CN104285776B - Breeding Methods of Maize Male Sterile Lines - Google Patents

Abstract

The invention discloses a method for breeding maize male sterile lines. The invention provides a method for breeding maize male sterile lines, which is maize S-type cytoplasmic male sterile line MD32CGMCC? No. 8657 is the donor, and the corn inbred line is used as the recipient, and backcrossing is carried out to obtain the male sterile line of the corn inbred line. Experiments of the present invention have proved that the present invention has the following advantages: 1. The combination of molecular marker-assisted selection technology and backcrossing transfer technology accelerates the transfer speed of the sterile line, and only three generations of backcrossing are required to obtain the Beijing 724 sterile line S Jing 724. 2. The S-type male sterile line MD32 selected in the present invention has a stable and complete sterility performance under various genetic backgrounds, and has not been used in the reported research on male sterility of maize hybrids.

Description

Breeding Methods of Maize Male Sterile Lines

technical field

The invention relates to the field of biotechnology, in particular to a method for breeding maize male sterile lines.

Background technique

Breeding and promotion of strong dominant hybrids is an important way to increase maize yield. The use of conventional seed production methods to prepare hybrids requires manual detasseling of the female parent, which not only consumes a lot of labor, increases the cost of seed production, but also has the potential risk of affecting seed quality due to untimely and incomplete detasseling. The use of male sterile lines for seed production is an effective method to ensure seed purity and increase maize yield.

As early as the 1950s and 1960s, research on maize sterile seed production began at home and abroad. Cytoplasmic male sterility is the main way to use in maize breeding because it is easy to realize the three-line matching of sterile line, maintainer line and restorer line. Cytoplasmic male sterile lines can be divided into three types: T, C and S. In the early 1960s, the T-type male sterile line was introduced into our country. Due to the specialized infection of "T race" of maize small spot disease, the application of T-type sterile lines is severely limited. In the 1970s, Chinese breeders introduced C-type and S-type sterile lines from abroad. Although the sterility of the C-type male sterile line is relatively stable and complete, it exhibits a delayed reverting mutation of fertility in a special genotype background, and its restorer line usually needs to be re-transduced, which takes a long period and cumbersome steps, resulting in this type of sterile male sterile line. The education system is difficult to popularize and apply in practice. The S-type male sterile line is the largest group among the three types, and it has been proved that Chang 7-2 and other yellow modified line materials are its natural strong restorer lines. However, the fertility of S-type male sterile lines varies greatly due to different genotype backgrounds, and the fertility is highly stable under a specific genetic background. Most of the male parents of domestic excellent maize hybrids belong to yellow-modified germplasm. Therefore, in order to save the work of transgenic restorer lines, it is a quick task to discover and create new S-type male sterile lines with complete sterility, stable genetics, and excellent comprehensive traits. The key to the research and application of sterile seed production.

The key to realizing maize cytoplasmic male sterility seed production is the selection of sterile lines, maintainer lines and restorer lines. The most commonly used method for breeding sterile lines is the backcross transfer method, that is, using stable sterile lines as non-recurrent parents, selecting excellent inbred lines as recurrent parents, and carrying out multi-generation backcrossing to breed excellent and stable sterile lines. A sterile inbred line, and the original recurrent parent is the maintainer line of the sterile line. However, only using the traditional backcrossing transfer method generally needs 5-6 generations of backcrossing, and the transfer cycle is longer, which delays the application of sterile seed production technology in corn hybrids. Therefore, how to speed up the breeding of sterile lines is an urgent problem to be solved in the current male sterile seed production technology.

Contents of the invention

The purpose of the present invention is to provide a method for breeding maize male sterile lines.

The method provided by the invention is to use the maize S-type cytoplasmic male sterile line MD32CGMCC No.8657 as a donor and the maize inbred line as a recipient to carry out backcross breeding to obtain the male sterile line of the maize inbred line.

In the above method, the corn inbred line is the corn inbred line Jing 724, and the male sterile line obtained is the male sterile line S Jing 724 of Jing 724.

In the above method, the number of times of backcrossing is 3 times.

In the above method, the backcross breeding comprises the following steps:

1) The maize S-type cytoplasmic male sterile line MD32CGMCCNo.8657 was used as the donor and the maize inbred line Jing724 was used as the recipient, and the male sterile hybrid progeny F ₁ was obtained;

2) Using the male sterile hybrid progeny F ₁ as the female parent, backcross with Jing 724 to obtain the male sterile BC ₁ generation population;

3) Using the male sterile BC _1st generation single plant as the female parent, continue backcrossing with Jing 724 to obtain the male sterile BC _2nd generation population;

4) Using the male sterile BC _2nd generation single plant as the female parent, continue backcrossing with Jing 724 to obtain the male sterile line S Jing 724 of Jing 724.

In the above method, between step 2) and step 3), the following step is further included: selecting from the male sterile BC ₁ generation population the genetic similarity of 92.5-95% to the maize inbred line Jing 724 Male sterile BC ₁ generation single plant;

In the above method, the method of selecting a male sterile BC ₁ generation single plant with a genetic similarity of 92.5-95% to the maize Jing 724 from the male sterile BC ₁ generation population comprises the following steps: using 40 pairs of The SSR core primers were used to amplify the male sterile BC _1st generation individual plant and the corn inbred line Jing 724 by PCR to obtain the SSR bands. By comparing the SSR profiles of the BC _1st generation individual plant and the corn inbred line Jing 724, the genetic similarity;

The formula for calculating the genetic similarity: [1-(Number of differential alleles/(2×Number of comparison total loci))]×100%

The number of differential alleles is the allele that is inconsistent with the SSR band pattern of the male sterile BC ₁ generation single plant amplified with SSR core primers and the SSR band pattern of the maize inbred line Jing 724 The number of genes; the total number of sites for the comparison is 40.

The sequences of the primers in the above 40 pairs of SSR core primers are respectively shown in the sequences 1-80 in the sequence listing, see Table 2 of the Examples for details.

In the above method, between step 3) and step 4), the following step is further included: selecting from the male sterile BC ₂ generation population the genetic similarity with the corn inbred line Jing 724 is 98.75%-100%. male sterile BC ₂ generation single plant.

The method for selecting a male sterile BC ₂ generation individual plant with a genetic similarity of 98.75%-100% to the maize inbred line Jing 724 from the male sterile BC ₂ generation population comprises the following steps: using primer A The male sterile BC ₂ generation individual plant and corn inbred line Jing 724 were amplified by PCR to obtain SSR bands, and the genetic similarity was calculated by comparing the SSR spectra of BC ₂ generation individual plant and corn inbred line Jing 724;

The primer A is an SSR primer with different amplified band patterns in the BC ₁ generation corresponding to the BC ₂ generation single plant compared with Jing 724;

The formula for calculating the genetic similarity: [1-(Number of differential alleles/(2×Number of comparison total loci))]×100%

The number of differential alleles is the allele whose SSR band pattern of the male sterile BC ₂ generation single plant amplified with primer A is inconsistent with the SSR band pattern of the maize inbred line Jing 724 number;

The total number of sites for the comparison is 40.

The application of maize S-type cytoplasmic male sterile line MD32CGMCC No. 8657 in breeding maize male sterile lines is also within the protection scope of the present invention.

The corn sterile line MD32 was deposited in the General Microorganism Center of China Committee for Microbial Culture Collection (CGMCC for short) on December 25, 2013, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, postal code 100101), the preservation number is CGMCC No.8657, and the plant is classified as Zeamays.

Experiments of the present invention prove that the present invention has the following advantages:

1. Using molecular marker-assisted selection technology combined with backcross transfer technology to speed up the transfer of sterile lines, only three generations of backcross were needed to obtain the Beijing 724 male sterile line S Jing 724.

2. The S-type cytoplasmic male sterile line MD32 selected in the present invention has a stable and complete sterility performance under various genetic backgrounds, and has not been used in the reported research on male sterility of maize hybrids.

detailed description

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.

Embodiment 1, the breeding of male sterile line S Jing 724

1. Determination of the type of male sterile line donor MD32 cytoplasmic male sterility

1. Maize male sterile line MD32

The breeding process of maize male sterile line MD32: use the established X line population (based on X1132) to carry out "tall and strict" line selection, and select excellent S5 high-generation lines and introduced hybrids to build a new basic line selection population. Sterile plants were found in the selfed offspring, the anthers of the tassels were not exposed, and there was no pollen. The sister plants with similar phenotypes in the same panicle row were selected for pair pollination. The hybrid offspring all showed complete sterility, and the plant phenotype tended to be basically the same. Then the material was named maize male sterile line MD32.

The maize sterile line MD32 is completely sterile: no anthers exposed, no pollen;

The sterility of maize sterile line MD32 is stable: under various genetic backgrounds, the sterility performance is complete;

Maize CMS line MD32 has excellent comprehensive traits: vigorous seed budding, strong emergence, seedling sheath color purple, wide leaves, leaf color dark green, semi-compact plant type, ear tube type, grain type semi-hard grain type, comprehensive resistance it is good.

The corn sterile line MD32 was deposited in the General Microorganism Center of China Committee for Microbial Culture Collection (CGMCC for short) on December 25, 2013, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, postal code 100101), the preservation number is CGMCC No.8657, and the plant is classified as Zeamays.

2. Determination of the type of cytoplasmic male sterility of the sterile line MD32

The DNA of the corn male sterile line MD32 seedlings was extracted as a template, and the primers in the following table 1 were used for PCR amplification, and the amplified products were electrophoresed at 90V for 1 hour and 30 minutes on an Agarose gel. Identification of maize MD32 cytoplasmic sterility based on amplified fragment pattern.

As a result, no amplified product was detected when using C and T-type primers to amplify MD32 DNA by PCR; when using S-type primers to detect it, the PCR product fragment size was 885 bp. Therefore, it was determined that MD32 was an S-type cytoplasmic male sterile line.

Table 1 is the primers for identification of cytoplasmic type

Cytoplasmic type Primer sequence C-1 TGAAAGGGTGGTGGAATA C-2 GAGCCAAAGTAATGAGAAAA S-1 GATGCTATGCTAAGCGAGAT S-2 CCGCTAACCCACTTCTTCT T-1 GTCGTGTCCTGGTAGCCT T-2 CCTCCTTCATTCCGTTGT

2. Breeding of maize male sterile line S Jing 724

1. Obtainment of male sterile hybrid offspring F1

In the summer of the first year, the maize male sterile line MD32 (non-recurrent parent) was used as the donor, and Jing 724 (the Corn Research Center of Beijing Academy of Agriculture and Forestry Sciences, the variety right application announcement number is CNA007811E) (the recurrent parent) was used as the recipient. For the F1 generation, the seeds _of the F1 generation _were harvested.

In the winter of the same year, the first generation in Hainan, the seeds of the F ₁ generation were planted, and 127 F ₁ generation maize plants were obtained.

The anthers of 127 F ₁ generation maize plants were not exposed, had no pollen, and showed complete sterility.

2. Obtain the _first generation of BC by backcrossing once

1) Backcross

The F ₁ generation plants were used as the female parent, and continued to backcross with the recurrent parent Jing 724, and the seeds of the BC ₁ generation population were harvested.

In the winter of the same year, the second generation of Hainan planted the seeds of the BC _1st generation population to obtain the BC _1st generation population.

The anthers of the _1st generation of BC populations were not exposed, had no pollen, and showed complete sterility.

2) Molecular marker screening

From the planted 2000 BC _1st generation populations, 616 BC _1st generation plants with complete male flower sterility and plant traits (plant height, ear height, plant type, number of tassel branches and ear traits) similar to Jing 724 were selected Listing mark; DNA of 616 BC _1st generation individual leaves was extracted as a template, and 40 pairs of SSR core primers (Table 2) were used to amplify each plant by PCR; Jing 724 was used as a control. Each pair of SSR core primers corresponds to a locus; each locus has 2 alleles.

Table 2 shows 40 pairs of SSR core primers

The PCR amplification spectrum corresponding to 40 loci obtained from each BC _1st generation individual plant was compared with the PCR amplification spectrum corresponding to the 40 loci obtained from Jing 724. The number of alleles with inconsistent bands in the PCR amplification spectrum was The number of differential alleles; the total number of loci for comparison is 40.

Genetic similarity calculation formula: [1-(number of differential alleles/(2×compared total number of loci))]×100%

According to the amplification results, the top 30 individual plants with the least number of differential alleles with Jing 724 were selected as the female parents of the next round of backcrossing, and after genetic similarity calculation, the genetic similarity between the top 30 individual plants and Jing 724 Both are between 92.5-95%.

3. Obtaining the _second generation of BC through backcrossing

1) Backcross

The BC _1st generation single plant with a genetic similarity between 92.5-95% with Jing 724 selected in the above 2 was used as the female parent, and continued to backcross with the recurrent parent Jing 724 to harvest the seeds of the BC _2nd generation population.

In the summer of the following year, the seeds of the BC _2nd generation population were planted in the field according to ear rows, and 50 plants were planted in each ear row, a total of 1500 plants.

2) Molecular marker screening

Select 300 BC _{2nd generation individual plants whose male flowers are completely sterile and whose plant traits are close to those of Jing 724. The leaf DNA of 300 BC 2nd generation individual} plants was respectively extracted as templates, and the corresponding female parent BC ₁ SSR primers with different amplified band patterns from Jing 724 were used for PCR amplification; Jing 724 was used as the control.

According to the above method, the genetic similarity is calculated, wherein the number of differential alleles is the allele that the SSR band pattern of the male sterile BC ₂ generation single plant is inconsistent with the SSR band pattern of the maize inbred line Jing 724 Number, the SSR band of a single plant in the _2nd generation of BC is the band obtained by amplifying the SSR primers with different amplification band patterns between the 1st generation of female parent BC ₁ and Jing 724 corresponding to the _2nd generation of BC; The number of points is 40.

The genetic similarity of 98.75%-100% (the top 30 individual plants with the least number of differential alleles with Jing 724) was selected as the female parent of the next round of backcrossing.

4. The CMS line S Jing 724 was obtained by backcrossing three times

The BC _2nd -generation single plant with a genetic similarity between 98.75%-100% selected from the above 3 was used as the female parent, and continued to backcross with the recurrent parent Jing 724, and the BC _3rd generation population was harvested, which was the sterile line S Beijing 724.

The sterile line S Jing 724 has no exposed anthers, no pollen, and the sterility is complete.

Three, the comparison of routine transfer and the method of the present invention

Conventional insemination is basically the same as the above two methods, the difference is that molecular marker screening is not carried out, and as a result, 6 generations of backcrossing can be obtained to obtain a sterile line whose genetic background reverts to the recurrent parent (return rate of genetic background is shown in Table 3).

Calculate the genetic background recovery rate G(g)=[L+X(g)]/2L; where, g refers to the number of backcross generations, G(g) refers to the genetic background recovery rate in the g generation; X(g) refers to the The g generation of backcross shows the number of molecular markers banded by the recipient parent; L refers to the number of molecular markers involved in the analysis.

Table 3 is the background recovery rate of the inventive method and conventional breeding

It can be seen from the above that the method of the present invention utilizes the combination of molecular marker-assisted background selection and backcross breeding, and only needs 3 generations of backcross to obtain a sterile line whose genetic background returns to the recurrent parent.

Claims (7)

1. A method for selecting a maize male sterile line, characterized in that: the maize S-type cytoplasmic male sterile line MD32 whose preservation number is CGMCCNo.8657 is a donor and a maize inbred line is a recipient, and backcrossing is carried out Transfer to obtain the male sterile line of the corn inbred line. 2. The method according to claim 1, characterized in that: the corn inbred line is the corn inbred line Jing 724, and the male sterile line obtained is the male sterile line S Jing 724 of Jing 724. 3. The method according to claim 1 or 2, characterized in that: the number of backcrosses is 3 times. 4. The method according to claim 2, characterized in that: said backcross breeding comprises the steps of: 1) Using maize male sterile line MD32CGMCCNo.8657 as donor and maize inbred line Jing 724 as recipient, hybridize to obtain male sterile hybrid progeny F1 _; 2) Using the male sterile hybrid progeny F ₁ as the female parent, backcross with Jing 724 to obtain the male sterile BC ₁ generation population; 3) Using the male sterile BC _1st generation single plant as the female parent, continue backcrossing with Jing 724 to obtain the male sterile BC _2nd generation population; 4) Using the male sterile BC _2nd generation single plant as the female parent, continue backcrossing with Jing 724 to obtain the male sterile line S Jing 724 of Jing 724. 5. The method according to claim 4, characterized in that: between step 2) and step 3), further comprising the step of: selecting from the ₁ generation population of male sterile BC that is genetically related to the maize Jing 724 The male sterile BC ₁ generation individual plants with a similarity of 92.5-95%. 6. The method according to claim 5, characterized in that: between step 3) and step 4), further comprising the step of: selecting from the ₂ generation population of male sterile BC that is genetically related to the maize Jing 724 The male sterile BC ₂ generation individual plants with similarity between 98.75% and 100%. 7. Application of maize S-type cytoplasmic male sterile line MD32 with deposit number CGMCCNo.8657 in breeding maize male sterile lines.