CN100368434C - Tomato RNA virus host factor and genes encoding same and use thereof - Google Patents

Abstract

The present invention discloses a host factor of a tomato RNA virus, a coded gene thereof and the application thereof. The present invention provides a host factor of a tomato RNA virus, a coded gene thereof and the application of the host factor in antivirus plant breeding. The host factor of a tomato RNA virus is a protein with one of the following amino acid residue sequences: firstly, SEQ ID No. 1 in a sequence list; secondly, a protein which is used for substituting, deleting or adding one to ten amino acid residues of an amino acid residue sequence of the SEQ ID No. 1 in the sequence list and has the function of supporting virus copy. By transferring an antisense gene fragment or using an RNA interfering method, the coded gene of the protein in a plant body is silenced so as to obtain an antiviral plant. The host factor gene ToTOM3 of a tomato RNA virus and a method for inhibiting the gene expression have great practical meanings and wide application prospects of antivirus plant breeding.

Description

Tomato RNA virus host factor and encoding gene thereof and application

Technical field

The present invention relates to albumen and encoding gene and application in the biological technical field, particularly relate to a kind of tomato RNA virus host factor and encoding gene thereof and its application in the plant virus resistance breeding.

Background technology

Tomato is a kind of important fruit type vegetables.In its growth and development process, be subjected to the harm of various diseases easily, wherein serious with viral disease.The viral great majority that infect tomato of report are RNA viruses at present, wherein modal RNA viruses has 7 kinds, be cucumber mosaic virus (Cucumber mosaic virus, CMV), tobacco mosaic virus (TMV) (Tabacco mosaic virus, TMV), Tomato mosaic virus (Toma to mosaic virus, ToMV), marmor upsilon (Potato virus Y, PVY), tomato bushy stunt virus (Tomato bushy stunt virus, TBSV), tomato aspermy virus (Tomato aspermy virus, TAV) and tomato chlorosis spot poison (Tomatochlorotic spot virus, TCSV).

The viroses of plant are one of important diseases that cause the agriculture production heavy losses.Because virus is strict obligatory parasite, also there is not strict optionally chemical agent to be used for the control of the viroses of plant so far.In production practice, mainly control the harm of virus disease as kill preventive measures such as amboceptor insect and plantation disease-resistant variety with chemical agent, wherein to plant disease-resistant variety economical and effective the most with the route of transmission of removing malicious source, cut-out virus.Yet conventional disease resistant and breeding method process is loaded down with trivial details, needs lot of manpower and material resources, the more important thing is the normal and bad agronomic shape gene linkage of disease-resistant gene, is difficult to reach disease-resistant fine production requirement; On the other hand, the shortage of resistant gene resource has also limited the application of conventional breeding method.New approach has been opened up in the control that be applied as the viroses of plant of plant genetic engineering in breeding.The method that obtains at present antiviral transfer-gen plant mainly contains two kinds: the one, will derive from the regulating and controlling sequence of the gene of virus self or gene (as the coat protein gene of virus, rdrp gene and fragment thereof, movement protein gene and 3 ' or 5 ' end non-coding region thereof, virus antisense RNA, ribozyme gene and viral satellite RNA etc.) the importing recipient plant, thereby obtain antiviral plant (the Lomonossoff G.P. of the resistance (pathogen-derived resistance) of viral origin, 1995.Pathogen-derived Resistance to Plant Viruses, Annu.Rev.Phytopathol., 33:323-343).Yet there is certain limitation in these transgenic plant in antiviral function aspects, and as the specificity height, even strain to occur be specialization etc., but also have potential Hazard Factor such as biological safety; Another kind method is to utilize the disease-resistant gene of plant itself (as the N gene) to obtain antivirus plant (Goldbach R., Bucher E., and Prins is mechani sms to plantviruses:an review.Virus Research. M.2003.Resistance, 92:207-212), but, up to now, a few is only arranged, limited further developing of this strategy through the plant virus resistance gene of cloning and identify.

After virus is invaded cell, duplicate propagation and cause systemic infection need experience following process in host cell: the assembling of the genome duplication of the shell of undressing of virus, virus and proteinic synthetic, new virion and virus particle are in cell and intercellular transportation etc.In this process, all conveniences that host cell offers virus are called as host factor (Host Factors), also claim host's albumen (host proteins) or cell protein (cellularproteins).If lack these host factors in the host cell, just the reproducible or the efficient of duplicating do not reduce (Ahlquist P. to virus greatly, Noueiry, A.O., and Lee, W.M., et al., 2003.Host Factor inPositive-Strand RNA Viruses Genome Replication.Journal ofVirology, 77 (15): 8181-8126.).Therefore, by supporting the gene of virus replication in inhibition or the reticent host cell, might make it not support virus duplicating and keeping in host cell, thereby obtain the antiviral plant of broad spectrum.Therefore, to the research of virus host factor gene, for the antiviral gene engineering provides a new approach.

Summary of the invention

The purpose of this invention is to provide a kind of tomato RNA virus host factor and encoding gene thereof.

Tomato RNA virus host factor provided by the present invention, name is called ToTOM3, and derive from tomato and belong to tomato (Lycopersicon esculentum Miller), be the protein with one of following amino acid residue sequences:

1) the SEQ ID № in the sequence table: 1;

2) with SEQ ID № in the sequence table: 1 amino acid residue sequence is through replacement, disappearance or the interpolation of one to ten amino-acid residue and have the protein of supporting the virus replication effect.

SEQ ID № in the sequence table: 1 is made up of 295 amino-acid residues.The zone that comprises a plurality of high hydrophobicities infers that this albumen is a kind of transmembrane protein with 7 membrane spaning domains, with the homology of Arabidopis thaliana AToTOM3 on amino acid levels be 76.9%.

SEQ ID № in the code sequence tabulation: the polynucleotide of 1 protein sequence also belong to protection scope of the present invention.

The encoding gene of tomato RNA virus host factor (ToTOM3) comprises the cDNA gene of tomato RNA virus host factor and the genomic gene of tomato RNA virus host factor.Its genomic gene is one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 2 dna sequence dna;

2) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 2 dna sequence dnas hybridization that limit.

SEQ ID № in the sequence table: 2 by 8129 based compositions, have 11 exons and 10 introns, 1245-1487 bit base from 5 ' end is first exon of this genomic gene, 3519-3609 bit base from 5 ' end is second exon of this genomic gene, 3765-3817 bit base from 5 ' end is the 3rd exon of this genomic gene, 3895-3987 bit base from 5 ' end is the 4th exon of this genomic gene, 4065-4136 bit base from 5 ' end is the 5th exon of this genomic gene, 4791-4863 bit base from 5 ' end is the 6th exon of this genomic gene, 4939-4984 bit base from 5 ' end is the 7th exon of this genomic gene, 6259-6322 bit base from 5 ' end is the 8th exon of this genomic gene, 6403-6456 bit base from 5 ' end is the 9th exon of this genomic gene, 6790-6867 bit base from 5 ' end is the tenth exon of this genomic gene, 7730-8129 bit base from 5 ' end is the 11 exon of this genomic gene, from 5 ' the 1317-1319 bit base of end be the initiator codon ATG of this genomic gene, from 5 ' the 7821-7822 bit base held is the terminator codon TGA of this genomic gene; 1488-3518 bit base from 5 ' end is first intron of this genomic gene, 3610-3764 bit base from 5 ' end is second intron of this genomic gene, 3818-3894 bit base from 5 ' end is the 3rd intron of this genomic gene, 3988-4064 bit base from 5 ' end is the 4th intron of this genomic gene, 4137-4790 bit base from 5 ' end is the 5th intron of this genomic gene, 4864-4938 bit base from 5 ' end is the 6th intron of this genomic gene, 4985-6258 bit base from 5 ' end is the 7th intron of this genomic gene, 6323-6402 bit base from 5 ' end is the 8th intron of this genomic gene, from 5 ' the 6457-6789 bit base of end be the 9th intron of this genomic gene, from 5 ' the 6868-7729 bit base held is the tenth intron of this genomic gene.

Its cDNA sequence is one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 3 dna sequence dna;

2) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 3 dna sequence dnas hybridization that limit.

SEQ ID № in the sequence table: 3 by 1282 based compositions, and its open reading frame (ORF) is that coding has SEQ ID № in the sequence table: the protein of 1 amino acid residue sequence from 5 ' end 73-957 bit base.

The rigorous condition of above-mentioned height can be that (or 0.1 * SSC), the solution of 0.1%SDS is hybridized and washed film with 0.1 * SSPE under 65 ℃.

Contain that arbitrary segmental primer also belongs to protection scope of the present invention in expression vector, transgenic cell line and the host bacterium of above-mentioned tomato RNA virus host factor encoding gene and the amplification tomato RNA virus host factor encoding gene.

Another object of the present invention provides a kind of method of cultivating antivirus plant.

The method of cultivation antivirus plant provided by the present invention is that the sense-rna of ToTOM3 or the rnai expression carrier of ToTOM3 are imported in the plant, obtains transfer-gen plant.

Can the sense-rna of ToTOM3 or the rnai expression carrier of ToTOM3 be imported transformed plant cells or tissue, as agrobacterium mediation converted method, particle gun mediated transformation method or pollen tube passage method etc. according to the ordinary method in the plant genetic engineering field.Be can be Solanaceae, Cruciferae or plant cucurbitaceous by the plant transformed host.

Tomato RNA virus host factor ToTOM3 provided by the present invention is the associated protein that a kind of RNA viruses is survived in plant materials, and intravital this RNA viruses host factor gene of the reticent plant of the method by antisense RNA or rna interference vector can obtain antivirus plant.Experimental results show that, compare with the non-transgenic plant, changeing the ToTOM3 sense-rna and the transgenic Fructus Lycopersici esculenti plant CMV of rna interference vector and the accumulation volume of TMV significantly reduces, disease time is obviously postponed, even asymptomatic performance, show that tomato ToTOM3 is the host factor gene of CMV and TMV, can obtain the plant variety of anti-CMV and TMV by inhibition or reticent ToTOM3.Tomato RNA virus host factor gene ToTOM3 of the present invention and suppress the method for this genetic expression has bigger practical significance and wide application prospect in the cultivation of antivirus plant and breeding.

Description of drawings

Fig. 1 is the agarose gel electrophoresis detected result of 3 ' the RACE product of ToTOM3

Fig. 2 is that the enzyme that contains the segmental cloning vector of 3 ' RACE PCR of ToTOM3 is cut qualification result

Fig. 3 is the agarose gel electrophoresis detected result of 5 ' the RACE product of ToTOM3

Fig. 4 is that the enzyme that contains the segmental cloning vector of 5 ' RACE PCR of ToTOM3 is cut qualification result

Fig. 5 is the agarose gel electrophoresis detected result of the pcr amplified fragment of ToTOM3

Fig. 6 is the Southern results of hybridization of the pcr amplified fragment (probe) of total DNA of tomato and ToTOM3

The positive colony of Fig. 7 for obtaining with bacterium colony in situ hybridization method

Fig. 8 is the agarose gel electrophoresis detected result of ToTOM3 genomic gene 3 ' end fragment PCR product

Fig. 9 is the agarose gel electrophoresis detected result of the recombinant plasmid of connection ToTOM3 genomic gene 3 ' end fragment

Figure 10 is the agarose gel electrophoresis detected result of the ToTOM3 full-length gene group gene fragment of pcr amplification

Figure 11 cuts evaluation for the enzyme of ToTOM3 full-length gene group fragment recombinant plasmid

Figure 12 is the agarose gel electrophoresis detected result of ToTOM3 antisense RNA expression plasmid

Figure 13 is the PCR qualification result of antisense RNA expression plasmid

Figure 14 obtains RNAi (A) fragment for pcr amplification

Figure 15 is BglII and the SpeI double digestion qualification result of RNA interference plasmid pUToT3R (A-)

Figure 16 is RNA interference plasmid pUToT3R (A) SalI and XhoI double digestion qualification result

Figure 17 cuts qualification result for the BglII enzyme of rnai expression plasmid pBIToT3R (A)

Figure 18 is the PCR qualification result of rnai expression plasmid pBIToT3R (A)

Figure 19 is the segmental agarose gel electrophoresis detected result of RNAi (B) that BglII and SpeI double digestion pTTOM3-3 obtain

Figure 20 is RNA interference plasmid pUToT3R (B-) BglII and SPeI double digestion qualification result

Figure 21 is SalI and the XhoI double digestion qualification result of RNA interference plasmid pUToT3R (B)

Figure 22 cuts qualification result for the BglII enzyme of reorganization rnai expression plasmid pBIToT3R (B)

Figure 23 is the PCR qualification result of reorganization rnai expression plasmid pBIToT3R (B)

Figure 24 is the PCR detected result of antisense rna expression plasmid pBIToT3 (A) transgenic Fructus Lycopersici esculenti

Figure 25 is antisense rna expression plasmid pBIToT3 (A) transgenic Fructus Lycopersici esculenti (total DNA BamHI single endonuclease digestion) Southern hybridization analysis result

Figure 26 is for changeing the PCR detected result of RNA interference plasmid pBIToT3R (A) transgenic Fructus Lycopersici esculenti

Figure 27 changes transgenic Fructus Lycopersici esculenti (total DNAEcoRI single endonuclease digestion) the Southern hybridization analysis result of RNA interference plasmid pBIToT3R (A) for 8B.

Figure 28 changes the PGR detected result of RNA interference plasmid pBIToT3R (B) transgenic Fructus Lycopersici esculenti for 9A.

Figure 29 changes transgenic Fructus Lycopersici esculenti (total DNA EcoRII single endonuclease digestion) the Southern hybridization analysis result of RNA interference plasmid pBIToT3R (B) for 9B.

Figure 30 A is the symptom of 10 days transgenic Fructus Lycopersici esculenti seedlings of inoculation TMV

Figure 30 B is the symptom of 10 days non-transgenic tomato seedlings of inoculation TMV

Figure 30 C is the symptom of 10 days transgenic Fructus Lycopersici esculenti seedlings of inoculation CMV

Figure 30 D is the symptom of 10 days non-transgenic tomato seedlings of inoculation CMV

Figure 31 A is the symptom of 90 days transgenic Fructus Lycopersici esculenti seedlings of inoculation TMV

Figure 31 B is the symptom of 90 days non-transgenic tomato seedlings of inoculation TMV

Figure 31 C is the symptom of 90 days transgenic Fructus Lycopersici esculenti seedlings of inoculation CMV

Figure 31 D is the symptom of 90 days non-transgenic tomato seedlings of inoculation CMV

Figure 32 is the physical map of plant expression vector pBI121

Embodiment

Method therefor is ordinary method if no special instructions among the following embodiment, and used tomato variety is " the super headliner " available from the academy of agricultural sciences, Guangxi.

The clone of the full length cDNA sequence of embodiment 1, tomato host factor gene ToTOM3

1, the clone of ToTOM33 ' end cDNA

The tomato est sequence BI923910 (250nt) that has certain homology with Arabidopis thaliana ATOM3 (gi:15425640) that searches according to GenBank (gi:16225384) designs the cDNA sequence of two forward primers amplification ToTOM33 ' ends, and primer sequence is as follows:

ttom3-1：5’-CGGAGATGGTTGTAGGCCCG-3’；

ttom3-A：5’-TGAATGATGCAATCAATTGG-3’

Utilize the cDNA of the synthetic ToTOM33 ' end of 3 ' RACE System for Rapid Amplication of cDNA Ends test kit (Invitrogen company, catalog number (Cat.No.) 18373-027).Extract total RNA of tomato, its first chain cDNA is synthesized in reverse transcription, and reaction system and reaction conditions are: 8 μ L ddH ₂O (RNase-Free), 1 μ L AP (10 μ M) (AP:5 '-GCCACGCGTCGACTAGTACT (T) ₁₆-3 '), total RNA of 3 μ L tomatoes (about 5 μ g) and 1 μ L dNTP (10mM), behind the mixing, 72 ℃ of water-baths 10 minutes are put 5 minutes rapidly on ice, and then are added 4 μ L, 5 * the first chain damping fluids and 2 μ L0.1M DTT, mixing, behind 42 ℃ of water-bath 3min, add 1 μ LSuperScript II RT (Invitrogen company), 42 ℃ were reacted 1 hour.After reaction finished, 70 ℃ of heating 15min made the transcriptase inactivation.The first chain cDNA is a template with the reverse transcription synthetic, under the guiding of primer AUAP:5 '-GGCCACGCGTCGACTAGTAC-3 ' that primer ttom3-1 and mentioned reagent box provide, carry out the PCR first time, again with the first time PCR product be template, under the guiding of primer ttom3-A and primer AUAP, carry out the PCR second time, reaction finishes the back PCR product is carried out the detection of 0.8% agarose gel electrophoresis, detected result is (3 ' the RACE PCR product of swimming lane M:100bp DNA Ladder swimming lane 1:ToTOM3) as shown in Figure 1, show the specific band that amplifies an about 1200bp of length, conform to expected results.Reclaim this specific PCR product, utilize TOPO TA Cloning Kits (Invitrogen company) that 3 ' RACE PCR product is cloned, reaction system is: 2 μ L PCR products, 0.5 μ LSalt Solution and 0.5 μ LpCR 2.1-TOPO carrier.Place under the room temperature reaction 30 minutes that the purpose fragment is connected with carrier pCR 2.1-TOPO reaction solution, to connect product Transformed E .coli DH5 α competent cell then, after blue hickie screening, select white single bacterium colony upgrading grain, carry out enzyme with restriction enzyme EcoR I and cut evaluation, enzyme is cut qualification result (swimming lane M:GeneRuler l kb DNA ladder as shown in Figure 2, swimming lane CK1: the EcoRI enzyme of carrier pCR2.1-TOPO is cut product, 3 ' the RACE PCR fragment of swimming lane CK2:ToTOM3, swimming lane 1-3: the EcoR I enzyme of recombinant plasmid is cut product), 3 ' the RACE PCR fragment that shows the ToTOM3 of the about 1200bp of length of being cloned into correctly is inserted among the carrier pCR 2.1-TOPO, with this recombinant vectors called after pCToT3-3.PCToT3-3 is carried out determined dna sequence, sequencing result shows that the dna fragmentation length of being inserted is 1149bp, have SEQ ID № in the sequence table: 3 the dna sequence dna from 5 ' end 134-1282 position, 3 ' end of this dna fragmentation has the poly that length is 15 bases (A) tail.

2, the clone of ToTOM35 ' end cDNA

The tomato est sequence BI923910 (250nt) that has certain homology with Arabidopis thaliana ATOM3 (gi:15425640) that searches according to GenBank (gi:16225384) designs the cDNA sequence of two reverse primers amplification ToTOM35 ' ends, and primer sequence is as follows:

ttom3-2：CCATTCACAAAGAAATTGAG；

ttom3-B：GAGCAACGACGGCGACAACGCCGTAGAG

Utilize SMART ^TMThe cDNA of the synthetic ToTOM35 ' end of RACE cDNA Ampiification test kit (Clontech company, catalog number (Cat.No.) K1881-1).Extract total RNA of tomato, its first chain cDNA is synthesized in reverse transcription, and reaction system and reaction conditions are: the total RNA of 3 μ L tomatoes (1 μ g/ μ L), 1 μ L5 '-CDS primer (5 '-(T) ₂₅N _-1N-3 ') (10 μ M) and 1 μ L SMART II A Oligo (5 '-AAGCAGTGGTATCAACGCAGAGTACGCGGG-3 ') (10 μ M), behind the mixing, 72 ℃ of water-baths 2 minutes, put rapidly 2 minutes on ice, and then add 2 μ L5 * first chain damping fluid, 1 μ L20mM DTT, 1 μ L10mM dNTP Mix and 1 μ LPower Script ThermoScript II, mixing, 42 ℃ of water-baths 90 minutes add 100 μ LTricine-EDTA damping fluids, 72 ℃ of water-baths 7 minutes, put on ice stopped reaction then.The first chain cDNA is a template with the reverse transcription synthetic, under the guiding of primer UPM:5 '-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3 ' that primer ttom3-2 and mentioned reagent box provide, carry out the PCR first time, again with the first time PCR product be template, under the guiding of primer ttom3-B and primer NUP:5 '-AAGCAGTGGTATCAACGCAGAGT-3 ', carry out the PCR second time, reaction finishes the back PCR product is carried out the detection of 1.2% agarose gel electrophoresis, detected result is (swimming lane M:1kb DNA Ladder as shown in Figure 3,5 ' the RACE PCR fragment of swimming lane 1:ToTOM3), show the specific band that amplifies an about 250bp of length, conform to expected results.Reclaim this specific PCR product, utilize TOPO TA Cloning Kits that 5 ' RACE PCR product is cloned, at first the purpose fragment is connected (reaction system and reaction conditions are with the clone of ToTOM33 ' end cDNA in the step 1) with carrier pCR2.1-TOPO, to connect product Transformed E .coli DH5 α competent cell then, after blue hickie screening, select white single bacterium colony upgrading grain, carry out enzyme with restriction enzyme EcoR I and cut evaluation, enzyme is cut qualification result (swimming lane M:GeneRuler 1kb DNA ladder as shown in Figure 4, CK1:5 ' RACE PCR fragment, CK2:pCR2.1-TOPO (3913bp), swimming lane 1-5: the EcoR I enzyme that is connected with the segmental recombinant plasmid of 5 ' RACE PCR is cut product), 5 ' the RACE PCR fragment that shows the ToTOM3 of the about 250bp of length of being cloned into correctly is inserted among the carrier TOPO, with this recombinant vectors called after pCToT3-5.PCToT3-5 is carried out determined dna sequence, and sequencing result shows that the pulsating length of 5 ' RACE PCR is 241bp, has SEQ ID № in the sequence table: 3 the dna sequence dna from 5 ' end 1-241 position Nucleotide.

3, the acquisition of ToTOM3 full-length cDNA

5 ' RACE PCR fragment and 3 ' the RACE PCR fragment of the ToTOM3 that step 1 and step 2 are obtained are carried out sequential analysis, and analytical results shows that 5 ' RACE PCR is segmental has the restriction enzyme site of a restriction enzyme Mun I and 3 ' RACE PCR segment overlapping from 5 ' end the 148th bit base place.An Xba I restriction enzyme site is arranged on carrier pCToT3-5, utilize two restriction enzyme sites of Mun I and Xba I that the cDNA of 3 ' RACE and 5 ' RACE is coupled together, obtain the full-length cDNA of ToTOM3.This full-length cDNA is checked order, and sequencing result shows that this sequence has SEQ ID № in the sequence table: 3 nucleotide sequence, and SEQ ID № in the sequence table: 3 are made up of 1282 Nucleotide, and 3 ' end has the poly that length is 15 bases (A) tail.With Vector NTI software the cDNA sequence of ToTOM3 total length is carried out sequential analysis, analytical results shows that its open reading frame (ORF) is for holding the 73-957 bit base from 5 ', its 5 ' end non-coding region length is 72 bases, 3 ' end non-coding region length is 307 bases, SEQ ID № in the code sequence tabulation: 1 amino acid residue sequence, SEQ ID № in the sequence table: 1 is made up of 295 amino-acid residues, ToTOM3 and Arabidopis thaliana AtTOM3 amino acids coding residue sequence are carried out homology relatively, and ToTOM3 and the homology of Arabidopis thaliana AtTOM3 on amino acid levels are 76.9%.Use Kyte ﹠amp; The method of Doolittle (Kyte ﹠amp; Doolittle, A simple method for displaying the hydropathic character of a protein, Journal Molecular Biology, 157 (1): 105-132) hydrophobicity of ToTOM3 encoded protein matter is analyzed, the result shows that ToTOM3 encoded protein matter has the zone of high hydrophobicity, stride the prediction of membrane structure district with online software TMPred (http://www.ch.embnet.org/cgi-bin/TMPREN-FORM-PARSER), infer that this albumen is a kind of transmembrane protein with 7 membrane spaning domains.

The clone of embodiment 2, ToTOM3 genomic gene

According to the genome sequence of the full length cDNA sequence of acquired ToTOM3 design primer amplification ToTOM3, primer sequence is as follows:

ttom3-1：5’-CGGAGATGGTTGTAGGCCCG-3’；

ttom3-2：5’-CCATTCACAAAGAAATTGAG-3’

With the total DNA of tomato is template, under the guiding of primer ttom3-1 and primer ttom3-2, carry out pcr amplification, reaction finishes the back PCR is carried out the detection of 0.8% agarose gel electrophoresis, detected result is (swimming lane M:1KbDNAMarker, the gene fragment of the ToTOM3 of swimming lane 1:PCR amplification) as shown in Figure 5, shows the gene fragment of the ToTOM3 that amplifies an about 2.3kb of size, this dna fragmentation is checked order, and sequencing result shows that this fragment comprises the partial sequence of ToTOM3.The total DNA of tomato is carried out enzyme with restriction enzyme EcoR V cut, enzyme is cut product and is transferred on the nylon membrane behind 0.7% agarose gel electrophoresis, with usefulness ³²The dna fragmentation of the 2.3kb of the above-mentioned pcr amplification of P mark carries out Southern hybridization and detects, and the result is (swimming lane M:1Kb DNA Marker, swimming lane 1: the hybridization band), show the hybrid belt that has obtained big or small about 6.5kb as shown in Figure 6.With restriction enzyme EcoR V the total DNA of tomato being carried out enzyme cuts, separate through 0.7% agarose gel electrophoresis, reclaiming size is the fragment of 6.0-6.5kb, with the dna fragmentation of these recovery be cloned into through the EcoRV enzyme cut and dephosphorylized carrier pSL118 (Promega company) in, transformed into escherichia coli DH5a obtains the portion gene library that tomato dna group DNA EcoR V enzyme is cut product.Adopt the method for bacterium colony in situ hybridization to screen about 10000 transformants, obtain a positive colony (Fig. 7), called after pSLToT3-6K, the two-way double-stranded dna sequence dna of measuring this positive colony, the result shows that the size of this EcoR V endonuclease bamhi is 6533bp, has in the sequence table SEQ ID № in the sequence table: 2 the nucleotide sequence from 5 ' end 1-6533 position.With the total DNA of tomato is template, under the guiding of primer ttom3-RNAi-lF:CCTCAGATCTGGGCTGAGATATACTAC and primer ttom3-G2:GAGAACAACGTGAAGTTTCAGGAG, 3 ' end fragment of pcr amplification ToTOM3 genomic gene, reaction finishes the back PCR is carried out the detection of 0.8% agarose gel electrophoresis, detected result is (swimming lane M:1KbDNA Marker as shown in Figure 8, swimming lane 1:PCR product), show and obtained the specific band that size is about 4.0kb.Reclaim this specific amplification products, it is connected with T carrier pCR2.1-TOPO, carry out the detection of 0.8% agarose gel electrophoresis to connecting product, detected result is (swimming lane CK:pCR2.1-TOPO as shown in Figure 9, swimming lane 1-3: the recombinant plasmid that connects ToTOM3 genomic gene 3 ' end fragment), obtain 3 kinds of comparisons according to the big recombinant vectors of pCR2.1-TOPO, recombinant vectors to swimming lane 1 and swimming lane 3 carries out two-way double chain DNA sequence mensuration, the result shows that the size of this PCR product is 4165bp, has SEQ ID № in the sequence table: 2 nucleotide sequence from 5 ' end 3965-8129 position, wherein, the 5595th bit base place is the restriction enzyme site of restriction enzyme Sac I from 5 ' end, a BamHI restriction enzyme site is arranged on the sequence of carrier pCR2.1-TOPO (Invitrogen company), utilize these two restriction enzyme sites that the two segment DNA fragments of above-mentioned size for 6533bp and 4165bp are coupled together, obtain the full-length gene group gene fragment of tomato ToTOM3, sequencing result shows that its genomic gene has SEQ ID № in the sequence table: 2 nucleotide sequence, SEQ ID № in the sequence table: 2 by 8129 based compositions, have 11 exons and 10 introns, 1245-1487 bit base from 5 ' end is first exon of this genomic gene, 3519-3609 bit base from 5 ' end is second exon of this genomic gene, 3765-3817 bit base from 5 ' end is the 3rd exon of this genomic gene, 3895-3987 bit base from 5 ' end is the 4th exon of this genomic gene, 4065-4136 bit base from 5 ' end is the 5th exon of this genomic gene, 4791-4863 bit base from 5 ' end is the 6th exon of this genomic gene, 4939-4984 bit base from 5 ' end is the 7th exon of this genomic gene, 6259-6322 bit base from 5 ' end is the 8th exon of this genomic gene, 6403-6456 bit base from 5 ' end is the 9th exon of this genomic gene, 6790-6867 bit base from 5 ' end is the tenth exon of this genomic gene, 7730-8129 bit base from 5 ' end is the 11 exon of this genomic gene, from 5 ' the 1317-1319 bit base of end be the initiator codon ATG of this genomic gene, from 5 ' the 7821-7822 bit base held is the terminator codon TGA of this genomic gene; 1488-3518 bit base from 5 ' end is first intron of this genomic gene, 3610-3764 bit base from 5 ' end is second intron of this genomic gene, 3818-3894 bit base from 5 ' end is the 3rd intron of this genomic gene, 3988-4064 bit base from 5 ' end is the 4th intron of this genomic gene, 4137-4790 bit base from 5 ' end is the 5th intron of this genomic gene, 4864-4938 bit base from 5 ' end is the 6th intron of this genomic gene, 4985-6258 bit base from 5 ' end is the 7th intron of this genomic gene, 6323-6402 bit base from 5 ' end is the 8th intron of this genomic gene, from 5 ' the 6457-6789 bit base of end be the 9th intron of this genomic gene, from 5 ' the 6868-7729 bit base held is the tenth intron of this genomic gene.

The acquisition of embodiment 3, transgenic Fructus Lycopersici esculenti plant

One, the structure of plant expression vector

1, the structure that contains the plant expression vector of ToTOM3 sense-rna

5 ' end and 3 ' end non-coding area sequence according to the full-length cDNA of tomato ToTOM3 design primer, and primer sequence is as follows:

ttom3-F：GTGAGTTTGATTTTGGAATCTCCG；

ttom3-G2：GAGAACAACGTGAAGTTTCAGGAG

With the total DNA of tomato is template, under the guiding of primer ttom3-F and primer ttom3-G2, pcr amplification ToTOM3 full-length gene group gene fragment, reaction finishes the back PCR is carried out the detection of 0.8% agarose gel electrophoresis, detected result is (swimming lane M:1Kb DNA Marker as shown in figure 10, swimming lane 1:PCR product), the specific band that shows the treaty 6.5kb that increases.Reclaim this specific PCR product, it is connected with carrier pCR2.1-TOPO (Invitrogen company), the result has obtained 3 kinds of comparisons according to the big recombinant plasmid of pCR2.1-TOPO, further with restriction enzyme BamHI and Xho I it being carried out enzyme cuts, enzyme is cut product carry out the detection of 0.8% agarose gel electrophoresis, detected result is (swimming lane M:1Kb DNA Marker as shown in figure 11, swimming lane 1-3: recombinant plasmid, BamH I and the XhoI enzyme of swimming lane CK1:pCR2.1-TOPO are cut product, the PCR product of swimming lane CK2:ToTOM3 full-length gene group gene), show that 3 groups of recombinant plasmids all contain size and are the exogenous dna fragment of 6.5kb.Clone shown in swimming lane 2 and the swimming lane 3 is checked order with reverse universal primer M13F and M13R with forward, sequencing result shows that the PCR product of the 6.5kb that amplification obtains is the genomic dna of ToTOM3, and all forward inserts (universal primer M13F sequencing sequence is corresponding with ToTOM35 ' end cDNA sequence), with recombinant plasmid called after pCToT3-6K.With restriction enzyme Xho I pCToT3-6K is carried out enzyme and cut, through T ₄After polysaccharase is mended and is put down, carrying out enzyme with BamHI again cuts, reclaim the exogenous dna fragment of 6.5kb, with its directed cloning to the carrier pBI121 (Clontech) that cuts through restriction endonuclease sma I and BamH I enzyme, transformed into escherichia coli, selecting the single bacterium colony shaking culture in the LB liquid nutrient medium that contains kantlex (50mg/L) that grows spends the night, the upgrading grain, institute's upgrading grain is carried out 0.8% agarose gel electrophoresis to be detected, detected result is (swimming lane CK:pBI121 as shown in figure 12, swimming lane 1-2: recombinant expression plasmid), obtain 2 comparisons according to the big band of pBI121.With institute's upgrading grain is template, carrying out PCR under the guiding of primer ttom3-F and primer ttom3-G2 identifies, reaction finishes the back PCR product is carried out the detection of 0.8% agarose gel electrophoresis, detected result is (swimming lane M:1Kb DNA Marker as shown in figure 13, swimming lane CK:pBI121, swimming lane 1-2: recombinant expression plasmid), amplified the specific band of 6.5kb, show that total length ToTOM3 has been inserted on the carrier pBI121, with recombinant plasmid called after pBIToT3-A.

2, the structure of the RNA interference plasmid pBIToT3R-A of ToTOM3

Design the encoding gene of the siRNA of a pair of primer amplification ToTOM3 according to the full length cDNA sequence of tomato ToTOM3, primer sequence is as follows:

Ttom3-RNAi-1F:5 '- CCTCAGATCTGGGCTGAGATATACTAC-3 ' (line part base is a restriction enzyme Bgl II recognition site);

Ttom3-RNAi-1R:5 '- TCTCACTAGTAGAGGAGAAATCCCAATG-3 ' (line part base is a restriction enzyme Spe I recognition site).

3 ' RACE cloned plasmids pTTOM3-3 with ToTOM3 is a template, under the guiding of primer ttom3-RNAi-1F and primer ttom3-RNAi-1R, carry out pcr amplification, and make the two ends of amplified production add upward restriction enzyme Bgl II and Spe I recognition site respectively.The PCR product is carried out 1.2% agarose gel electrophoresis detect, detected result is (swimming lane M:100bp DNA ladder, swimming lane 1:PCR product) as shown in figure 14, obtains the specific fragment (RNAi (A) fragment) of the about 200bp of size.Cut the PCR product of acquisition and with (construction process: with the total DNA of potato is template, at primer GA-F:5 '-AGG through the RNA of same enzyme double digestion interference plasmid pUCGA with restriction enzyme BglII and the dual enzyme of SpeI GAGCTC CTCGAG ACTAGT AGATCTGGTACGGACCGTACTACTCTATTCG-3 ' (line part base is followed successively by the recognition site of restriction enzyme Sac I, Xho I, Spe I and Bgl II) and primer GA-R:5 '-AGG GGATCCCarry out pcr amplification under the guiding of CTATATAATTTAAGTGGAAAAAAAGGTTAAC-3 ' (line part base is the recognition site of restriction enzyme BamHI), obtain first intron fragment (199bp) of potato GA20 oxidase gene, this fragment is cut with Sac I and BamH I enzyme, be connected with carrier pUC18 (TaKaRa company) through same enzyme double digestion, with the recombinant vectors called after pUCGA that obtains) connect, to connect the product transformed into escherichia coli, and be coated on the LBA substratum that contains penbritin (100mg/L) and cultivated 12-24 hour.Select 3 single bacterium colonies growing in the LB liquid nutrient medium that contains penbritin (50mg/L) shaking culture 12-24 hour, also carrying out enzyme with restriction enzyme BglII and SpeI cuts evaluation to extract recombinant plasmid, the result is (swimming lane M:100bp DNA ladder as shown in figure 15, swimming lane CK1:RNAi (A) fragment, swimming lane CK2:pUCGA, swimming lane 1-3: recombinant plasmid), enzyme is cut the fragment that discharges the about 200bp of length, RNAi (A) fragment that shows pcr amplification has been inserted in the pUCGA carrier, with this recombinant plasmid called after pUToT3R (A-).With restriction enzyme Xba I and BamH I pUToT3R (A-) is carried out double digestion, be connected then with through the RNAi (A) of restriction enzyme BglII and SpeI double digestion fragment.To connect the product transformed into escherichia coli, and be coated on the LBA substratum that contains penbritin (100mg/L) and cultivated 12-24 hour.Selecting 3 single bacterium colonies shaking culture in the LB liquid nutrient medium that contains penbritin (50mg/L) spends the night, also carrying out enzyme with restriction enzyme SalI and XhoI cuts evaluation to extract plasmid, the result is (swimming lane M:1kb DNA ladder as shown in figure 16, swimming lane CK:pUToT3R (A-), swimming lane 1-3: recombinant plasmid), 3 recombinant plasmids all can discharge the fragment of the about 600bp of length, and the about 400bp of fragment that the plasmid pUToT3R (A-) that connects acquisition for the first time discharges, RNAi (A) fragment that shows ToTOM3 is connected on the pUCGA with positive and negative both direction respectively, interstitial granules called after pUToT3R (A) during this recombinant RNA is disturbed.With restriction enzyme Sal I pUToT3R (A) is carried out enzyme and cut, use T ₄Archaeal dna polymerase is mended flat terminal, carrying out enzyme with restriction enzyme SpeI again cuts, behind agarose gel electrophoresis, reclaim the small segment of 600bp, be connected with carrier pBI121 reclaiming fragment through SmaI and XbaI double digestion, to connect the product transformed into escherichia coli, and be coated on the LBA substratum that contains kantlex (100mg/L) and cultivated 12-24 hour.5 single bacterium colonies of picking shaking culture in the LB liquid nutrient medium that contains kantlex (50mg/L) is spent the night, and the extraction plasmid carries out enzyme and cuts evaluation.Because respectively there is the restriction enzyme site (its physical map shown in figure 32) of a BglII at the 2349th and the 9149th bit base place of pBI121, the RNA interference fragment of ToTOM3 has a BglII site, if this fragment is inserted multiple clone site, the rnai expression plasmid of cutting reorganization with restriction enzyme BglII enzyme will obtain three fragments, one of them is 7948bp, and two other segmental length is about 3700bp.Enzyme is cut qualification result (swimming lane M:1Kb DNA Marker as shown in figure 17, swimming lane 1-2: recombinant RNA interference expression plasmid, swimming lane 3:pBI121), after cutting with restriction enzyme BglII enzyme, recombinant plasmid is cut to three fragments, wherein have a fragment consistent with the 7948bp clip size of contrast pBI121, all the other two fragment lengths are about 3700bp (electrophoresis result shows that these two fragments are overlapping).With the recombinant plasmid is template, under the guiding of Auele Specific Primer ttom3-RNAi-1F and primer 35S-F:5 '-AATCTTCGTCAACATGGTGGAGCAC-3 ', carrying out PCR detects, the PCR product is carried out 1.2% agarose gel electrophoresis to be detected, detected result is (swimming lane M:pUC Mix8 DNAMarker as shown in figure 18, swimming lane 1-2: the recombinant RNA interference expression plasmid), amplify length and be about the specific band of 640bp, show that the RNA interference fragment has been connected on the expression vector pBI121, with the rna interference vector called after pBIToT3R-A of this ToTOM3.

3, the structure of the RNA interference plasmid pBIToT3R-B of ToTOM3

3 ' RACE cloned plasmids pTTOM3-3 with restriction enzyme BglII and SpeI double digestion ToTOM3, enzyme is cut product carry out the detection of 1.2% agarose gel electrophoresis, detected result is (swimming lane M:100bp DNAladder as shown in figure 19, swimming lane 1:RNAi (B) fragment), reclaiming also, the purifying size is RNAi (B) fragment of 334bp, the fragment of this 334bp size is connected with rna interference vector pUCGA through restriction enzyme BglII and SpeI double digestion, to connect the product transformed into escherichia coli, and be coated on the LBA substratum that contains penbritin (100mg/L) and cultivated 12-24 hour.3 single bacterium colonies of picking are further cultivated, the extraction plasmid carries out enzyme with restriction enzyme BglII and SpeI and cuts evaluation, the result is (swimming lane M:1kb DNA ladder as shown in figure 20, swimming lane CK1:RNAi (A) fragment, swimming lane CK2:pUCGA, swimming lane 1-2: recombinant plasmid), can discharge the fragment of the about 300bp of length through BglII and SpeI double digestion, show that RNAi (B) fragment has been inserted between the BglII and SpeI restriction enzyme site of pUCGA, with this recombinant plasmid called after pUToT3 (B-).PUToT3 (B-) is connected with RNAi (B) fragment with behind restriction enzyme XbaI and the BamHI double digestion, will connects the product transformed into escherichia coli, be coated on the LBA substratum that contains penbritin (100mg/L) cultivation 12-24 hour.2 single bacterium colonies of picking are further cultivated, the extraction plasmid is done further enzyme with restriction enzyme SalI and XhoI and is cut evaluation, the result is (swimming lane M:100bp DNAladder plus as shown in figure 21, swimming lane CK:pUToT3R (B-), swimming lane 1-2: recombinant plasmid), 2 recombinant plasmids that obtained all can discharge the fragment of the about 900bp of length, and the about 600bp of fragment that the plasmid pUToT3R (B-) that connects acquisition for the first time discharges, RNAi (B) fragment that shows ToTOM3 is connected on the carrier pUCGA with positive and negative both direction respectively, with interstitial granules called after pUToT3R (B) in the recombinant RNA interference of this ToTOM3.

To after interstitial granules pUToT3R (B) enzyme is cut in the above-mentioned RNA interference, use T with restriction enzyme SalI ₄Archaeal dna polymerase is mended flat, cut with restriction enzyme SpeI enzyme again, reclaim the small segment of 900bp through 0.8% agarose gel electrophoresis, be connected with carrier pBI121 through SmaI and XbaI double digestion, to connect the product transformed into escherichia coli, 5 single bacterium colonies of picking are further cultivated, the extraction plasmid carries out enzyme with restriction enzyme BglII and cuts evaluation, enzyme is cut qualification result (swimming lane M:1Kb DNA Marker as shown in figure 22, swimming lane 1-2: recombinant RNA interference expression plasmid, swimming lane 3:pBI121), recombinant plasmid shown in the swimming lane 1-2 is cut to three fragments, wherein there is a fragment consistent with the 7948bp clip size of contrast pBI121, the all about 3700bp of all the other two fragments (electrophoresis result shows that these two fragments are overlapping), with the recombinant plasmid is template, making further PCR under the guiding of Auele Specific Primer ttom3-g:5 '-CCGTCTGTCCTCACACTAGGCAG-3 ' and primer 35S-F identifies, the PCR qualification result is (swimming lane M:pUCMix8 DNA Marker as shown in figure 23, swimming lane 1-2: the recombinant RNA interference expression plasmid), pcr amplification goes out the specific band of the about 440bp of length, show that the RNA interference fragment all has been connected on the expression vector pBI121, with the rna interference vector called after pBIToT3R-B of this ToTOM3.

Two, the genetic transformation of tomato

1, three close combined techniqueses transform Agrobacterium with plant expression plasmid

With the three kind of plant expression plasmid pBIToT3-As of three close combined techniqueses with the step 1 structure, pBIToT3R-A and pBIToT3R-B (Rogers S.G., Horsch R.B., and Fraley R.T.1986.Gene transfer inplant:production of transformed plants using Ti-plasmid vectors.MethodsEnzymol., 118:627-640) transform Agrobacterium EHA105 respectively, screen at the LA flat board that contains 50mg/mL Rifampin (Rif) and 50mg/mL kantlex, obtain containing Agrobacterium-mediated Transformation of above-mentioned 3 kind of plant expression plasmids.

2, the genetic transformation of tomato

Respectively conversion is had Agrobacterium-mediated Transformation of pBIToT3-A, pBIToT3R-A and pBIToT3R-B to import tomato with following method, the following substratum that is used for tomato tissue culture and conversion is the MS minimum medium.

1) preparation of Flamingo Bill explant

With reference to people's such as Javier Pozueta-Romero method (Pozueta-romero, J., Houlne, G.,

L., et al.2001.Enhanced regeneration of tomato and pepper seedlingexplants for Agrobactereium-mediated transformation.Plant cell, Tissue andorgan culture., 67:173-180) preparation Flamingo Bill explant, concrete grammar is: tomato seeds is separated one by one, with distillation washing 3 times, also ceaselessly stirred 2 minutes with 80% alcohol immersion then, adding 4-6 drips 100% Tween-80, remove ethanolic soln, again with sterilized water washing 2-3 time.Adding available chlorine and be 1% NaClO solution and 4-6 drips 100%Tween-80 and ceaselessly stirred on agitator 15 minutes, remove NaClO solution, with aseptic washing 2 times, repeat secondary again, color until tomato seeds becomes golden yellow by brown, and so far, tomato seeds is aseptic substantially, use aseptic water washing 6-10 time again, be placed on the aseptic filter paper and dry.Drying the back has the seed access in the 1/2MS substratum culturing bottle of (containing 3% sucrose), seal, in 25-28 ℃ illumination box, cultivated 7 days, culturing bottle is placed in the super clean bench, uncap replenishes the moisture in the culturing bottle again, aseptic seedling was cultivated 15 hours under open environment, make its vertical growth, cotyledon is open and flat, in order to next step operation.One side cotyledon of the aseptic seedling of cultivating is all cut together with terminal bud and peripheral meristem from petiole base, only stay a side cotyledon, most of root system of aseptic seedling is cut only keep the radicle that length is 2-3cm in addition.

2) infect explant Flamingo-Bill with Agrobacterium EHA105

Conversion there is the Agrobacterium of pBIToT3-A, pBIToT3R-A and pBIToT3R-B on the YEB flat board that contains 50mg/mL kantlex and 50mg/mL Rifampin, rule, put 28 ℃ of about 24h of constant temperature culture, picking list colony inoculation is in containing corresponding antibiotic YEB liquid nutrient medium after growing bacterium colony, and 28 ℃ of constant temperature shaking tables (200 rev/mins) are cultivated about 24h to OD ₆₀₀Be 04-0.6, change in the aseptic centrifuge tube that the centrifugal 10min of 3000rpm abandons supernatant liquor, the thalline of collecting is cleaned once with the MS nutrient solution and suspend again, be used for the conversion of tomato after diluting 50 times.

The explant Flamingo-Bill of step 1) preparation put into contains step 2) the MS liquid nutrient medium (adding the Syringylethanone that final concentration is 100 μ mol/L in addition) of activatory Agrobacterium, ceaselessly shook 10 minutes, explant taken out and with twice of aseptic water washing, put into the common culture medium of MS then one by one and (on the basis of MS minimum medium, added 6-BA 2.0mg/L, indolylacetic acid 0.1mg/L, in the big culture dish of 15cm diameter AS 100 μ mol/L), seal, in illumination box, cultivated 2 days.

3) induction

Cultivate after 2 days, its differentiation screening culture medium of transferring (has been added ZT1.0mg/L on the basis of MS minimum medium, IAA 0.1mg/L, Km 50mg/L and Cef 200mg/L) in, 2-3 week cultivated in continuation in illumination box, culture condition is 25-28 ℃, 15 hours every days illumination/9 hour dark.

4) the taking root of transfer-gen plant, hardening and transplanting

To in the differentiation screening culture medium, downcut (related callus is not wanted in attention) from callus by the normal plant of growth (long long) to about 2-3cm.Downcut the back and insert in the root media (on the basis of MS minimum medium, having added Km 50mg/L, Cef 150mg/L and NAA 0.2mg/L), continue cultivation it is taken root.After taking root, with the covered opening of culturing bottle and keep the skin wet, make plant adapt to external environment gradually, after 3-4 days plant extracted at leisure, clean root with agar, be transplanted in the soil, keep the humidity of soil, culture temperature is made as 25-30 ℃.

Three, the Molecular Identification of transfer-gen plant

The kalamycin resistance plant is potted plant in the insect protected solarium, get its blade after one month, extract total DNA according to a conventional method, and as template, under the guiding of primer Kam-R:5 '-GATCTGGATCGTTTCGCATG-3 ' and primer Kam-F:5 '-AAGGCGATAGAAGGCGATGC-3 ', carrying out PCR detects, obtain the transfer-gen plant that 26 strains can amplify the specific band of 800bp altogether, wherein 13 strains of antisense RNA plasmid pBIToT3-A, change 10 strains of RNA interference plasmid pBIToT3R-A, change 3 strains of pBIToT3-B.Below this 26 strain transfer-gen plant is carried out further PCR and Southern hybridization detection with 35S-F and corresponding Auele Specific Primer.

1, the Molecular Identification of sense-rna transfer-gen plant

Extract total DNA that the transfer-gen plant of pBIToT3-A is changeed in 13 strains, and be template with it, under the guiding of primer 35S-F and primer ttom3-G (5 '-CAATTGAATTCATTATTTCTCC-3 '), carrying out PCR detects, with the non-transgenic tomato is contrast, and the result is (swimming lane M:pUCMix8 DNA Marker, swimming lane CK: non-transgenic tomato as shown in figure 24, swimming lane 1-13: transgenic Fructus Lycopersici esculenti), amplify the transfer-gen plant that is of the about 400bp specific band of length.With restriction enzyme BamH I total DNA of transfer-gen plant is carried out enzyme and cut, use P ³²The RNAi of mark (B) fragment is carried out Southern hybridization, results of hybridization is (swimming lane M:1kb DNA Marker as shown in figure 25, swimming lane CK: non-transgenic tomato, swimming lane 1-13: the transgenic Fructus Lycopersici esculenti that changes pBIToT3 (A)), all plant all have the endogenous hybrid belt of an endogenous 6.2kb, and a hybrid belt that varies in size also can appear in transfer-gen plant except endogenous hybrid belt, shows that the sense-rna fragment of ToTOM3 has been incorporated on the different positions of tomato dna group.

2, the evaluation of RNA interference of transgene plant

With conversion total DNA of the transfer-gen plant of rnai expression plasmid pBIToT3R-A being arranged is template, under the guiding of primer 35S-F and primer ttom3-RNAi-1F, carrying out PCR detects, detected result is (swimming lane M:pUCMix8 DNA Marker as shown in figure 26, swimming lane CK: non-transgenic tomato, swimming lane 1-10: transgenic Fructus Lycopersici esculenti), what can amplify the about 600bp specific band of length is the transgenic positive plant; Having the transfer-gen plant of pBIToT3R-B to carry out PCR to conversion with above-mentioned same method under the guiding of primer 35S-F and primer ttom3-g detects, detected result is (swimming lane M:1kb DNA Marker as shown in figure 28, swimming lane CK: non-transgenic tomato, swimming lane 1-10: commentaries on classics pBIToT3 (A) transgenic Fructus Lycopersici esculenti), what can amplify the about 400bp specific band of length is the transgenic positive plant.With restriction enzyme EcoRI total DNA of above-mentioned plant is carried out enzyme and cut, will change pBIToT3R-A's and P ³²The RNAi of mark (A) fragment is carried out Southern hybridization, and results of hybridization is (swimming lane M:1kb DNA Marker, swimming lane CK: non-transgenic tomato, swimming lane 1-10: change pBIToT3 (A) transgenic Fructus Lycopersici esculenti) as shown in figure 27, will change pBIToT3R-B's and P ³²The RNAi of mark (B) fragment is carried out Southern hybridization, and results of hybridization is (swimming lane M:1kb DNA Marker, swimming lane CK: non-transgenic tomato, swimming lane 1-3: transgenic Fructus Lycopersici esculenti) as shown in figure 29.All plant all have the endogenous hybrid belt of an endogenous 5.8kb, and transfer-gen plant a hybrid belt that varies in size all occurs except endogenous hybrid belt, show that two RNA interference fragments are incorporated into respectively on the different positions of tomato dna group.

The disease resistance of embodiment 4, transfer-gen plant detects

Adopt frictional inoculation method, the transgenic Fructus Lycopersici esculenti of the 5-6 leaf phase that all embodiment 3 is obtained with CMV and TMV carries out inoculation experiments respectively, non-transgenic tomato with the isometric growth phase is contrast, regularly carry out observation of symptoms, and the viral level conventional biology measuring method and DAS-ELISA method mensuration transgenic Fructus Lycopersici esculenti plant are used in inoculation after 75 days in.

1, symptom performance

Inoculate after 10 days, the mottled symptom (Figure 20 B) of non-transgenic tomato seedling performance of inoculation TMV, inoculation CMV non-transgenic tomato seedling shows typical flower leaf paresthesia (Figure 20 D), and transgenic seedling does not then have any symptom performance (Figure 20 A, Figure 20 C).Inoculate after 30 days, except that slight mottled symptom appearred in the minority transgenic seedling, most of transgenic seedling did not still have any symptom performance.Inoculate after 90 days, inoculation TMV non-transgenic plant still shows as mottled symptom (Figure 21 B), transfer-gen plant does not have the serious yellow of blade of any symptom performance (Figure 21 A) inoculation CMV non-transgenic tomato seedling, form the blister spot (Figure 21 D) of recessed prominent injustice, transfer-gen plant then shows slight class and refutes symptom, forms a spot of blister spot (Figure 21 C).

2, TMV relative content in the transfer-gen plant

TMV is after 75 days in inoculation, gets the new leave (third from the bottom new leave) of transfer-gen plant and adjoining tree respectively, clip area identical (about 2 * 2cm ²), with 1mL phosphoric acid buffer (0.02M Na2HPO ₄, 0.001M KH2PO4 pH7.2) wears into homogenate,, is inoculated on the Chenopodium amaranticolor blade 100 times of homogenate dilutions with phosphoric acid buffer, adds up withered spot number after five days.Statistics is as shown in table 1, with the transgenic Fructus Lycopersici esculenti is inoculation source, the withered spot number that forms on Chenopodium amaranticolor all significantly is lower than the contrast tomato plant that grows directly from seeds, wherein the individual plant of antisense rna expression plasmid is abbreviated as An (n is the numbering of individual plant), and the individual plant that changes the RNA interference plasmid is abbreviated as R (A) n and R (B) n respectively.

Other gets the 0.1g blade, adds the 1mL bag and is cushioned liquid (0.015M Na ₂CO ₃, 0.035M NaHCO ₃PH9.6) wear into homogenate, being used for DAS-ELISA after diluting 1000 times detects, detected result is as shown in table 2, the concentration that shows TMV in all transfer-gen plants all is starkly lower than the non-transgenic plant, consistent with withered spot measurement result, TMV content significantly reduces in all transfer-gen plants, and TMV is had stronger resistance.

The biology measurement result (inoculating 75 days) of TMV relative content in table 1 transfer-gen plant

Strain system	Average withered spot number	Standard deviation (S.D.)	Standard error (S.E.)	Significance
					Non-transgenic plant (contrast)	171.00	3.61	2.08
A6	20.33	3.22	1.86	Extremely remarkable
					A25	25.67	1.53	0.88	Extremely remarkable
A36	40.67	7.02	4.06	Extremely remarkable
					A52	52.67	3.22	1.86	Extremely remarkable
A53	12.00	2.65	1.53	Extremely remarkable
					A59	51.67	4.04	2.33	Extremely remarkable
A94	24.00	3.61	2.08	Extremely remarkable
					A99	24.33	2.52	1.45	Extremely remarkable
A119	22.00	3.61	2.08	Extremely remarkable
					A121	34.33	3.06	1.76	Extremely remarkable
A123	20.67	2.52	1.45	Extremely remarkable
					A134	90.67	5.13	2.96	Extremely remarkable
A155	58.67	4.51	2.60	Extremely remarkable
					R(A)6	31.00	4.58	2.65	Extremely remarkable
R(A)8	26.00	2.65	1.53	Extremely remarkable
					R(A)12	37.00	7.55	4.36	Extremely remarkable
R(A)55	86.67	5.86	3.38	Extremely remarkable
					R(A)66	22.33	3.06	1.76	Extremely remarkable
R(A)69	25.00	2.65	1.53	Extremely remarkable
					R(A)71	38.33	3.06	1.76	Extremely remarkable
R(A)111	23.67	2.31	1.33	Extremely remarkable
					R(A)114	90.67	6.43	3.71	Extremely remarkable
R(A)139	64.67	3.79	2.19	Extremely remarkable
					R(B)16	17.00	2.00	1.16	Extremely remarkable

R(B)28	25.33	2.52	1.45	Extremely remarkable
					R(B)46	14.67	3.06	1.76	Extremely remarkable

The DAS-ELISA measurement result (inoculating 75 days) of TMV relative content in table 2 transfer-gen plant

Strain system	Average OD only	Standard deviation (S.D.)	Standard error (S.E.)	Significance
					Non-transgenic plant (contrast)	1.982	0.003	0.002
A6	0.235	0.002	0.001	Extremely remarkable
					A25	0.229	0.003	0.001	Extremely remarkable
A36	0.362	0.003	0.002	Extremely remarkable
					A52	0.527	0.003	0.002	Extremely remarkable
A53	0.235	0.004	0.002	Extremely remarkable
					A59	0.512	0.003	0.001	Extremely remarkable
A94	0.222	0.003	0.002	Extremely remarkable
					A99	0.220	0.003	0.002	Extremely remarkable
A119	0.220	0.001	0.001	Extremely remarkable
					A121	0.405	0.004	0.002	Extremely remarkable
A123	0.216	0.003	0.002	Extremely remarkable
					A134	0.948	0.003	0.002	Extremely remarkable
A155	0.669	0.002	0.001	Extremely remarkable
					R(A)6	0.275	0.003	0.002	Extremely remarkable
R(A)8	0.211	0.003	0.002	Extremely remarkable
					R(A)12	0.433	0.003	0.002	Extremely remarkable
R(A)55	0.770	0.002	0.001	Extremely remarkable
					R(A)66	0.213	0.002	0.001	Extremely remarkable
R(A)69	0.281	0.003	0.001	Extremely remarkable
					R(A)71	0.381	0.003	0.001	Extremely remarkable
R(A)111	0.204	0.003	0.001	Extremely remarkable
					R(A)114	0.748	0.003	0.002	Extremely remarkable
R(A)139	0.504	0.003	0.001	Extremely remarkable
					R(B)16	0.254	0.003	0.002	Extremely remarkable
R(B)28	0.313	0.003	0.002	Extremely remarkable
					R(B)46	0.215	0.005	0.003	Extremely remarkable

3, the relative content of CMV in the transfer-gen plant

CMV is after 70 days in inoculation, gets the new leave (third from the bottom new leave) of transfer-gen plant and adjoining tree respectively, clip area identical (about 2 * 2cm ²), wear into homogenate with the 1mL phosphoric acid buffer, direct inoculation is added up withered spot number after five days to the Chenopodium amaranticolor blade.Statistics is as shown in table 3, is inoculation source with the transgenic Fructus Lycopersici esculenti, and the withered spot number that forms on Chenopodium amaranticolor all significantly is lower than non-transgenic plant according to the facts.

Other gets the 0.1g blade, adding 1mL bag is cushioned liquid and wears into homogenate, being used for DAS-ELISA after diluting 10 times detects, detected result is as shown in table 4, the concentration of TMV all is starkly lower than the non-transgenic plant in all transfer-gen plants, consistent with withered spot measurement result, show that all transfer-gen plants all have certain resistance to CMV.

The biology measurement result (inoculating 70 days) of CMV relative content in table 3 transfer-gen plant

Strain system	Average withered spot number	Standard deviation (S.D.)	Standard error (S.E.)	Significance
					Non-transgenic plant (contrast)	148.00	2.65	1.53
A6	22.00	4.36	2.52	Extremely remarkable
					A25	18.33	2.08	1.20	Extremely remarkable
A36	22.67	3.79	2.19	Extremely remarkable
					A52	23.67	8.02	4.63	Extremely remarkable
A53	28.33	2.52	1.45	Extremely remarkable
					A59	22.00	2.65	1.53	Extremely remarkable
A94	21.33	3.22	1.87	Extremely remarkable
					A99	26.67	3.79	2.19	Extremely remarkable
A119	30.67	4.04	2.33	Extremely remarkable
					A121	74.33	5.13	2.96	Extremely remarkable
A123	31.00	6.00	3.46	Extremely remarkable
					A134	78.00	2.65	1.53	Extremely remarkable
A155	60.00	7.00	4.04	Extremely remarkable
					R(A)6	25.00	4.00	2.31	Extremely remarkable
R(A)8	85.67	5.69	3.28	Extremely remarkable
					R(A)12	62.00	5.57	3.22	Extremely remarkable
R(A)55	76.00	5.57	3.22	Extremely remarkable
					R(A)66	25.33	4.51	2.60	Extremely remarkable
R(A)69	28.33	3.06	1.76	Extremely remarkable
					R(A)71	58.33	5.51	3.18	Extremely remarkable
R(A)111	28.00	3.61	2.08	Extremely remarkable
					R(A)114	74.67	5.69	3.28	Extremely remarkable
R(A)139	46.33	5.86	3.38	Extremely remarkable
					R(B)16	21.67	3.06	1.76	Extremely remarkable
R(B)28	29.00	2.65	1.53	Extremely remarkable
					R(B)46	20.00	2.65	1.53	Extremely remarkable

The DAS-ELISA measurement result (inoculating 70 days) of CMV relative content in table 4 transfer-gen plant

Strain system	Average OD value	Standard deviation (S.D.)	Standard error (S.E.)	Significance
					Non-transgenic plant (contrast)	1.512	0.003	0.001
A6	0.192	0.003	0.002	Extremely remarkable
					A25	0.213	0.003	0.001	Extremely remarkable
A36	0.231	0.003	0.002	Extremely remarkable
					A52	0.243	0.003	0.002	Extremely remarkable
A53	0.224	0.003	0.001	Extremely remarkable
					A59	0.251	0.003	0.002	Extremely remarkable
A94	0.213	0.003	0.002	Extremely remarkable
					A99	0.201	0.002	0.001	Extremely remarkable
A119	0.209	0.002	0.001	Extremely remarkable
					A121	0.384	0.002	0.001	Extremely remarkable
A123	0.195	0.003	0.002	Extremely remarkable
					A134	0.892	0.003	0.002	Extremely remarkable
A155	0.625	0.002	0.001	Extremely remarkable

R(A)6	0.209	0.001	0.001	Extremely remarkable
					R(A)8	0.608	0.003	0.001	Extremely remarkable
R(A)12	0.503	0.002	0.001	Extremely remarkable
					R(A)55	0.572	0.001	0.001	Extremely remarkable
R(A)66	0.201	0.003	0.002	Extremely remarkable
					R(A)69	0.259	0.002	0.001	Extremely remarkable
R(A)71	0.363	0.003	0.002	Extremely remarkable
					R(A)111	0.184	0.002	0.001	Extremely remarkable
R(A)114	0.403	0.003	0.001	Extremely remarkable
					R(A)139	0.334	0.003	0.002	Extremely remarkable
R(B)16	0.203	0.002	0.001	Extremely remarkable
					R(B)28	0.284	0.003	0.001	Extremely remarkable
R(B)46	0.195	0.003	0.002	Extremely remarkable

Sequence table

<160>3

<210>1

<211>295

<212>PRT

＜213〉tomato belongs to tomato (Lycopersicon esculentum Miller)

<400>1

Met Gly Arg Ala Glu Met Val Val Gly Pro Ser Glu Lys Val Ala Val

1 5 10 15

Val Ala Tyr His Leu Asn Asp Ala Ile Asn Trp Trp Asp Asp Val Asn

20 25 30

Arg Ser Leu Asp Trp Gln Asn Arg Ile Phe His Val Leu Ala Val Leu

35 40 45

Tyr Gly Val Val Ala Val Val Ala Leu Val Gln Leu Ile Arg Ile Gln

50 55 60

Met Arg Val Pro Glu Tyr Gly Trp Thr Thr Gln Lys Val Phe His Phe

65 70 75 80

Leu Asn Phe Phe Val Asn Gly Val Arg Ser Leu Val Phe Thr Phe Arg

85 90 95

Arg Asp Val Gln Lys Leu His Pro Glu Ile Val Gln His Ile Met Leu

100 105 110

Asp Met Pro Ser Leu Ala Phe Phe Thr Thr Tyr Ala Leu Leu Val Leu

115 120 125

Phe Trp Ala Glu Ile Tyr Tyr Gln Ala Arg Ala Val Ser Thr Asp Gly

130 135 140

Leu Arg Pro Ser Phe Phe Thr Ile Asn Gly Val Val Tyr Ala Ile Gln

145 150 155 160

Ile Ile Leu Trp Leu Ile Met Trp Trp Lys Pro Ile Arg Val Leu Phe

165 170 175

lle Leu Ser Lys Met Phe Phe Ala Gly Val Ser Leu Phe Ala Ala Leu

180 185 190

Gly Phe Leu Leu Tyr Gly Gly Arg Leu Phe Leu Met Leu Gln Arg Phe

195 200 205

Pro Val Glu Ser Arg Gly Arg Arg Lys Lys Leu Gln Glu Val Gly Tyr

210 215 220

Val Thr Thr Ile Cys Phe Ser Cys Phe Leu Ile Arg Cys Val Met Met

225 230 235 240

Cys Phe Asn Ala Phe Asp Lys Ala Ala Asp Leu Asp Val Leu Tyr His

245 250 255

Pro Ile Leu Asn Leu Ile Tyr Tyr Leu Leu Val Glu Ile Leu Pro Ser

260 265 270

Ser Leu Val Leu Phe Ile Leu Arg Lys Leu Pro Pro Lys Arg Gly Ile

275 280 285

Thr Gln Tyr His Pro Ile His

290 295

<210>2

<211>8129

<212>DNA

＜213〉tomato belongs to tomato (Lycopersicon esculentum Miller)

<400>2

aaatgttaga ggttttacca acatccgttc cccaaaagcc ccaaaaatcc aacaagacac 60

cacgtataac gtgatcttag aattattcat atgaacgttc aacattttct ttattataaa 120

gaaagatatt ttactctcta ctgtttctcg taatagaaaa tagctaaaga attatctata 180

tttacaacaa tgcgaaatcc taatcctata ttattagact aaagttttta ttagttgatt 240

tcttctccta atgcatgaag gacatgggtt taaaaaaatc gaacataccg ataaatcgaa 300

tcgaaaaaat gttattgggg tattgttatt gtgttattga tttattgggg tttaatgagt 360

ttataaaaat aatttattag gttattggtt cggcatcagt ttttactatt ggattattgg 420

taaatcgata acccaataaa atggtaataa tttattattt tgcccttcct aattattaat 480

attaatactt taatatataa ttaaacacta taactatatc aaattattag aactctacca 540

acttcaccgt atgccatttt actagctttt actatttact caaaacctaa agattaaagt 600

aaggggttca caattgaagc tatttgattt tagttttagt tttagcttta gtgttggact 660

agtttatttt agttttagtt tgtaattgta ggttgtagca tttgcaagtt tgtaaaggtt 720

cataatttga ttaacataaa aaattacata ctatgttttg gcgataacat gtaattataa 780

ccttcgaact atatattctc ttattgatgt aatttctcat tatctttctt gtttcactat 840

atcaaaacat ctagagaagt gaaaagacat ataatatttc acgggcattt tcttattgga 900

taaatcgaaa tcgaactgat aatgattaaa aatcggtaca tcgaaaaccg ataaagaata 960

tcttattggt ttgttattgg attagcatat ttaaaaacca aaaaccgata atccgaaccg 1020

aaccgaccgg tgcacacccc taatcaagga tatatatata tatcggacaa cattacccct 1080

ctaaacgttt tttttaatat tgtatttgtt tttatatata ataaaataat accttttttt 1140

tctagccgtc cattttgaaa aacaaaagaa aaaaaagtac aaatttaaat aaacaaaaat 1200

agtaaatgaa tttttttaaa aattaatttc tgaaaaaggt agttgccgat tttggtgttt 1260

gatttttttt tggggggatt ttgaaattgg tgagtttgat tttggaatct ccggtgatgg 1320

gacgggcgga gatggttgta ggcccgtcgg agaaggtggc ggtggtggca tatcatctga 1380

atgatgcaat caattggtgg gacgatgtga acagatctct tgattggcaa aaccgtatat 1440

tccatgtcct tgctgttctc tacggcgttg tcgccgtcgt tgctcttgta aattctgtct 1500

ctctatcttt acgtctcagc gtttgagttt tgaattttat gagttaattt taacataatt 1560

gttatgttga ttgggataag agaggttcca tcaggtggta agcatccttc cttgtgaact 1620

agaagaaagg aggtctagga ggtaagttgt tgtcatgtta gtatgatgtg acaggttcga 1680

gcggtgtaaa taggcttttt gcatccaata gaccaatgtg gttcagtgca tagtaggagc 1740

ttagtataga agaaaggagg tcgtctagac gggaaagatg ttgtcatgtt agtaggatgt 1800

gacaggtttg agctgtgtaa ataggctttt tgcatccaat agagctttgt ggttcagtgc 1860

atagcaggag cttagtatac tgggctgctc tttttatatt gttatgttga ttggtaaagt 1920

aagattgggc tcatatatgt gttggagatg tatgaagaat ctgaatattt gttttatgtt 1980

gcttgttagt tgtttgaatt gaatgtcatg tgcatcatgt aactccaaac tttgatgttt 2040

tcgtcaaggg aagaattcta ggtggaactt ttgaatttga ggcattttag acttgttttt 2100

gatggtcctt gaaacgggga tagataactc atagagtatg catcaagctt tcaaggggcg 2160

cttactagaa ctatcactca gcagagcttt agtttcggct catatcagtg ttttagacgg 2220

caaaaggcga caagggtctg ccttgccata aggcgaggcg accggcgagg cactcacctt 2280

tttgaagtgt ggcaccaatt aataccaaaa aattaaaata ttgaattgca tatgtaaata 2340

ataaaaatct caatagcaat aacatattag caaatagttt aattcaaaac taaaaataga 2400

tagtacatac tataattcta gaacatgaat gagaaaaaaa caaaacaaaa gtcaaaacag 2460

aggtagaagt gactctgaag tccgaagaag aaggaaaaag aaacccaaaa aagaagaagt 2520

ttgaagaaga aaagaagaaa catgtcttgg ttggactttc gagtagccgg aaaagtttgc 2580

ctggtcgtcg aaggagtcta atcgtaagcc ctaaaattac cttttaactt ttaaaatcct 2640

aaattggtag tcttttttta agaatataca aaaggtgacg cctttcttgc ttttcttgca 2700

tctcacctct cgccttttgt cgccatggct cgcttcgcca caaagttaaa aggcgatgag 2760

gggtcgcctc gcctctcgcc cattggcgac gaggcgatcg cctttcgcaa cacttggctc 2820

atatggatag ggataggaaa aagagagatt ttcgtcgttt tgggatcatt cggataaaca 2880

cagtaatttg cggaagtgga gtattctata gttatagtag attaatacac aatttgttca 2940

agagacaatt gcttcttaac cggaaaatac ttgcttaaat agatatatca aataggaatt 3000

gtctttatat gatttcatat agacacttga aagtgattaa aactgaaatt tgaaactaaa 3060

aagggaagtt gttgaagtag gtaaaacttt taaaggattg catcttttcc tccctgaaag 3120

ttcatgatta ttatttccgg tatggcgggt gttgttgttg gtgttcaggt gtttagtcat 3180

ggcaaaacta ttatatgttt ccagggagaa tatgcactta tagtatgtat atttttggca 3240

aaagttgaaa ttgtctaatt tccactaatt ggtttatgta tgcaaaaaag agggggcaca 3300

tggcctggag tttgaaattt aaattttgcc aattggtttg tttgtgtctc attgattgat 3360

tttggtatac ttgtttaaat tttcatgcat gttcttgcgc attggatgat catattgtta 3420

ttcagttatt gctctacaaa attattatta ccagtaccaa tacttcaatt tatgtgcggc 3480

tctggaattt gtttcttact ttgcaacttg gcaatcaggt acaattaatt cgcattcaaa 3540

tgagagttcc tgaatatggc tggaccactc aaaaagtctt ccactttctc aatttctttg 3600

tgaatggagg tcagtatctt tcttttcttt acttctaatt attttttgaa catcctgatg 3660

ggaagttcca ttacacatgc ttttcaaatg attgttcctg tacactccac tttgttttga 3720

cgtgttgtct ttgttattta actgtgtctt catgttcttg gcagttcgct cgctagtttt 3780

tacatttcgt cgggatgttc agaagttgca cccggaggtt aagcaacaga gtatcttgat 3840

gttttttgtc ttacactcct ttaattttta acgctttata ctacattttt gcagattgtg 3900

caacatatta tgcttgatat gccaagtctt gcattcttca caacttatgc tctgctagta 3960

ttattctggg ctgagatata ctaccaggtt cttgtggtct gtctcaattt ttgtgtagat 4020

atatatcttc tcaaggttaa catatttgtt ttttccatga caaggcacgt gctgtgtcca 4080

cggatgggct tagacctagt ttcttcacaa tcaacggagt ggtttatgct attcaggtaa 4140

atatgtgaca gttatgcaat acttatataa actgcttgtt tcaatttatt cgtctttctt 4200

tcctttttgg tccatttcaa aagaatccct tggcaggcgc atcaatttat tttggtgctt 4260

gctagaaata aactctggtc tgggagtttt gacatcaata tatttctaaa agtgacaaca 4320

agtttcatct gatcagaatt tttctcaaca ttcttaaaca tgtcgttcat agggtacttc 4380

actcagtacc ccggccatcc tctccaactc ccaaacgtta aggataccct ccacctgagc 4440

atcagcaatt actacaattt tcccttctta agggtattct attagcagaa atgagagcac 4500

agtgcctaat atttcacaaa atgctgagac cactcataaa tcttagggat atatcaaacg 4560

aagtgtcatt gataaggaaa tatgtttctg tcatttggag atactttatc aagactacat 4620

tttgtttgga tgagatgttc agtgcccgca gttagacatg gtgactttta tgttttctca 4680

tggaaactgt tgcatgaaac atgtgagaca agggtttact cttttaaatt gctgtaccta 4740

tttggtggat gttcattgct gattttcttt gtttcttata tatcttgcag attatattat 4800

ggctgataat gtggtggaaa cctattcgag tactcttcat cttatccaag atgttttttg 4860

caggttcttg ttttagattt aacttatttt tagtattgca tggatctgtt gcgaagtatt 4920

aacataatgt acttgcaggt gtatccctat ttgcagcatt gggatttctc ctctacggtg 4980

gaaggtaaaa tcttgatttt tagtatcagt cactttgtca ccgacaggaa ttaccgaatg 5040

tacatttgtt aaatcgcata cagaatgggt ataaatcaag cacataagca taaagcttag 5100

cacttgtttc tatcgttcgt taaaggatgt tttatcttct gattcgttgc tattcttaac 5160

acttctttag aaggtagaga tggatatgta gtcaattgtt gtttgctttg atcaaaagcc 5220

aatttttttg gacgaaaagg tgatctgctt cctagcctat acatccacag atctaaacct 5280

tcacgagatg acttctgttg tgtcctaagc gtcaccattt tctgaaatta agtatcttgt 5340

atattggcat gtatcttatg cgatcatcgg ttactttcag taacctgtac ttcattagtt 5400

tgatatttga taccaggagc acacattgac aaagaggaca taagtaagaa gaagatgtag 5460

aaggaaggag ggaaaagaag gagggggcgg gagtgaagaa ggaaaatgaa agaaacatac 5520

cctaatatgg tgaattagag aagagaggag caaaagattg aaaattggaa ccttcgagaa 5580

atgaatggag agctcattag gaggagagat gagtggagga gtttcccatt cttgaccaac 5640

tattttgaca atgcaaccat taacctctgt tttgcccttg tcgcattcga cacctgctat 5700

atcgatcatt tttatcctcc tagctaaaaa gtggaagatt ccccattgaa gtcttccctc 5760

atctctaaag agtactctag agtgaagttc ctaatacata ggaaaagaaa ttggcaggtg 5820

ctagattgaa tgaacgcagc aaccacggca gtaatagatg acaaacatat aaaaaagtaa 5880

aatatcttca attacactta cttttagtga aagttcatgt gaccttttat tgccctgcct 5940

aatgaaagtt caaaagtctt ctcaagcatt atcttagttt gtcggcacgg tcgtacaaag 6000

atgcatagtg ttgttgaacg tgctgcttaa aaataaaatt agtaatttaa atattaagat 6060

actgcaaaaa aagttcttac agcactgcgt atagcacatg tttgtttagt ttgtggattg 6120

acctttgcta tatctcgctt gagtaccttg tgtactctta tgtttgaata attgggtcca 6180

tgcaacttgt atgtcattca tattcatcct tcaatatcac cttactgttt ggcttgatat 6240

tctttcactt tcttccaggc tttttcttat gttacagcgg tttccagtag aatcaagagg 6300

gagacgcaag aagctgcagg aggtatgtta ttagtacttc tctttcttgg tatttcattc 6360

ttattaggtc ttttgacttc tccggcattt tggcttctgt aggttggtta tgtcacgaca 6420

atatgttttt catgcttcct cattagatgc gttatggtaa gtccatattc ctcgtgaact 6480

aaacattttt tagctgatca taactaaccc atgtttgtag tgtgtgaatg atatctatat 6540

tttgctttag atggtttctt ttttgtctaa aacctttctt gatacaataa gttactctta 6600

gctgagatgc gtgcaagctg ggtcagacac ccttttttcc ggaaaaaaaa agtcttagct 6660

gatgcattga ttttctttct atagggcatc tttctcaaat tttttccttt ctatctatag 6720

ggcataaagc ctctttggtt attctatatg gcttaatggt tagtcactct attattatct 6780

ttgctacaga tgtgcttcaa tgcatttgat aaagctgcag atcttgatgt tttgtatcat 6840

cctattttga atttgatata ttacctggtg agttccatat cactgaactt ctattagcac 6900

ttctttaggt aaaatattgg ttgctgcgcc ataatcaaaa gaagtattgg cagtcagtat 6960

attttatata attattgcca aatcacgata aattggataa ttcacatgat atttcagctt 7020

gtggcatctt acaatcagtt ttatgcgcca aaattctgtt tggctccttt tctatgtagt 7080

cttttgagtt gggatggggg tttcttactt gtgccatgaa ctcaggtttc tttctcttcg 7140

tttgacattt tgtttaaatt gaaaattgga ttcaaaatct taagattatg gtgaaatatt 7200

tgagacacag ggagtggaaa tcatgttctg aaattatagc atggttatta ttttggcaca 7260

tacataaaca gacacttaaa cttggcctca acgggcatat aagcattgca actttgagaa 7320

agcacatcta gacacctcaa ctaaacattc caactcatcc ccactctata tcttgtggac 7380

actctgatgt ggctcataaa ttttggaggt gtctagatga tcactttgta agtcggagtg 7440

ttcaactgac acaatggaga cgagttgagg tgtcgtgtgt gcatactcaa agttggagtg 7500

gttacttgcc agttgaggcc gattttgagt gtctgtttat gtattatgcc tattatttca 7560

cttgatcgtg tcctatccaa accttagttt catccaaatt tcaaatcatg agtatatact 7620

tagacatggt gttttttact ttgcgctttg gggggtagaa agtggagaaa atggagtaat 7680

atttttctgt atgttttgag actaagcaaa ctttttaacc tcttcgcagt tagtggagat 7740

actgccttct tctcttgtcc tttttatttt aaggaagttg cctccaaagc gagggatcac 7800

ccaataccac cctattcact aatacattaa gagggtagat aatgatgaaa atcaggctcc 7860

gggatcaggt attaagtaag ttggctttta cctggatgtg atttgcaagc aagaaatacg 7920

agaggagtga taatgtaaat tgaagtatgg ttcgtctata ctgaaatatc cgtctgtcct 7980

cacactaggc agattgtagc tctgttttgt accactagtt atagatggaa ttgtgaagta 8040

tcttacgacc tttagtgtat tatttcgcct ttgtatgtgt cagatttcaa ttgaattcat 8100

tatttctcct gaaacttcac gttgttctc 8129

<210>3

<211>1282

<212>DNA

＜213〉tomato belongs to tomato (Lycopersicon esculentum Miller)

<400>3

gccgattttg gtgtttgatt tttttttggg gggattttga aattggtgag tttgattttg 60

gaatctccgg tgatgggacg ggcggagatg gttgtaggcc cgtcggagaa ggtggcggtg 120

gtggcatatc atctgaatga tgcaatcaat tggtgggacg atgtgaacag atctcttgat 180

tggcaaaacc gtatattcca tgtccttgct gttctctacg gcgttgtcgc cgtcgttgct 240

cttgtacaat taattcgcat tcaaatgaga gttcctgaat atggctggac cactcaaaaa 300

gtcttccact ttctcaattt ctttgtgaat ggagttcgct cgctagtttt tacatttcgt 360

cgggatgttc agaagttgca cccggagatt gtgcaacata ttatgcttga tatgccaagt 420

cttgcattct tcacaactta tgctctgcta gtattattct gggctgagat atactaccag 480

gcacgtgctg tgtccacgga tgggcttaga cctagtttct tcacaatcaa cggagtggtt 540

tatgctattc agattatatt atggctgata atgtggtgga aacctattcg agtactcttc 600

atcttatcca agatgttttt tgcaggtgta tccctatttg cagcattggg atttctcctc 660

tacggtggaa ggctttttct tatgttacag cggtttccag tagaatcaag agggagacgc 720

aagaagctgc aggaggttgg ttatgtcacg acaatatgtt tttcatgctt cctcattaga 780

tgcgttatga tgtgcttcaa tgcatttgat aaagctgcag atcttgatgt tttgtatcat 840

cctattttga atttgatata ttacctgtta gtggagatac tgccttcttc tcttgtcctt 900

tttattttaa ggaagttgcc tccaaagcga gggatcaccc aataccaccc tattcactaa 960

tacattaaga gggtagataa tgatgaaaat caggctccgg gatcaggtat taagtaagtt 1020

ggcttttacc tggatgtgat ttgcaagcaa gaaatacgag aggagtgata atgtaaattg 1080

aagtatggtt cgtctatact gaaatatccg tctgtcctca cactaggcag attgtagctc 1140

tgttttgtac cactagttat agatggaatt gtgaagtatc ttacgacctt tagtgtatta 1200

tttcgccttt gtatgtgtca gatttcaatt gaattcatta tttctcctga aacttcacgt 1260

tgttctcaaa aaaaaaaaaa aa 1282

Claims (10)

1. tomato RNA virus host factor, its amino acid residue sequence is shown in SEQ ID NO:1.

2. the encoding gene of the described tomato RNA virus host factor of claim 1.

3. encoding gene according to claim 2 is characterized in that: the base sequence of its genomic gene is shown in SEQ ID NO:2.

4. encoding gene according to claim 2 is characterized in that: the base sequence of its cDNA gene is shown in SEQID NO:3.。

5. the expression vector that contains claim 2 or 3 or 4 described encoding genes.

6. the transgenic cell line that contains claim 2 or 3 or 4 described encoding genes.

7. the host bacterium that contains claim 2 or 3 or 4 described encoding genes.

8. a method of cultivating antivirus plant is in the sense-rna or its rnai expression carrier importing plant with claim 2 or 3 or 4 encoding genes, obtains transfer-gen plant.

9. method according to claim 8 is characterized in that: described by the plant of plant transformed host for Solanaceae.

10. claim 2 or the 3 or 4 described encoding genes application in cultivating antivirus plant.

Images