CN115501340B

CN115501340B - Application of CircPIAS1 as target in preparation of liver cancer diagnostic reagent or therapeutic drug

Info

Publication number: CN115501340B
Application number: CN202110630277.2A
Authority: CN
Inventors: 练一帆; 黄月华; 王嘉亮; 陈冬妹
Original assignee: Third Affiliated Hospital Sun Yat Sen University
Current assignee: Third Affiliated Hospital Sun Yat Sen University
Priority date: 2021-06-07
Filing date: 2021-06-07
Publication date: 2024-04-12
Anticipated expiration: 2041-06-07
Also published as: CN115501340A

Abstract

The invention provides application of circPIAS1 serving as a target in preparation of a liver cancer diagnosis reagent or a therapeutic drug. The invention also provides application of the circPIAS1 inhibitor or the circPIAS1 inhibitor combined with sorafenib in preparing medicines for treating liver cancer. The invention also provides application of the reagent for regulating the expression level of the circPIAS1 in preparing medicines for treating liver cancer. The invention also provides reagents for diagnosing and/or prognosis evaluation of liver cancer, comprising reagents for detecting the content of circPIAS1 in a biological sample.

Description

Application of CircPIAS1 as target in preparation of liver cancer diagnostic reagent or therapeutic drug

Technical Field

The invention relates to the technical field of biological medicines, in particular to application of circPIAS1 serving as a target in preparation of a liver cancer diagnosis reagent or a therapeutic drug.

Background

With the increase of medical level and improvement of health condition, global cancer overall mortality rate continues to decrease, but the incidence and mortality rate of liver cancer has increased year by year, and liver cancer has become the third leading cause of cancer-related death worldwide. Recent data show that global liver cancer incidence in 2018 reaches 84 ten thousand people, china is a country with highest liver cancer incidence rate, occupies more than half of new and dead liver cancer cases, brings heavy economic burden to the country and people, and consumes a large amount of medical resources, so that development of new diagnosis and treatment strategies is urgently needed to cope with serious diseases which seriously threaten human lives.

Due to insufficient early diagnosis and limited treatment means, the average 5-year tumor-free survival rate of liver cancer is only about 25 percent. In the current conventional treatment methods, the recurrence rate of a few patients who receive surgery is as high as 60-75% in five years; most patients receive hepatic artery chemoembolization treatment, but the curative effect is general and the side effect is large; the systemic targeting drugs Sorafenib (Sorafenib) and Lenvatinib (Lenvantinib) approved by the FDA have the problems of different degrees of drug resistance, relatively limited benefits and the like; while the liver cancer immunotherapy is still in the starting stage. A large number of researches at home and abroad indicate that the bottleneck of liver cancer refractory is complexity, diversity and multiple gene variability in the development and progress of liver cancer, and the characteristics are helpful for the growth of tumor cells and immune evasion; therefore, the continuous deep exploration of new liver cancer related gene pathways and the search for more effective therapeutic targets are key to improving the clinical outcome of liver cancer.

Disclosure of Invention

Based on this, it is necessary to provide the use of circPIAS1 as a target in the preparation of diagnostic reagents or therapeutic drugs for liver cancer in view of the above-mentioned problems.

The circRNA is a kind of covalent closed circular RNA molecules, and the prior study shows that the circRNA is more stable than linear RNA, is wide in variety and rich in source, can serve as miRNA sponge, codes protein and participates in posttranscriptional regulation of genes, thereby playing a specific biological function (figure 1). The relationship between circRNA and liver cancer is also one of the hot spots of current research. In recent years, it has been found that different circrnas play a role in cancer or suppression, regulating tumor growth proliferation, invasion and metastasis in liver cancer. Therefore, the in-depth research on the interaction relationship between the circRNA and the liver cancer is expected to provide a novel diagnosis and treatment marker for the liver cancer.

Current research shows that most of circrnas act as miRNA sponges, and regulate the stability of mirnas when they are assembled into RNA-induced silencing complexes, so that the expression of target genes corresponding to mirnas is enhanced or reduced, and the biological functions of the mirnas are exerted. The invention discloses a circPIAS1, which is discovered by high-throughput sequencing at the earliest that the circPIAS1 can be expressed in tissues such as liver, mammary gland and rectum, and sequence analysis shows that the circPIAS1 is a circular RNA formed by splicing mRNA corresponding to the 4 th-10 th exons of a parent PIAS1 gene from head to tail, so far, research reports on the circPIAS1 in the aspect of tumors are not seen.

Through in vivo and in vitro experimental researches, the applicant discovers that the circPIAS1 has the function of promoting liver cancer proliferation and migration capacity for the first time, and the targeting circPIAS1 pathway has the function of resisting liver cancer, and the result provides scientific basis for further designing and screening a new tumor targeting diagnosis and treatment strategy development aiming at the circPIAS 1.

The invention provides application of circPIAS1 serving as a target spot in preparation of liver cancer diagnosis reagents or therapeutic drugs, wherein the circPIAS1 is obtained by splicing mRNA corresponding to exons 4-10 of a PIAS1 gene end to end.

In one embodiment, the nucleotide sequence of the circPIAS1 is shown in SEQ ID No. 1:

SEQ ID No.1：

CATCAGACAACAGTCAGCGCTTTCGAGAAACCTGTTTTGCATTTGCCTTGACACCACAACAAGTGCAGCAAATCAGTAGTTCCATGGATATTTCTGGGACCAAATGTGACTTCACAGTACAGGTCCAGTTAAGGTTTTGTTTATCAGAAACCAGTTGTCCACAAGAAGATCACTTCCCACCCAATCTTTGTGTGAAAGTGAATACAAAACCTTGCAGCCTTCCAGGTTACCTTCCACCTACAAAAAATGGCGTGGAACCAAAGCGACCCAGCCGACCAATTAATATCACCTCACTTGTCCGACTGTCCACAACAGTACCAAACACGATTGTTGTTTCTTGGACTGCAGAAATTGGAAGAAACTATTCCATGGCAGTATATCTTGTAAAACAGTTGTCCTCAACAGTTCTTCTTCAGAGGTTACGAGCAAAGGGAATAAGGAATCCGGATCATTCTAGAGCTTTAATTAAAGAGAAGTTGACTGCGGATCCAGACAGTGAAATAGCTACAACCAGCCTAAGGGTTTCTCTACTATGTCCACTTGGTAAAATGCGGCTGACAATTCCGTGTCGGGCCCTTACATGTTCTCATCTACAATGTTTTGACGCAACTCTTTACATTCAGATGAATGAGAAAAAACCAACCTGGGTTTGTCCTGTCTGTGATAAGAAGGCTCCATATGAACACCTTATTATTGATGG。

CircPIAS1 is recorded in the CircBase database (circular RNA database), and has the mature sequence shown in SEQ ID No.1 and length of 700nt, and is numbered hsa_circ_ 0007088.

The invention also provides application of the circPIAS1 inhibitor in preparing medicines for treating liver cancer.

The invention also provides application of the circPIAS1 inhibitor combined with sorafenib in preparing medicines for treating liver cancer.

Experiments show that the proliferation capacity of liver cancer cells overexpressed by the circPIAS1 is obviously increased, the cloning capacity is obviously enhanced, and the liver cancer cells have stronger growth and migration capacity. And the gircPIAS 1 inhibitor or the gircPIAS 1 inhibitor combined with sorafenib can effectively inhibit the growth of liver cancer tumors.

In one embodiment, the circPIAS1 inhibitor comprises a specific nucleotide sequence that targets and inactivates the circPIAS1 Junction region.

In one embodiment, the specific nucleotide sequence is selected from the group consisting of: one or more than two of SEQ ID No.1, SEQ ID No.2 and SEQ ID No. 3;

circPIAS 1-inhibitor 001: TTGATGGCATCAGACAACA (SEQ ID No. 2),

circPIAS 1-inhibitor 002: GATGGCATCAGACAACAGT (SEQ ID No. 3),

circPIAS 1-inhibitor 003: CCTTATTATTGATGGCATC (SEQ ID No. 4).

The invention also provides application of the circPIAS1 inhibitor in preparing a medicament for inhibiting the growth and migration capacity of liver cancer cells.

The invention also provides application of the circPIAS1 inhibitor combined with sorafenib in preparing medicines for inhibiting growth and migration capacity of liver cancer cells.

The use of the circPIAS1 inhibitor or the circPIAS1 inhibitor in combination with sorafenib can effectively inhibit the growth and migration ability of liver cancer cells.

The invention also provides application of the reagent for regulating the expression level of the circPIAS1 in preparing medicines for treating liver cancer.

The growth and migration ability of liver cancer cells can be inhibited by down-regulating the expression level of circPIAS 1.

The invention also provides a reagent for diagnosing and/or prognosis evaluation of liver cancer, which comprises a reagent for detecting the content of the circPIAS1 in the biological sample.

In one embodiment, the biological sample is serum, plasma, or exosomes.

Compared with the prior art, the invention has the following beneficial effects:

the invention takes the circPIAS1 as a target spot, and achieves the effect of inhibiting the growth and migration capacity of liver cancer cells by down-regulating the expression of the circPIAS1 or inhibiting the circPIAS 1.

Drawings

FIG. 1 is a schematic diagram of the regulatory effect of circRNA as a miRNA sponge on a miRNA target gene.

FIG. 2 shows the expression abundance of circPIAS1 in serum exosomes of 21 liver cancer patients.

FIG. 3 shows the results of verification of the true expression of circPIAS1 in liver cancer.

Wherein A is a sequence composition schematic diagram of the circPIAS1, B is a circPIAS1 verification convergent primers and a probe design schematic diagram, C is a circPIAS1 Junction region sequencing peak diagram, and D is an RNase R enzyme practical verification result.

FIG. 4 shows the results of construction of a HepG2 overexpressing circPIAS1 cell line verified by Norhtern Blot experiments and qRT-PCR experiments.

Wherein A is Norhtern Blot experimental result, and B is qRT-PCR experimental result.

FIG. 5 shows the results of CCK-8 proliferation assay to verify the ability of overexpressing circPIAS1 to promote proliferation of hepatoma cells.

FIG. 6 shows the results of plate cloning experiments to verify that overexpression of circPIAS1 promotes liver cancer cell stem.

FIG. 7 shows the results of Transwell experiments demonstrating that overexpression of circPIAS1 promotes migration of hepatoma cells.

FIG. 8 is a result of qRT-PCR experiment verification of construction of PLC/PRF/5 knock-down circPIAS1 cell line.

FIG. 9 shows the results of CCK-8 proliferation assay to verify the ability of knockdown circPIAS1 to inhibit proliferation of hepatoma cells.

FIG. 10 shows the results of Transwell experiments to verify that knockdown circPIAS1 inhibits the ability of liver cancer cells to migrate.

FIG. 11 is a graph showing the results of PARIS experiments demonstrating the localization of circPIAS1 in hepatoma cells.

Wherein A is qRT-PCR experiment to verify the expression result of the circPIAS1 in cytoplasmic nucleus and plasma, and B is FISH experiment result.

FIG. 12 shows the effect of the combination of the circPIAS1 inhibitor and Sorafenib on tumor growth.

Wherein A is the immunohistochemical identification of tumor cells, B is the volume comparison of tumors collected by different treatment groups after the experiment is finished, C is the tumor weight curve of the different treatment groups, and D is the tumor volume growth curve of the different treatment groups. * : p <0.001.

FIG. 13 is a graph showing the effect of different concentrations of the circPIAS1 inhibitor and Sorafenib on survival of hepatoma cells and normal human hepatocytes.

Wherein, the left graph is the circPIAS1 inhibitor, and the right graph is sorafenib.

Detailed Description

In order that the invention may be understood more fully, a more particular description of the invention will be rendered by reference to the preferred embodiments that are now set forth. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.

Example 1

And (5) analyzing a biological information database.

(1) GEO database:

a comprehensive Gene expression (Gene Expression Omnibus, GEO) database (http:// www.ebi.ac.uk/arrayexpress /) was created in 2000 by NCBI and the data of gene expression submitted by the global research institute was recorded on the website. In order to explore important genes and pathways closely related to the development of liver cancer, the inventors performed a search analysis using the NCBI GEO database, in which dataset GSE77661 contained a plurality of human cancer and paracancestral circRNA expression sequencing data, in an analysis of liver cancer dataset, one expression of circRNA hsa_circ_0007088 (circPIAS 1) was found that could be related to liver cancer.

(2) exoRbase database:

the exoRbase database is a database of human blood exosomes circRNA, lncRNA and mRNA, the exosomes are nanoscale endocytic vesicles that can be secreted by most cells, contain a large number of different types of RNAs, can regulate the behavior of receptor cells, and can be used as circulating biomarkers for diseases. exoRBase integrates and visualizes the RNA expression profile of standardized RNA-seq data, which covers normal individuals and patients with different diseases.

In the present invention, the inventors have found that circPIAS1 is expressed in serum exosomes of liver cancer patients by using exoRbase database analysis (FIG. 2). To verify the expression of circPIAS1, the inventors analyzed the transcription structure of circPIAS1 according to the sequence recorded by circBase (FIG. 3A), and designed convergent primer (FIG. 3B), the nucleotide sequence of convergent primer was shown as SEQ ID Nos. 5-6, and it was confirmed by sequencing that circPIAS1 was spliced end to end from exon 4 to exon 10 of PIAS1 mRNA (FIG. 3C), and enzyme experiments further showed that circPIAS1 was more resistant to cleavage by RNase R than linear PIAS1 mRNA (linePIAS 1) (FIG. 3D), thus confirming its cyclicity.

Example 2

Influence of CircPIAS1 on malignant phenotype of hepatoma cells.

1. Experimental protocol

In vitro cytological function experiments are carried out by using human hepatoma cell lines (HepG 2 and PLC/PRF/5), stable high expression (pLO 5-Vector (control empty Vector) vs. pLO5-circPIAS1 (high expression)) and knockdown (pLKO.1-SHC 202 (control group, non-target shRNA) vs. pLKO.1-shrPIAS 1 (knockdown)) of the circPIAS1 are respectively established by a lentiviral infection expression system, and the functions of the circPIAS1 expression on the growth, proliferation and metastasis of hepatoma cells are verified by using CCK-8 experiments, plate cloning experiments, soft agar colony formation experiments, transwell experiments, scratch experiments and the like.

2. Verification experiment

(1) CCK-8 proliferation assay

The first step: the circ-PIAS over-expressed and knocked down liver cancer cell lines grown in log phase were taken, counted by digestion, and diluted to 10000 cells per ml with DMEM medium containing 10% FBS.

And a second step of: the diluted cell suspension was aspirated, and cells were seeded in 96-well plates (100 cells per well/100. Mu.l) at a volume of 100. Mu.l per well, and a round of sterilized double distilled water was added around the plate edge and placed in a cell incubator for overnight culture.

And a third step of: CCK-8 working solution (1:100) was prepared in proportion, cells were removed from the incubator, the supernatant was carefully discarded, 100. Mu.L of diluted CCK-8 working solution was added to each well, and the wells were incubated at 37℃for 4 hours.

Fourth step: after incubation, the 96-well plate is placed in an enzyme-labeled instrument, and the absorbance at the wavelength of 450nm is read.

Fifth step: the test is carried out daily at a fixed time, and a growth curve is drawn by taking days as an abscissa and light absorption values as an ordinate.

(2) Plate cloning experiments

The first step: cells in good growth state were subjected to digestion counting, resuspended using complete medium and cell density was adjusted to 1000 cells/ml.

And a second step of: the cell suspension is inoculated into 6-hole plates, each group is provided with 3 compound holes, and the compound holes are placed into a cell incubator for culture after being gently shaken.

And a third step of: continuously culturing the inoculated cells in an incubator for 7-14 days, observing the cell state every two days in the middle, and replacing fresh complete culture medium until the number of most single clone cells is more than 100.

Fourth step: after clone formation, cells were removed from the incubator, medium was discarded, washed twice with fresh PBS, pre-chilled methanol was added and fixed at 4 ℃ for 30min; the fixative was aspirated, washed twice with PBS, and stained with 0.5% crystal violet for 2h.

Fifth step: and (3) recovering crystal violet, vertically and slowly placing the pore plate into tap water to clean the background, photographing under a microscope after airing, and counting the number of purple clones with the visual field of more than 1 mm.

(3) Soft agar colony formation experiments

Cells were seeded in 6-well plates and used after cells had grown to about 95%. After 2h, 5X 10 ³ Cells were resuspended in 1ml of 0.375% agar DMEM medium containing 10% fbs and poured on top of 0.6% agar DMEM medium (2.0 ml/well) in 6-well plates. After 2 weeks, count and shoot>Colonies of 100 cells. The calculation formula of colony volume is: volume= (length x width ² )/2。

(4) Transwell experiment

The first step: prior to the experiment, the cells were starved for 24h in serum-free culture.

And a second step of: cells were digested, resuspended and counted using serum-free DMEM, and cell concentrations were adjusted to 5×10 ⁵ And each ml.

And a third step of: mu.l of DMEM medium containing 10% FBS was added to the wells of the 24-well plate.

Fourth step: the chamber was removed, the chamber PC membrane was gently rinsed with 100. Mu.l of serum-free medium, and then 200. Mu.l of the cell suspension was added to the chamber interior.

Fifth step: the cells-containing chamber was carefully transferred with forceps to a 24-well plate containing complete medium to avoid air bubbles, and the 24-well plate was placed in a cell incubator for 24h.

Sixth step: after the incubation was completed, the cells were removed and the medium in the upper chamber was carefully aspirated, and the cells in the upper chamber were gently scraped with a cotton swab.

Seventh step: the cells were fixed with methanol for 30min, stained with 0.5% crystal violet for 2h, and rinsed with tap water until the background was clear.

Eighth step: randomly selecting 3-5 visual fields under a normal microscope, and calculating the number of the cells passing through the membrane.

(5) Scratch test

The first step: before inoculating cells on the culture plate, a cross line mark is drawn on the back of the 12-hole plate by using a decoloration-preventing Marker pen.

And a second step of: cells were digested and counted, and the counted cells were inoculated into 12-well plates, preferably after adherence to the walls and plating to the bottom of the plates.

And a third step of: after the cells are attached, the sterilized 200 mu l gun head is used for rapidly scratching the cells from top to bottom perpendicular to the pore plate, and the width of each scratch is ensured to be consistent as much as possible.

Fourth step: the cell culture medium was removed, the scratched area was gently rinsed three times with PBS, cell debris was washed off, and serum-free medium was added for culture.

Fifth step: putting the culture plate into an incubator, taking out and photographing every 4-6 hours, and analyzing scratch areas according to collected picture data.

(6) qRT-PCR experiments

a) The circPIAS1 primer was designed and submitted to the primer synthesis company for synthesis, and the circPIAS1 primer sequence pairs were as follows:

the circPIAS1 forward primer sequence: TGTCGGGCCCTTACATGTTC (SEQ ID No. 5);

the circPIAS1 reverse primer sequence: TCTCGAAAGCGCTGACTGTT (SEQ ID No. 6).

b) PCR conditions for circPIAS1 quantification: (i) initial denaturation: 5min,95 ℃; (ii) 45 cycles: 15sec of denaturation at 95 ℃; annealing for 20sec,55 ℃; extended for 20sec,72 ℃. (iii) final extension: 5min at 72 ℃.

3. Results

The stable strain of the liver cancer overexpressed by the HerG 2 cell is constructed by using a slow virus infection mode, FIG. 4A is a Northern Blot experiment result, FIG. 4B is a qRT-PCR experiment result, and compared with pLO5-V, the expression quantity of the pLO5-circPIAS1 is obviously increased, which indicates that the construction of the stable strain of the liver cancer overexpressed by the HerG 2 cell is successful. FIG. 5 shows the experimental results of CCK-8, and the number of cells of pLO5-circPIAS1 is more than that of pLO5-V, which indicates that the proliferation capacity of liver cancer cells overexpressed by circPIAS1 is remarkably increased. FIG. 6 shows the results of plate clone formation experiments, and the number of colonies corresponding to pLO5-circPIAS1 is significantly greater than that of pLO5-V, indicating that the clonogenic capacity of liver cancer cells overexpressed by circPIAS1 is significantly enhanced. FIG. 7 shows the result of Transwell experiments, which shows that the migration ability of pLO5-circPIAS1 cells is significantly stronger than that of pLO5-V, and the circPIAS1 has the effect of promoting the growth and migration of liver cancer cells in vitro.

The construction of the stable strain of the knockdown circPIAS1 liver cancer is carried out on the PLC/PRF5 cells by using a slow virus infection mode, and FIG. 8 is a qRT-PCR experiment result, compared with shNC, shcircPIAS1, the expression level is obviously lower, which shows that the construction of the strain of the knockdown circPIAS1 cell of the PLC/PRF/5 is successful. FIG. 9 shows the experimental results of CCK-8, which are compared with shNC, shcircPIAS1, the cell number is smaller, and the proliferation capacity of the liver cancer cell knockdown by the circPIAS1 is obviously reduced. Fig. 10 shows that the transference capacity of cells was significantly reduced compared to shNC, shcircPIAS1, indicating that the migration capacity of the circumcision pias1 knockdown liver cancer cells was significantly impaired.

Example 3

Positioning of CircPIAS1 in hepatoma cells.

1. Experimental method

Immunofluorescence method:

the first step: taking liver cancer cells growing in log phase, uniformly inoculating into a chamber culture dish, and inoculating 1×10 of each hole ⁵ And each.

And a second step of: after cell attachment, the supernatant was discarded, washed twice with PBS, and each well was fixed with 200. Mu.l of pre-chilled methanol solution for 15min.

And a third step of: methanol was discarded, PBS was washed twice, and 0.1% Triton X-100 was added to break membranes for 5min.

Fourth step: PBS was washed twice, and appropriate amount of CCT6A (1:100 dilution) primary antibody was added to each well (preferably to completely cover the cells) and incubated overnight at 4 ℃.

Fifth step: the sample is taken out and the primary antibody is recovered, PBS is washed twice, and fluorescent secondary antibody (diluted 1:1000) is added for incubation for 45min at room temperature (whole light-shielding operation after the secondary antibody is added).

Sixth step: the secondary antibody was discarded, washed twice with PBS, and stained with DAPI (1:5000 dilution) for 5min.

Seventh step: the residual DAPI dye is washed off by PBS, an external device of the chamber culture dish is removed, and after the natural drying, the anti-quenching agent is used for sealing the plate, and the plate is observed under a fluorescence microscope.

2. Results

Isolation of hepatoma cells by PARIS kit cytoplasmic and nuclear RNA analysis found that circPIAS1 was mainly expressed in the cytoplasm (FIG. 11A), and that after overexpression of circPIAS1 was observed by FISH experiments, it was mainly distributed in the cytoplasm (FIG. 11B). The positioning of CircPIAS1 has a significant impact on its functioning.

Example 4

Inhibiting the anti-liver cancer effect of the circPIAS1 in vivo.

1. Experimental method

(1) Grouping animals

Four groups were set up after the animal model was tumor using the nude mice subcutaneous tumor model: the first group is a Vehicle control group, the second group is a circPIAS1 inhibitor, the third group is a Sorafenib single drug group, and the fourth group is a circPIAS1 inhibitor+Sorafenib group. Wherein the CircPIAS1 inhibitor is CircPIAS 1-inhibitor 001:TTGATGGCATCAGACACA (SEQ ID No. 2).

(2) Monitoring index

Monitoring the changes of the weight, biochemical indexes and the like of the mice, observing the size changes of the transplanted tumor samples of the mice, and weighing at the end of the experiment; and determining the value of the IC50 when the two are combined.

(3) Experimental procedure

Cells were digested and counted, resuspended using diluted matrigel (serum-free DMEM: matrigel = 4:1), and 1×10 cells per tube ⁷ Split charging 200 μl; sterilizing skin with 75% alcohol, penetrating needle head under rib to armpit via subcutaneous injection, slowly pushing 200 μl of cells, and gently pressing wound with sterilized cotton swab for 15s after needle extraction; after one week, primarily observing the tumor formation condition, then measuring tumor growth data every 2-3 days, recording main indexes (body weight, tumor volume and the like of the mice), and drawing a growth curve; at the end of the experiment (waiting for tumor body to grow to about 100mm ³ ) Mice were sacrificed by cervical dislocation, tumor mass carefully removed after photographing, weighed, sized and stored in 4% paraformaldehyde for subsequent pathology detection.

2. Results

Fig. 12 shows that the circPIAS1 inhibitor, the Sorafenib and the combination of the circPIAS1 inhibitor and the Sorafenib affect the weight and the volume of the tumor in the growth process of the tumor, and the fact that the circPIAS1 inhibitor and the circPIAS1 inhibitor combined with Sorafenib can obviously reduce the volume of the tumor and reduce the growth rate of the tumor can be seen from the figure, and the result shows that the circPIAS1 inhibitor and the circPIAS1 inhibitor combined with Sorafenib have better anti-liver tumor effect.

FIG. 13 is a graph showing the effect of different concentrations of the circPIAS1 inhibitor and Sorafenib on survival of hepatoma cells (HepG 2) and normal human hepatocytes (Miha), and the pharmacological safe IC50 values of the circPIAS1 inhibitor and Sorafenib were experimentally detected. The IC50 value of the CircPIAS1 inhibitor for HepG2 was 15.6. Mu.M, and for Miha cells was 38.5. Mu.M; sorafenib has an IC50 value of 12.6. Mu.M for HepG2 and 38.4. Mu.M for Miha cells. The result suggests that the targeting circPIAS1 can become a new path for treating liver cancer, thereby providing a theoretical basis for developing a new strategy for liver cancer.

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Sequence listing

<110> university of Zhongshan affiliated third hospital (university of Zhongshan hepatopathy Hospital)

Application of <120> CircPIAS1 as target in preparation of liver cancer diagnostic reagent or therapeutic drug

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 700

<212> DNA/RNA

<213> Unknown (Unknown)

<400> 1

catcagacaa cagtcagcgc tttcgagaaa cctgttttgc atttgccttg acaccacaac 60

aagtgcagca aatcagtagt tccatggata tttctgggac caaatgtgac ttcacagtac 120

aggtccagtt aaggttttgt ttatcagaaa ccagttgtcc acaagaagat cacttcccac 180

ccaatctttg tgtgaaagtg aatacaaaac cttgcagcct tccaggttac cttccaccta 240

caaaaaatgg cgtggaacca aagcgaccca gccgaccaat taatatcacc tcacttgtcc 300

gactgtccac aacagtacca aacacgattg ttgtttcttg gactgcagaa attggaagaa 360

actattccat ggcagtatat cttgtaaaac agttgtcctc aacagttctt cttcagaggt 420

tacgagcaaa gggaataagg aatccggatc attctagagc tttaattaaa gagaagttga 480

ctgcggatcc agacagtgaa atagctacaa ccagcctaag ggtttctcta ctatgtccac 540

ttggtaaaat gcggctgaca attccgtgtc gggcccttac atgttctcat ctacaatgtt 600

ttgacgcaac tctttacatt cagatgaatg agaaaaaacc aacctgggtt tgtcctgtct 660

gtgataagaa ggctccatat gaacacctta ttattgatgg 700

<210> 2

<211> 19

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ttgatggcat cagacaaca 19

<210> 3

<211> 19

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

gatggcatca gacaacagt 19

<210> 4

<211> 19

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ccttattatt gatggcatc 19

<210> 5

<211> 20

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

tgtcgggccc ttacatgttc 20

<210> 6

<211> 20

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

tctcgaaagc gctgactgtt 20

Claims

Use of a circPIAS1 inhibitor for the preparation of a medicament for the treatment of liver cancer, the circPIAS1 inhibitor being a specific nucleotide sequence targeting and inactivating the circPIAS1 junction region, the specific nucleotide sequence being SEQ ID No.2.
2. The use according to claim 1, wherein the medicament for the treatment of liver cancer is a medicament for inhibiting growth and migration of liver cancer cells.
3. The use according to claim 1, wherein the CircPIAS1 inhibitor is a drug that modulates the expression level of CircPIAS 1.
4. Use of a CircPIAS1 inhibitor in combination with sorafenib according to claim 1 for the preparation of a medicament for the treatment of liver cancer.
5. The use according to claim 4, wherein the medicament for the treatment of liver cancer is a medicament for inhibiting growth and migration of liver cancer cells.