CN100374573C - Carrier PCD-VEGF able to stable express VEGF shRNA - Google Patents

Abstract

The present invention relates to a carrier capable of stably expressing VEGF shRNA in mammal cells and an inhibition effect and therefore in tumor cell invasion and metastasis. A research result indicates that after a pCD-VEGF carrier designed by a VEGF gene is transfected with cells, the invasion capability of the cells to a base membrane can be weakened, the locomotory capacity of the cells is reduced, the growth of tumor cells in a body of a nude mouse is obviously inhibited, and the carrier indicates that pCD-VEGF can be developed into a novel effective tumor resistance drug.

Description

But the carrier pCD-VEGF of a kind of stable express VEGF shRNA

Technical field:

The present invention relates to a kind of can be in mammalian cell the carrier of stable express VEGF shRNA; The invention still further relates to the application of said carrier in oncotherapy.

Background technology:

Blood vessel plays an important role in the developing of tumour.When tumour is grown to 1～2mm ³The time, need the generation of neovascularity.New blood vessel couples together the tumour and the recycle system on every side, for growth of tumor provides essential exchange of substance.In addition, former tumour cell also enters blood circulation by blood vessel, causes the transfer of tumour.Therefore, angiogenesis is the only way which must be passed of tumor growth, development, and with the generation of tumour, shift confidential relation is arranged, the reason of clinical symptom only just appears in many tumours that Here it is after new vasculogenesis.The antineoplaston that target vascular therapy generates has the advantage that the conventional chemotherapy medicine can't replace: for example tumor tissues inside have usually higher between matter press, chemotherapeutics is difficult to arrive inside tumor; Even some drugs has arrived inside tumor, also, be difficult to bring into play curative effect because inner anaerobic environment is difficult for redox reaction takes place; Chemotherapeutics almost comprises that to the cell of all quick division growths in the body cancer cells produces inhibition or killing action, be that it lacks the specificity to cancer cell multiplication, in anticancer propagation, also can produce obvious toxic and side effects for quick splitted cell in medullary cell, gastrointestinal mucosa epithelial cell and the hetero-organization organ thereof; Because the diversity of tumour cell and the high mutagenicity of gene thereof make chemotherapeutics not good to the tumor efficiency that tumour has especially shifted.Therefore, suppress the new focus that tumor-blood-vessel growth has become current oncotherapy research.

The generation of blood vessel is subjected to the control of multiple regulatory factor, and wherein (vascularendothelial growth factor VEGF) is a kind of main positive regulatory factor to vascular endothelial growth factor.It is 1989 by glycoprotein that at first purifying comes out from Niu Chuiti folliculus stellate cell vitro culture liquid such as Ferrara, being the mitogen that starts an angiopoietic high special in embryo's generation and wound healing process, also is a kind of effective vascularization and vascular permeability factor.Tischer in 1991 etc. have at first illustrated the gene structure of people VEGF, and this gene is a term single gene, is about 14kb, is made of 8 exons and 7 introns.After being transcribed into mRNA, can shearing and be spliced into 5 kinds of isomer VEGF ₁₂₁, VEGF ₁₄₅, VEGF ₁₆₅, VEGF ₁₈₉And VEGF ₂₀₆, the below numeral is represented the amino acid number of forming this isomer respectively.VEGF by with the receptors bind of cell surface, regulate the generation of blood vessel by the mode of paracrine or autocrine.The invasion and attack of VEGF and tumour, shift closely relatedly, the tumor prognosis that vegf expression is high is bad, and common malignancy all has the overexpression of VEGF usually.

So far, the medicine that obtains for target spot design with VEGF mainly contains antibody, antisense nucleic acid and micromolecular inhibitor.The monoclonal antibody Avastin of a kind of VEGF of inhibition of U.S. FDA approved is used for clinical, but price is expensive unusually.And antisense nucleic acid itself has certain limitation, because its specificity does not reach problems such as dosage is higher by force, causes its further applied research to be made slow progress.

The RNA interference phenomenon is found in C.elegan, and it is meant that double-stranded RNA (dsRNA) induces homologous mRNA degraded specifically, thereby suppresses the expression of target protein.Through the cutting of RNA enzyme III Dicer, (small interferingRNA, siRNA), it is characterized by 3 ' end has the outstanding double-stranded RNA of two Nucleotide to the double-stranded RNA of external source to become the short interfering rna of 21～23nt in cell.SiRNA combines with protein ingredients such as nucleases, form reticent mixture (the RNA-induced silencing complex of RNA inductive, RISC), RISC is under the effect of ATP, the antisense strand of guiding siRNA combines with the complimentary positions on the said target mrna, the cutting said target mrna, thus reach the purpose that suppresses expression of target gene.Though the discovery of RNA interference phenomenon is less than 10 years, because the quick validity and the high degree of specificity of its effect have become one of effective way of specific inhibition of gene expression.

The method that obtains siRNA at present mainly contains five kinds, i.e. chemosynthesis siRNA method, shRNA expression vector method, in-vitro transcription siRNA method (adopting the T7 promotor), RNaseIII (Dicer) cutting long dsrna method and PCR expression cassette method.Wherein external synthetic siRNA method is simple, convenient and rapid, but synthetic cost is higher, and its application is restricted.And shRNA expression vector method relative cost is lower, has recyclability, and all can reach good RNA interference effect in vivo and in vitro, has become a kind of RNA perturbation technique that more and more comes into one's own in recent years.

The objective of the invention is, a kind of plasmid vector that can long-acting VEGF expression shRNA is provided,, obtain the effect more of treatment tumour by the expression that suppresses VEGF with troublesome operation and the non-specific toxicity of avoiding repeatedly transient transfection to cause.

Summary of the invention:

But the carrier pCD-VEGF of the said stable express VEGF shRNA of the present invention, but formed by the dna profiling sequence of pcDNA3.0 basic sequence, people H1 promotor and VEGF expression shRNA.

The present invention made up one can be in mammalian cell the plasmid vector pCD-VEGF of long-time VEGF expression shRNA.This plasmid is to be based upon on the pcDNA3.0 basic sequence, cut by restriction endonuclease, removed original CMV promotor, and be connected into and known others H1 promotor by rna plymerase iii (Pol III), be connected into one section dna profiling that contains the VEGF reverse complementary sequence therein, this template enters cell through after transcribing in transfection, form shRNA (short hairpin RNA, be hairpin structure RNA), by the base complementrity effect, combine with VEGF mRNA target sequence, thereby disturb the VEGF expression of gene.ELISA and Western Blotting detect and show, the HT1080 cell transfecting has been connected at the interference plasmid pCD-VEGF of VEGF and the monoclonal cell strain HT1080-V3 that obtains after stable screening, the expression level of its VEGF has been starkly lower than control cells and the transfection negative control cell HT1080-M of MOCK (promptly expressing not shRNA) plasmid at any specific gene, its vegf expression amount is 25.4% of a control group, 30.5% of HT1080-M group; Matrigel invasion and attack experiment shows that pCD-VEGF has suppressed the invasive ability of HT1080 cell, and the cell count of passing basilar membrane is respectively 26.8% and the HT1080-M group 28.9% of control group; Scratch experiment is the result show, pCD-VEGF has weakened the motor capacity of cell; In vivo test is the result show, pCD-VEGF can significantly suppress HT1080 cell growth in vivo, and after inoculation the 24th day, tangibly knurl piece did not appear in HT1080-V3 group as yet, and the long-pending average of HT1080-M group knurl block this moment has reached 1000mm ³, during to the 54th day, though HT1080-V3 group knurl piece can touch, the volume average only is 43.4mm ³, illustrate that the pCD-VEGF effect that the present invention makes up obviously is better than control group.

The invention effect:

The present invention is according to RNA interference base present principles, and a kind of plasmid vector that can long-acting VEGF expression shRNA is provided, and with troublesome operation and the non-specific toxicity of avoiding repeatedly transient transfection to cause, can obtain to treat the better effect of tumour by the expression that suppresses VEGF.

Description of drawings:

Fig. 1: the structural representation of plasmid pCD-VEGF

Fig. 2: the structure schema of plasmid pCD-VEGF

Fig. 3: each HT1080 stablizes the comparison (ELISA result) of VEGF secretory volume in the strain cells and supernatant

Wherein: HT1080 is the cellular control unit of any plasmid of untransfected;

The HT1080-M negative control cell of pCD-MOCK plasmid that has been the transfection that filters out;

HT1080-V1, HT1080-V2, HT1080-V3 and HT1080-V4 have been respectively the transfection that the filters out cell of pCD-VEGF plasmid.

Fig. 4: each HT1080 stablizes the comparison (Western Blotting result) of strain cell VEGE expression amount

Wherein: HT1080 is the cellular control unit of any plasmid of untransfected;

The HT1080-M negative control cell of pCD-MOCK plasmid that has been the transfection that filters out;

HT1080-V1, HT1080-V2, HT1080-V3 and HT1080-V4 have been respectively the transfection that the filters out cell of pCD-VEGF plasmid.

Fig. 5: plasmid pCD-VEGF has weakened the invasive ability of cell to basilar membrane

Wherein: HT1080 is the cellular control unit of any plasmid of untransfected

The HT1080-M negative control cell of pCD-MOCK plasmid that has been the transfection that filters out;

HT1080-V3 has been transfection pCD-VEGF plasmid and after screening, continue the cell of low VEGF expression.

Fig. 6: plasmid pCD-VEGF has weakened the motor capacity of cell

Wherein: HT1080 is the cellular control unit of any plasmid of untransfected

The HT1080-M negative control cell of pCD-MOCK plasmid that has been the transfection that filters out;

HT1080-V3 has been transfection pCD-VEGF plasmid and after screening, continue the cell of low VEGF expression.

Fig. 7: become the knurl detection in the nude mouse of VEGF down-regulated express cell strain HT1080-V3

Wherein: HT1080 is the cellular control unit of any plasmid of untransfected

The HT1080-M negative control cell of pCD-MOCK plasmid that has been the transfection that filters out;

HT1080-V3 has been transfection pCD-VEGF plasmid and after screening, continue the cell of low VEGF expression.

Embodiment:

When emphasizing constructed hair fastener type short interfering rna structure, represent in the embodiment of the invention, when emphasizing the effect of short interfering rna, represent with siRNA with shRNA.

Following examples are only further understood the present invention for help those skilled in the art, but do not limit the present invention. Embodiment 1: the design of VEGF shRNA target sequence and dna profiling thereof

The selection of shRNA target sequence, mainly be follow the Tushl principle (Methods 2002,26:199-213), as avoid within 50 Nucleotide in initiator codon downstream as far as possible and 100 Nucleotide in terminator codon upstream within sequence; Because it is more to regulate protein binding site near 5 ' or 3 ' non-translational region and the initiator codon, so generally also do not select these positions; Sequence should be avoided too high GC content, and should avoid the G of appearance more than 3 or 3 continuously in sequence, or the like.

Need to carry out the Blast search after having selected, very low with the homology of guaranteeing target sequence and other gene, guarantee that as far as possible the siRNA of design has the reticent effect of maximum specific gene and the minimum non-specific toxicity and (off-target) effect of missing the target.

After the target sequence design finishes, need (Science 2002 according to existing rule, 296:550-553) the dna profiling of synthetic shRNA, this template comprises justice, two complementary short dnas of antisense strand, the fundamental unit of its positive-sense strand is: the ring sequence of BamHI site, target sequence positive-sense strand, 9bp, target sequence antisense strand, continuous 6 T, HindIII site, dna profiling length overall 64bp.

MRNA target sequence and the few dna sequence dna of designed VEGF shRNA are as follows:

The mRNA target sequence:

5’-UGUGAAUGCAGACCAAAGA-3’(SEQ?ID?No?1)

Few dna sequence dna:

Positive-sense strand:

5’-GATCCC TGTGAATGCAGACCAAAGATTCAAGAGA TCTTTGGTCTGC ATTCACATTTTTTGGAAA-3′(SEQ?ID?No?2)

Antisense strand:

5’-AGCTTTTCCAAAAAA TGTGAATGCAGACCAAAGATCTCTTGAA TCT TTGGTCTGCATTCACAGG-3’(SEQ?ID?No?3)

The present invention adopted a target sequence not with the MOCK shRNA of any dna homolog, the mRNA target sequence of the MOCK-shRNA of use and few dna primer sequence be as follows:

The mRNA target sequence:

5’-GGAUAGUACGAGAUUACAC-3’

Few dna sequence dna:

Positive-sense strand:

5′-GATCCC GGATAGTACGAGATTACACTTCAAGAGA GTGTAATCTCGTA CTATCCTTTTTTGGAAA-3′

Antisense strand:

5′-AGCTTTTCCAAAAAA GGATAGTACGAGATTACACTCTCTTGAA GTG TAATCTCGTACTATCCGG-3′

To form complementation herein after line in the dna sequence dna is partly represented to transcribe, form hairpin structure.Used dna sequence dna is synthetic by match Parkson company.After the synthetic dna sequence dna is diluted to 1 μ g/ μ l, gets 2 μ l respectively and mix with the annealing buffer of 46 μ l, annealing, annealing conditions is: 90 ℃, 3min; 37 ℃, 60min;-20 ℃ of preservations are standby.5 ' end of the double-stranded DNA that sequence annealing back forms has the sticking end of BamHI restriction enzyme site, and 3 ' end has the sticking end of HindIII restriction enzyme site, can be directly used in connection.

Embodiment 2: the structure of pCD-VEGF plasmid

In order to make plasmid long-time continuous expression in mammalian cell, need to have eucaryon reproducing signals and promotor in the plasmid vector.For this reason, the present invention has selected the main sequence of the present carrier for expression of eukaryon pcDNA3.0 that uses always as basic sequence (Fig. 1).For preventing that its original CMV promotor from exerting an influence to the expression of shRNA sequence, adopt the restriction enzyme cutting that the CMV promotor is removed, be connected into the H1 promotor that is used for the shRNA expression again, concrete steps are as follows:

1), adopt BamHI and BglII restriction endonuclease that pcDNA3.0 is carried out double digestion, cut the CMV promotor.Owing to have only a BamHI and a BglII restriction enzyme site on the pcDNA3.0, therefore, enzyme is cut rear electrophoresis and two bands only occurred, length is respectively about 0.9kb and 4.5kb, reclaim big fragment about 4.5kb behind the low melting point gel electrophoresis, after connecting, form a length and be the circular plasmids about 4.5kb.

2), in the circular plasmids after connection, there are an EcoRI and an XhoI restriction enzyme digestion sites, this plasmid is carried out enzyme with EcoRI and XhoI to be cut, and reclaim big fragment (4518bp), simultaneously pCSH1-1 plasmid (number of patent application 200510066531.1) being carried out enzyme with EcoRI and XhoI cuts, reclaim small segment (167bp), the large and small fragment that recovery is obtained connects, when being connected into people H1 promotor, introduced BamHI and HindIII restriction enzyme site, the plasmid length that obtains is 4685bp.

3) plasmid that, previous step is obtained BamHI and HindIII double digestion, remove wherein original BamHI-HindIII fragment (64bp), reclaim big fragment (4621bp), the short double-stranded DNA that forms with VEGF Nucleotide (64bp) the annealing back of synthetic is connected, and obtains plasmid vector pCD-VEGF (4685bp) (Fig. 2).

Employing SP6 reverse sequence checks order, and records VEGF shRNA ceneme antisense strand sequence and is:

5’-AGCTTTTCCAAAAAATGTGAATGCAGACCAAAGATCTCTTGAATCTTTGGTCTGCATTCACAGG-3’，

The result is consistent with implementation sequence (SEQ ID No 3).Adopt similar approach to make up the plasmid that contrasts MOCK shRNA expressed sequence, called after pCD-MOCK.

Embodiment 3: the screening of the mammalian cell strain of the transfection of interference sequence expression plasmid and continuous expression shRNA sequence

The present invention adopts LipofectAMINE ^TM2000 liposomes (Life Technologies, article No. 11668-027) transfection human fibrosarcoma cell strain HT1080, plasmid quality of transfection (μ g) and liposome volume (μ l) ratio are 1: 2.5.Used plasmid concentration is 2 μ g/ml.All operations is all undertaken by the liposome specification sheets.Transfection was changed liquid to cell after finishing 24 hours, changed the nutrient solution that contains 400 μ g/ml G418 into.Changed liquid every 2～3 days to cell later on.After treating the whole death of cellular control unit (being any plasmid group of untransfected), with the cell of transfection pCD-VEGF plasmid group and transfection pCD-MOCK plasmid group cell dissociation get off, behind the counting, dilute with selectivity nutrient solution (the MEM-EBSS nutrient solution that contains 400 μ g/ml G418 and 10%FBS), join in 96 orifice plates, make cell≤1 in each hole.After treating that cell covers with, the clone who is grown by individual cells in 96 orifice plates is transferred to 24 orifice plates, goes to 6 orifice plates and 25cm more successively ²Cultivate in the culturing bottle, go down to posterity after covering with and identify.

Embodiment 4: continue the screening of the HT1080 cell of low VEGF expression

The cell clone that to choose carries out elisa assay and Western Blot detects, to filter out the minimum clone of vegf expression.

1), elisa assay

Each cell clone that to choose is laid in 24 orifice plates with the cell count in every hole 80,000, cultivates after 48 hours, changes the MEM-EBSS nutrient solution that contains 2%FBS into, continue to cultivate 24 hours, collect culture supernatant, 14000g, 4 ℃ removed cell debris in centrifugal 15 minutes, and-80 ℃ frozen to be measured.Simultaneously the cell in 24 holes is digested, counts.Adopt VEGF ELISA detection kit (R﹠amp; D Systems, Minneapolis, MN) the VEGF content in the pair cell culture supernatant detects, and the result shows that the VEGF secretory volume of HT1080-V3 cell strain is minimum, is 25.4% of control group HT1080 cell, 30.5% (Fig. 3) of HT1080-M group.

2), Western Blotting detects

After each cell clone to be chosen covers with Tissue Culture Flask, with freshly prepared cell pyrolysis liquid (50mMTris-HCl, pH7.5; 1%NP-40; 150mM NaCl; 1mg/ml aprotinin; 1mg/ml leupeptin; 1mM Na ₃VO ₄1mM NaF) lysing cell, the collecting cell total protein, and quantitatively.SDS-PAGE glue with 10% carries out each albumen of sex change electrophoretic separation, and half-dried commentaries on classics film instrument (Amersham Biosciences, HoeferTE 70) forwards albumen on PVDF (poly(vinylidene fluoride)) film to.The film that has changeed is dipped in and contains in 5% (w/v) skim-milk-TBS (10mM Tris HCl, pH7.5,150mM NaCl) solution room temperature jolting sealing and spend the night.Use TBS room temperature rinse 5 times subsequently, each 5 minutes, with the film hybridization bag of packing into, with the TBS solution dilution first antibody that contains 1%BSA (bovine serum albumin), room temperature jolting, hatch 3 hours with film after, use TBS room temperature rinse 5 times again, each 5 minutes.Film is packed in the new hybridization bag, with two anti-(horseradish peroxidase-labeled) incubated at room 3 hours, TBS room temperature rinse 5 times, each 5 minutes.Drip chemiluminescence intensifier (Santa Cruz Biotechnology sc-2048) on the film, operate, catch image by chemoluminescence imaging system ChemiImager5500 (Alpha Innotech.) according to the reagent specification sheets.The Dilution ratio of antibody is as follows, rabbit polyclonal VEGF antibody (Santa Cruz product, sc-152) 1/200 dilution, sheep polyclone Actin antibody (Santa Cruz product, sc-1616) 1/400 dilution, the anti-goat-anti body of the rabbit of goat anti-rabbit antibody of horseradish peroxidase-labeled (ZB-2301) and horseradish peroxidase-labeled (ZB-2306) 1/2000 dilution.The result shows that the expression amount of VEGF minimum (Fig. 4) is consistent with elisa assay in the HT1080-V3 cell.

Above-mentioned two experiments are all carried out after 3 months at the plasmid transfection cell, and cell cryopreservation and recovery process have been experienced midway, therefore can confirm that pCD-VEGF can give expression to VEGF shRNA for a long time constantly in the HT1080 cell, thereby suppress the secretion and the expression of vegf protein.

Embodiment 5: Matrigel invasion and attack experiment detects the invasive ability of cell to basilar membrane

Adopt Transwell cell culture systems to detect.Coat the Matrigel of the 1mg/ml matrix of basilar membrane environment (a kind of can be in in-vitro simulated body) 100 μ l at shiny surface above the polycarbonate membrane of Transwell cell 8.0 μ m, at 37 ℃, 5%CO ₂Dried overnight under the condition.Following chamber adds the nutrient solution 600 μ l that contain 5 μ g/ml fibronectin (fibronectin).What logarithmic phase was grown in collection respectively organizes cell, digests, blows and beats into individual cells respectively, and counting is with 10 ⁵Individual cell suspension adds Transwell and goes up the chamber in the nutrient solution 100 μ l that contain 1%FBS, jiggles, and it is evenly distributed.At 37 ℃, 5%CO ₂Condition under hatched 20 hours, H﹠amp is carried out with film in chamber in the taking-up; E dyeing, and mounting are in microscopically meter invasion and attack cell count.Every group of cell got 10 visuals field at random, meter mean number.The result shows that pCD-VEGF can significantly suppress the invasive ability (Fig. 5) of cell, and the cell count of passing the HT1080-V3 of basilar membrane only is 26.8% of control group HT1080,28.9% of HT1080-M group.

Embodiment 6: scratch experiment detects the motor capacity of cell

With logarithmic phase respectively organize cell dissociation, counting, with 1 * 10 ⁵Cell/ml/ hole is laid in 24 orifice plates, and every group of cell established 3 parallel holes.Cell is at 37 ℃, 5%CO ₂Condition under cultivated 72 hours, treat that cell grows to 100% and merges, with 20 μ l micropipette rifle heads vertical cut in 24 orifice plates, wash twice with nutrient solution behind the cut, the flush away cell debris, the observation of cell scar closes up situation after 12 hours.The result shows that pCD-VEGF can weaken the motor capacity of cell.After 12 hours, HT1080 and HT1080-M group cell attenuate and narrow down, covered by cell gradually, and HT1080-V3 group cell scar still high-visible (Fig. 6).

Embodiment 7: become the knurl comparative experiments in the body

Respectively organize cell for nude inoculation, become the influence of knurl ability with the xenotransplantation of estimating the pCD-VEGF pair cell.The HT1080-V3 that takes the logarithm vegetative period, HT1080-M and HT1080 cell dissociation, blow out individual cells, counting, cell suspension inoculation is subcutaneous in 5 all female BALB/c in age (nu/nu) nude mouses right side armpits, every nude inoculation amount is 200 μ l, contains 2 * 10 in the serum-free MEM-EBSS nutrient solution ⁵Cell.8 nude mices of every winding kind.Record nude mice weight during tumor inoculation, 2 times weekly.Tangibly knurl piece is appearring in control group about a week after the inoculation.By major diameter (a) and the minor axis (b) of measuring tangible tumour, with formula: volume=1/2ab ²Calculate gross tumor volume.Measure weekly 3 times.The result shows that HT1080-V3 group cell is starkly lower than HT1080 and HT1080-MOCK group (Fig. 7) in the intravital one-tenth knurl of nude mice.

Claims (4)

1. but the carrier pCD-VEGF of a stable express VEGF shRNA, but it is characterized in that described carrier system is made up of the dna profiling sequence of pcDNA3.0 basic sequence, people H1 promotor and VEGF expression shRNA.

2. the carrier pCD-VEGF of VEGF shRNA according to claim 1 is characterized in that described dna profiling sequence according to the design of VEGF mRNA target sequence,

Described VEGF mRNA target sequence is:

5’-UGUGAAUGCAGACCAAAGA-3’(SEQ?ID?No?1)。

3. the carrier pCD-VEGF of VEGF shRNA as claimed in claim 1 or 2 is characterized in that described dna profiling sequence system is made up of few DNA positive-sense strand and antisense strand sequence,

Described positive-sense strand is:

5’-GATCCCTGTGAATGCAGACCAAAGATTCAAGAGATCTTTGGTCTGC

ATTCACATTTTTTGGAAA-3′(SEQ?ID?No?2)；

Described antisense strand is:

5’-AGCTTTTCCAAAAAATGTGAATGCAGACCAAAGATCTCTTGAATCT

TTGGTCTGCATTCACAGG-3’(SEQ?ID?No?3)。

4. the application of the carrier pCD-VEGF of VEGF shRNA in the preparation antitumor drug according to claim 1.

Images