CN104351038B - Capital section 665 three series mating hybrid seed production method - Google Patents
Capital section 665 three series mating hybrid seed production method Download PDFInfo
- Publication number
- CN104351038B CN104351038B CN201410495417.XA CN201410495417A CN104351038B CN 104351038 B CN104351038 B CN 104351038B CN 201410495417 A CN201410495417 A CN 201410495417A CN 104351038 B CN104351038 B CN 104351038B
- Authority
- CN
- China
- Prior art keywords
- capital
- male sterility
- sterile line
- colony
- individual plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of capital section 665 three series mating hybrid seed production method, a kind of method that the invention provides hybrid seeding, comprise the steps: with corn sterile line S capital 725 as sterile line, corn inbred line capital 725 is for keeping system, corn inbred line capital 92 is restorer, carry out the three series mating production of hybrid seeds, obtain cenospecies capital section 665.The experiment proves that, the present invention utilizes the sterile line S capital 725 of incubation, keep being capital 725 and restorer capital 92 carries out capital section 665 three series mating cross breeding seed, and sterilization cenospecies capital section 665 seed of preparation is essentially identical with capital section 665 seed that conventional producing method for seed produces on yield, resistance and other economical characters.
Description
Technical field
The present invention relates to biological technical field, particularly relate to a kind of capital section 665 three series mating hybrid seed production method.
Background technology
The seed selection of strong superior hybrid crosses and popularization are the important channels improving corn yield.Conventional producing method for seed is utilized to join
Cenospecies processed needs female parent is carried out artificial emasculation, not only expends substantial amounts of labour, increase seed production cost, and exist by
The potential risk of seed quality not in time, is the most thoroughly affected in emasculation.The male sterile line production of hybrid seeds is utilized to be to ensure that seed purity carries
A kind of effective ways of high corn yield.
As far back as the sixties in last century five, begin to the research to the corn sterilization production of hybrid seeds both at home and abroad.Cytoplasmatic male
Sterile owing to easily realizing the supporting of sterile line, holding system and restorer, it is the main Types utilized in corn breeding.Cytoplasm
Male sterile line can be divided into T, S and c-type.At the beginning of the sixties, T-shaped sterile line introduces China.Due to corn southern leaf blight " T microspecies "
Specialization infects, and the application of T-shaped sterile line is severely limited.The seventies, China breeder introduces c-type, S type from abroad
Sterile line.Although c-type sterile line sterility is more stable, thorough, but its restorer typically requires transformation again, cycle length and step
Loaded down with trivial details, cause this type sterile line to be difficult to popularization and application in practice.S type sterile line is a group maximum in 3 types, existing
Research proves that the G. eurycarpa materials such as prosperous 7-2 are its natural strong restorers.But the fertility of S type sterile line is because of the difference of genotype background
And have larger difference, under specific genetic background, fertility is highly stable.Male parent many genus Huang of domestic superior corn cenospecies changes
Kind of matter, therefore makes full use of S type sterile line and can save the transformation work of restorer, be realize quick sterilization production of hybrid seeds research and
The effective way of application.
Realize the mitochondrial DNA production of hybrid seeds it is crucial that sterile line, holding system and the seed selection of restorer.Seed selection
Sterile line most common method is backcross transformation method, i.e. makees nonrecurrent parent with stable sterile line, selects Elite inbred to make
Recurrent parent, carries out many for backcrossing, is bred as the excellent sterile self-mating system that sterility is stable, and former recurrent parent is this sterile line
Holding system.But just with traditional backcross transformation method, typically need to backcross 5-6 generation, and the transformation cycle is longer, has delayed sterile
Change seeding technique application on corn hybrid seed.Backcross transformation method is utilized to carry out the seed selection of restorer more multiple than sterile line
Miscellaneous, test cross to be carried out while backcrossing, using test cross result as the selection standard of restorer；Or utilize not in backcross transformation
Hatching cell matter provides the index character of fertility.Owing to Breeding Process is relatively cumbersome, not yet it is bred as or only part is extensive in restorer
In the case of renaturation, the hybrid seed of sterilization and normal hybridisation kind seed must be pressed proper proportion and blend use, this just gives and plants
Son produces has higher requirement in technology and management.Therefore, how to accelerate the seed selection speed of sterile line, simplify restorer
Breeding Process, be the current male sterility seeding technique problem of needing solution badly.
Summary of the invention
A kind of method that it is an object of the present invention to provide hybrid seeding.
The method that the present invention provides, comprises the steps: with corn sterile line S capital 725 as sterile line, corn inbred line capital
725 for keeping system, and corn inbred line capital 92 is restorer, carries out the three series mating production of hybrid seeds, obtains cenospecies capital section 665.
In said method, described sterile line S capital 725 is according to the method transformation comprised the steps:
A) female parent is done in corn sterile line S capital 724, and paternal hybrid is done in capital 725, obtains male sterility hybrid generation F1；
B) with described male sterility hybrid generation F1Backcross with capital 725 for female parent, obtain male sterility BC1For colony；
C) with described male sterility BC1Individual plant for colony continues to backcross with capital 725 for female parent, obtains the male of capital 725
Sterile line.
In said method, between step b) and step c), also including the step of Molecular Identification, described Molecular Identification is for using
SSR core primers umc2105k3, bnlg240k1 are to described male sterility BC1Carry out PCR amplification for colony's individual plant and realize molecule
Identify, choose AFLP system with as primer described capital 725PCR is expanded the male sterility BC that the collection of illustrative plates that obtains is identical1Generation
Individual plant；Owing to, in 40 SSR core primers, S capital 724 and capital 725 are only deposited on umc2105k3, bnlg240k1 these two pair primer
In difference, therefore have only to detect these two pair primer.
Described core primers umc2105k3 is by sequence in the single strand dna shown in sequence in sequence table 9 and sequence table
The primer pair of the single strand dna composition shown in 10；
Described core primers bnlg240k1 is by sequence in the single strand dna shown in sequence in sequence table 29 and sequence table
The primer pair of the single strand dna composition shown in row 30；
D) with male sterility BC1-A individual plant continues to backcross with capital 725 for female parent, obtains the male sterile line in capital 725.
In said method, in order to reduce workload, step b) and c) between Molecular Identification step before, also include as follows
The step of phenotypic evaluation, the step of described phenotypic evaluation is for choosing described male sterility BC1Consistent with capital 725 for phenotype in colony
BC1For individual plant.
Above-mentioned phenotype is consistent with described corn capital 725 is that phenotype is identical with corn capital 725 or close；Phenotype is specially
Plant height, Ear height, plant type, tassel branch number and/or Ear Characters etc..
The selection in the sterile line S capital 725 in said method is also that another of the present invention solves the technical problem that.
In said method, described sterile line S capital 724 is according to the method seed selection comprised the steps: with corn S type cell
Matter male sterile line MD32CGMCC No.8657 be donor, corn inbred line capital 724 be acceptor, carry out backcross transformation, obtain capital
The male sterile line S capital 724 of 724.
In said method, described in the number of times that backcrosses be 3 times.
In said method, described backcross transformation comprises the steps:
1) with male sterile line of maize MD32CGMCC No.8657 as donor, corn inbred line capital 724 as acceptor, hybridization,
Obtain male sterility hybrid generation F1；
2) with male sterility hybrid generation F1Backcross with capital 724 for female parent, obtain male sterility BC1For colony；
3) with male sterility BC1Continue to backcross with capital 724 for female parent for individual plant, obtain male sterility BC2For colony；
4) with male sterility BC2Continue to backcross with capital 724 for female parent for individual plant, obtain the male sterile line S capital in capital 724
724。
In said method, in step 2) and step 3) between, also include the step of following Molecular Identification: from described male not
Educate BC1For colony choosing with described corn capital 724 genetic similarty at the male sterility BC of 92.5-95%1For individual plant.
In said method, described from described male sterility BC1For colony choosing and described corn capital 724 genetic similarty
Male sterility BC at 92.5-95%1For the method for individual plant comprise the steps: with 40 to SSR core primers respectively to male
Sterile BC1Carry out PCR amplification for individual plant and corn inbred line capital 724, obtain SSR bands of a spectrum, by comparing BC1For individual plant and corn
The SSR collection of illustrative plates in self-mating system capital 724, calculates genetic similarty；
Described genetic similarty computing formula: [1-(difference number of alleles/(2 × compare total number of sites))] × 100%
Described difference number of alleles is to expand, with SSR core primers, the described male sterility BC obtained1Compose for individual plant SSR
The allele number that SSR bands of a spectrum banding pattern with banding pattern Yu described corn inbred line capital 724 is inconsistent；The total number of sites of described comparison
It is 40.
In above-mentioned 40 pairs of SSR core primers, the sequence of each primer is respectively in sequence table shown in sequence 1-80, is specifically shown in
The table 1 of embodiment.
In said method, in order to reduce workload, also comprise the steps: before described Molecular Identification from described male not
Educate BC1The male sterility BC consistent with described corn capital 724 for choosing phenotype in colony1For individual plant.
In said method, in step 3) and step 4) between, also include the step of following Molecular Identification: from described male not
Educate BC2For colony choosing with described corn capital 724 genetic similarty at the male sterility BC of 98.75%-100%2For individual plant.
Described from described male sterility BC2Exist with described corn inbred line capital 724 genetic similarty for colony chooses
The male sterility BC of 98.75%-100%2Method for individual plant comprises the steps: with primer A respectively to male sterility BC2Generation
Individual plant and corn inbred line capital 724 carry out PCR amplification, obtain SSR bands of a spectrum, by comparing BC2For individual plant and corn inbred line capital
The SSR collection of illustrative plates of 724, calculates genetic similarty；
Described primer A is BC2For the maternal BC that individual plant is corresponding1Dai Yujing 724 compares the SSR primer that amplification banding pattern is different；
Described genetic similarty computing formula: [1-(difference number of alleles/(2 × compare total number of sites))] × 100%
Described difference number of alleles is to expand, with primer A, the described male sterility BC obtained2For individual plant SSR bands of a spectrum banding pattern
The allele number inconsistent with the SSR bands of a spectrum banding pattern in described corn inbred line capital 724；
The total number of sites of described comparison is 40.
In said method, also comprise the steps: before described Molecular Identification from described male sterility BC2Select in colony
Take the male sterility BC that phenotype is consistent with described corn capital 7242For individual plant.
Above-mentioned phenotype is consistent with described corn capital 724 is that phenotype is identical with corn capital 724 or close；Phenotype is specially
Plant height, Ear height, plant type, tassel branch number and/or Ear Characters etc..
Another object of the present invention is to provide a kind of method cultivating sterile line S capital 725.
The method that the present invention provides, comprises the steps:
A) female parent is done in corn sterile line S capital 724, and paternal hybrid is done in capital 725, obtains male sterility hybrid generation F1；
B) with described male sterility hybrid generation F1Backcross with capital 725 for female parent, obtain male sterility BC1For colony；
C) with described male sterility BC1Individual plant for colony continues to backcross with capital 725 for female parent, obtains the male of capital 725
Sterile line；
Between step b) and step c), also specifically including the step of Molecular Identification, described Molecular Identification is for use SSR core
Primer umc2105k3, bnlg240k1 are to described male sterility BC1Carry out PCR amplification for colony's individual plant, choose AFLP system with
With same primer, described capital 725PCR is expanded the male sterility BC that the collection of illustrative plates obtained is identical1For individual plant；
Described core primers umc2105k3 is by sequence in the single strand dna shown in sequence in sequence table 9 and sequence table
The primer pair of the single strand dna composition shown in 10；
Described core primers bnlg240k1 is by sequence in the single strand dna shown in sequence in sequence table 29 and sequence table
The primer pair of the single strand dna composition shown in row 30；
Step b) and c) between Molecular Identification step before, also specifically include the step of following phenotypic evaluation, described table
The step that type is identified is for choosing described male sterility BC1For the BC that phenotype in colony is consistent with capital 7251For individual plant.
The application in hybrid seeding of the above-mentioned corn sterile line S capital 725 is also the scope of protection of the invention.
The experiment proves that, the present invention specifically has a following advantage:
1, the strong restorer that material is S type cytoplasmic male sterile line, capital section 665 male parent capital 92 are changed due to Huangs such as prosperous 7-2
Replant matter for Huang, therefore select capital 92 to have the most restorative S type sterile line donor as maternal capital 725 sterile line transformation,
Save the tedious work of seed selection male parent restorer；
2, selecting the acquired sterile line S capital 724 nearer with maternal capital 725 affiliation is donor, binding molecule mark
Note assisted Selection technology realizes rapid transfer, and two generations that only backcrossed can obtain corn sterile line S capital 725, has coordinate force high, anti-
Property is good, dehydration is fast, unit weight advantages of higher；
3, the S type sterile line MD32 sterility selected is stable, pollen abortion is thorough, male at the corn hybrid seed reported
Sterilization production of hybrid seeds research has no use；
In a word, the present invention utilizes the sterile line S capital 725 of incubation, keeps being capital 725 and restorer capital 92 carries out capital section 665
Three series mating cross breeding seed, sterilization cenospecies capital section 665 seed of preparation on yield, resistance and other economical characters with
Capital section 665 seed that conventional producing method for seed produces is essentially identical, and save maternal artificial emasculation in the conventional production of hybrid seeds time and
Cost, eliminate due to emasculation not in time, affect the potential risk of seed quality.
Detailed description of the invention
Experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
Embodiment 1, the seed selection in male sterile line S capital 724
One, the determination of sterile line donor MD32 cytoplasmic male sterility type
1, corn sterile line MD32
Corn sterile line MD32 Breeding Process: utilize the colony of X system (based on X1132) built to carry out " tall and big tight " choosing
System, therefrom selecting excellent S5 height generation system and draw outward cenospecies building new choosing is basic population.Self progeny find sterile
Strain, tassel flower pesticide does not exposes, and selects to pollinate it in pairs with sisters' strain that head progeny row phenotype is close.Filial generation all shows
The most sterile, plant phenotype also tends to basically identical.Then it is male sterile line of maize MD32 by this material designation.
Corn sterile line MD32 sterility is thorough: flower pesticide does not exposes；
Corn sterile line MD32 sterility is stable: under multiple genetic background, and sterility performance is thoroughly；
Corn sterile line MD32 Comprehensive Traits is excellent: seed bud gesture is vigorous, and power of emerging is strong, seedling leaf sheath look purple, blade
Roomy, leaf look dark green, and plant type half is compact, fruit ear cartridge type, grain type half Hard grain type, and comprehensive resistance is good.
It is common that corn sterile line MD32 is preserved in China Committee for Culture Collection of Microorganisms on December 25th, 2013
CGMCC, address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Chinese Academy of Sciences's microbe research (are called for short in microorganism center
Institute, postcode 100101), preserving number is CGMCC No.8657, and this plant Classification And Nomenclature is corn (Zea mays).
2, the determination of sterile line MD32 cytoplasmic male sterility type
The DNA of extraction corn sterile line MD32 seedling, as template, carries out PCR amplification with the primer such as table 1 below, is expanded
Volume increase thing on Agarose gel, 90V electrophoresis 1 hour 30 minutes.Corn MD32 cytoplasmic sterility is differentiated according to amplified fragments collection of illustrative plates
Type.
As a result, when utilizing C, T-shaped primer that the DNA of MD32 carries out PCR amplification, amplified production all it is not detected by；Utilize S type
When it is detected by primer, PCR primer clip size is 885bp.It is thus determined that MD32 is S type cytoplasmic male sterile line.
Table 1 is the primer identifying kytoplasm type
| Kytoplasm type | Primer sequence |
| C-1 | TGAAAGGGTGGTGGAATA |
| C-2 | GAGCCAAAGTAATGAGAAAA |
| S-1 | GATGCTATGCTAAGCGAGAT |
| S-2 | CCGCTAACCCACTCTTCT |
| T-1 | GTCGTGTCCTGGTAGCCT |
| T-2 | CCTCCTTCATTCCGTTGT |
Two, the seed selection in male sterile line of maize S capital 724
1, male sterility hybrid generation F1The acquisition in generation
In the First Year summer, do donor, capital 724 (Beijing's agricultural and forest science with male sterile line of maize MD32 (nonrecurrent parent)
Institute's corn research center, kind power application notification number be CNA007811E) (recurrent parent) do acceptor hybridization assemble F1Generation, results
F1The seed in generation.
Winter in the same year Hainan first generation, plants F1The seed in generation, obtains 127 strain F1For milpa.
127 strain F1Not exposing for milpa flower pesticide, sterility performance is thoroughly.
2, backcross a BC1The acquisition in generation
1) backcross
With F1Do female parent for plant, continue to backcross with recurrent parent capital 724, gather in the crops BC1Seed for colony.
Winter in the same year Hainan second generation, plants BC1For the seed of colony, obtain BC1For colony.
BC1Not exposing for colony's flower pesticide, sterility performance is thoroughly.
2) Molecular Identification
The 2000 strain BC from plantation1For colony selects male flower is the most sterile, tree characteristics (plant height, Ear height, plant type,
Tassel branch number and Ear Characters etc.) 616 BCs close with capital 7241For individual plant listing mark；Extract 616 BC1For individual plant
The DNA of blade, as template, utilizes 40 pairs of SSR core primers (table 2) respectively each strain to be carried out PCR amplification；With capital 724 for right
According to.Every pair of corresponding site of SSR core primers；There are 2 allele in each site.
Table 2 is 40 pairs of SSR core primers
Each BC140 PCR AFLP system corresponding to site are obtained for individual plant, corresponding with 40 sites that capital 724 obtains
PCR AFLP system compare, the inconsistent allele number of PCR AFLP system bands of a spectrum is difference number of alleles；Ratio
More total number of sites is 40.
Genetic similarty computing formula: [1-(difference number of alleles/(2 × compare total number of sites))] × 100%
According to amplification, choose front 30 individual plants minimum with capital 724 difference number of alleles and backcross as next round
Female parent, and through genetic similarty calculate, the genetic similarty between front 30 individual plants and capital 724 is all between 92.5-95%.
3, backcross quadratic B C2The acquisition in generation
1) backcross
With the BC that above-mentioned 2 choose and capital 724 genetic similarty is between 92.5-95%1Do female parent for individual plant, continue with
Recurrent parent capital 724 backcrosses, and gathers in the crops BC2Seed for colony.
In summer next year, plant BC2For the seed of colony, by head progeny row field planting, each head progeny row plants 50 strains, and altogether 1500
Strain.
2) Molecular Identification
Select 300 BC that male flower is the most sterile, tree characteristics is close with capital 7242For individual plant listing mark, extract respectively
300 BC2For the DNA of single-strain blade as template, utilize BC2For the maternal BC that individual plant is corresponding1Dai Yujing 724 expands banding pattern not
Same SSR primer carries out PCR amplification to it；With capital 724 for comparison.
According to the method described above, calculating genetic similarty, wherein, difference number of alleles is male sterility BC2For individual plant SSR
The allele number that bands of a spectrum banding pattern is inconsistent with the SSR bands of a spectrum banding pattern in described corn inbred line capital 724, BC2List for colony
Strain SSR bands of a spectrum are for using BC2For the maternal BC that individual plant is corresponding1The SSR primer that Dai Yujing 724 compares amplification banding pattern inconsistent expands
Increase the bands of a spectrum obtained；Relatively total number of sites is 40.
Choosing genetic similarty is 98.75%-100% (front 30 individual plants minimum with capital 724 difference number of alleles)
The female parent backcrossed as next round.
4, backcross the acquisition in 3 sterile line S capital 724
With the BC that above-mentioned 3 choose and capital 724 genetic similarty is between 98.75%-100%2Do female parent for individual plant, continue
Continue and backcross with recurrent parent capital 724, gather in the crops BC3For colony, it is sterile line S capital 724.
Sterile line S capital 724 flower pesticide does not exposes, and sterility performance is thoroughly.
Three, conventional transformation and the comparison of the inventive method
Conventional transformation is essentially identical with the method for above-mentioned two, does not the most carry out Molecular Identification, and result backcrossed for 6 generations,
Genetic background can be obtained and be returned to the sterile line (genetic background response rate is shown in Table 3) of recurrent parent.
Calculate genetic background response rate G (g)=[L+X (g)]/2L；Wherein, g refers to backcross generations number, and G (g) referred in g generation
Genetic background response rate；X (g) refers at the g that backcrosses for the molecular labeling quantity showing as receptor parent banding pattern；L refers to be participated in analyzing
Molecular labeling quantity.
Table 3 is the background response rate of the inventive method and conventional breeding
As seen from the above, the method for the present invention utilizes molecular labeling auxiliary background to select to combine with backcross transformation, only needs
In 3 generations that backcrossed, i.e. obtain genetic background and are returned to the sterile line of recurrent parent.
Embodiment 2, the transformation in maternal sterile line S capital, capital 725 725
Owing to capital 725 and capital 724 affiliation are relatively near, therefore select sterile line S capital 724 as capital 725 sterile line transformation
Donor material.
Female parent, capital 725 (Corn Rearch Center, Beijing Farming & Forestry Research Academy, kind power application public affairs are done with sterile line S capital 724
Accuse number for CNA007812E) do paternal hybrid and assemble F1Generation, F1The most sterile for variable rate technology；
Again with F1In generation, does female parent, and continuing backcrosses with capital 725 obtains BC1For colony.
The 200 strain BC from plantation1The most sterile, tree characteristics (plant height, Ear height, axle look, hero for selection male flower in colony
Branch of the ear of grain number, Ear Characters and breeding time etc.) 48 individual plant listing marks close with capital 725；Extract BC1For single-strain blade
DNA, as template, utilizes the primer that there are differences between S capital 724 and capital 725 in 40 SSR core primers (in table 2
Umc2105k3, bnlg240k1) respectively each strain is carried out PCR amplification；With capital 725 for comparison.Select and capital 725 AFLP system
Identical individual plant, is denoted as BC1-A；
By BC1Continue to backcross and obtain BC in-A and capital 7252For colony, the sterile line S capital 725 in i.e. maternal capital 725.
Observing fertility, sterile line S capital 725 flower pesticide does not exposes, and sterility performance is thoroughly.
Embodiment 3, the capital 92 restorative qualification to sterile line S capital 725
Doing female parent with the sterile line S capital 725 formulated by embodiment 2, capital 92 is (in the research of Beijing City Agriculture and Forestry Institute corn
The heart, kind power application notification number is CNA007637E) do male parent, hybridization assembles F1In generation, gather in the crops F1The seed in generation.Next year, exist respectively
The multiple spot field planting F such as Beijing, Hainan, Jilin1In generation, obtain F1For plant.Observe and identify F1Fertility restorer feelings for plant tassel
Condition, all shows as fertility restorer normal.
Illustrate that capital 92 is the strong restorer in sterile line S capital 725, there is complete recovery capability.
Embodiment 4, the capital section 665 three series mating production of hybrid seeds
One, three breeding being
1, sterile line propagation
Sterile line propagation is carried out with the sterile line S capital 725 prepared by embodiment 2:
When maternal male sterile line S capital 725 is expanded numerous in Gansu, many with other space, zasiokaurin source place isolation distance
In 500 meters.Sterile line S capital 725 and holding are that capital 725 is planted according to 8:2 row ratio, and planting density is 5000 plants/acre, and pollination terminates
After surgery and maternal keep system, it is to avoid being mixed into holding in sterile line is seed.Sterile line propagation yield typically 450 kilograms every mu with
On.
2, system's breeding is kept
Maternal holding is that the breeding in capital 725 is identical with conventional parent breeding method.When expanding numerous in Gansu, with other popcorn
Space, powder source place isolation distance is no less than 500 meters.Holding be capital 725 planting density be 5000 plants/acre, reproductive output typically exists
Every mu more than 500 kilograms.
3, restorer breeding
The breeding in restorer capital 92 is identical with conventional parent breeding method.When expanding numerous in Gansu, come with other zasiokaurin
Space, seedbed isolation distance is no less than 500 meters.Restorer capital 92 planting density is 5000 plants/acre, and reproductive output is typically at every mu
More than 400 kilograms.
Two, sterilization cross breeding seed:
With sterile line S capital 725 for maternal, capital 92 is male parent, carries out the capital section 665 cenospecies sterilization production of hybrid seeds, specific as follows:
When the Gansu production of hybrid seeds, with other space, zasiokaurin source place isolation distance no less than 300 meters.By female parent sterile line
S capital 725 and male parent capital 92 are according to the ratio plantation of 5:1 row, and planting density is 5000 plants/acre, and maternal sterile line shifts to an earlier date 7 days kinds than male parent
Planting, pollination surgeries male parent row after terminating, it is to avoid be mixed into male parent seed in cenospecies.Wherein when Parent mistake phase number of days can root for row
Make the appropriate adjustments according to production of hybrid seeds actual conditions.
Obtain sterilization cenospecies capital section 665 seed.
According to the investigation standard of country's conventional corn strain's area experiment project, detect sterilization cenospecies capital section 665 yield, resist
The economical character such as property and plant type, plant height, Ear height, fringe type, spike length, tassel row number, axle look, mass of 1000 kernel, concrete measuring method is as follows:
1, yield: community fruit ear air-dries rear threshing, weighs seed dry weight, converts by standard moisture content (14%), is community
Yield, then it is converted into per mu yield by cell production.
2, resistance: carry out jade according to People's Republic of China's agricultural industry criteria " corn disease and insect resistance identification technology specification "
The corn main diseases and insect pests Field inoculation Resistance Identifications such as rice snout moth's larva, leaf blight and head smut, investigation records anti-emotion condition.
3, economical character
1) plant type: according to the corner dimension of plant leaf is point compact, half compact, open and flat three kinds.
2) plant height: take fertility normal plant 10 strain (being defined as sampling strain) continuously in milk stage, measure ground to tassel
The height on top, seeks its average.
3) Ear height: measure sampling strain and the height of tight knot position by ground to the first fruit ear, seek its average.
4) fringe type: according to fruit ear shape, point cartridge type, tapered two kinds.
5) spike length: measure sampling strain fruit ear length from fringe base portion to top, seek its average.
6) tassel row number: the seed line number in the middle part of counting sampling strain fruit ear.
7) axle look: share out bonus, white two kinds.
8) mass of 1000 kernel: will sampling strain fruit ear threshing after, seed is sufficiently mixed, take the most at random 500 weigh, repeated sampling
3 times, two close numbers are added, are mass of 1000 kernel.
The yield (Seed weight) of result sterilization cenospecies capital section 665 is 778.3 kilograms every mu；
Through field resistance inoculated identification, anti-corn borer, middle Resistance To Helminthosporium Turcicum etc.；
Plant height 294 centimetres, Ear height 120 centimetres, cartridge type fringe, spike length 18.1 centimetres, tassel row number 16-18 row, cob is red,
Mass of 1000 kernel 382 grams.
Use the capital section 665 kinds that the method for the conventional production of hybrid seeds (with capital 725 for maternal, obtain for paternal hybrid) produces with capital 92
Son is on yield, resistance and other economical characters, and the capital section 665 produced with above-mentioned three series mating, without significant difference, however it is necessary that
The step of maternal artificial emasculation, adds breeding cost.
Therefore explanation production of hybrid seeds success.
Claims (9)
1. a method for hybrid seeding, comprises the steps: with corn sterile line S capital 725 as sterile line, corn inbred line capital
725 for keeping system, and corn inbred line capital 92 is restorer, carries out the three series mating production of hybrid seeds, obtains cenospecies capital section 665；Described not
Educate be S capital 725 be according to the method transformation comprised the steps:
A) female parent is done in corn sterile line S capital 724, and paternal hybrid is done in capital 725, obtains male sterility hybrid generation F1；
B) with described male sterility hybrid generation F1Backcross with capital 725 for female parent, obtain male sterility BC1For colony；
C) with described male sterility BC1Individual plant for colony continues to backcross with capital 725 for female parent, obtains the male sterility in capital 725
System.
Method the most according to claim 1, it is characterised in that:
Between step b) and step c), also including the step of Molecular Identification, described Molecular Identification is for use SSR core primers
Umc2105k3, bnlg240k1 are to described male sterility BC1Carry out PCR amplification for colony's individual plant, choose AFLP system and with same
Sample primer expands, to described capital 725PCR, the male sterility BC that the collection of illustrative plates obtained is identical1For individual plant；
Described core primers umc2105k3 is by sequence 10 institute in the single strand dna shown in sequence in sequence table 9 and sequence table
The primer pair of the single strand dna composition shown；
Described core primers bnlg240k1 is by sequence 30 in the single strand dna shown in sequence in sequence table 29 and sequence table
The primer pair of shown single strand dna composition.
Method the most according to claim 2, it is characterised in that:
Step b) and c) between Molecular Identification step before, also include the step of following phenotypic evaluation, described phenotypic evaluation
Step is for choosing described male sterility BC1For the BC that phenotype in colony is consistent with capital 7251For individual plant.
The most according to the method in claim 2 or 3, it is characterised in that:
Described sterile line S capital 724 is according to the method seed selection comprised the steps: the jade being CGMCC No.8657 with preserving number
Rice sterile line MD32 be donor, corn inbred line capital 724 be acceptor, carry out backcross transformation, obtain the male sterile line S in capital 724
Capital 724.
Method the most according to claim 4, it is characterised in that the number of times that backcrosses described in: is 3 times；
Described backcross transformation specifically includes following steps:
1) with preserving number be CGMCC No.8657 corn sterile line MD32 as donor, corn inbred line capital 724 as acceptor, miscellaneous
Hand over, obtain male sterility hybrid generation F1；
2) with male sterility hybrid generation F1Backcross with capital 724 for female parent, obtain male sterility BC1For colony；
3) with male sterility BC1Continue to backcross with capital 724 for female parent for individual plant, obtain male sterility BC2For colony；
4) with male sterility BC2Continue to backcross with capital 724 for female parent for individual plant, obtain the male sterile line S capital 724 in capital 724.
Method the most according to claim 5, it is characterised in that: in step 2) and step 3) between, also include following molecule
The step identified: from described male sterility BC1For colony choosing with described capital 724 genetic similarty at the hero of 92.5-95%
The sterile BC of property1For individual plant.
Method the most according to claim 6, it is characterised in that: also comprise the steps: from institute before described Molecular Identification
State male sterility BC1The male sterility BC consistent with described capital 724 for choosing phenotype in colony1For individual plant；
In step 3) and step 4) between, also specifically include the step of following Molecular Identification: from described male sterility BC2For colony
In choose with described capital 724 genetic similarty at the male sterility BC of 98.75%-100%2For individual plant；
Following steps are also specifically included: from described male sterility BC before described Molecular Identification2For colony choosing phenotype with described
The male sterility BC that capital 724 is consistent2For individual plant.
8. the method cultivating sterile line S capital 725, comprises the steps:
A) female parent is done in corn sterile line S capital 724, and paternal hybrid is done in capital 725, obtains male sterility hybrid generation F1；
B) with described male sterility hybrid generation F1Backcross with capital 725 for female parent, obtain male sterility BC1For colony；
C) with described male sterility BC1Individual plant for colony continues to backcross with capital 725 for female parent, obtains the male sterility in capital 725
System；
Between step b) and step c), also specifically including the step of Molecular Identification, described Molecular Identification is for use SSR core primers
Umc2105k3, bnlg240k1 are to described male sterility BC1Carry out PCR amplification for colony's individual plant, choose AFLP system and with same
Sample primer expands, to described capital 725PCR, the male sterility BC that the collection of illustrative plates obtained is identical1For individual plant；
Described core primers umc2105k3 is by sequence 10 institute in the single strand dna shown in sequence in sequence table 9 and sequence table
The primer pair of the single strand dna composition shown；
Described core primers bnlg240k1 is by sequence 30 in the single strand dna shown in sequence in sequence table 29 and sequence table
The primer pair of shown single strand dna composition；
Step b) and c) between Molecular Identification step before, also specifically include the step of following phenotypic evaluation, described phenotype is reflected
Fixed step is for choosing described male sterility BC1For the BC that phenotype in colony is consistent with capital 7251For individual plant.
9. the application in hybrid seeding of the described corn sterile line S capital 725 in the arbitrary described method of claim 1-8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410495417.XA CN104351038B (en) | 2014-09-24 | 2014-09-24 | Capital section 665 three series mating hybrid seed production method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410495417.XA CN104351038B (en) | 2014-09-24 | 2014-09-24 | Capital section 665 three series mating hybrid seed production method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104351038A CN104351038A (en) | 2015-02-18 |
| CN104351038B true CN104351038B (en) | 2016-08-24 |
Family
ID=52518435
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410495417.XA Active CN104351038B (en) | 2014-09-24 | 2014-09-24 | Capital section 665 three series mating hybrid seed production method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104351038B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105132420B (en) * | 2015-09-23 | 2018-02-13 | 北京市农林科学院 | A kind of primer set for identifying corn variety purity and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100587077C (en) * | 2006-03-15 | 2010-02-03 | 北京市农林科学院 | Corn authenticity detecting kit and its detecting method |
-
2014
- 2014-09-24 CN CN201410495417.XA patent/CN104351038B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100587077C (en) * | 2006-03-15 | 2010-02-03 | 北京市农林科学院 | Corn authenticity detecting kit and its detecting method |
Non-Patent Citations (2)
| Title |
|---|
| Development and characterization of a core set of SSR markers for fingerprinting analysis of Chinese maize varieties;Feng-Ge Wang et al;《Open Access》;20111231;第1-11页 * |
| 玉米杂交种京科665高产制种技术;毛振武等;《种子世界》;20140630(第6期);第56页左栏第1段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104351038A (en) | 2015-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102198083B1 (en) | Selection and Breeding of Cruciferous Vegetable Ingredients and Varieties in Rapeseed Double Haploid Induction System | |
| Parthiban et al. | Hybrid progenies in Jatropha–a new development | |
| CN104285776B (en) | The selection of male sterile line of maize | |
| CN103609428A (en) | Method for cultivating corn allopolyploid by using unreduced gamete characteristic of tripsacum dactyloides | |
| CN104313155B (en) | One kind support osmanthus type chrysanthemum floral organ trait associations method for screening molecular markers and application | |
| US20190191645A1 (en) | Method for cultivating perennial rice using asexual propagation characteristic of oryza longistaminata | |
| Reimann-Philipp | Breeding perennial rye | |
| Wang et al. | Creation of new maize germplasm using alien introgression from Zea mays ssp. mexicana | |
| CN104351037B (en) | NK718 three series mating hybrid seed production method | |
| Khush | IRRI breeding program and its worldwide impact on increasing rice production | |
| CN110463599A (en) | A kind of Direct-seeding Rice selection | |
| Abbo et al. | Interspecific hybridization in wild Cicer sp. | |
| One et al. | Phenotypic and genotypic variability of F2 plants derived from Jatropha curcas× integerrima hybrid | |
| Akoroda | Yams: Dioscorea spp. | |
| CN104351036B (en) | Capital section 968 three series mating hybrid seed production method | |
| CN102308747B (en) | Method for carrying out variety purity or trueness identification on corn by utilizing purple germ mark | |
| CN104351038B (en) | Capital section 665 three series mating hybrid seed production method | |
| CN103461091A (en) | Seed selection method of sorghum A3 cytoplasmic male sterile line | |
| CN104351039B (en) | The single 38 three series mating hybrid seed production methods in capital | |
| CN110692511A (en) | Method for improving crucifer crop characters according to genome size | |
| CN104521738B (en) | Jing Nongke 728 three series mating hybrid seed production method | |
| CN104946644A (en) | Molecular marker for corn tripsacum monosome addition line nucleic male sterility genes and application thereof | |
| CN104521737B (en) | NK971 three series mating hybrid seed production method | |
| CN104396732B (en) | Capital section 528 three series mating hybrid seed production method | |
| CN105918107A (en) | Breeding method for repairing and improving natural doubling rate of maize haploid male flower by utilizing recurrent selection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |