose a polymorphism height, the banding pattern primer sites of statistics easily, 20 primer sites of accumulative total at chromosomal long-armed, the galianconism of 10 of corns.In order to make it can carry out multi-PRC reaction, on the basis of former primer sites, utilize primer-design software according to unified amplification condition redesign, P01-P10 (choosing 1 primer on every karyomit(e)) is as the first cover combination, and P11-20 (choosing 1 primer on every karyomit(e)) is as the second cover combination.
Use corn authenticity detection kit of the present invention to detect corn variety following three kinds of methods are arranged.
First kind of corn authenticity detection method is to adopt capillary electrophoresis in conjunction with multicolored fluorescence detecting system, wherein, at first above-mentioned 20 primers are divided into 2 cover combinations, P01-P10 is as the first cover combination, P11-20 is as the second cover combination, and every cover combination is according to 4 kinds of different fluorescence of following triple or double composite marking.
10 re-constituteds of first cover:
| Triple | Triple | Two-fold | Two-fold | ||||
| Primer | The amplification scope | Primer | The amplification scope | Primer | The amplification scope | Primer | The amplification scope |
| phi065k9 | 399-419 | bnlg1754k5 | 421-465 | bnlg439w1 | 319-385 | phi072k4 | 413-433 |
| bnlg161k6 | 263-319 | bnlg1450k2 | 288-376 | bnlg1792k8 | 192-250 | bnlg125k1 | 219-327 |
| umc1705k2 | 144-201 | umc1741k8 | 141-203 | ||||
The second cover combination:
| Triple | Triple | Two-fold | Two-fold | ||||
| Primer | The amplification scope | Primer | The amplification scope | Primer | The amplification scope | Primer | The amplification scope |
| bnlg2331k6 | 394-440 | bnlg2291k4 | 370-410 | umc1225k1 | 265-310 | umc2163w3 | 290-365 |
| umc2105k3 | 286-330 | phi080k7 | 279-325 | phi299852k1 | 137-200 | mmc0191k5 | 130-213 |
| bnlg1191k6 | 154-215 | phi116k3 | 168-215 | ||||
Adopt ordinary method to carry out DNA extraction then, 10 heavy PCR reactions are carried out in every cover combination, reaction product uses capillary electrophoresis to detect in conjunction with multicolored fluorescence detecting system, and wherein primer takies 4 kinds of different colours fluorescence altogether, and mark takies a kind of color fluorescence in the molecular weight.
Second kind of corn authenticity detection method is to adopt denaturing polyacrylamide gel electrophoresis to dye detection in conjunction with silver, wherein, at first above-mentioned 20 primers is divided into following 8 cover combinations:
The 1st cover combination, 3 heavy PCR:
Primer: Phi065k9, Bnlg161k6, Umc1705k2
Amplification scope: 399-419,263-319,144-201
The 2nd cover combination, 3 heavy PCR:
Primer: Bnlg1754k5, Bnlg1450k2, Umc1741k8
Amplification scope: 421-465,288-376,141-203
The 3rd cover combination, 2 heavy PCR:
Primer: Bnlg439w1, Bnlg1792k8
Amplification scope: 319-385,192-250
The 4th cover combination, 2 heavy PCR:
Primer: Phi072k4, Bnlg125k1
Amplification scope: 413-433,219-327
The 5th cover combination, 3 heavy PCR:
Primer: bnlg2331k6, umc2105k3, bnlg1191k6
Amplification scope: 394-440,286-330,154-215
The 6th cover combination, 3 heavy PCR:
Primer: bnlg2291k4, phi080k7, phi116k3
Amplification scope: 370-410,279-325,168-215
The 7th cover combination, 2 heavy PCR:
Primer: umc1225k5, phi299852k1
Amplification scope: 265-310,137-200
The 8th cover combination, 2 heavy PCR:
Primer: umc2163w3, mmc0191k5
Amplification scope: 290-365,130-213
Adopt ordinary method to carry out DNA extraction then, the combination of every cover is increased triplely or double respectively according to above-mentioned, re-uses denaturing polyacrylamide gel electrophoresis and dyes detection in conjunction with silver, finishes the detection of all 20 primers.
See that from above-mentioned detection method first kind of detection method only needs 2 PCR to react the detection that just can finish all 20 primers, second kind of detection method only needs 8 PCR reactions just can finish detection.
The third method is to use 2～20 primers in the described corn authenticity detection kit of claim 1, adopt ordinary method to carry out DNA extraction, use that single primer carries out pcr amplification respectively in the described corn authenticity detection kit, adopt conventional detection technique to detect then, can access conclusion and just stop to detect.The decision method of Miao Shuing can be seen from behind, if use two or more primer just can judge that two kinds are different, so just can stop testing process, directly obtains conclusion.The situation that it is different varietiess that this method is particularly suitable for two kinds of kinds of preliminary judgement can be saved material resources like this.
DNA extraction in the detection method of the present invention can obtain quality according to the whole bag of tricks that provides in the prior art and meet the DNA that pcr amplification requires.Test materials can be seed, seedling, blade etc.
Pcr amplification method in the detection method of the present invention is specific as follows:
Reaction system: the reaction solution volume is 20 μ l, and the component preparation should meet the regulation of following table.
Table 1PCR amplification reaction system
| Reactive component | Original content | Final concentration | Reaction volume (μ l) |
| ddH 2O | - | Constant volume to 20 | |
| 10×Buffer | 10× | 1× | 2 |
| MgCl 2 | 25mmol/l | 2.5mmol/l | 2 |
| dNTP | 2.5mmol/l each | 0.15mmol/l each | 1.2 |
| The Tag enzyme | 5U/μl | 1U | 0.2 |
| Primer * | 20μmol/l | 0.25μmol/l each | 0.25 * (10,3 or 2) |
| DNA | 20ng/ul | 40ng | 2 |
Remarks: the primer amount is each primer 0.25 μ l, if adopt 10 heavy PCR, promptly the primer total amount of Jia Ruing is 2.5 μ l; In like manner, if adopt 3 heavy PCR, promptly the primer total amount of Jia Ruing is 0.75 μ l, adopts 2 heavy PCR, and promptly the primer total amount of Jia Ruing is 0.5 μ l.
Response procedures: 94 ℃ of pre-sex change 5min, 1 circulation; 94 ℃ of sex change 40s, 68 ℃ of annealing 35s, 72 ℃ are extended 45s, totally 30 circulations; 72 ℃ are extended 5min, 4 ℃ of preservations.
Electrophoresis detection in the detection method of the present invention is recommended following two kinds of electrophoretic detections
(1) denaturing polyacrylamide gel electrophoresis dyes detection in conjunction with silver;
(2) the capillary electrophoresis combined with fluorescent detects.
Two kinds of detection method gained results are all effective, and concrete grammar is as follows.
(1) denaturing polyacrylamide gel electrophoresis dyes detection in conjunction with silver
1 cleans sheet glass
Be stained with dish detergent with sheet glass scrub repeatedly with tap water, distilled water is cleaned twice, 95% ethanol and is cleaned twice, drying.On long slab, coat the affine silane working fluid of 0.5ml, be coated with 0.5ml on the short slab of band groove and peel off the silane working fluid.Prevent in the operating process that two sheet glass from polluting mutually.
2 assembling electrophoresis plates
Treat to assemble electrophoresis plate behind the sheet glass finish-drying, and use the water level gauge leveling.
3 encapsulatings
In 100ml 4.5%PAGE glue, add TEMED and each 100 μ l of 25% ammonium persulphate, rapidly encapsulating behind the mixing.Treat that glue flow to the bottom, gently the insertion comb on top makes its polymerization at least more than the 1h.Prevent bubble in the encapsulating process.
4 prerunnings
In anodal groove (following groove), add 1 * tbe buffer liquid 600ml, be preheated to 1 * tbe buffer liquid 600ml of 65 ℃, extract comb in negative pole groove (going up groove) adding.The permanent power prerunning of 90W 10-20min.
5 sex change
In 20 μ l PCR samples, add 4 μ l, 6 * sample loading buffer, behind the mixing, operation sex change program on the PCR instrument: 95 ℃ of sex change 5min, more than 4 ℃ of cooling 10min.
6 electrophoresis
With pipettor pressure-vaccum loading slot, remove bubble and impurity, insert the sample comb.Each well is clicked and entered 5 μ l samples.The permanent power electrophoresis of 80W arrives the middle part (about 40min) of offset plate to the index strip (dimethylbenzene green grass or young crops) on top.After electrophoresis finishes, carefully separate two sheet glass, gel can be close on the long slab.
7 silver medals dye
7.1 it is fixing: as to rock 3min in the stationary liquid gently;
7.2 rinsing: the quick rinsing of distilled water 1 time is no more than 10s;
7.3 dyeing: 5min dyes in the staining fluid;
7.4 rinsing: the quick rinsing of distilled water, the time is no more than 10s;
7.5 develop: rock gently in the developing solution to the appearance of band line;
7.6 photographic fixing: photographic fixing 5min in the stationary liquid;
7.7 rinsing: distilled water rinsing 1min.
(2) capillary electrophoresis is in conjunction with multicolored fluoroscopic examination
1 sex change
With 30 times of PCR product dilutions, in each hole of 96 orifice plates, add the PCR product behind the mark and 1 μ L dilution in 9 μ L methane amides, the 0.1 μ L respectively, operation sex change program on the PCR instrument: 95 ℃ of sex change 5min, more than 4 ℃ of cooling 10min.
2 electrophoresis
After the sample panel taking-up, 3000rpm is short to throw away the heart, carries out capillary electrophoresis on genetic analyzer (as the ABI3730XL genetic analyzer).Prerunning 15KV, 2min; Electrophoresis 15KV, 20min.
3 data collection analyses
Collect raw data with data collection software, raw data is analyzed with fragment analysis software.
Use corn variety verity detection kit detection of the present invention and judge that the standard of corn variety verity is as follows:
Detect with primer of the present invention, obtain the dna fingerprint bands of a spectrum data of kind to be measured, utilize the dna fingerprint bands of a spectrum data in 20 sites to carry out comparing between kind 20 primer sites:
A) product difference between species number of sites 〉=2 are judged to be different varieties;
B) product difference between species number of sites=1 is judged to be close kind;
C) product difference between species number of sites=0 is judged to be and doubts same kind.
Can see that from above-mentioned criterion when product difference between species number of sites 〉=2 occurring, just can stop detection, providing the detection corn is the conclusion of different varieties.
Corn authenticity detection kit of the present invention is compared with existing corn authenticity detection kit has significant beneficial effect.
At first incompatible from a whole set of primer sets, it has following characteristics:
(1) from the distribution of primer on karyomit(e), existing combination of primers has been chosen 3～4 primer sites at the 3rd, 4,6,8 karyomit(e)s, and some site drops on the phase near field, as having chosen 3 primer sites in the 6th chromosomal 6.00 zones; On the 2nd karyomit(e), chosen 2 primer sites, but at a distance of nearer; On the 1st, 7,9,10 karyomit(e)s, only chosen a primer sites respectively; On the 5th karyomit(e), do not choose primer sites, therefore do not follow equally distributed principle on maize chromosome, cause between some primer chain tightr.And combination of primers of the present invention is chosen 2 primers (long-armed and galianconism is chosen 1 primer) on 10 chromosomal every karyomit(e)s of corn, has guaranteed that primer is evenly distributed on maize chromosome.
(2) from the ability of combination of primers multiplex PCR, in the existing combination of primers, the amplified production size except bnlg125 more than 300bp, bnlg439 and bnlg162 more than 200bp outside, other 17 primer extension product sizes are all about 100-200bp, the product magnitude range of different primers has intersection, can't make up multiplex PCR; And the TM value of different primers differs bigger, minimum only 66.6, the highest reaches 82.1, and the varying in size of primer TM value, the suitableeest annealing temperature difference selected for use of primer amplification program then, therefore, this cover primer is not suitable for carrying out the multiplex PCR amplification according to unified program, can only carry out single primer amplification, so, finish the detection of all 20 primers and need carry out 20 PCR reactions.And all primers of combination of primers of the present invention all are to design according to unified condition, the TM value of primer is all between the 73-76 degree, the amplified production size is the particular design that requires according to the combination multiplex PCR, the influence amplification does not significantly interact between the primer in the same set of combination, if adopt capillary electrophoresis four look fluorescence detecting systems, every group of different fluorescence of (triple or double) mark, then every cover combination all can be formed 10 heavy PCR, only need 2 PCR to react the detection that just can finish all 20 primers, if adopt plain polypropylene acrylamide gel electrophoresis detection system, it is triple and double then can to increase respectively by the array mode that provides, and only needs 8 PCR reactions just can finish detection.Therefore, improve greatly than existing combination of primers amplification efficiency.
Table 2 primer of the present invention
| Numbering | The primer title | Bin * | TM value (U; L; P) ** | The product size |
| P01 | bnlg439w1 | 1.03 | 75；75.4；85.6 | 319-385 |
| P02 | bnlg125K1 | 2.02 | 74.9；75.1；83.9 | 219-327 |
| P03 | bnlg1754K5 | 3.09 | 73.3；73.4；89.8 | 421-465 |
| P04 | phi072K4 | 4.00 | 74.3；75.2；83.7 | 413-433 |
| P05 | umc1705K2 | 5.03 | 73.9；74.4；85.5 | 144-201 |
| P06 | bnlg161k6 | 6.00 | 73.8；73.3；83.0 | 263-319 |
| P07 | bnlg1792K8 | 7.02 | 73.1；72.8；84.4 | 192-250 |
| P08 | umc1741K8 | 8.03 | 74.2；75.3；80.4 | 141-203 |
| P09 | phi065K9 | 9.03 | 75.2；75.7；88.4 | 399-419 |
| P10 | bnlg1450K2 | 10.07 | 74.2；74.3；81.0 | 288-376 |
| P11 | bnlg2331K6 | 1.11 | 75.0；75.1；85.5 | 394-440 |
| P12 | mmc0191K5 | 2.07 | 75.0；74.4；83.4 | 130-213 |
| P13 | umc2105K3 | 3.00 | 74.4；75.1；85.9 | 286-330 |
| P14 | bnlg2291K4 | 4.06 | 73.8；74.1；87.8 | 370-410 |
| P15 | umc1225K5 | 5.08 | 75.9；75.1；87.1 | 265-310 |
| P16 | phi299852K1 | 6.07 | 73.5；73.2；90.0 | 137-200 |
| P17 | phi116K3 | 7.06 | 75.1；75.4；83.2 | 168-215 |
| P18 | phi080K7 | 8.03 | 75.5；75.3；90.5 | 279-325 |
| P19 | bnlg1191K6 | 9.07 | 75.7；75.6；86.1 | 154-215 |
| P20 | umc2163w3 | 10.04 | 74.4；75.0；84.8 | 290-365 |
Annotate:
*Bin represents the designation of chromosome zone;
*U, L, P represent the TM value of upstream primer sequence, downstream primer sequence, amplified production sequence respectively.
The existing primer of table 3
| Numbering | The primer title | bin | TM value (U; L; P) | The product size |
| S1 | bnlG439 | 1.03 | 79.2；77.9；82.2 | 201-253 |
| S2 | phi402893 | 2.00 | 68.5；68.0；90.5 | 221-265 |
| S14 | bnlg125 | 2.02 | 66.6；67.9；83.7 | 323-422 |
| S19 | phi053 | 3.05 | 71.3；72.9；84.3 | 193-224 |
| S3 | bnlg197 | 3.06 | 71.7；71.8；82.5 | 99-122 |
| S16 | umc1399 | 3.07 | 71.6；71.3；84.7 | 103-135 |
| S17 | phi072 | 4.00 | 78.6；78；78 | 142-162 |
| S4 | umc1294 | 4.02 | 72.0；72.0；91.4 | 137-165 |
| S17 | umc1559 | 4.08 | 71.2；70.3；80.8 | 133-159 |
| S11 | bnlg589 | 4.10 | 82.1；80.3；82.7 | 160-188 |
| S5 | bnlg238 | 6.00 | 76.0；74.9；82.5 | 150-202 |
| S6 | phi126 | 6.00 | 69.5；71.0；82.6 | 136-190 |
| S7 | bnlg161 | 6.00 | 70.6；70.4；82.7 | 129-185 |
| S18 | phi077 | 6.01 | 75.9；73.4；86.2 | 135-170 |
| S12 | phi116 | 7.06 | 75.6；76.7；83.2 | 170-217 |
| S20 | bnlg162 | 8.05 | 71.0；72.4；82.3 | 214-266 |
| S9 | bnlg240 | 8.05 | 71.2；66.6；80.7 | 120-166 |
| S8 | phi080 | 8.08 | 75.9；75.1；87.9 | 157-198 |
| S13 | phi065 | 9.03 | 70.8；72；83.6 | 132-153 |
| S10 | umc1196 | 10.07 | 71.9；71.3；87.9 | 155-186 |
From single primer, it has following characteristics then:
(1) it is identical in combination of primers of the present invention and existing combination of primers the pleomorphism site of 7 primer amplifications being arranged, be bnlg439, bnlg125, phi072, bnlg161, phi116, phi080, phi065, but existing primer is the online disclosed primer sequence of directly downloading, these primers are not to design according to identical amplification condition, the TM value differs bigger between the different primers, as bnlg125 upstream and downstream sequence TM value is 66.6 and 67.9, and bnlg589 upstream and downstream sequence TM value is 82.1 and 80.3, except phi080, other 6 primer TM values are all less than designing in 73-76 degree scope, and primer of the present invention is all according to identical amplification condition design, the TM value all designs in 73-76 degree scope, in addition, and to phi080, although the TM value of existing primer adheres to specification, but in order to make up the needs of multiplex PCR, the amplified production size of existing primer does not meet design requirements, therefore, this primer is also redesigned, make its amplified production size within the limits prescribed.
(2) it is different in combination of primers of the present invention and existing combination of primers the pleomorphism site of 13 primer amplifications being arranged, why do not select the site identical for use with former combination of primers, major cause is that the existing distribution of primer on karyomit(e) is undesirable, promptly on every chromosomal long-armed and galianconism, choose a primer, secondly, even the distribution of some primer on karyomit(e) meets the requirements in existing that cover combination of primers, also from the design of primers difficulty or ease, the polymorphism height, after comparing, the aspects such as requirement that whether meet multiplex PCR combination selected new primer sites again for use, as umc1196 on long-armed 10.07 positions of corn the 10th karyomit(e), but on this primer sites, bnlg1450k2 is than umc1196 polymorphism height, and the easier primer of designing regulation product size comes, therefore, replaced umc1196 with bnlg1450.
Embodiment
Further explain the present invention in the mode of embodiment below, but the present invention is not limited to the following example.
Embodiment 1
Identify that censorship unknown sample (code name A) is known kind 108 (the code name B) of agricultural university, operating process is as follows:
(1) DNA extraction
The standard model of unknown sample A and known kind B is respectively extracted 5 parts of individual DNA, extracting method is as follows: the embryo that strips the simple grain dry seeds, put into the 1.5ml centrifuge tube, grind after adding 100 μ l chloroforms, add 300 μ l DNA extraction liquid (1mol/l Tris-HCl 50ml, 0.5mol/lEDTA 50ml, 5mol/l NaCl 50ml, SDS 7.5g is settled to 500ml), behind the mixing in the centrifugal 2min of 10000rpm, suct clear liquid, it is added in the 1.5ml centrifuge tube that 300 μ l Virahols and 300 μ l NaCl solution are housed in advance, treats that DNA chooses after agglomerating, after 70% washing with alcohol, add 200 μ l TE damping fluid (1mol/l Tris-HCl 5ml, 0.5mol/l EDTA 1ml, add HCl and transfer pH to 8.0, be settled to 500ml), treat that fully the dissolving back is standby.
(2) the SSR primer is synthetic
Adopt fluorescently-labeled primer.At four kinds of different fluorescence FAM, VIC, NED, PET of 5 ' end difference mark of upstream primer, the fluorescent primer sequence is synthetic by American AB I company.
Table 4 fluorescent primer sequence
| Numbering | The primer title | Sequence |
| P01 | bnlg439w1 | Upstream: 5 ' NED-AGTTGACATCGCCATCTTGGTGAC downstream: GAACAAGCCCTTAGCGGGTTGTC |
| P02 | bnlg125k1 | Upstream: 5 ' PET-GGGTACGGTTTCGTTTCCTTTGG downstream: TGCATCTAACAGCATCCCTTGAGC |
| P03 | bnlg1754k5 | Upstream: 5 ' VIC-CGGTTGCCATCTTGTTCACG downstream: ACCACGCTGTCGTAGTGCTCC |
| P04 | phi072k4 | Upstream: 5 ' PET-GCTCGTCTCCTCCAGGTCAGG downstream: CGTTGCCCATACATCATGCCTC |
| P05 | umc1705k2 | Upstream: 5 ' FAM-GTTCAGCCCCGTCCGTCTC downstream: CACGTACGGCAATGCAGACAAG |
| P06 | bnlg161k6 | Upstream: 5 ' FAM-CAGCTCCTGCTTATTGCTTTCGTC downstream: ACTCGTCATCAACTCTGCCCATC |
| P07 | bnlg1792k8 | Upstream: 5 ' NED-CCCCAAAATTCCAGGTGCC downstream: CCTCGTCGTCTCCTACCAGAATG |
| P08 | umc1741k8 | Upstream: 5 ' VIC-GCGCTTGGCATCTCCATGTATATC downstream: CGAACCGACCATCATCTTTCCC |
| P09 | phi065k9 | Upstream: 5 ' FAM-CGCCTTCAAGAATATCCTTGTGCC downstream: GGACCCAGACCAGGTTCCACC |
| P10 | bnlg1450k2 | Upstream: 5 ' VIC-GCACTGAAATCTCCCATCATGTACG downstream: TACAGCTCTTCTTGGCATCGTCG |
| P11 | bnlg2331k6 | Upstream: 5 ' FAM-GGGGCAGCAAGAACAGGAGG downstream: TTTGCACAGGAATGCCAAGAGC |
| P12 | mmc0191k5 | Upstream: 5 ' PET-GGGCAGCTCCTGAGAATGGTG downstream: CCGATCAAGATTTCCGCAAGG |
| P13 | umc2105k3 | Upstream: 5 ' FAM-GAAGGGCAATGAATAGAGCCATGAG downstream: ATGGACTCTGTGCGACTTGTACCG |
| P14 | bnlg2291k4 | Upstream: 5 ' VIC-GCACACCCGTAGTAGCTGAGACTTG downstream: CATAACCTTGCCTCCCAAACCC |
| P15 | umc1225k5 | Upstream: 5 ' NED-TGAGGGAGGACGACGCAGC downstream: AGAAGGGTGGGTGGGTGGG |
| P16 | phi299852k 1 | Upstream: 5 ' NED-AGCAAGCAGTAGGTGGAGGAAGG downstream: GGCTACGGCAGAGGAGGAGAC |
| P17 | phi116k3 | Upstream: 5 ' VIC-AACTCCCTGCCGGGACTCCT downstream: CGGCCATGGATGGGATACAAATAC |
Table 4 (continuing) fluorescent primer sequence
| P18 | phi080k7 | Upstream: 5 ' VIC-GAACCAGTGAACCACCCGATGC downstream: GTACGGTACGTTGCGGACGAGG |
| P19 | bnlg1191k6 | Upstream: 5 ' FAM-GCCGATCCAGAGGGTCCATTC downstream: CCTTGCATTGGGAGCGACTTTC |
| P20 | umc2163w3 | Upstream: 5 ' PET-CAAGCGGGAATCTGAATCTTTGTTC downstream: CTTCGTACCATCTTCCCTACTTCATTGC |
(3) pcr amplification
The SSR primer that utilization provides above carries out 10 heavy pcr amplifications to the DNA sample, 10 heavy PCR array modes to forming two 10 heavy PCR reaction systems:
10 re-constituteds of first cover:
| Triple: mark fluorescent FAM | Triple: mark fluorescent VIC | Two-fold: mark fluorescent NED | Two-fold: mark fluorescent PET | ||||
| Primer | The amplification scope | Primer | The amplification scope | Primer | The amplification scope | Primer | The amplification scope |
| Phi065k9 | 399-419 | BNLg1754k5 | 421-465 | Bnlg439w1 | 319-385 | Phi072k4 | 413-433 |
| Bnlg161k6 | 263-319 | Bnlg1450k2 | 288-376 | Bnlg1792k8 | 192-250 | Bnlg125k1 | 219-327 |
| Umc1705k2 | 144-201 | Ume1741k8 | 141-203 | ||||
10 re-constituteds of second cover:
| Triple: mark fluorescent FAM | Triple: mark fluorescent VIC | Two-fold: mark fluorescent NED | Two-fold: mark fluorescent PET | ||||
| Primer | The amplification scope | Primer | The amplification scope | Primer | The amplification scope | Primer | The amplification scope |
| bnlg2331k6 | 394-440 | bnlg2291k4 | 370-410 | umc1225k5 | 265-310 | umc2163w3 | 290-365 |
| umc2105k3 | 286-330 | phi080k7 | 279-325 | phi299852k1 | 137-200 | mmc0191k5 | 130-213 |
| bnlg1191k6 | 154-215 | phi116k3 | 168-215 | ||||
The heavy pcr amplification reaction system of table 510
| Reactive component | Original content | Final concentration | Reaction volume (μ l) |
| ddH 2O | - | 10.1 | |
| 10×Buffer | 10× | 1× | 2 |
| MgCl 2 | 25mmol/l | 2.5mmol/l | 2 |
| dNTP | 2.5mmol/l each | 0.15mmol/l each | 1.2 |
| The Tag enzyme | 5U/μl | 1U | 0.2 |
| Primer (10) | 20μmol/l | 0.25μmol/l each | 2.5 |
| DNA | 20ng/ul | 40ng | 2 |
Response procedures: 94 ℃ of pre-sex change 5min, a circulation; 94 ℃ of sex change 40s, 60 ℃ of annealing 35s, 72 ℃ are extended 45s, totally 35 circulations.(MJ Research, Watertown carry out on MA) pcr amplification at the PTC-100PCR instrument.
(4) capillary electrophoresis detects
Sex change:, in each hole of 96 orifice plates, add the PCR product behind the mark and 1 μ L dilution in 9 μ L methane amides, the 0.1 μ L respectively, operation sex change program on the PCR instrument with 30 times of PCR product dilutions: 95 ℃ of sex change 5min, more than 4 ℃ of cooling 10min.
Capillary electrophoresis: after the sample panel taking-up, 3000rpm is short to throw away the heart, carries out capillary electrophoresis on the ABI3730XL genetic analyzer.Prerunning 15KV, 2min; Electrophoresis 15KV, 20min.Data collection is analyzed: collect raw data with data collection software, with fragment analysis software raw data is analyzed.
(5) detected result
Detect with this cover primer, obtain the dna fingerprint bands of a spectrum data of kind to be measured 20 primer sites, utilize the dna fingerprint bands of a spectrum data in 20 sites to carry out comparing between kind, find that two kinds are in bnlg439w1, phi065k9, bnlg125k1 totally 3 primer sites fingerprint differences, according to criterion, identify that submitted sample A is not an agricultural university 108.
Embodiment 2
Identify that censorship unknown sample (code name A) is yellow four (the code name B) early of known kind, operating process is as follows:
(1) DNA extraction
The standard model of unknown sample A and known kind B is respectively extracted 5 parts of individual DNA, extracting method is as follows: the embryo that strips the simple grain dry seeds, put into the 1.5ml centrifuge tube, grind after adding 100 μ l chloroforms, add 300 μ l DNA extraction liquid (1mol/l Tris-HCl 50ml, 0.5mol/lEDTA 50ml, 5mol/l NaCl 50ml, SDS 7.5g is settled to 500ml), behind the mixing in the centrifugal 2min of 10000rpm, suct clear liquid, it is added in the 1.5ml centrifuge tube that 300 μ l Virahols and 300 μ l NaCl solution are housed in advance, treats that DNA chooses after agglomerating, after 70% washing with alcohol, add 200 μ l TE damping fluid (1mol/l Tris-HCl 5ml, 0.5mol/l EDTA 1ml, add HCl and transfer pH to 8.0, be settled to 500ml), treat that fully the dissolving back is standby.
(2) the synthetic employing of SSR primer primer of the present invention.Primer sequence is synthetic by Shanghai Ying Jun company.
Table 6 primer sequence of the present invention
| Numbering | The primer title | Chromosome position | Sequence |
| P01 | bnlg439w1 | 1.03 | Upstream: AGTTGACATCGCCATCTTGGTGAC downstream: GAACAAGCCCTTAGCGGGTTGTC |
| P02 | bnlg125k1 | 2.02 | Upstream: GGGTACGGTTTCGTTTCCTTTGG downstream: TGCATCTAACAGCATCCCTTGAGC |
| P03 | bnlg1754k5 | 3.09 | Upstream: CGGTTGCCATCTTGTTCACG downstream: ACCACGCTGTCGTAGTGCTCC |
| P04 | phi072k4 | 4.00 | Upstream: GCTCGTCTCCTCCAGGTCAGG downstream: CGTTGCCCATACATCATGCCTC |
| P05 | umc1705k2 | 5.03 | Upstream: GTTCAGCCCCGTCCGTCTC downstream: CACGTACGGCAATGCAGACAAG |
| P06 | bnlg161k6 | 6.00 | Upstream: CAGCTCCTGCTTATTGCTTTCGTC downstream: ACTCGTCATCAACTCTGCCCATC |
| P07 | bnlg1792k8 | 7.02 | Upstream: CCCCAAAATTCCAGGTGCC downstream: CCTCGTCGTCTCCTACCAGAATG |
| P08 | umc1741k8 | 8.03 | Upstream: GCGCTTGGCATCTCCATGTATATC downstream: CGAACCGACCATCATCTTTCCC |
| P09 | phi065k9 | 9.03 | Upstream: CGCCTTCAAGAATATCCTTGTGCC downstream: GGACCCAGACCAGGTTCCACC |
| P10 | bnlg1450k2 | 10.07 | Upstream: GCACTGAAATCTCCCATCATGTACG downstream: TACAGCTCTTCTTGGCATCGTCG |
| P11 | bnlg2331k6 | 1.11 | Upstream: GGGGCAGCAAGAACAGGAGG downstream: TTTGCACAGGAATGCCAAGAGC |
| P12 | mmc0191k5 | 2.07 | Upstream: GGGCAGCTCCTGAGAATGGTG downstream: CCGATCAAGATTTCCGCAAGG |
| P13 | umc2105k3 | 3.00 | Upstream: GAAGGGCAATGAATAGAGCCATGAG downstream: ATGGACTCTGTGCGACTTGTACCG |
| P14 | bnlg2291k4 | 4.06 | Upstream: GCACACCCGTAGTAGCTGAGACTTG downstream: CATAACCTTGCCTCCCAAACCC |
| P15 | umc1225k5 | 5.08 | Upstream: TGAGGGAGGACGACGCAGC downstream: AGAAGGGTGGGTGGGTGGG |
| P16 | phi299852k1 | 6.07 | Upstream: AGCAAGCAGTAGGTGGAGGAAGG downstream: GGCTACGGCAGAGGAGGAGAC |
| P17 | phi116k3 | 7.06 | Upstream: AACTCCCTGCCGGGACTCCT downstream: CGGCCATGGATGGGATACAAATAC |
| P18 | phi080k7 | 8.03 | Upstream: GAACCAGTGAACCACCCGATGC downstream: GTACGGTACGTTGCGGACGAGG |
| P19 | bnlg1191k6 | 9.07 | Upstream: GCCGATCCAGAGGGTCCATTC downstream: CCTTGCATTGGGAGCGACTTTC |
| P20 | umc2163w3 | 10.04 | Upstream: CAAGCGGGAATCTGAATCTTTGTTC downstream: CTTCGTACCATCTTCCCTACTTCATTGC |
(3) pcr amplification
The SSR primer that utilization provides above carries out the multiplex PCR amplification to the DNA sample, the multiplex PCR array mode to forming 8 double or triple PCR reaction systems:
The 1st cover combination, 3 heavy PCR:
Primer: Phi065k9, Bnlg161k6, Umc1705k2
Amplification scope: 399-419,263-319,144-201
The 2nd cover combination, 3 heavy PCR:
Primer: Bnlg1754k5, Bnlg1450k2, Umc1741k8
Amplification scope: 421-465,288-376,141-203
The 3rd cover combination, 2 heavy PCR:
Primer: Bnlg439w1, Bnlg1792k8
Amplification scope: 319-385,192-250
The 4th cover combination, 2 heavy PCR:
Primer: Phi072k4, Bnlg125k1
Amplification scope: 413-433,219-327
The 5th cover combination, 3 heavy PCR:
Primer: bnlg2331k6, umc2105k3, bnlg1191k6
Amplification scope: 394-440,286-330,154-215
The 6th cover combination, 3 heavy PCR:
Primer: bnlg2291k4, phi080k7, phi116k3
Amplification scope: 370-410,279-325,168-215
The 7th cover combination, 2 heavy PCR:
Primer: umc1225k5, phi299852k1
Amplification scope: 265-310,137-200
The 8th cover combination, 2 heavy PCR:
Primer: umc2163w3, mmc0191k5
Amplification scope: 290-365,130-213
Table 5 multiplex PCR amplification reaction system
| Reactive component | Original content | Final concentration | Reaction volume (μ l) |
| ddH 2O | - | 12.1 or 11.85 | |
| 10×Buffer | 10× | 1× | 2 |
| MgCl 2 | 25mmol/l | 2.5mmol/l | 2 |
| dNTP | 2.5mmol/l each | 0.15mmol/l each | 1.2 |
| The Tag enzyme | 5U/μl | 1U | 0.2 |
| Primer (2 or 3) | 20μmol/l | 0.25μmol/l each | 0.5 or 0.75 |
| DNA | 20ng/ul | 40ng | 2 |
Response procedures: 94 ℃ of pre-sex change 5min, a circulation; 94 ℃ of sex change 40s, 60 ℃ of annealing 35s, 72 ℃ are extended 45s, totally 35 circulations.(MJ Research, Watertown carry out on MA) pcr amplification at the PTC-100PCR instrument.
(4) denaturing polyacrylamide gel electrophoresis dyes detection in conjunction with silver
1 cleans sheet glass
Be stained with dish detergent with sheet glass scrub repeatedly with tap water, distilled water is cleaned twice, 95% ethanol and is cleaned twice, drying.On long slab, coat the affine silane working fluid of 0.5ml, be coated with 0.5ml on the short slab of band groove and peel off the silane working fluid.Prevent in the operating process that two sheet glass from polluting mutually.
2 assembling electrophoresis plates
Treat to assemble electrophoresis plate behind the sheet glass finish-drying, and use the water level gauge leveling.
3 encapsulatings
In 100ml 4.5%PAGE glue, add TEMED and each 100 μ l of 25% ammonium persulphate, rapidly encapsulating behind the mixing.Treat that glue flow to the bottom, gently the insertion comb on top makes its polymerization at least more than the 1h.Prevent bubble in the encapsulating process.
4 prerunnings
In anodal groove (following groove), add 1 * tbe buffer liquid 600ml, be preheated to 1 * tbe buffer liquid 600ml of 65 ℃, extract comb in negative pole groove (going up groove) adding.The permanent power prerunning of 90W 10-20min.
5 sex change
In 20 μ l PCR samples, add 4 μ l, 6 * sample loading buffer, behind the mixing, operation sex change program on the PCR instrument: 95 ℃ of sex change 5min, more than 4 ℃ of cooling 10min.
6 electrophoresis
With pipettor pressure-vaccum loading slot, remove bubble and impurity, insert the sample comb.Each well is clicked and entered 5 μ l samples.The permanent power electrophoresis of 80W arrives the middle part (about 40min) of offset plate to the index strip (dimethylbenzene green grass or young crops) on top.After electrophoresis finishes, carefully separate two sheet glass, gel can be close on the long slab.
7 silver medals dye
7.1 it is fixing: as to rock 3min in the stationary liquid gently;
7.2 rinsing: the quick rinsing of distilled water 1 time is no more than 10s;
7.3 dyeing: 5min dyes in the staining fluid;
7.4 rinsing: the quick rinsing of distilled water, the time is no more than 10s;
7.5 develop: rock gently in the developing solution to the appearance of band line;
7.6 photographic fixing: photographic fixing 5min in the stationary liquid;
7.7 rinsing: distilled water rinsing 1min.
(5) detected result
Detect with this cover primer, obtain the dna fingerprint bands of a spectrum data of kind to be measured 20 primer sites, utilize the dna fingerprint bands of a spectrum data in 20 sites to carry out comparing between kind, find that two kinds are identical at all 20 site fingerprint bands of a spectrum, according to criterion, identify that submitted sample A and known kind are yellow early four for doubting same kind.
Claims (4)
1. a corn authenticity detection kit is characterized in that, it comprises following 20 primers:
Numbering The primer title Chromosome position Sequence
P01 bnlg439w1 1.03 Upstream: AGTTGACATCGCCATCTTGGTGAC downstream: GAACAAGCCCTTAGCGGGTTGTC
P02 bnlg125k1 2.02 Upstream: GGGTACGGTTTCGTTTCCTTTGG downstream: TGCATCTAACAGCATCCCTTGAGC
P03 bnlg1754k5 3.09 Upstream: CGGTTGCCATCTTGTTCACG downstream: ACCACGCTGTCGTAGTGCTCC
P04 phi072k4 4.00 Upstream: GCTCGTCTCCTCCAGGTCAGG downstream: CGTTGCCCATACATCATGCCTC
P05 umc1705k2 5.03 Upstream: GTTCAGCCCCGTCCGTCTC downstream: CACGTACGGCAATGCAGACAAG
P06 bnlg161k6 6.00 Upstream: CAGCTCCTGCTTATTGCTTTCGTC downstream: ACTCGTCATCAACTCTGCCCATC
P07 bnlg1792k8 7.02 Upstream: CCCCAAAATTCCAGGTGCC downstream: CCTCGTCGTCTCCTACCAGAATG
P08 umc1741k8 8.03 Upstream: GCGCTTGGCATCTCCATGTATATC downstream: CGAACCGACCATCATCTTTCCC
P09 phi065k9 9.03 Upstream: CGCCTTCAAGAATATCCTTGTGCC downstream: GGACCCAGACCAGGTTCCACC
P10 bnlg1450k2 10.07 Upstream: GCACTGAAATCTCCCATCATGTACG downstream: TACAGCTCTTCTTGGCATCGTCG
P11 bnlg2331k6 1.11 Upstream: GGGGCAGCAAGAACAGGAGG downstream: TTTGCACAGGAATGCCAAGAGC
P12 mmc0191k5 2.07 Upstream: GGGCAGCTCCTGAGAATGGTG downstream: CCGATCAAGATTTCCGCAAGG
P13 umc2105k3 3.00 Upstream: GAAGGGCAATGAATAGAGCCATGAG downstream: ATGGACTCTGTGCGACTTGTACCG
P14 bnlg2291k4 4.06 Upstream: GCACACCCGTAGTAGCTGAGACTTG downstream: CATAACCTTGCCTCCCAAACCC
P15 umc1225k5 5.08 Upstream: TGAGGGAGGACGACGCAGC downstream: AGAAGGGTGGGTGGGTGGG
P16 phi299852k1 6.07 Upstream: AGCAAGCAGTAGGTGGAGGAAGG downstream: GGCTACGGCAGAGGAGGAGAC
P17 phi116k3 7.06 Upstream: AACTCCCTGCCGGGACTCCT downstream: CGGCCATGGATGGGATACAAATAC
P18 phi080k7 8.03 Upstream: GAACCAGTGAACCACCCGATGC downstream: GTACGGTACGTTGCGGACGAGG
P19 bnlg1191k6 9.07 Upstream: GCCGATCCAGAGGGTCCATTC downstream: CCTTGCATTGGGAGCGACTTTC
P20 umc2163w3 10.04 Upstream: CAAGCGGGAATCTGAATCTTTGTTC downstream: CTTCGTACCATCTTCCCTACTTCATTGC
2. method that detects corn authenticity, it is characterized in that, it uses the described corn authenticity detection kit of claim 1, adopt capillary electrophoresis to detect in conjunction with multicolored fluorescence detecting system, wherein, at first above-mentioned 20 primers are divided into 2 cover combinations, P01-P10 is as the first cover combination, P11-20 is as the second cover combination, with every cover according to the different fluorescence of triple or double respectively mark, adopt ordinary method to carry out DNA extraction then, 10 heavy PCR are formed in every cover combination, and wherein primer takies 4 kinds of different colours fluorescence altogether, and mark takies a kind of color fluorescence in the molecular weight, every cover combination carrying out respectively PCR reaction re-uses capillary electrophoresis is finished all 20 primers in conjunction with multicolored fluoroscopic examination detection.
3. method that detects corn authenticity, it is characterized in that it uses the described corn authenticity detection kit of claim 1, adopt denaturing polyacrylamide gel electrophoresis to dye and detect in conjunction with silver, wherein, at first above-mentioned 20 primers are divided into following 8 cover combinations:
The 1st cover combination, 3 heavy PCR:
Primer: Phi065k9, Bnlg161k6, Umc1705k2
Amplification scope: 399-419,263-319,144-201
The 2nd cover combination, 3 heavy PCR:
Primer: Bnlg1754k5, Bnlg1450k2, Umc1741k8
Amplification scope: 421-465,288-376,141-203
The 3rd cover combination, 2 heavy PCR:
Primer: Bnlg439w1, Bnlg1792k8
Amplification scope: 319-385,192-250
The 4th cover combination, 2 heavy PCR:
Primer: Phi072k4, Bnlg125k1
Amplification scope: 413-433,219-327
The 5th cover combination, 3 heavy PCR:
Primer: bnlg2331k6, umc2105k3, bnlg1191k6
Amplification scope: 394-440,286-330,154-215
The 6th cover combination, 3 heavy PCR:
Primer: bnlg2291k4, phi080k7, phi116k3
Amplification scope: 370-410,279-325,168-215
The 7th cover combination, 2 heavy PCR:
Primer: umc1225k5, phi299852k1
Amplification scope: 265-310,137-200
The 8th cover combination, 2 heavy PCR:
Primer: umc2163w3, mmc0191k5
Amplification scope: 290-365,130-213
Adopt ordinary method to carry out DNA extraction then, the combination of every cover is carried out triple or double pcr amplification respectively according to above-mentioned, re-uses denaturing polyacrylamide gel electrophoresis and dyes detection in conjunction with silver, finishes the detection of all 20 primers.
4. method that detects corn authenticity, it is characterized in that, it uses 2～20 primers in the described corn authenticity detection kit of claim 1, adopt ordinary method to carry out DNA extraction, use that single primer carries out pcr amplification respectively in the described corn authenticity detection kit, adopt conventional detection technique to detect then, can access conclusion and just stop to detect.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200610065734A CN100587077C (en) | 2006-03-15 | 2006-03-15 | Corn authenticity detecting kit and its detecting method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200610065734A CN100587077C (en) | 2006-03-15 | 2006-03-15 | Corn authenticity detecting kit and its detecting method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101037709A true CN101037709A (en) | 2007-09-19 |
| CN100587077C CN100587077C (en) | 2010-02-03 |
Family
ID=38888881
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200610065734A Expired - Fee Related CN100587077C (en) | 2006-03-15 | 2006-03-15 | Corn authenticity detecting kit and its detecting method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100587077C (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103282519A (en) * | 2012-04-09 | 2013-09-04 | 北京市农林科学院 | Maize authentication detection and molecular breeding SNP chip - maizeSNP3072 and detection method thereof |
| CN103699812A (en) * | 2013-11-29 | 2014-04-02 | 北京市农林科学院 | Plant variety authenticity authenticating site screening method based on genetic algorithm |
| CN104532359A (en) * | 2014-12-10 | 2015-04-22 | 北京市农林科学院 | Core SNP sites combination maizeSNP384 for building of maize DNA fingerprint database and molecular identification of varieties |
| CN105132420A (en) * | 2015-09-23 | 2015-12-09 | 北京市农林科学院 | Complete set of primers for identifying purity of maize varieties and application |
| CN108760416A (en) * | 2018-03-29 | 2018-11-06 | 中国计量科学研究院 | Aflatoxin in Peanut byHigh B1 substrate standard substance preparation methods |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104351039B (en) * | 2014-09-24 | 2016-08-24 | 北京市农林科学院 | The single 38 three series mating hybrid seed production methods in capital |
| CN104351038B (en) * | 2014-09-24 | 2016-08-24 | 北京市农林科学院 | Capital section 665 three series mating hybrid seed production method |
| CN104521737B (en) * | 2014-12-08 | 2016-08-24 | 北京市农林科学院 | NK971 three series mating hybrid seed production method |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1546688A (en) * | 2003-12-05 | 2004-11-17 | 北京市农林科学院玉米研究中心 | Corn detection kit for distinguishing trueness from falsity |
-
2006
- 2006-03-15 CN CN200610065734A patent/CN100587077C/en not_active Expired - Fee Related
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103282519A (en) * | 2012-04-09 | 2013-09-04 | 北京市农林科学院 | Maize authentication detection and molecular breeding SNP chip - maizeSNP3072 and detection method thereof |
| WO2013152456A1 (en) * | 2012-04-09 | 2013-10-17 | 北京市农林科学院 | Maize authentication detection and molecular breeding snp chip - maizesnp3072 and detection method thereof |
| CN103282519B (en) * | 2012-04-09 | 2014-08-06 | 北京市农林科学院 | Maize authentication detection and molecular breeding SNP chip - maizeSNP3072 and detection method thereof |
| CN103699812A (en) * | 2013-11-29 | 2014-04-02 | 北京市农林科学院 | Plant variety authenticity authenticating site screening method based on genetic algorithm |
| CN103699812B (en) * | 2013-11-29 | 2016-08-17 | 北京市农林科学院 | Plant variety authenticity identification site selection method based on genetic algorithm |
| CN104532359A (en) * | 2014-12-10 | 2015-04-22 | 北京市农林科学院 | Core SNP sites combination maizeSNP384 for building of maize DNA fingerprint database and molecular identification of varieties |
| CN105132420A (en) * | 2015-09-23 | 2015-12-09 | 北京市农林科学院 | Complete set of primers for identifying purity of maize varieties and application |
| CN105132420B (en) * | 2015-09-23 | 2018-02-13 | 北京市农林科学院 | A kind of primer set for identifying corn variety purity and application |
| CN108760416A (en) * | 2018-03-29 | 2018-11-06 | 中国计量科学研究院 | Aflatoxin in Peanut byHigh B1 substrate standard substance preparation methods |
| CN108760416B (en) * | 2018-03-29 | 2021-03-23 | 中国计量科学研究院 | Preparation method of aflatoxin B1 matrix standard substance in peanuts |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100587077C (en) | 2010-02-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101037709A (en) | Corn authenticity detecting kit and its detecting method | |
| CN107604078B (en) | Molecular marker related to sheep wool fiber diameter character and specific primer pair and application thereof | |
| CN1665937A (en) | Methods and compositions for determining methylation profiles | |
| CN106191240A (en) | For identifying single nucleotide polymorphism site, primer, test kit and the application of Peach fruits epidermal hair character | |
| KR100956323B1 (en) | Multiplex real time pcr method for discrimination of rice cultivar | |
| CN106701950A (en) | Pea cold resistance correlated SSR primer compositions and application thereof | |
| CN1873019A (en) | Quick method for testing chain reaction of multiple reverse transcription polymerase of lily virus | |
| CN113832243B (en) | Core SNP marker for tea tree variety identification based on KASP technology development | |
| CN1464910A (en) | Method of amplifying dna chip signals | |
| CN113151567B (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
| CN1356553A (en) | Tissue microarray biochip | |
| CN1900314A (en) | Fluorescence labelling ABO gene typing method and its reagent kit | |
| CN1303223C (en) | Idiocratic amplification primer in medicolegal insect flies and authentication method | |
| CN1824801A (en) | Real-time fluorescent PCR testing primer, probe and immobilized kit for citrus ulcer bacteria and testing process thereof | |
| CN110453008B (en) | Molecular marker ZMM6206 closely linked with length and width major gene locus of sesame leaf and application thereof | |
| CN1294277C (en) | Methods for identifying animal hide and skin | |
| CN1769496A (en) | Method and apparatus for analyzing nucleic acid amplification | |
| CN1772922A (en) | Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit | |
| CN1557966A (en) | Internal standard gene suitable to exogenous gene detection such as transgene cotton and application thereof | |
| CN100351395C (en) | Norwalk virus expression detecting kit and its special primer and probe | |
| CN103243094A (en) | Single nucleotide polymorphism of black cattle PDSS1 gene and detection method thereof | |
| CN103667450B (en) | DNA chip suitable for high-throughput detection of transgenic products | |
| CN1289669C (en) | Design process for compound amplifying primer | |
| CN1678753A (en) | Methods and compositions for monitoring primer extension and polymorphism detection reactions | |
| CN101225439B (en) | Conserved sequence amplified polymorphic molecular marker and analytical method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100203 Termination date: 20160315 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |