CN1884536A - Promotor specificly-response to heavy metal ion - Google Patents
Promotor specificly-response to heavy metal ion Download PDFInfo
- Publication number
- CN1884536A CN1884536A CN 200510077452 CN200510077452A CN1884536A CN 1884536 A CN1884536 A CN 1884536A CN 200510077452 CN200510077452 CN 200510077452 CN 200510077452 A CN200510077452 A CN 200510077452A CN 1884536 A CN1884536 A CN 1884536A
- Authority
- CN
- China
- Prior art keywords
- heavy metal
- gene
- plant
- promoter
- promotor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
This invention is associated with the inducible promoter of new heavy metal in plant. This invention provides the promoter sequence of bean heavy metal inducive gene PvSR2 gene and the sequence of verified metalloid response element. Using the promoter in this invention to undergo the transgenic development of gene engineering products can improve the fastness to heavy metal of plant, reduce the accumulation of heavy metal in edible plant as well as increase the heavy metal accumulation capacity of transgenic plant and eukaryotic microbiology. This invention has significant utilization value in administer heavy metal pollution.
Description
Invention field
The invention belongs to the plant promoter field, particularly about the promotor of response heavy metal ion and the metalloid response element in this promoter sequence in the plant.
Background technology
Heavy metal is biological essential trace element a bit, but excessively also can damage, and nonessential heavy metal then can cause the damage of organism.By develop the resistance that the transgenic plant product can improve the heavy metal of plant with plant gene engineering technology, reduce the heavy metallic poison of edible plants, the protection human health; Improve the accumulation ability of the heavy metal of certain plants, have great application value administering heavy metal contamination.By the plant genetic engineering influence factor that achieves the above object used combination or the transhipment albumen of heavy metal ion or the goal gene of polypeptide are arranged, the transgenic plant species, promotor of transgenic method and the controlled target genetic expression adopted etc., wherein the most key is the selection of promotor.A few heavy metal species inductive promotors and metallic response element thereof are found in animal and some plants at yeast, but special evoked promoter is not also cloned in higher plant at present.Clone's heavy metal evoked promoter comprises zymic Cu at present
2+Inductive metallothionein(MT) (metallothionein, promotor MT) (Wendy J et al., 1996.JBIC 1:451-459), Zn
2+The promotor of transporter gene (Zhao HEide D, 1996.J Bio Chem 271:23203-23210), promotor (the Kim Y.H. of Cu/Zn superoxide-dismutase (SOD1) gene of mouse, et al.1993.Gene 133:267-271.), promotor (the Stuart of mouse metallothionein gene, G.W.et al.1985.Nature 317:828-831), CPX1 and the CYC6 gene promoter (Quinn J M and Merchant S 1995.Plant Cell 7:623-638) of the promotor of the ParA gene in the tobacco (Kusaba M et al.1996.Plant Physiol.111:, 11 61-1167) chlamydomonas.
Though at present in the resistance of the heavy metal that has improved model plant by plant gene engineering technology or changed the distribution in plant of heavy metal, also be not very desirable on the whole, this has great relation with promotor of selecting.Often adopt the promotor of yeast copper metallothionein gene at present in plant, this promotor is only to Cu
2+Response is to the then not response of heavy metal of other kinds.The promotor of the metallothionein gene of mouse does not have activity (Maiti. in tobacco, I.B.et al., 1991.Plant Sci.76,94-107), the activity of the 35S promoter (caMV35S) of the promotor cauliflower mosaic virus of composing type is not subjected to the influence (Stefanov of cadmium in transgene tobacco, I.J.et al., 1997.Plant Cell Reports16:291-294).The special evoked promoter of heavy metal can be controlled metal binding protein gene or metal ion translocator under the condition that heavy metal exists, express on differential high efficient ground, improved heavy metal tolerance or the accumulation ability of transgenic plant, thereby avoided the promotor continuous expression of composing type to cause the metal inducement promotor of damage or animal-origin in plant, not have active drawback transgenic plant.
The PvSR2 gene is the gene of the special response heavy metal ion that the clone comes out from Kidney bean, other are coerced as heat shock, uv-radiation, virus infection then do not respond (Yuxiu Zhang, Tuan-yao Chaiet al., 2001.Plant Sci.161 (4): 783-790).Also there is not relevant report at present about the research of PvSR2 gene promoter.
Summary of the invention
The object of the present invention is to provide the promotor of the special response of heavy metal in the plant genetic engineering and the metalloid response element in this promotor; the present invention has the transgenic product of preventing from heavy metal or enriching heavy metal for exploitation from now on, for protecting human health and preventing and treating Heavy-metal Polluted Environment and lay a good foundation.
We have cloned the promoter region of Kidney bean PvSR2 gene at present, and promotor studied, the result shows that 3 fragments of this promotor have the ability of counterweight metallic response, and identify one the metallic response element metallic response ability and that find in animal (metal responsive element, MRE) similar metalloid response element (MRE-like) are arranged.
In a technical scheme of the present invention, three sections different fragments in the Kidney bean PvSR2 gene promoter sequence (Fig. 1) are provided, these three sections sequences are-1161 to+48 sequence (SEQ IDNO.2) in Fig. 1 sequence, and-687 to+48 sequence (SEQ ID NO.3) 1-281 is to+48 sequence (SEQ IDNO.4) sequence.
These sequences can both be as promotor in plant, the expression of gene of control specificly-response heavy metal ion.This promotor preferably is used on tobacco or the mouseearcress.
In another technical scheme of the present invention, the metalloid response element (MRE-like) that the metallic response ability is arranged in the Kidney bean PvSR2 gene promoter is provided, this response element has core sequence: TGCAGGCG (SEQ ID NO.5).
Use promotor of the present invention and carry out transgenosis exploitation gene engineering product, can improve the resistance of the heavy metal of plant, reduce the accumulation of heavy metal in edible plants; And can improve the heavy metal accumulation ability of transgenic plant, microorganism, have great application value to administering heavy metal contamination.
Description of drawings
Fig. 1 is the promoter region sequence of PvSR2 gene
The base of transcription initiation site represents with underscore and be labeled as+1, and the translation initiation site codon (ATG) of deduction is demarcated with underscore.The TATA box that infers, CAAT box, MRE-like and other cis element are demarcated with square frame, wherein HSE is the heat shock response element, and ABRE is the drought stress response element, and MRE is the metalloid response element, AuxRE is the growth hormone response element, and I-box, GATAbox are light response element;
Fig. 2 is a PvSR2 gene promoter 5` deletion analysis
Wherein ,+: 15 μ M Hg added
2+-: do not add 15 μ M Hg
2+Experimental data is from three independent experiments, and numerical value is mean+SD.The GUS enzyme apply flexibly nmol[right-nitrophenols]/min/mg protein represents.The left side of figure is the expression cassette synoptic diagram of the used plasmid vector of deletion analysis, and wherein the MRE-like element marks with black surround, and the coding region of gus reporter gene, termination subarea and 5` non-translational region are represented with GUS, NOS and 5`-UTR respectively.
Fig. 3 A is the functional analysis of MRE-like element, the structural representation of pBMRE and pBmMRE;
Fig. 3 B is for adding HgCl
2PBMRE and the transient expression analysis of pBmMRE;
Fig. 3 C is for adding ZnCl
2PBMRE and the transient expression analysis of pBmMRE;
Fig. 4 is T
0The Southern hybridization analysis of-8 strains system
Wherein+: the probe positive control;-: the negative control of wild-type tobacco genomic dna; H:HindIII; E:EcoRI:X:XbaI
Fig. 5 A is T
0-8 strains are that T1 is for the responding ability of seedling to different heavy metal ion;
Fig. 5 B is T
0-8 strains are that T1 is for the Cu of seedling to different concentration
2+Responding ability;
Fig. 5 C is T
0-8 strains are that T1 is for the responding ability of seedling to different organ types
Fig. 6 T
0-8T1 is for the tissue staining analysis to the response of different types of heavy metal of seedling
Embodiment
The cultivation of embodiment 1 vegetable material
(Nicotiana tabacum W38) is grown in the MS substratum to aseptic tobacco seedling, cultivates under 16h illumination (25 ℃)/8h dark condition.Mouseearcress (Arabidopsis thaliana, Columbiaecotype) grow in the 1/2MS of additional 2% sucrose by seed-coat sterilization back.Be grown in Tu Penzhong after the sterilization of Kidney bean (Phaseolusvulgaris L.cv.Saxa) seed-coat, growth conditions is to cultivate under illumination 16h (22 ℃)/8h dark condition.When launching two early years, with 0.2% (w/v) HgCl
2. the spray blade.
Embodiment 2 Kidney bean PvSR2 gene promoter areas clone
Step 1:DNA walking obtains the upstream region of gene control region
The genomic dna of Kidney bean extracts with the CTAB method, and the clone of the 5` upstream of PvSR2 gene carries out according to the In vitro Cloning kit specification sheets of Bao Bio-Engineering Company.Be summarized as follows: the genomic dna of isolating Kidney bean is with PstI, HindIII and three kinds of restriction enzymes of EcoRI respectively after the complete digestion, is connected with the joint that has corresponding restriction enzyme site and primer C1 and C2 that provides in the test kit after ethanol sedimentation reclaims.Then use gene specific primer 1 (gene-specific primerl according to the PvSR2 gene design, GSP1 sees Table 1) and joint on primer C1 (primer that test kit carries) carry out first time amplification, carry out nest-type PRC after then amplified production being diluted 100 times, the primer is the primer GSP2 (gene-specific primer2, GSP2 sees Table 1) that is positioned at GSP1 and C1 inboard and the primer C2 (primer that test kit carries) on the joint.The specific amplified band is reclaimed rear clone also order-checking (Shanghai bio-engineering corporation) on pMD18T-vector, with this plasmid called after pUC-MRP.Order-checking shows passes through the segment that the DNA walking has obtained the upstream 2188bp of PvSR2 gene, i.e. PvSR2 gene upstream sequence from the DNA that the PstI enzyme is cut.
Step 2:5`-RACE determines transcription initiation site
Spray 0.2% (w/v) HgCl with RNAgent Total RNA Isolation System (promega) extraction
2Total RNA of the Kidney bean blade of 6h.5`-RACE is according to SMAR
TMRACE cDNAAmplification kit (Clontech Laboratories) process specifications carries out.Be summarized as follows: the total RNA of the 200ng gene specific reverse transcription primer (RGSP of PvSR2 cDNA sequences Design, see Table 1) carry out reverse transcription, get 2.5 μ l cDNA and carry out PCR, the primer is that RGSP (sequence sees Table 1) and test kit provide UPM (universal primer mix) primer.The PCR product cloning goes up and order-checking to T-easy vector (Promega company), and four selected order-checkings of independent positive colony (Shanghai bio-engineering corporation) are to determine transcription initiation site more accurately.Order-checking shows that this gene transcription initiation site is positioned at the Nucleotide A at 119bp place of original clone's PvSR2cDNA5` end upstream.Comprehensive step 1 and step 2 have obtained the promoter sequence of 1624bp, and sequence as shown in Figure 1.
Embodiment 35` deletion analysis promoter area function
Step 1: the structure of promoter region-gus reporter gene fusion expression vector
Holding the 5` of PvSR2 promoter region not, the segment and the gus reporter gene of same district are connected to form fusion gene.Specific as follows: according to promoter region design primer (sense primer SP1, SP2, SP3, SP4, SP5 and SP6, antisense primer ASP) (concrete sequence sees Table 1), increasing respectively by PCR obtains length and is respectively 1.6,1.2,0.7,0.3,0.15 and the promoter region of 0.1kb, the used template of pcr amplification is plasmid pUC-MRP, and these promoter region deletion fragments are correspondence and-1623 to+48 ,-1161 to+48 ,-687 to+48 ,-281 to+48 ,-146 to+48 and-90 to+48 of Fig. 1 respectively.HindIII and XbaI enzyme cutting site have been introduced in two ends in these segments PCR process, these PCR products are reclaimed after with HindIII and XbaI enzyme cutting, connect with the same large stretch of disconnection of pBI221 (Clontech company) through HindIII and XbaI enzyme cutting recovery, replace constitutive promoter CaMV35S promotor with the PvSR2 promoter region, obtain recombinant chou.With each recombinant chou difference transformed into escherichia coli DH5 α, go out positive colony promoter region order-checking (Shanghai bio-engineering corporation) through Screening and Identification and show correctly do not have mutating alkali yl to introduce.The final pBMRP1.6 that obtains, pBMRP1.2, pBMRP0.7, pBMRP0.3, the promotor of a series of 5` disappearances of pBMRP0.15 and pBMRP0.1 and the expression vector that gus gene merges.
Table 1
| Title | Primer sequence a | The experiment purposes |
| SP1 SP2 SP3 SP4 SP5 SP6 ASP | 5`CCC AAGCTTCTGCAGACATCGTrrrGTArT3` HindIII (1623 to-1603) 5`CCC AAGCTTTGTTTTGAAATAGGAAAAAGTAAC3 HindIII (1161 to-1138) 5`CCC AAGCTTTTCTTCCTACATCTCACCCA3` HindIII (687 to-668) 5`CCC AAGCTTAAAATGTGGTGTTTGTGAC3` HindIII (281 to-263) 5`CCC AAGCTTAGGAAGCAATAACGTGGAAA3` HindIII (146 to-127) 5`CCC AAGCTTCGATTTGTCTCGCTTTCTGA3` HindIII (90 to-71) 5`GC TCCTAGATGATGGAACTGTGAAGATTGT3` XbaI (+28 to+48) | The 5`-deletion |
| GSP1 GSP2 | ||
| 5`CTCCACTGTGTTAACGCCGGGCTTC3` (+641 to+665) 5`GTTCCTTGGCGTAAGAGTAGAGGATGC3` (+601 to+627) | The genomic | |
| RGSP | ||
| 5`AGATGGAACCTGTCGTACACCGGA3` (+688 to+712) | 5`-RACE |
a: numerical value is represented the position of primer in the table, is+1 to transcribe PvSR2 gene transcription initiation site.
Step 2: the preparation of tobacco protoplast and PEG mediated transformation
The protoplastis of tobacco separates preparation from the blade of the aseptic seedling in three weeks, pBMRP1.6, pBMRP1.2, each 20 μ g of pBMRP0.7, pBMRP0.3, pBMRP0.15, pBMRP0.1, pBI121 and pBI101 are according to the method transformation of tobacco protoplastis (Negrutiu et al.1987, Plant Mol.Biol.8:363-373) of PEG mediation in 1987 such as Negrutiu.The tobacco protoplast that transforms is cultivated with the MS liquid nutrient medium (contain 30g/l sucrose, 72.8g/l N.F,USP MANNITOL does not contain heavy metal ion) of improvement, and treatment group is added 15 μ M HgCl
2, control group does not add 15 μ M HgCl
2The plasmid pBI101 of the preceding no any promotor of gus gene has the plasmid pBI221 conduct of CaMV 35S promoter over against photograph as negative contrast and 5` end.The transient expression analysis is carried out after transforming 24h.Each plasmid is done three parallel dealing with.
The mensuration of step 3:GUS enzymic activity
The centrifugal 1min of 100g collects the protoplasm somatocyte that transforms after cultivating, extract damping fluid (10mM EDTA with 200 μ l GUS then, 0.1%Triton X-100,0.1%SLS and 10mmol/L beta-mercaptoethanol) resuspended protoplastis precipitation, add a little sterilization quartz sand, concussion is with smudge cells on the spiral oscillator.Place 10min on ice, the centrifugal 5min of 10000g reclaims the crude extract that contains the GUS enzyme then, and is standby on ice.Prepare Sephadex G-25 chromatography column in advance, extract damping fluid balance pillar 10min with freshly prepared GUS before using, then the centrifugal 10min of 1000g discards effluent liquid, the crude extract of GUS enzyme is added to the pillar top, put then on ice, flow out up to not containing chlorophyllous GUS enzyme extract, then cross post again if also have chlorophyll to exist.Determination of protein concentration Bradford method (1976).The spectrophotometry (Plant Mol Biol Rep 5:387-405) that the GUS enzymic activity is described with Jefferson (1987), reaction substrate is used (right-nitrophenyl-β-D-glucosiduronate PNPG) (sigma company product).Surveying instrument SmartSpec
TM3000 spectrophotometers (Bio-Rad) .GUS enzyme apply flexibly nmol[right-nitrophenols]/min/mg protein represents.GUS histochemical stain staining (Jeffersonet al., the 1987.EMBO J. of Jefferson (1987); 6:3901-3907) substrate X-gluc.
Step 4: analytical data
The promoter fragment of analyzing different lengths is at HgCl
2Coerce with the active height of the following GUS of startup of collating condition enzyme gene expression and weigh promoter activity and counterweight metal inducement activity etc., determine the position of metallic response element.As shown in Figure 2, the promotor of total length is not having to instruct gus gene to express under the heavy metal inductive condition, express 1.6 times and under heavy metal is induced, can improve gus gene, show heavy metal and induce the activity that strengthens expression, when promotor 5` end lacks-1161 places, suitable in the GUS enzymic activity that does not have to show under the heavy metal inductive condition with negative contrast, and induce the next intensive expression activity that shows at heavy metal, therefore be the special elicitor fragment of heavy metal, further lack-687 and-281 and demonstrate the special induced activity of heavy metal too.Then showing when further the sequence of disappearance 135bp is to-146 places does not have heavy metal to induce to express yet, and has the heavy metal abduction delivering not strengthen, and illustrates that it is necessary that-281 to-146 135bp fragment responds to promotor that heavy metal induces.The metalloid response element (MRE-like) similar with the metallic response element (MRE) that identifies in the animal metallothionein gene promoter also exists in this zone.Above result as shown in Figure 2.
Embodiment 4 analyzes the activity of the PvSR2 gene promoter of 735bp in stablizing genetically modified tobacco
Step 1: the structure of plant expression vector
The pBMRP0.7 plasmid is cut the back with HindIII and EcoRI enzyme reclaim the expression cassette fragment that contains 735bp promoter region-gus gene, connect with the same large stretch of disconnection of pBI121 (Clontech company) that cuts back to close through HindIII and EcoRI enzyme then, replace constitutive promoter CaMV35S promotor with the PvSR2 promoter region, finally be built into transgenic plant expression vector pMRP0.7-GUS.
Step 2: agriculture bacillus mediated leaf dish method transformation of tobacco
The plant expression vector pMRP0.7-GUS that step 1 is built with freeze-thaw method imports to Agrobacterium LBA4404 (Agrobactenium tumefaciens), adopt method (Horsch et al. in 1985 such as Horsch then, 1985, Science 227 (4691); 1229-1231) gene is imported in the genome of tobacco cell, through inducing sprout, take root etc. resistance select to cultivate, with the method evaluation of the PCR positive seedling of taking root.At last in the greenhouse with the transgene tobacco earth culture, self-pollination obtains the first filial generation seed.
Step 2: the evaluation of the transgenic line that single copy gene inserts
The first filial generation seed is sprouted on the MS substratum that contains the kantlex of 200mg/L (Km), calculated the ratio of green resistance seedling (transgenosis) and albefaction seedling (non-transgenic).Obtain the green seedling of 6 strains altogether: albefaction seedling ≈ 3: 1 promptly meets monofactorial mendelian inheritance.Therefrom picked at random T0-8 strain system further identifies by Southern hybridization: every kind of enzyme of result is cut has only a hybrid belt to occur, and wild-type does not have hybridization signal, proves that the gene that changes in this strain system has only a copy (Fig. 4).
Step 4: the heavy metal induced activity of the transgene tobacco seedling that single copy gene inserts is analyzed
The first filial generation seed of T0-8 strain system is transferred to the HgCl of additional 20 μ M respectively with the positive seedling of green after sprouting in not containing the MS substratum of heavy metal ion (kantlex of additional 200mg/L)
2, CdCl
2, AgNO
3, and Pb (NO)
3The ZnSO of 100 μ M
4, CoCl
2, CuSO
4, and MnCl
2Same MS substratum in, or additional 2.5,5,10,50 and 100 μ M CuSO
4Same MS substratum in, coerce after 24 hours and carry out the GUS enzyme activity assay.More than every heavy metal species coerce each 1 and get 10 seedlings, triplicate.
The mensuration of step 5:GUS enzymic activity
After seedling after the processing is removed substratum on the root with rinsed with sterile water, add 200 μ l GUS and extract damping fluid (10mM EDTA, 0.1%Triton X-100,0.1%SLS and 10mmol/L beta-mercaptoethanol) and a little sterilization quartz sand, concussion is with smudge cells on the spiral oscillator.Place 10min on ice, the centrifugal 5min of 10000g reclaims the crude extract that contains the GUS enzyme then, and is standby on ice.Prepare Sephadex G-25 chromatography column in advance, extract damping fluid balance pillar 10min with freshly prepared GUS before using, then the centrifugal 10min of 1000g discards effluent liquid, the crude extract of GUS enzyme is added to the pillar top, put then on ice, flow out up to not containing chlorophyllous GUS enzyme extract, then cross post again if also have chlorophyll to exist.Determination of protein concentration Bradford method (1976).The spectrophotometry (Jefferson et al.1987, Plant Mol Biol Rep 5:387-405) that GUS enzymic activity usefulness Jefferson (1987) describes, and reaction substrate usefulness (right-nitrophenyl-β-D-glucosiduronate PNPG, sigma).Surveying instrument SmartSpec
TM3000 spectrophotometers (Bio-Rad) .GUS enzyme apply flexibly nmol[right-nitrophenols]/min/mg protein represents.GUS histochemical stain staining (Jefferson et al., 1987, the EMBO J. of Jefferson (1987); 6:3901-3907), substrate X-gluc.
Step 4: analytical data
The first filial generation that the T0-8 strain that contains promotor-gus reporter gene of single copy insertion 735bp is can respond contents of many kinds of heavy metal ion, at the following Ag of ability order of the responding heavy metal ion of being tested
+＞Zn
2+＞Cd
2+＞Hg
2+＞Pb
3+＞Co
2+＞Mn
2+＞Cu
2+(referring to Fig. 5 A).The Cu of different concns
2+The expression intensity of startup gus gene also different, wherein at 2.5 μ M in the concentration range of 100 μ M, 50 μ M inducibilities the strongest (referring to Fig. 5 B).Cu at 50 μ M
2+Induce down, this promoter activity shows as the pattern (referring to Fig. 5 C) of cauline leaf specifically expressing.
Seedling is carried out the GUS histochemical stain show, in not having heavy metal inductive seedling (contrast), do not have blue the appearance, and at Ag
+, Co
2+, Cd
2+, Al
3+, Zn
2+, Cu
2+, Hg
2+Induce down appearance significantly blue etc. heavy metal ion, demonstrate,proved the 735bp promoter fragment from an enterprising step directly perceived and can instruct gus reporter gene response heavy metal (referring to Fig. 6).
The Function Identification of the metalloid response element (MRE-like) of embodiment 5 promoter regions
Step 1 contains the structure of the expression vector of metalloid response element
To contain MRE-like and be incorporated into the 5` end of the basic promotor of CaMV35S ((82/+8,35S Δ 82)) in the method for interior 25bp promoter sequence by PCR, used primer is 35S-82F (5`CCC
TAAGGGATGACGCACAA3`, underscore place are the HindIII restriction enzyme site, and the base sequence at square frame place is the 25bp promoter region, MRE-like element shadow representation) and 35S-82R (5`GC
TCTAGAGTCCCCCGTG3`, underscore place are the XbaI enzyme cutting site), used template is the CaMV35S promoter fragment.Equally, the MRE-like that will contain sudden change also is incorporated into the 5` end of the basic promotor of CaMV35S (82/+8,35S Δ 82) at interior 25bp promoter sequence by PCR method, and used primer is 35S-82mF (5`CCC
TAAGGGATGACGCACAA3` underscore place is the HindIII restriction enzyme site, and the base sequence at square frame place is the 25bp promoter region, the mMRE-like element shadow representation after the sudden change) and 35S-82R.After the PCR product is cut with the HindIII/XbaI enzyme, be inserted into through the HindIII/XbaI enzyme and cut the big fragment of pBI221 that reclaim the back, to replace the CaMV 35S promoter.Order-checking (Shanghai bio-engineering corporation) shows that insertion sequence is correct.Finally be built into expression vector pBMRE and pBmMRE, its concrete structure is referring to Fig. 3 A.
Step 2: the preparation of tobacco protoplast and PEG mediated transformation
The protoplastis of tobacco separates preparation from the blade of the aseptic seedling in three weeks, each 20 μ g of pBMRE and pBmMRE are according to the method transformation of tobacco protoplastis (Negrutiu et al.1987, Plant Mol.Biol.8:363-373) of PEG mediation in 1987 such as Negrutiu.The tobacco protoplast that transforms is cultivated with the MS liquid nutrient medium (contain 30g/l sucrose, 72.8g/l N.F,USP MANNITOL does not contain heavy metal ion) of improvement, and treatment group is added 20 μ M HgCl respectively
2With 50 μ M ZnCl
2, control group is normally cultivated.The transient expression analysis is carried out after transforming 24h.Each plasmid is done three parallel dealing with.
Step 3:GUS enzyme assay
The same embodiment 4 steps 5 of method are described.
Step 4: data analysis
According to the responding ability of the MRE-like element that does not suddenly change and suddenly change, determine the function of this element to heavy metal ion.At 20 μ M HgCl
2With 50 μ M ZnCl
2Handle down, containing not in the protoplastis that the pBMRE plasmid of the MRE-like element of sudden change transforms promotor can respond heavy metal and induce, activity strengthens 1.8-and 1.6 times respectively, contain that promotor has then lost response heavy metal inducibility in the protoplastis that the pBmMRE plasmid of the MRE-like element of sudden change transforms, show the inhibition (Fig. 3 B and 3C) that activity is subjected to heavy metal ion.These evidences show that this element can mediate the heavy metal induced activity of basic promotor.
Claims (7)
1. the metalloid response element of a specificly-response heavy metal ion in plant, this element has core nucleotide sequence: TGCAGGCG.
2. the described metalloid response element of claim 1 is regulated and control the purposes of the gene of specificly-response heavy metal ion in plant.
3. purposes according to claim 2, wherein said plant are tobacco or mouseearcress.
4. the promoter sequence of the gene of specificly-response heavy metal ion in plant, wherein this promoter sequence comprises the described response element of claim 1, and promoter sequence is-1161 to+48 or-687 to+48 sequences among Fig. 1, or-281 to+48 sequences.
5. promoter sequence according to claim 4, wherein promoter sequence is-281 to+48 sequences among Fig. 1.
6. the described promoter sequence of claim 4 is as the purposes of the heavy metal evoked promoter of control goal gene in the plant.
7. purposes according to claim 2, wherein said plant are tobacco or mouseearcress.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100774520A CN100412195C (en) | 2005-06-23 | 2005-06-23 | Promotor specificly-response to heavy metal ion |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100774520A CN100412195C (en) | 2005-06-23 | 2005-06-23 | Promotor specificly-response to heavy metal ion |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1884536A true CN1884536A (en) | 2006-12-27 |
| CN100412195C CN100412195C (en) | 2008-08-20 |
Family
ID=37582841
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100774520A Expired - Fee Related CN100412195C (en) | 2005-06-23 | 2005-06-23 | Promotor specificly-response to heavy metal ion |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100412195C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103923922A (en) * | 2014-04-22 | 2014-07-16 | 中国农业科学院农业资源与农业区划研究所 | Application of heavy metal induction promoter in cultivating soil heavy metal pollution prewarning transgenic plant |
| CN103923923A (en) * | 2014-04-22 | 2014-07-16 | 中国农业科学院农业资源与农业区划研究所 | Heavy metal induced promoter from arabidopsis and application thereof |
| CN106191108A (en) * | 2016-08-08 | 2016-12-07 | 湖南人文科技学院 | Weak virulence CMV vector expression resistant gene strengthens the application of Genes For Plant Tolerance heavy metal performance |
| CN112662672A (en) * | 2020-12-31 | 2021-04-16 | 上海交通大学 | Promoter and preparation method thereof |
-
2005
- 2005-06-23 CN CNB2005100774520A patent/CN100412195C/en not_active Expired - Fee Related
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103923922A (en) * | 2014-04-22 | 2014-07-16 | 中国农业科学院农业资源与农业区划研究所 | Application of heavy metal induction promoter in cultivating soil heavy metal pollution prewarning transgenic plant |
| CN103923923A (en) * | 2014-04-22 | 2014-07-16 | 中国农业科学院农业资源与农业区划研究所 | Heavy metal induced promoter from arabidopsis and application thereof |
| CN103923923B (en) * | 2014-04-22 | 2016-03-02 | 中国农业科学院农业资源与农业区划研究所 | Derive from heavy metal evoked promoter and the application thereof of Arabidopis thaliana |
| CN103923922B (en) * | 2014-04-22 | 2016-03-02 | 中国农业科学院农业资源与农业区划研究所 | Heavy metal evoked promoter is cultivating the application in heavy metal pollution of soil early warning transgenic plant |
| CN106191108A (en) * | 2016-08-08 | 2016-12-07 | 湖南人文科技学院 | Weak virulence CMV vector expression resistant gene strengthens the application of Genes For Plant Tolerance heavy metal performance |
| CN112662672A (en) * | 2020-12-31 | 2021-04-16 | 上海交通大学 | Promoter and preparation method thereof |
| CN112662672B (en) * | 2020-12-31 | 2023-03-10 | 上海交通大学 | Promoter and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100412195C (en) | 2008-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Crane et al. | Transgenic Medicago truncatula plants obtained from Agrobacterium tumefaciens-transformed roots and Agrobacterium rhizogenes-transformed hairy roots | |
| Li et al. | Establishment of an Agrobacteriuim-mediated cotyledon disc transformation method for Jatropha curcas | |
| Chen et al. | Gene transfer via pollen‐tube pathway for anti‐fusarium wilt in watermelon | |
| CN100535118C (en) | Paraquat resistance gene and a vascular tissue- and trichome-specific promoter | |
| CN103710357B (en) | Alfalfa stress response gene M sNAC2 and application thereof | |
| Yibrah et al. | Agrobacterium rhizogenes-mediated induction of adventitious rooting from Pinus contorta hypocotyls and the effect of 5-azacytidine on transgene activity | |
| CN102154296A (en) | Promoter efficiently expressing in cotton root and application thereof | |
| CN102002101A (en) | Plant root development related protein ZmNR1 and coding gene thereof | |
| CN104278052A (en) | RHD6 and its use in modulating plant root hair development | |
| CN1884536A (en) | Promotor specificly-response to heavy metal ion | |
| CN113249390A (en) | Application of arabidopsis AGP30 gene in reducing cadmium absorption of plants | |
| CN107325161B (en) | Protein related to low-nitrogen stress and high-salt stress resistance as well as encoding gene and application thereof | |
| CN101845437B (en) | Promoter with properties of inducing and organizing specific expression | |
| CN115772212A (en) | Alfalfa chloroplast MsSAP22 gene and application thereof in improving drought resistance of plants | |
| CN103243096A (en) | Plant tissue specific expression promoter and application of plant tissue specific expression promoter | |
| CN116103262A (en) | Cotton silk/threonine protein phosphatase GhTOPP4, encoding gene and application thereof | |
| CN102154314B (en) | Photoinduced cotton anthocyanidin synthesis regulatory gene GhMYBAP (Gossypium hirsutum Anthocyanin Promoting MYB) and application thereof | |
| CN107354161A (en) | Watermelon Cla005622 genes are improving the application in liking warm crop low temperature stress resistance | |
| CN112746073A (en) | Method for obtaining cucumber seed material with high powdery mildew resistance through polygene editing | |
| CN116694675B (en) | Application of soybean GmGST gene in improving aluminum toxicity stress resistance of plants | |
| Ilori et al. | Transgene expression in cowpea (Vigna unguiculata (L.) Walp.) through Agrobacterium transformation of pollen in flower buds | |
| CN1316023C (en) | Photoinduction expressed Gacab promoter and its expression function in different segments | |
| KR102396572B1 (en) | OsRP2 promoter derived from Oryza sativa and use thereof | |
| YU et al. | Breeding of selectable marker-free transgenic rice lines containing AP1 gene with enhanced disease resistance | |
| CN100368434C (en) | Tomato RNA virus host factor and genes encoding same and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080820 Termination date: 20100623 |