CN100352922C

CN100352922C - SiRAN and expression carrier for inhibiting human VEGF gene expression and their pharmaceutical use

Info

Publication number: CN100352922C
Application number: CNB031322638A
Authority: CN
Inventors: 樊燕蓉; 傅更锋; 刘文华; 肖祥华; 刘新卷; 郭丹; 徐根兴
Original assignee: 徐根兴
Current assignee: Xu Genxing
Priority date: 2003-08-07
Filing date: 2003-08-07
Publication date: 2007-12-05
Anticipated expiration: 2023-08-07
Also published as: CN1580259A

Abstract

The present invention discloses an siRNA specifically inhibiting human VEGF gene expression, an expression carrier thereof and the application thereof for preparing medicines of diseases relative to a human VEGF gene. The present invention obtains a group of human VEGF gene sequences from GenBank by using a biological computer information technology, a group of siRNA which can induce RNA interference is designed by using an RNA interference technology as a foundation, and a certain amount of siRNA is synthesized chemically or expressed by plasmids and lambda phages; thereby, the expression of the human VEGF gene can be specifically inhibited to realize the purpose of blood vessel hyperplasia restraint. The siRNA and expression plasmids thereof can be used for preparing medicines which has the advantages of high efficiency, rapidness, strong specificity, few side effects and tumor resistance and is used for diseases which are relative to novel vessel abnormal hyperplasia.

Description

Suppress siRNA and the expression vector and the application in pharmacy thereof of the expression of human VEGF gene

Technical field

The present invention relates to a kind of siRNA, particularly relate to a kind of siRNA and expression vector and application in pharmacy thereof that suppresses the expression of human VEGF gene.

Background technology

Growth of tumor and transfer and tumor area blood vessel have confidential relation, and tumor vessel is that the growth of tumour cell is carried nutritive substance and drained metabolic waste, and the formation and development of metastases kitchen range also depends on tumor vascular formation.Therefore, cut off the blood of tumour for reaching the purpose that suppresses tumor growth and transfer.In the somatomedin that the multiple stimulation new vessel of having found forms, has only the single-minded vasoactive endotheliocyte of VEGF.VEGF is the somatomedin of telling from tumour secretory product first in 1979, it is efficient, specific action is in vascular endothelial cell, it is the center regulatory factor that new vessel forms, it is not expressed in normal tissue cell, at tumour cell and be subjected to that tumour stimulates around express in the stroma cell, and, the vascularization degree of malignant tumour and VEGF mRNA express has high correlation, therefore, by the unconventionality expression of inhibition VEGF and the formation of new vessel, for tumor treatment provides novel method.

Existing research effectively suppresses new vessel formation and growth of tumor with mono-clonal or the polyclonal antibody of VEGF; the specificity of employing height is also arranged; the Antisense OligodeoxynucleotideTechnique Technique that toxic side effect is lower suppresses growth of tumor; but it is big with the common used dosage of the gene therapy of Antisense OligodeoxynucleotideTechnique Technique; suppress VEGF genetic expression and only reach 20-90%; adopt little double-stranded RNA (19-23bp) interference technique (RNAi) targeting obvious; the continuous action of amplification effect is arranged; dosage is little; vitro inhibition target gene mRNA expresses stable being suppressed at more than 90%; as change a base then restraining effect disappear; therefore; interfere the effect that does not influence normal gene with little double-stranded RNA, its specificity and target are strong.

The RNAi technology is utilized the special PTGS (posttranscriptional gene silencing) of double-stranded RNA (double-stranded RNA) induced sequence exactly.May calendar year 2001 and December calendar year 2001, people such as Germany scientist Elabshir, Harborth and Tuschl have delivered in succession on " Nature " and " J.Cell Sci. " with the RNAi technology and have made 16 gene expression doses reductions or reticent in the cells of mamma animals respectively, thereby proof RNAi also works to cells of mamma animals, this makes this technology be applied to treat some because specific gene is expressed the disease that too much causes, the cancer that causes as the overexpression of oncogene becomes possibility.Being expected to this technology can become the effective means of new gene therapy for cancer.

Compare with the gene therapy with Antisense OligodeoxynucleotideTechnique Technique, the advantage of double-stranded RNA interference technique is: 1. target, specificity are strong.2. double-stranded RNA has the amplification continuous action in the technology of relating to, and the time is short, instant effect, and experimental repeatability and stability are all fine.3. the used synthetic double-stranded RNA of double-stranded RNA interference technique dosage is little, and is littler nearly ten thousand times than the used dosage of antisense technology.4. the double-stranded RNA available support is expressed, and a sustainable expression of transfection is more than one month, and is stable and expression amount is higher.

For this reason, the invention provides a kind of little double-stranded RNA that human VEGF gene is expressed that suppresses, they specifically targeting in people VEGFmRNA, thereby suppress tumour cell VEGF genetic expression, suppress the whole animal in-vivo tumour and organize the formation and the growth of new vessel and suppress growth of tumor, can be used for preparing the medicine of treatment and blood vessel hyperplasia diseases related.

Summary of the invention

The purpose of this invention is to provide a specific specificity and suppress the siRNA that human VEGF gene is expressed.

Another object of the present invention provides a kind of expression vector that can produce above-mentioned siRNA.

A further object of the present invention provides above-mentioned siRNA or produces the application of expression vector in the preparation antitumor drug of this siRNA.

Purpose of the present invention realizes in the following manner:

One specific specificity suppresses the siRNA that human VEGF gene is expressed, it is characterized in that it comprise following any six kinds of siRNA wherein one or more, their base sequence and site of action see Table 1.

Described siRNA, they can pass through synthetic, T ₇External synthetic the expression with plasmid vector forms, and this siRNA has 2～6 dT to modify or 2～6 U modifications at 3 ' end.

The expression vector that comprises the siRNA described in the table 1.

Described siRNA reaches application in the medicine of the disease relevant with the new vessel paraplasm in preparation treatment and prophylaxis of tumours.

Described expression vector reaches application in the medicine of the disease relevant with the new vessel paraplasm in preparation treatment and prophylaxis of tumours.

Detailed description of the present invention:

According to people VEGF mRNA sequence, the 75th Nucleotide begins to seek AA+N19+UU sequence or AA+N19 sequence (wherein any 19 the mRNA nucleotide sequences of N19) behind the ATG, and meet in the Nucleotide G+C ratio for accounting for about 30～70%, satisfactory 21 base sequences are confirmed that by BLAST the gene of EST gene pool targeting is unique.Design the sense-rna sequence of 19～23 bases, and synthesize or T by machine ₇External Synthetic 2 bar RNA chain (seeing Table 1) adds respectively that at 3 ' end of 2 RNA chains 2～6 dT sequences modify, and degrades to reduce in the cell.Article two, chain connects into little double-stranded RNA by PCR, and little double-stranded RNA is transduceed in the cell of VEGF high expression level by Oligofectamine reagent, example Hela cell and SMMC-7721 cell, effect was cultivated after 48～72 hours, carry out westernblot and the observation of fluorescence immunoassay group, detect the decline of vegf protein expression contents with VEGF antibody, confirm that these six kinds of little double-stranded RNAs all have inhibition human VEGF gene expression effect in various degree; Adopt two-way then or hair clip shape structure synthetic DNA chain, by expressing the promotor of little double-stranded RNA, as U6 promotor and H1 promotor, transcribe in eukaryotic cell by plasmid vector or virus vector and to form the little double-stranded RNA that has 2～6 little double-stranded RNAs of U or have hair clip shape structure, these plasmid vectors are transduceed or the virus transfection cancer cells by liposome, anticancer VEGF genetic expression, thus tumor growth suppressed.The result shows, can produce little double-stranded RNA by plasmid vector or virus vector, but and VEGF genetic expression and the tumor vascular growth and the tumor growth that suppress to transplant in animal in the anticancer.

Table 1 suppresses little double-stranded RNA sequence, modification and the action site that human VEGF gene is expressed

Sequence number	Little double-stranded RNA sequence	3 ' is terminal modified	Act on the mRNA site of people VEGF
Sequence number	Little double-stranded RNA sequence	3 ' is terminal modified	Act on the mRNA site of people VEGF	1 (SEQ ID NO.1)	5’ GGA GGA GGG CAG AAT CAT C 3’ 3’ CCU CCU CCC GUC UUA GUA G 5’	DU or U	132～150
2 (SEQ ID NO.2)	5’ UCA UCA CGA AGU GGU GAA G 3’ 3’ AGU AGU GCU UCA CCA CUU C 5’	DU or U	146～164	1 (SEQ ID NO.1)		DU or U	132～150
2 (SEQ ID NO.2)		DU or U	146～164	3 (SEQ ID NO.3)	5’ GUG GUG AAG UUC AUG GAU G 3’ 3’ CAC CAC UUC AAG UAC CUA C 5’	DU or U	156～174
4 (SEQ ID NO.4)	5’ GUU CAU GGA UGU CUA UCA G 3’ 3’ CAA GUA CCU ACA GAU AGU C 5’	DU or U	164～182	3 (SEQ ID NO.3)		DU or U	156～174
4 (SEQ ID NO.4)		DU or U	164～182	5 (SEQ ID NO.5)	5’ GCC AUC CUG UGU GCC CCU G 3’ 3’ CGG UAG GAC ACA CGG GGA C 5’	DU or U	260～278
6 (SEQ ID NO.6)	5’ CAU CAC CAU GCA GAU UAU G 3’ 3’ GUA GUG GUA CGU CUA AUA C 5’	DU or U	341～359	5 (SEQ ID NO.5)		DU or U	260～278

Advantage of the present invention:

The present invention synthesizes and transcribes by the plasmid vector system the little double-stranded RNA of formation according to people VEGF mRNA sequences Design, effect dosage is little, the specificity height, effectively the interior VEGF genetic expression of anticancer is more than 85～90%, can suppress to transplant in intravital tumor vascular growth of whole animal and tumor growth, it has higher Substratspezifitaet and lower toxic side effect than VEGF monoclonal antibody or polyclonal antibody, and can be applicable to be mixed with the medicine of the relevant disease of treatment tumour and new vessel paraplasm through the present invention of animal experiment proof.

Description of drawings

Fig. 1: pass through T ₇RNA polymerase synthetic siRNA suppresses VEGF expression of gene westernblot figure in liver cancer and the cervical cancer cell

Fig. 2: the agarose electrophoresis figure that identifies the pRK5 plasmid that the U6 promotor is arranged

Fig. 3: the psiRNA plasmid is identified agarose electrophoresis figure

Fig. 4: 22 days posterior tuberosity body weight of nude inoculation Hela cell histogram

Fig. 5: pcDNA3.1 (+) collection of illustrative plates

Fig. 6: pRK5 plasmid map

Fig. 7: pAVU ₆₊₂₇Collection of illustrative plates

Embodiment

The present invention is further elaborated by following examples, but do not limit the scope of the invention.Embodiment 1, the synthetic little double-stranded intervening rna (siRNA) of machine suppress VEGF expression of gene in the Hela cervical cancer cell

(1) by the synthetic siRNA of machine

The mRNA sequence (Xm166457) that the VEGF gene is searched from GenBank by elder generation, 75 bases begin to seek AA+N19+UU sequence or AA+N19 sequence behind the initiation codon from the said gene sequence, wherein any 19 the mRNA nucleotide sequences of N19.Find out therefrom generally that the G+C ratio is about 50% in 21 Nucleotide, be not higher than 70% or be not less than 30% nucleotide sequence.Satisfactory 21 base sequences are searched for little nucleotide sequence homology nuclear ESTLibrary by BLASU in NCBI database, be unique with the goal gene that guarantees institute's target.

(SEQ ID NO.3) is example with sequence 3:

At first design normal chain (sense) RNA and anti-chain (antisense) the RNA sequence that contain 21 bases, degrade for reducing in the cell, 3 ' end is modified with two dU, and is synthetic by siACE-RNAi,

sense： 5’GUG GUG AAG UUC AUG GAU GdTdT 3’

antisense：5’dTdTCAC CAC UUC AAG UAC CUA C 3’

Respectively two RNA strand primers are made into 50 μ M with the water of no RNA enzyme, 5X pairing damping fluid (the 100mM Potassium ethanoate that each 30 μ l of two RNA strand primers is added 15 μ l, 30mM HEPES-KOH pH7.4 and 2mM magnesium acetate), amount to 75 μ l, with 90 ℃ in PCR instrument 1 minute, 37 ℃ 1 hour, after turning off the PCR instrument then and making it cool to room temperature,-20 ℃ of storages, and multigelation 5 times, the ultimate density of dsRNA is 20 μ M like this.

(2) siRNA suppresses VEGF expression of gene in the Hela cervical cancer cell

Use the RPMI-1640 nutrient solution on HeLa cell 24 orifice plates, contain 6% calf serum (FBS) and two anti-(penicillin, Streptomycin sulphate, down with) at 37 ℃ of 5%CO ₂Be cultured to 50% of full bottle in the cell culture incubator.Then, inhale and remove nutrient solution, do not wash 1 time with not containing two RPMI-1640 anti-and FBS.Before transfection siRNA, add serum-free and two anti-DMEM197 μ l/ hole.Next get 20 μ M siRNA, 3 μ l (final concentration is 60pM), add 40 μ l Opti-MEM mixed dilutings, another test tube adds 2 μ l oligofectamine Reagent, with 8 μ l OpUi-MEM mixed dilutings.Two test tubes were placed 10 minutes under the room temperature aseptic condition, and two test tubes merge to mix under the room temperature aseptic condition of back to be placed 15～20 minutes, treated to move in 24 orifice plates after the solution retrogradation, and every hole adds 53 μ l and amounts to the every hole of 250 μ l/ developing medium, 37 ℃ of 5%CO ₂Under cultivated 4 hours, every hole adds and contains the two anti-RPMI-1640 nutrient solution 250 μ l of 3 times of FBS and 3 times, 37 ℃ of 5%CO ₂Cultivated respectively 48 hours and 72 hours down.

Behind the transfection siRNA, cell cultures was inhaled and is removed developing medium in 48 hours and 72 hours, washed cell once with 0.1M PBS liquid, and every hole adds 50 μ l 1%SDS, behind the taking-up cell, and slight ultrasonication cell 10 minutes ,-70 ℃ are frozen.Take out 3 μ l simultaneously and survey protein concentration, OD with Bio-Rad DC ₇₅₀Survey absorption value, find protein concentration from typical curve.Regulate protein concentration make each sample protein content be that 100 μ g make the 10%SDS-PAGE electrophoresis, and be transferred on the nitrocellulose filter, carry out westernblot.The nitrocellulose filter that contains sample was washed 30 minutes with the PBS of 2% skim-milk preparation, after diluting by 1: 250 usefulness 2% skim-milk-PBS with rabbit how anti-(the anti-people VEGF of rabbit polyclonal antibody one is anti-), oscillatory reaction 1.5 hours was washed 30 minutes with 2% skim-milk-PBS.Use 1: 50 2% skim-milk-PBS of HRP-goat anti-rabbit igg to dilute afterreaction 1 hour then, PBS washed 30 minutes, and DAB test kit color development treatment is calculated the protein expression inhibiting rate.

Embodiment 2, pass through T ₇The little double-stranded intervening rna of RNA polymerase synthetic (siRNA) suppresses VEGF expression of gene in the SMMC-7721 liver cancer cell

(1) passes through T ₇RNA polymerase is synthesized siRNA

Double-stranded RNA provided by the present invention (siRNA), be to obtain by the sequence that is found among the GenBank about people VEGFmRNA according to the contriver, the action site of these RNA sequences and pairing people VEGF mRNA thereof sees Table 1, and (SEQ ID NO.1) is example with sequence 1:

Design synthetic primer earlier:

T ₇：5’-TAA TAC GAC TCA CTA TAG-3’ (SEQ ID NO.7)

sense：5’-TCG TGA TGA TTC TGC CCT CCT CCT ATA GTG AGT CGT ATT A-3’

(SEQ ID NO.8)

antisense：5’-AAG GAG GAG GGC AGA ATC ATC ACT ATA GTG AGT CGT ATT A-3’

(SEQ ID NO.9)

Three kinds of primers respectively are dissolved among the 100 μ l.

(1) forms double-stranded DNA (dsDNA) earlier: the T that gets 1nmol ₇The sense primer of the VEGF of primer and 1nmol is dissolved in 50 μ l TE buffer (10mmol Tris-HCL pH 8.0,1mmol EDTA) as A1; Get the T of 1nmol ₇The antisense primer of the VEGF of primer and 1nmol is dissolved in 50 μ l TE buffer (10mmol Tris-HCL pH8.0,1mmol EDTA) as B1, respectively A1 and 95 ℃ of heating of B1 pipe progressively is cooled to 4 ℃ after 2 minutes.

Transcribe: in the responsive transcription system of 50 μ l:

200pmol dsDNA (A1 or B1)

1mmol rNTPs

U yeast pyrophosphatase

40U RNA enzyme inhibitors (RnaseOUT)

100U T ₇RNA polymerase (T ₇RNA polymerase)

1 * T ₇Transcribe damping fluid (40mmol Tris-HCL pH 8.0

6mmol MgCl2

10mmol DTT

10mmol NaCl

2mmol spermidine)

Be called A2 and B2.A2 and B2 were put 37 ℃ of heating after 2 hours, and each adds 1U does not have behind the DNA enzyme (RNase free Dnase) of RNA enzyme again that 37 ℃ of heating obtained A3 and B3 in 15 minutes.

Form siRNA:

A3 and B3 are mixed, and 95 ℃ were heated 5 minutes, and 37 ℃ were heated 1 hour, and progressively were cooled to 4 ℃.

This liquid is 5.2 with 3M sodium-acetate adjust pH, and with the dehydrated alcohol precipitation of 2.5 times of volumes, centrifuged deposit is washed once with 70% ethanol again, dries up, and being dissolved in 50 μ l does not have in water (RNase-free) water of RNA enzyme, and-20 ℃ frozen stand-by.

(2) siRNA suppresses VEGF expression of gene in the SMMC-7721 liver cancer cell

Use the RPMI-1640 nutrient solution on SMMC-7721 cell 24 orifice plates, contain 6% calf serum (FBS) and two anti-(penicillin, Streptomycin sulphate, down with) at 37 ℃ of 5%CO ₂Be cultured to 50% of full bottle in the cell culture incubator.Then, inhale and remove nutrient solution, do not wash 1 time with not containing two RPMI-1640 anti-and FBS.Before transfection siRNA, add serum-free and two anti-DMEM197 μ l/ hole.Next get 20 μ M siRNA, 3 μ l (final concentration is 60pM), add 40 μ l Opti-MEM mixed dilutings, another test tube adds 2 μ l oligofectamine Reagent, with 8 μ l Opti-MEM mixed dilutings.Two test tubes were placed 10 minutes under the room temperature aseptic condition, and two test tubes merge to mix under the room temperature aseptic condition of back to be placed 15～20 minutes, treated to move in 24 orifice plates after the solution retrogradation, and every hole adds 53 μ l and amounts to the every hole of 250 μ l/ developing medium, 37 ℃ of 5%CO ₂Under cultivated 4 hours, every hole adds and contains the two anti-RPMI-1640 nutrient solution 250 μ l of 3 times of FBS and 3 times, 37 ℃ of 5%CO ₂Under cultivated 72 hours.

Behind the transfection siRNA, cell cultures was inhaled and is removed developing medium in 72 hours, washed cell once with 0.1M PBS liquid, and every hole adds 50 μ l 1%SDS, and behind the taking-up cell, slight 10 ' ,-70 ℃ in ultrasonication cell is frozen.Take out 3 μ l simultaneously and survey protein concentration with Bio-Rad DC, OD750 surveys absorption value, finds protein concentration from typical curve.Regulate protein concentration make each sample protein content be that 100 μ g make the 10%SDS-PAGE electrophoresis, and be transferred on the nitrocellulose filter, carry out westernblot.The nitrocellulose filter that contains sample was washed 30 minutes with the PBS of 2% skim-milk preparation, and after diluting by 1: 200 usefulness 2% skim-milk-PBS with rabbit is how anti-, oscillatory reaction 1.5 hours was washed 30 minutes with 2% skim-milk-PBS.Diluted afterreaction 1 hour with HRP-goat anti-rabbit igg 1:100 2% skim-milk-PBS then, PBS washed 30 minutes, and DAB test kit color development treatment the results are shown in Figure 1, and 1 is the SMMC7721 cell among the figure, and 2 are transfection T ₇The SMMC7721 cell of-siRNA, 3 is the Hela cell, 4 are transfection T ₇The Hela cell of-siRNA.Can be observed with the untransfected tumour and compare significantly minimizing of VEGF amount in the transfectional cell, calculate the protein expression inhibiting rate.

Embodiment 3: the hair clip shape double-stranded RNA of structure suppresses VEGF expression of gene in the SMMC-7721 liver cancer cell

(1): the preparation of U6 promotor

1, the process of U6 promotor PCR primer design and PCR

Primer:

3 ' end primer

AATCTGCAGAAAAAGCGGACCGAAGTCCGCTCTAGATGCATGCTCGAGGTCGTCCGGTGTTTCGTCCTTTCCA

C

(SEQ ID NO.10)

5 ' end primer

CGCGGATCCAAGGTCGGGCAGGAAGAGGGC

(SEQ ID NO.11)

Pcr template: pTZU6+27

The process of PCR

94 ℃ 1 minute, 57 ℃ 1 minute, 72 ℃ 1 minute, after 35 circulations, 72 ℃ 10 minutes, 4 ℃ of preservations.

2.PCR product is through 1% agarose gel electrophoresis, at 280bp a very dark very bright band is arranged under the UV-light, the band of U6 promotor that Here it is, downcut,, get the DNA that 17 μ l reclaim with the double-stranded DNA on the Qiagen gel recovery test kit recovery gel, add 10X restriction enzyme PstI damping fluid 2 μ l, add restriction enzyme PstI 1 μ l again, mixing, 37 ℃ are incubated enzymolysis 5 hours, after the reaction, add 16 μ l 4M Spirit of Mindererus in the reaction system, 84 μ l dehydrated alcohols mix,-20 ℃ 30 minutes, 4 ℃ of 14000g 15 minutes are centrifugal, remove supernatant, after drying up, add 17 μ l sterilized waters and 10X restriction enzyme BamHI damping fluid 2 μ l, add restriction enzyme BamHI 1 μ l again, mix, 37 ℃ are incubated enzymolysis 2 hours.At last, 1% agarose gel electrophoresis has a very dark very bright band at 280bp under the UV-light, downcuts, and the double-stranded DNA with on the Qiagen gel recovery test kit recovery gel is dissolved in the 20 μ l sterilized waters, is to be A liquid, and-20 ℃ of preservations are standby.

(2): the enzyme of pRK5 plasmid cut with being connected of U6 promotor

1. get plasmid pRK5 (4716bp) 0.5 μ g (0.5 μ l), add 10X restriction enzyme PstI damping fluid 2 μ 1, sterilized water 17 μ l and restriction enzyme PstI 1 μ l, mixing, 37 ℃ are incubated enzymolysis 5 hours, after the reaction, add 16 μ l 4M Spirit of Mindererus in the reaction system, 84 μ l dehydrated alcohols, mix ,-20 ℃ 30 minutes, 4 ℃ of 14000g 15 minutes are centrifugal, remove supernatant, after drying up, add 17 μ l sterilized waters and 10X restriction enzyme BamHI damping fluid 2 μ l, add restriction enzyme BamHI 1 μ l again, mix, 37 ℃ are incubated enzymolysis 2 hours.At last, 1% agarose gel electrophoresis has a band above 4500bp under the UV-light, downcuts, and the double-stranded DNA with on the Qiagen gel recovery test kit recovery gel is dissolved in the 20 μ l sterilized waters, is to be B liquid, and-20 ℃ of preservations are standby.

2. get above-mentioned A liquid 7 μ l, B liquid 1 μ l adds the sterilized water of 10 μ l, and the T4 dna ligase of the 10XT4 dna ligase damping fluid of 2 μ l and 1 μ l was hatched 1 hour for 22 ℃.

The competence escherichia coli DH5a that in Incubating Solution, adds 100 μ l, transformed into escherichia coli, be coated on then on the LB solid medium of 100 μ g/ml penbritins, 37 ℃ incubated overnight 16-18 hour, the picking colony bacterium of in the liquid LB substratum that contains 100 μ g/ml penbritins, increasing at random, the extracting plasmid, cut with restriction enzyme PstI and BamHI enzyme respectively, reaction solution separates at 1% agarose gel electrophoresis, the results are shown in Figure 2, among the figure, 4,7,8 positive bacterium.Selection occurs inserting segmental plasmid about 300bp, preserves standby.

(3): the preparation of VEGF suppressor gene be connected

Hair clip shape double-stranded RNA provided by the present invention (siRNA) is to be obtained by the sequence about people VEGF mRNA that is found among the GenBank according to the contriver, and the action site of these RNA sequences and pairing people VEGF mRNA thereof sees Table 1,

The contriver is according to above principle, and sequence 2 in claims 1 (SEQ ID NO.2) has been synthesized in design:

5’AA UCA UCA CGA AGU GGU GAA G 3’

3’UU AGU AGU GCU UCA CCA CUU C 5’

Act on the 146-164 position of VEGF mRNA.

Two ends stay the restriction enzyme site of SalI and XbaI, and the gene order of concrete hair clip shape RNA is:

The N end

5’TCGACC TCATCACGAAGTGGTGAAGTTCAAGAGACTTCACCACTTCGTGATGATTTTTTGGAAAT

(SEQ ID NO.12)

The C end

5’ CTAGATTCCAAAAAATCATCACGAAGTGGTGAAGTCTCTTGAAGCTTCACCACTTCTGATGACGG

(SEQ ID NO.13)

1. above-mentioned two single stranded DNAs of synthetic respectively are made into two strands

The single stranded DNA that is made into 50 μ M is respectively got 2 μ l, add the annealing Buffer (100mM Potassium ethanoate, 30mM Hepes-KOH pH7.4,2mM magnesium acetate) of 46 μ l, in the PCR instrument, 95 ℃ 4 minutes, 70 ℃ 10 minutes, the shutdown postcooling to room temperature, 4 ℃ deposit after ,-20 ℃ of preservations are standby.

2. the phosphorylation of synthetic dsdna

2 μ l synthetic dsdnas

The buffer A of 1 μ l T4 polynueleotide kinase

1μl 1mMATP

1μl T ₄PNK

5 μ l sterilized waters

Is cumulative volume the liquid mixing of 10 μ l, 37 ℃ 30 minutes, 70 ℃ 10 minutes, be cooled to room temperature then, 4 ℃ deposit after ,-20 ℃ of preservations are standby.

3. get the pRK5 plasmid 16 μ l (1 μ g) that connected the U6 promotor, add 10X restriction enzyme SalI damping fluid 2 μ l, each 1 μ l of restriction enzyme SalI and XbaI, mixing, 37 ℃ are incubated enzymolysis 5 hours, after the reaction, 1% agarose gel electrophoresis has a band below 5000bp under the UV-light, downcut, double-stranded DNA with on the Qiagen gel recovery test kit recovery gel is dissolved in the 20 μ l sterilized waters, and-20 ℃ of preservations are standby.

4. the double-stranded DNA 7 μ l of the plasmid 1 μ l that above-mentioned enzyme is cut and the VEGF of phosphorylation add the sterilized water of 10 μ l, and the T4 dna ligase of the 10XT4 dna ligase damping fluid of 2 μ l and 1 μ l was hatched 1 hour for 22 ℃.

5. the competence escherichia coli DH5a that in Incubating Solution, adds 100 μ l, transformed into escherichia coli, be coated on then on the LB solid medium of 100 μ g/ml penbritins, 37 ℃ incubated overnight 16-18 hour, the picking colony bacterium of in the liquid LB substratum that contains 100 μ g/ml penbritins, increasing at random, extracting plasmid, use restriction enzyme SalI and XbaI enzyme cutting respectively, reaction solution separates at 2.5% agarose gel electrophoresis, selects 64bp to occur and inserts segmental plasmid, and this is the pRI plasmid.

(4): the construction process that contains G418 resistant gene double-stranded RNA plasmid pCI

1. the pRI plasmid that has built, get 17 μ l (about 1 μ g), add 10X restriction enzyme EcoRI damping fluid 2 μ l, restriction enzyme EcoRI 1 μ l, mixing, 37 ℃ are incubated enzymolysis 1 hour, after the reaction, add 16 μ l 4M Spirit of Mindererus in the reaction system, 84 μ l dehydrated alcohols mix,-20 ℃ 30 minutes, 4 ℃ of 14000g 15 minutes are centrifugal, remove supernatant, after drying up, add 17 μ l sterilized waters and 10X restriction enzyme XbaI damping fluid 2 μ l, add restriction enzyme XbaI 1 μ l again, mix, 37 ℃ are incubated enzymolysis 5 hours.At last, 1% agarose gel electrophoresis has a band at 400bp under the UV-light, downcuts, and the double-stranded DNA with on the Qiagen gel recovery test kit recovery gel is dissolved in the 20 μ l sterilized waters, is to be A liquid, and-20 ℃ of preservations are standby.

2. get pcDNA3.0 plasmid 17 μ l (about 1 μ g), add 10X restriction enzyme EcoRI damping fluid 2 μ l, restriction enzyme EcoRI 1 μ l, mixing, 37 ℃ are incubated enzymolysis 2 hours, after the reaction, add 16 μ l 4M Spirit of Mindererus in the reaction system, 84 μ l dehydrated alcohols, mix ,-20 ℃ 30 minutes, 4 ℃ of 14000g 15 minutes are centrifugal, remove supernatant, after drying up, add 17 μ l sterilized waters and 10X restriction enzyme XbaI damping fluid 2 μ l, add restriction enzyme XbaI 1 μ l again, mix, 37 ℃ are incubated enzymolysis 5 hours.At last, 1% agarose gel electrophoresis has a band at 5400bp under the UV-light, downcuts, and the double-stranded DNA with on the Qiagen gel recovery test kit recovery gel is dissolved in the 20 μ l sterilized waters, is to be B liquid, and-20 ℃ of preservations are standby.

3. the connection of plasmid, conversion and evaluation

(1) get above-mentioned A liquid 7 μ l, B liquid 1 μ l adds the sterilized water of 10 μ l, and the T4 dna ligase of the 10XT4 dna ligase damping fluid of 2 μ l and 1 μ l was hatched 1 hour for 22 ℃.

(2) the competence escherichia coli DH5a of adding 100 μ l in Incubating Solution, transformed into escherichia coli, be coated on then on the LB solid medium of 100 μ g/ml penbritins, 37 ℃ of incubated overnight 18 hours, the picking colony bacterium of in the liquid LB substratum that contains 100 μ g/ml penbritins, increasing at random, extracting plasmid, use restriction enzyme EcoRI and XbaI enzyme cutting respectively, reaction solution separates at 1% agarose gel electrophoresis, selects 400bp to occur and inserts segmental plasmid, is the pCI plasmid.

(5) the .pCI plasmid is to the restraining effect of SMMC-7721 liver cancer cell VEGF genetic expression

1.SMMC-7721 the cultivation of liver cancer cell and transfection

SMMC-7721 liver cancer cell cell is from cell institute of the Shanghai Chinese Academy of Sciences, and 1640 substratum+10% calf serum is cultivated, and the adherent rate of waiting to cultivate cell is spread 6 porocyte culture plates, 1.5 * 10 about 80% ⁵Individual cells/well, after the incubated overnight, the adherent rate of cell is inhaled and is removed nutrient solution when 90% left and right sides, does not wash 1 time with not containing two resisting with 1640 of calf serum.Next get pCI plasmid 4 μ g, add 250 μ l Opti-MEM mixed dilutings, another test tube adds 10 μ l lipofectamin2000, with 250 μ l Opti-MEM mixed dilutings.Two test tubes were placed 5 minutes under the room temperature aseptic condition, and two test tubes merge to mix under the room temperature aseptic condition of back to be placed 20 minutes, treated to move in 6 orifice plates after the solution retrogradation, and every hole adds 560 μ l developing mediums, 37 ℃ of 5%CO ₂Under cultivated 4 hours, every hole adds and contains the two anti-RPMI-1640 1440 μ l of 2 times of calf serums and 2 times, 37 ℃ of 5%CO ₂Under cultivated 72 hours.

2. the screening of cell

Developing medium is removed in suction, with the 1640 substratum screening positive cell that contains 200 μ g/ml G418, middle constantly change fresh 1640 substratum that contain 200 μ g/ml G418, treat that cell is adherent fully after, this is the SMMC-7721 liver cancer cell (positive cell strain) that contains the pCI plasmid.

3. the evaluation of the recovery of cell and inhibition effect

The SMMC-7721 liver cancer cell that contains the pCI plasmid, is inhaled and removed developing medium after 72 hours in 1640 culture medium culturing that do not contain G418, use Hank ' s liquid to wash once, every hole adds 50 μ l 1%SDS, after taking out cell, slight ultrasonication cell 10 seconds ,-70 ℃ are frozen.Take out 3 μ l simultaneously and survey protein concentration with Bio-Rad DC, OD750 surveys absorption value, finds protein concentration from typical curve.Regulate protein concentration make each sample protein content be that 100 μ g make 10% SDS-PAGE electrophoresis, and be transferred on the nitrocellulose filter, carry out westernblot.(0.1M pH7.0) washes 30 minutes to the nitrocellulose filter that contains sample, and after diluting by 1: 200 usefulness 2% skim-milk-PBS with rabbit is how anti-, oscillatory reaction 1.5 hours was washed 30 minutes with 2% skim-milk-PBS with the PBS of 2% skim-milk preparation.Diluted afterreaction 1 hour with HRP-goat anti-rabbit igg 1:50 2% skim-milk-PBS then, PBS washed 30 minutes, DAB test kit color development treatment.Found that, compare, calculate its VEGF expression of gene protein inhibiting rate of cell that transduction has the pCI plasmid with non-transfected cells.

Embodiment 4: make up two-way expression sense and antisense and form little dsrna expression vector

1, comprises the formation of the double-stranded DNA of goal gene

For the little double-stranded RNA sequence that will design can be expressed in plasmid, at first synthetic 3 primers utilize round pcr to form the double chain DNA fragment that comprises the U6+27 promotor accordingly respectively.

With sequence 4 (No.260) is example, and the sequence of 3 primers is respectively:

A.3 ' terminal normal chain (sense) primer sequence is:

5’ATT GGG CCC GTC GAC ATC GAT AAA AAA GTT CAT GGA TGT CTA TCA GTT CGG TGTTTC GTC CTT TCC AC 3’

(SEQ ID NO.14)

B.3 ' terminal minus strand (antisense) primer sequence is:

5’CCG GAA TCC TCT AGA AAA AAA CAA GTA CCT ACA GAT AGT CTT CGG TGT TTC GTCCTT TCC AC 3’

(SEQ ID NO.15)

5 ' terminal primer sequence is:

5’ATA AGA ATG CGG CCG CCC CGG GGA TCC AAG GTC GGG 3’

(SEQ ID NO.16)

Respectively with 3 ' terminal normal chain and minus strand primer and 5 ' terminal primer by pcr amplification formation two dna double chains (sense chain, antisense chain), pcr template is pTZU6+27, the process of PCR: 94 ℃ 1 minute, 57 ℃ 1 minute, 72 ℃ 1 minute, after 35 circulations, 72 ℃ 10 minutes, 4 ℃ of preservations are called PCR product 1 and PCR product 2.

2, enzyme is cut double-stranded DNA and the plasmid vector pcDNA3.1 (5.428kb) that comprises goal gene U6+27-antisense

PCR product 2 has a very dark very bright band through 1.5% agarose gel electrophoresis about 350bp under the UV-light, be U6+27-antisense DNA band, reclaims test kit with the Qiagen gel and reclaims.That gets that 17 μ l reclaim contains U6+27-antisense DNA, adds 10 * restriction enzyme XbaI damping fluid, 2 μ l, adds restriction enzyme XbaI1 μ l again, mixing, 37 ℃ of enzymes are cut and are spent the night, and add restriction enzyme BamHI 1 μ l again in reaction system, and 37 ℃ of enzymes are cut 3h.Same method XbaI and BamHI digested plasmid carrier pcDNA3.1 (5.428kb).Electrophoresis also reclaims, and obtains containing U6+27-antisense small pieces segment DNA (restriction enzyme site is XbaI and BamHI) and big fragment plasmid vector pcDNA3.1 (restriction enzyme site is XbaI and BamHI).-20 ℃ of preservations are standby.

3, enzyme is cut double-stranded DNA and the plasmid vector pcDNA3.1 (5.428kb) that forgives goal gene U6+27-sense

PCR product 1 has a very dark very bright band through 1.5% agarose gel electrophoresis about 350bp under the UV-light, be U6+27-sense DNA band, reclaims test kit with the Qiagen gel and reclaims.Get the U6+27-senseDNA that contains of 17 μ l recovery, add 10 * restriction enzyme NotI damping fluid, 2 μ l, add restriction enzyme NotI 1 μ l again, mixing, 37 ℃ of enzymes are cut and are spent the night, and add 16 μ l 4M Spirit of Mindererus then in the reaction system, 84 μ l dehydrated alcohols, mix ,-20 ℃ 30 minutes, 4 ℃ of 14000g 15 minutes are centrifugal, remove supernatant, after drying up, add 17 μ l sterilized waters and 10 * restriction enzyme A paI, enzyme is cut 3h.Same method is cut pcDNA3.1 with NotI and ApaI enzyme.Obtain containing U6+27-sense small pieces segment DNA (restriction enzyme site be NotI and ApaI and) and big fragment plasmid vector pcDNA3.1 (restriction enzyme site is NotI and ApaI).-20 ℃ of preservations are standby.

4, goal gene U6+27-antisense is connected among the plasmid vector pcDNA3.1

Get enzyme and cut big fragment plasmid vector pcDNA3.1 (restriction enzyme site is XbaI and BamHI) 1 μ l, get U6+27-antisense small pieces segment DNA (restriction enzyme site is XbaI and BamHI) 7 μ l again, the sterilized water that adds 10 μ l, the T4 dna ligase of the 10 * T4 dna ligase damping fluid of 2 μ l and 1 μ l was hatched 1 hour for 22 ℃.The competence bacillus coli DH 5 alpha that in Incubating Solution, adds 100 μ l, transformed into escherichia coli, be coated on then on the LB solid medium that contains 100 μ g/ml penbritins, 37 ℃ of incubated overnight 16-18h, the picking colony bacterium of in the liquid LB substratum that contains 100 μ g/ml penbritins, increasing at random, extracting plasmid, cut evaluation with restriction enzyme XbaI and BamHI enzyme respectively, reaction solution separates at 1.5% agarose gel electrophoresis, selects 350bp to occur and inserts segmental plasmid, preserves standby.

5, goal gene U6+27-sense is connected among the plasmid vector pcDNA3.1

Get enzyme and cut big fragment plasmid vector pcDNA3.1 (restriction enzyme site is NotI and ApaI) 1 μ l, get U6+27-sense small pieces segment DNA (restriction enzyme site is NotI and ApaI) 7 μ l again, same step (4) connects, transforms, 37 ℃ of incubated overnight 16-18h, the picking colony bacterium of in the liquid LB substratum that contains 100 μ g/ml penbritins, increasing at random, the extracting plasmid, cut evaluation with restriction enzyme NotI and ApaI enzyme respectively, reaction solution separates at 1.5% agarose gel electrophoresis, 350bp occurs and insert segmental plasmid, preserve standby.

6, the structure of psiRNA plasmid

With the positive colony bacterium upgrading grain in the step (4), and after cutting 3h with Apa I enzyme, in reaction solution, add 0.5 μ l tack enzyme, hatch 15min for 37 ℃, 75 ℃ of deactivation 10min add 16 μ l 4M Spirit of Mindererus then in the reaction system, 84 μ l dehydrated alcohols, precipitation, centrifugal.Remove supernatant, after drying up, add 17 μ l sterilized waters and 10 * restriction enzyme HindIII damping fluid and 1 μ l HindIII, enzyme is cut 3h.1.5% agarose gel electrophoresis separates, and what obtain 350bp contains U6+27-antisense small pieces segment DNA, and its restriction enzyme site is HindIII and Apa I (putting down).Glue reclaims standby.

With the positive colony bacterium upgrading grain in the step (5), and after cutting 2h with EcoR I enzyme, in reaction solution, add 0.5 μ l tack enzyme, hatch 15min for 37 ℃, 75 ℃ of deactivation 10min add 16 μ l 4M Spirit of Mindererus then in the reaction system, 84 μ l dehydrated alcohols, precipitation, centrifugal.Remove supernatant, after drying up, add 17 μ l sterilized waters and 10 * restriction enzyme HindIII damping fluid and 1 μ l HindIII, enzyme is cut 3h.1.5% agarose gel electrophoresis separates, and obtains comprising the big fragment of U6+27-sense, and its restriction enzyme site is HindIII and EcoR I (tack enzyme).Glue reclaims standby.

Get the big fragment that the comprises U6+27-sense 1 μ l in the step (7), get U6+27-antisense small pieces segment DNA (restriction enzyme site is XbaI and BamHI) the 7 μ l in the step (6) again, the method for attachment in (4) gets involved small segment in the big fragment set by step.Transformed into escherichia coli, be coated on then on the LB solid medium that contains 100 μ g/ml penbritins, 37 ℃ of incubated overnight 16-18h, the picking colony bacterium of in the liquid LB substratum that contains 100 μ g/ml penbritins, increasing at random, the extracting plasmid is cut evaluation with restriction enzyme BamHI enzyme respectively, electrophoretic separation, the segmental positive clone bacterium of 350bp occurs, the results are shown in Figure 3, No. 1 positive bacterium among the figure.The positive bacteria order-checking.The result shows in the plasmid vector of new structure and comprises U6+27-antisense and U6+27-sense, called after psiRNA.

Embodiment 5: the little double-stranded RNA of structure suppresses SMMC-7721 cell expressing VEGF

1.SMMC-7721 liver cancer cell culture experiment

Respectively the positive cell strain of SMMC-7721 liver cancer cell and the little double-stranded RNA of transfection is bred certain number in containing the RPMI-1640 substratum of 10% calf serum, 0.25% trysinization, centrifugal collection, PBS gives a baby a bath on the third day after its birth inferior, change serum free medium, plant to 96 orifice plates, every hole is 200 μ l volumes, contains 10 * 10 ³Individual cell. the same terms is cultivated down, the 3rd day collection nutrient solution, 4 ℃ of centrifugal collection supernatants.

2.VEGF the survey experiment of living

This supernatant is added in the 96 orifice plate human umbilical vein endothelial cell substratum, and every hole 50 μ l collect the umbilical vein vascular endothelial cell after 72 hours, and the MTT staining detects the endothelial cell growth situation, calculates growth inhibition ratio with following formula.

The x100% of inhibiting rate=(1-Nn/N), wherein N is the cell count after handling with the supernatant of SMMC-7721 tumour cell, and Nn is for handling back cell count (adding the cell count of collecting behind the supernatant) with the positive cell strain supernatant of the little double-stranded RNA of transfection, and No is the initial cell number.It is 72.4% that experiment obtains average growth inhibition ratio

Embodiment 6: press down the knurl experiment in the little double-stranded RNA body of structure

The tumour cell group that the BALB/C nude mice is divided at random control group (untreated fish group), the blank plasmid cell group of commentaries on classics (changeing the cell of pcDNA3.0), the little double-stranded RNA of commentaries on classics pcDNA3.0-VEGF hair clip shape, tumour cell and the positive transfection cell strain of the tumour cell of taking the logarithm respectively vegetative period, commentaries on classics pcDNA3.0,0.25% trysinization is placed in the serum-free RPMI-1640, and adjusting concentration is 5 * 10 ⁷/ ml, the right armpit that is inoculated in the BALB/C nude mouse respectively is subcutaneous, every 0.1ml, after the visible tumour of naked eyes to be formed, the next day with the length and width of vernier caliper measurement tumour, gross tumor volume calculates by following formula: V=(L * W2) * 0.52.After 22 days, put to death, and cuts tumour by the cervical vertebra dislocation at the injection tumour cell for each group, measure tumor weight, the results are shown in Figure 4,1 is control group among the figure, 2 for changeing blank plasmid cell (changeing the cell of pcDNA3.0), and 3 for changeing the tumour cell of the little double-stranded RNA of pcDNA3.0-VEGF hair clip shape.Calculate tumour inhibiting rate, and carry out microvessel density mensuration and apoptosis of tumor cells detection in the tumor tissues.The result shows that the little double-stranded RNA of pcDNA3.0-VEGF hair clip shape has the effect of obvious suppression tumor growth.

＜110〉Xu Genxing

＜120〉siRNA and the expression vector and the application in pharmacy thereof of the expression of inhibition human VEGF gene

<160>16

<210>1

<211>19

<212>RNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: the little double-stranded RNA of synthetic

<400>1

ggaggagggc agaat cat c 19

<210>2

<211>19

<212>RNA

＜213〉artificial sequence

<220>

<400>2

ucaucacgaa guggugaag 19

<210>3

<211>19

<212>RNA

＜213〉artificial sequence

<220>

<400>3

guggugaagu ucauggaug 19

<210>4

<211>19

<212>RNA

＜213〉artificial sequence

<220>

<400>4

guucauggau gucuaucag 19

<210>5

<211>19

<212>RNA

＜213〉artificial sequence

<220>

<400>5

gccauccugu gugccccug 19

<210>6

<211>19

<212>RNA

＜213〉artificial sequence

<220>

<400>6

caucaccaug cagauuaug 19

<210>7

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: T7 primer

<400>7

taatacgact cactatag 18

<210>8

<211>40

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the positive-sense strand primer of the description of artificial sequence: VEGF

<400>8

tcgtgatgat tctgccctcc tcctatagtg agtcgtatta 40

<210>9

<211>40

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the antisense strand primer of the description of artificial sequence: VEGF

<400>9

aaggaggagg gcagaatcat cactatagtg agtcgtatta 40

<210>10

<211>74

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: U6 promotor PCR 3 ' end primer

<400>10

aatctgcaga aaaagcggac cgaagtccgc tctagatgca tgctcgaggt cgtccggtgt 60

ttcgtccttt ccac 74

<210>11

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: U6 promotor PCR 5 ' end primer

<400>11

cgcggatcca aggtcgggca ggaagagggc 30

<210>12

<211>65

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: the N terminal sequence of single stranded DNA

<400>12

tcgacctcat cacgaagtgg tgaagttcaa gagacttcac cacttcgtga tgattttttg 60

gaaat 65

<210>13

<211>65

<212>DNA

＜213〉artificial sequence

<220>

<400>13

ctagattcca aaaaatcatc acgaagtggt gaagtctctt gaagcttcac cacttctgat 60

gacgg 65

<210>14

<211>69

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: beidirectional double-stranded RNA 3 ' is rectified adopted strand primer sequence

<400>14

attgggcccg tcgacatcga taaaaaagt tcatggatgt ctatcagttc ggtgtttcgt 60

cctttccac 69

<210>15

<211>62

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: beidirectional double-stranded RNA 3 ' end antisense strand primer sequence

<400>15

ccggaatcct ctagaaaaaa acaagtacct acagatagtc ttcggtgttt cgtcctttcc 60

ac 62

<210>16

<211>36

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: beidirectional double-stranded RNA 5 ' end primer sequence

<400>16

ataagaatgc ggccgccccg gggatccaag gtcggg 36

Claims

1, a specific specificity suppresses the siRNA that human VEGF gene is expressed, and it is characterized in that it is among the following siRNA any one, and its base sequence and site of action are as follows:

1：5’GGA GGA GGG CAG AAT CAT C 3’

3’CCU CCU CCC GUC UUA GUA G 5’

Act on the 132nd～150 of people VEGFmRNA

2：5’UCA UCA CGA AGU GGU GAA G 3’

3’AGU AGU GCU UCA CCA CUU C 5’

Act on the 146th～164 of people VEGFmRNA

3：5’GUU CAU GGA UGU CUA UCA G 3’

3’CAA GUA CCU ACA GAU AGU C 5’

Act on the 164th～182 of people VEGFmRNA

2, according to the siRNA described in the claim 1, they can pass through synthetic, T ₇External synthetic the expression with plasmid vector forms, and it is characterized in that this siRNA has 2～6 dT to modify or 2～6 U modifications at 3 ' end.

3, the expression vector that comprises claim 1 or 2 described siRNA.

4, claim 1 or the 2 described siRNA application in the medicine of preparation treatment and prophylaxis of tumours and the disease relevant with the new vessel paraplasm.

5, the application of the described expression vector of claim 3 in the medicine of preparation treatment and prophylaxis of tumours and the disease relevant with the new vessel paraplasm.