CN102051362B - Interference RNA (Ribonucleic Acid) of targeted HPIP (hematopoietic PBX-interacting protein) gene, medical composition containing same and application thereof - Google Patents
Interference RNA (Ribonucleic Acid) of targeted HPIP (hematopoietic PBX-interacting protein) gene, medical composition containing same and application thereof Download PDFInfo
- Publication number
- CN102051362B CN102051362B CN 201010528175 CN201010528175A CN102051362B CN 102051362 B CN102051362 B CN 102051362B CN 201010528175 CN201010528175 CN 201010528175 CN 201010528175 A CN201010528175 A CN 201010528175A CN 102051362 B CN102051362 B CN 102051362B
- Authority
- CN
- China
- Prior art keywords
- hpip
- cell
- sirna
- expression vector
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides an interference RNA (Ribonucleic Acid) of a targeted HPIP (hematopoietic PBX-interacting protein) gene, a medical composition containing the same and application thereof.
Description
Technical field
The present invention relates to new interferential RNA, the pharmaceutical composition that contains this interferential RNA and the application thereof of target hematopoiesis PBX interaction protein (hematopoieticPBX-interacting protein, HPIP).
Background technology
HPIP is the gene that separation obtains from the fetus liver library of reported first in 2000, up to the present, only has 4 pieces about the bibliographical information of HPIP.731 amino acid of HPIP full-length cDNA (SEQID NO:1) coding, with known albumen without obvious homology.The major function of HPIP is energy and transcription factor interaction, and regulates the transcriptional activity of transcription factor.HPIP is by suppressing the transcriptional activity of PBX with the interaction of PBX transcription factor, and it is by promoting the transcriptional activity of ER with the interaction of transcription factor estrogen receptor (ER).In addition, the overexpression of HPIP can promote the growth of the breast cancer cell in external and the nude mouse, utilizing target sequence is the growth that the HPIP siRNA of 5 ' TTCTAGGGAGTGGAGTGGA 3 ' (SEQ ID NO:2) can suppress external breast cancer cell, the growth of these presentation of results HPIP energy regulate tumor cell, but the expression of HPIP in human tumor is not clear.
RNA disturbs (RNA interference, RNAi) to refer to homologous mRNA generation specificity degraded in endogenous or exogenous double-stranded RNA (dsRNA) inducing cell, thus the phenomenon of inhibition of gene expression.In the RNAi process, long-chain dsRNA is cut into siRNA (siRNA) by the Dicer enzyme, reticent mixture (RISC) combination that chain of siRNA and RNA induce is combined with said target mrna in the mode of base complementrity pairing subsequently, causes the degraded of mRNA.Because siRNA can suppress the expression of specific gene, this technology has been widely used in various research fields, comprises gene therapy research.At present the method that imports in the body of siRNA mainly contains two kinds: the one, and the siRNA that direct injection is exposed or through the siRNA of chemically modified; The 2nd, use virus vector to express siRNA, such as slow virus, adenovirus and adeno-associated virus etc.
Our research is found, compares with the normal human mammary tissue, and HPIP raises at human breast carcinoma and Expression In Hepatocellular Carcinoma level.Therefore, we have made up the novel siRNA (being called HPIP siRNA) of target HPIP gene, and the HPIP cDNA sequence of HPIP siRNA target is 5 ' TTCTAGGGAGTGGAGTGGA 3 ' (SEQ ID NO:2).Reduce the expression of HPIP gene in the tumours such as mammary cancer and liver cancer by HPIPsiRNA, can reach the purpose of these tumours for the treatment of.Simultaneously, our research finds that by the expression of HPIP gene in the HPIP siRNA reduction cell, but Cell protection is avoided radiation injury.
Summary of the invention
Definition
Term used herein " HPIP gene target region " refer to polynucleotide of the present invention or siRNA for the HPIP gene mRNA on the zone, wherein coding or the siRNA that expresses or described siRNA itself can instruct the mRNA by RNA interference effect cracking HPIP target gene.HPIP gene target region both can be positioned at 5 ' end of HPIP gene mRNA, can be positioned at again 3 ' end, can also be positioned at the middle part.
In the present invention, for polynucleotide or siNA, siRNA, when shRNA mentions " positive-sense strand ", refer to and comprise nucleic acid chains identical with HPIP gene target region or the height similar nucleotide sequences; When mentioning " antisense strand ", refer to the nucleotide sequence of or complete complementary basic with aforementioned positive-sense strand.
Therefore, one aspect of the present invention provides a kind of interferential RNA molecule, wherein comprises the first nucleotide sequence with the complementation of HPIP gene target region, can reduce or eliminate by the RNA interference effect expression of HPIP gene mRNA.Described interferential RNA molecule can be double-stranded RNA, such as siRNA (short interfering RNA), miRNA (microinterfering RNA) etc., perhaps single stranded RNA, shRNA (short hairpinRNA) for example, they can cause the degraded (for example situation of siRNA or miRNA) of HPIP target gene mRNA or can form the molecule (for example situation of shRNA) with this function by the RNA interference effect.
In the present invention, described interferential RNA molecule for the HPIP gene mRNA in target region can be 5 ' TTCTAGGGAGTGGAGTGGA3 ' (SEQ ID NO:2) or its part.This target region can have any suitable length, for example 5-30nt, preferably 18-25nt, more preferably 20-23nt.Most preferably, described target region is 5 ' TTCTAGGGAGTGGAGTGGA 3 ' (SEQ ID NO:2).
In some embodiments, interferential RNA molecule of the present invention is siRNA (shortinterfering RNA).Such siRNA molecule comprise with the HPIP gene mRNA in the rna chain (being called " antisense strand ") of target region reverse complemental, and complementary another rna chain (being called " positive-sense strand ") with it.In the present invention, described siRNA can have any suitable length.Preferably, its length is 15-30bp, more preferably 18-25bp, especially preferably 20-23bp.For example, the length of described siRNA can be 15b p, 16bp, 17bp, 18bp, 19bp, 20bp, 21bp, 22bp, 23bp, 24bp, 25bp, 26bp, 27bp, 28bp, 29bp or 30bp.
Preferably, interferential RNA molecule of the present invention is siRNA, among its target HPIP gene cDNA or " mRNA " with lower area: 5 ' TTCTAGGGAGTGGAGTGGA 3 ' (SEQ ID NO:2).Its positive-sense strand sequence is 5 '-TTCTAGGGAGTGGAGTGGAdTdT-3 ' (SEQ ID NO:3), and the antisense strand sequence is 5 '-TCCACTCCACTCCCTAGAAdTdT-3 ' (SEQ ID NO:4).
In other embodiments, interferential RNA molecule of the present invention is shRNA, its in same nucleic acid chains, comprise with first nucleotide sequence (being referred to herein as " antisense district ") of HPIP gene mRNA target region complementation, with second nucleotide sequence (being referred to herein as " justice district ") of described the first nucleotide sequence reverse complemental and therebetween catenation sequence.In shRNA, described just district can be positioned at 5 ' end, and the antisense district is positioned at 3 ' end; Perhaps, described antisense district can be positioned at 5 ' end, and the justice district is positioned at 3 ' end.Described shRNA can be strand, can form the RNA with hairpin structure, and wherein justice district and antisense district consist of the duplex part, and catenation sequence forms ring.The length that forms the catenation sequence of ring can change.For example, in some embodiments, described catenation sequence has the length of 5 Nucleotide (nucleotide is called for short nt), 6nt, 7nt, 8nt, 9nt, 10nt, 11nt, 12nt or 13nt.The hairpin structure that this shRNA forms can also comprise 5 ' or 3 ' overhang.In some embodiments, it is long that described overhang has 0,1,2,3,4,5,6,7,8,9 or 10 Nucleotide.
In some embodiments, interferential RNA molecule of the present invention is zone among target HPIP gene cDNA or " mRNA ": the shRNA of 5 ' TTCTAGGGAGTGGAGTGGA 3 ' (SEQID NO:2).Preferably, it has following nucleotide sequence:
Positive-sense strand is:
5′-GATCCGTTCTAGGGAGTGGAGTGGATTCAAGAGATCCACTCCACTCCCTAGAATTTTTTGGAAA-3′(SEQ?ID?NO:5),
Antisense strand is:
3′-GCAAGATCCCTCACCTCACCTAAGTTCTCTAGGTGAGGTGAGGGATCTTAAAAAACCTTTTCGA-5′(SEQ?ID?NO:6)。
In the present invention, can carry out various ways to interferential RNA molecule of the present invention such as siRNA or shRNA modifies.In one embodiment, comprising phosphorothioate bond in the described interferential RNA molecule, namely comprise the non-bridging oxygen atom that sulphur atom replaces phosphodiester bond, also is that the P-S key substitutes the P-O key.In another embodiment, 2 of the one or more Nucleotide that comprise among described interferential RNA molecule such as siRNA or the shRNA '-hydroxyl is alternative by fluorine or methyl etc.In another embodiment, one of described interferential RNA molecule such as siRNA or shRNA or two chain ends have 1,2,3 or 4 Nucleotide to be modified.In another embodiment, described interferential RNA molecule such as siRNA or shRNA comprise one or more modifications in positive-sense strand or justice district.In another embodiment, described interferential RNA molecule such as siRNA or shRNA 3 ' distal process in positive-sense strand/justice district or antisense strand/antisense district goes out Nucleotide and is substituted by deoxynucleotide.In another embodiment, the positive-sense strand of described interferential RNA molecule such as siRNA or shRNA/justice district end contains lipophilic group, such as cholesterol etc.Specifiable cholesterol group has: C16 alkanol, C18 alkanol or C20 alkanol etc.
Interferential RNA molecule of the present invention such as siRNA or shRNA can also be by chemically modifieds.By chemically modified, can improve the siRNA molecule to the resistance of nuclease degradation and/or improve its cellular uptake, and still keep the ability that reduces HPIP genetic expression.The limiting examples of such chemically modified has key between the thiophosphatephosphorothioate nucleosides (phosphorothioateinternucleotide linkages), 2 '-deoxyribonucleotide (2 '-deoxyribonucleotides), 2 '-O-methyl ribonucleotides (2 '-O-methylribonucleotides), 2 '-deoxidation-2 '-fluorine ribonucleotide (2 '-deoxy-2 '-fluororibonucleotides), 4 '-thioribose Nucleotide (4 '-thio ribonucleotides), 2 '-O-trifluoromethyl Nucleotide (2 '-O-trifluoromethyl nucleotides), 2 '-O-ethyl trifluoromethoxy Nucleotide (2 '-O-ethyl-trifluoromethoxy nucleotides), 2 '-O-difluoro-methoxy oxyethyl group Nucleotide (2 '-O-difluoromethoxy-ethoxy nucleotides, " universal base " Nucleotide, " acyclic " Nucleotide, the 5-C-methyl nucleotide, 2 '-deoxidation-2 '-fluorine aralino (2 '-deoxy-2 '-fluoroarabino, FANA) mix.The application of these chemically modifieds in siNA construct (for example based on RNA siNA construct) can keep still that they are active at intracellular RNAi, can greatly improve its serum stability simultaneously.
In another embodiment, siRNA molecule of the present invention or shRNA molecule comprise one or more Nucleotide in the duplex that forms or non-nucleotide is outstanding.Term " is given prominence to " and is referred to the nucleotide sequence terminal portions that duplex that siRNA molecule of the present invention or shRNA form can not base pairing between two chains." give prominence to " 3 ' end that can be positioned at any one or two chain.In one embodiment, the duplex that described siRNA molecule or shRNA form comprises and is selected from following Nucleotide overhang: 2 '-O-methyl, 2 '-deoxidation, 2 '-deoxidation-2 '-fluorine, 2 '-deoxidation-2 '-fluorine pectinose (FANA), 4 '-sulphur, 2 '-O-trifluoromethyl, 2 '-O-ethyl-trifluoromethoxy, 2 '-O-difluoro-methoxy-oxyethyl group, universal base or 5-C-methyl nucleotide.
For the stability that improves siRNA or shRNA or the HPIP target gene mRNA zone specificity with siRNA interacts, can also be by 3 ' two Nucleotide-dTdT of end extension or the UU in chemosynthesis justice district and antisense district in 3 ' end of two chains of siRNA or shRNA.In some embodiments, can pass through chemical derivative or tagged molecule to synthetic siRNA/shRNA modification, in order to improve its physiology stability and follow the trail of it in intracellular distribution.
SiRNA of the present invention or shRNA can obtain in several ways, comprise such as chemosynthesis, synthetic etc. by vector expression or enzymatic.
In some embodiments, siRNA of the present invention or shRNA obtain by chemosynthesis.About the method for chemosynthesis and modification of nucleic acids, numerous instructions is arranged in the art, these are all in those of ordinary skill in the field's limit of power.
In other embodiments, siRNA of the present invention or shRNA are anabolic by enzyme.The method of relevant enzymatic nucleic acid also has numerous instructions in the art, and these are also all in those of ordinary skill in the field's limit of power.
Interferential RNA of the present invention such as siRNA or shRNA can be incorporated in target cell, tissue, organ or the experimenter by multiple suitable method, such as liposome transduction method, electroporation, microinjection, microparticle bombardment etc.
In other embodiment, interferential RNA molecule of the present invention such as siRNA or shRNA produce in cell, tissue or organism.
Therefore, the present invention also provides nucleic acid construct, wherein comprises the nucleotide sequence of code book invention interferential RNA, and be operatively connected with it, drive this nucleotides sequence and be listed in the Expression element of expressing described interferential RNA after importing in the host cell.In this article, all mentioning when the first nucleotide sequence and the second nucleotide sequence " are operatively connected ", refer to be in relative with the second nucleotide sequence of this first nucleotide sequence and bring into play its separately position of predetermined function, for example promoter sequence can start and the transcribing or expressing in target cell of its encoding sequence that " is operatively connected ".Described Expression element comprises such as promotor, transcription terminator, enhanser etc.Available promotor has multiple, comprise for example rna plymerase ii promotor (pol II), rna plymerase iii promotor (pol III), such as U6 promotor and people H1 promotor, housekeeping gene promotor such as the actin promoter etc. in people source and mouse source.Specific expressed for realizing, can also select some specific expressing promoters, such as temporal promotor, tissue-specific promoter, cell type specificity promotor, etap specificity promoter etc., the example has globin promotor etc.But also can select some inducible promoters, but tsiklomitsin inducible promoter for example.Viral promotors also can be used in the present invention, such as SV40 early promoter, reverse transcription disease virus promoter, cytomegalovirus immediate early promoter etc.The selection of terminator and enhanser is well known to those of ordinary skill in the art, for example terminator can select 5 '-TTTTT-3 ' (SEQ ID NO:7).
In some embodiments, nucleic acid construct of the present invention comprises the nucleotide sequence of code book invention shRNA.Described shRNA can form siRNA.Preferably, the duplex partial-length of described siRNA is no more than 30bp, and for example length is 12-30bp, 15-28bp, 18-25bp or 20-23bp.For example, the length of described siRNA can be 12bp, 13bp, 14bp, 15bp, 16bp, 17bp, 18bp, 19bp, 20bp, 21bp, 22bp, 23bp, 24bp, 25bp, 26bp, 27bp, 28bp, 29bp or 30bp.
In the present invention, can also be respectively be positive-sense strand and antisense strand from two chains of two promoter expression siRNA that separate, then be combined into double-stranded siRNA.Therefore, in other embodiments, nucleic acid construct of the present invention comprises the nucleotide sequence of code book invention siRNA positive-sense strand.In other embodiment, nucleic acid construct of the present invention comprises the nucleotide sequence of code book invention siRNA antisense strand.In other embodiment, nucleic acid construct of the present invention comprises the nucleotide sequence of two chains of code book invention siRNA, their each expression under the promotor control that separates.
The present invention also provides expression vector, wherein comprises the above-mentioned nucleic acid construct of the present invention.
There is multiple suitable carrier to can be used for expressing interferential RNA of the present invention, such as siRNA or shRNA, comprises such as plasmid vector, virus vector such as adenovirus carrier, gland relevant viral vector, lentiviral vectors etc.Not only comprise the promotor of transcribing for startup in such carrier, also comprise enhanser, transcription termination signal or other expression and regulate sequence.Carrier of the present invention can be used as naked plasmid dna, is delivered in the host cell with the mutually compound mixture of transfection agents or target delivery materials or as recombinant viral vector.The selection of expression vector and structure are that those of ordinary skills know, and can carry out with reference to some factors, such as siRNA expression time of the state of the host cell for the treatment of transfection or type, expectation and level etc.
Expression vector of the present invention can be delivered in target cell or the host cell by transfection carrier, and described transfection carrier is such as (Akhtar etal., Trends Cell Bio.1992,2,139) such as liposome, hydrogel, bioadhesive microballoons are arranged.Expression vector of the present invention also can be delivered in target cell or the host cell by calcium phosphate precipitation method, direct microinjection, electroporation, microprojectile bombardment methods etc.Such method also is well known to those of ordinary skill in the art.
The present invention also provides a kind of host cell, wherein transform or transfection nucleic acid construct of the present invention or expression vector.In some embodiments, described host cell is prokaryotic cell prokaryocyte.In other embodiments, described host cell is eukaryotic cell, such as cell mass of primary cell culture, clone, yeast, complete organ or organism etc.
The present invention also provides a kind of pharmaceutical composition, wherein comprises interferential RNA of the present invention (such as siRNA or shRNA), nucleic acid construct, expression vector and/or host cell and the pharmaceutically acceptable carrier of pharmacy effective dose." pharmacy effective dose " refers to and can reduce HPIP mRNA level to expected degree after importing the experimenter or can realize the drug dose of desired effects.Pharmacy effective dose can rule of thumb be determined by the treatment doctor, and may depend on many factors, such as route of administration, preparation nature, disease condition, experimenter's physique, body weight, age, sex etc.
Pharmaceutical composition of the present invention can be mixed with the form of solid, semisolid, liquid or gas, such as being tablet, capsule, pulvis, particle, ointment, solution, suppository, injection, inhalation etc.The preparation method of this class preparation is that those of ordinary skills know.
That pharmaceutical composition of the present invention can be administered to by suitable route of administration is pending/cell, tissue, organ and/or the experimenter for the treatment of, such as pharmaceutical composition being mixed with suitable dosage form by oral, suck, the mode administrations such as parenteral, subcutaneous, intraocular, intramuscular, intraperitoneal, intravenously, intranasal, per rectum.
In order to promote interferential RNA molecule of the present invention, nucleic acid construct or expression vector to be delivered in purpose cell, tissue, organ or the experimenter, described interferential RNA molecule, nucleic acid construct or expression vector can be mixed mutually with vehicle or excipient.Applicable vehicle or excipient comprise salt solution, damping fluid (such as acetate buffer, citrate buffer solution, phosphoric acid buffer etc.), amino acid, xitix, alcohols, protein, liposome, glycerine, sorbyl alcohol etc.The method of the preparation that well known preparation is so for example can be referring to Remington ' sPharmaceutical Sciences.
The present invention also provides a kind of reduce HPIP expression level and/or active method in the subject, it comprises uses one or more interferential RNAs of the present invention, nucleic acid construct, expression vector, host cell or pharmaceutical composition to the experimenter that these needs are arranged, cell or tissue, wherein reduces the HPIP level and can obtain beneficial effect.
The present invention provides again a kind of prevention, treatment or has alleviated HPIP gene-correlation disease or the method for illness, for example tumour, it comprises uses one or more interferential RNAs of the present invention, nucleic acid construct, expression vector, host cell or pharmaceutical composition to the individuality that these needs are arranged
In the present invention, term " experimenter " and " individuality " can Alternates, refer to and reduce therein any animal that the HPIP level can obtain beneficial effect, preferred vertebrates, and Mammals for example, the example has people, horse, ox, mouse, rat etc.
Description of drawings
Fig. 1 shows the sequencing results based on the HPIP siRNA of non-virus carrier.
Fig. 2 shows the sequencing results based on the HPIP siRNA of lentiviral vectors.
Fig. 3 shows that HPIP siRNA can reduce HPIP mRNA and protein level in the cell.After will contrasting siRNA slow virus and HPIP siRNA recombinant slow virus infection MCF-7 cell 24h, collecting cell, extract RNA and protein, use respectively primer and HPIP antibody for HPIP cDNA to carry out RT-PCR (Fig. 3 A) and Western blot (Fig. 3 B), GAPDH is as confidential reference items.
But Fig. 4 shows the Growth of Cells that the grappling of HPIP siRNA inhibition tumor cell relies on.After will contrasting siRNA slow virus and HPIP siRNA recombinant slow virus infection breast cancer cell MCF-7 (Fig. 4 A), liver cancer cell HepG2 (Fig. 4 B) and lung cell A549 (Fig. 4 C), press different time points shown in the figure and measure the Growth of Cells situation.
But Fig. 5 shows the Growth of Cells of the non-dependence of HPIP siRNA inhibition tumor cell grappling.To contrast siRNA slow virus and HPIP siRNA recombinant slow virus and infect breast cancer cell MCF7, and utilize soft agar assay to observe the colony formational situation.“-”:100μm。
Fig. 6 shows that HPIP siRNA can suppress the growth of nude mice inner tumour cell.To contrast siRNA slow virus and HPIP siRNA recombinant slow virus and infect breast cancer cell MCF-7, and seed cells into the nude mice mammary fat pad, and press different time points shown in the figure and measure MCF-7 Growth of Cells situation.
Fig. 7 shows the expression of HPIP in the nude mice knurl piece.Get the tumor tissues in 10 whens week, utilize Western blot to detect HPIP level in the tumour of contrast siRNA slow virus group and HPIP siRNA recombinant slow virus group, GAPDH is used as confidential reference items.
Fig. 8 shows that HPIP siRNA suppresses the activation of ERK1/2 and AKT.To contrast siRNA slow virus and HPIP siRNA recombinant slow virus and infect breast cancer cell MCF7, press shown in the figure with 10nm E2,100 μ M ICI182,780 process cell 24h, collecting cell, use phosphorylation antibody (pERK and pAKT) and corresponding non-phosphorylating antibody thereof for ERK1/2 and AKT to carry out Western blot detection, GAPDH is as confidential reference items.
Fig. 9 shows that HPIP expresses in mammary cancer and liver cancer patient.Utilize immunohistochemistry technology to detect the expression of HPIP in the other phase normal tissue of cancer and the cancerous tissue.(A) the other tissue of a routine representative breast cancer patients; (B) routine representative patient with breast cancer's cancerous tissue; (C) a routine representative liver cancer patient cancer beside organism; (D) a routine representative liver cancer patient cancerous tissue.
Figure 10 shows that HPIP siRNA can reduce cell to the susceptibility of radiation.SiRNA slow virus and HPIP siRNA recombinant slow virus be will contrast and human cervical carcinoma cell Hela (Figure 10 A), breast cancer cell MCF-7 (Figure 10 B) and normal lymphoblast AHH-1 (Figure 10 C) infected, measure the cell colony formational situation through 2,4,6, behind the 8Gy gammairradiation, calculate survival rate.
Figure 11 shows that HPIP siRNA can strengthen H2AX (Ser139) phosphorylation.To contrast siRNA slow virus and HPIP siRNA recombinant slow virus and infect human cervical carcinoma cell Hela, utilize Western blot to detect the protein level of HPIP, pH2AX (Ser139) (γ H2AX) and H2AX behind the 10Gy gammairradiation, GAPDH is as confidential reference items.
Figure 12 shows that the expression level of HPIP raises gradually in the mode that radiation dose relies on.Press the dose irradiation of gamma-rays shown in figure human cervical carcinoma cell Hela, collecting cell during respectively at 6h and 12h utilizes HPIP antibody to carry out Western blot, and GAPDH is as confidential reference items.
Embodiment
Further specify the present invention below by specific embodiment, still, should be understood to, these embodiment are only used for the more detailed usefulness that specifically describes, and should not be construed as for limiting in any form the present invention.
General description is carried out to the material and the test method that use in the present invention's test in this part.Although for realizing that the employed many materials of the object of the invention and working method are well known in the art, the present invention still does to describe in detail as far as possible at this.It will be apparent to those skilled in the art that hereinafter, if do not specify that material therefor of the present invention and working method are well known in the art.
The structure of the siRNA of embodiment 1, target HPIP gene
(1), method
Utilize 2 kinds of methods to make up HPIP siRNA, the one, chemosynthesis HPIP siRNA, another is based on non-virus carrier or lentiviral vectors makes up HPIP siRNA.Which kind of method no matter, the core sequence of HPIP siRNA target HPIP cDNA is 5 ' TTCTAGGGAGTGGAGTGGA 3 ' (SEQ ID NO; 2).
1, chemosynthesis HPIP siRNA
Utilize the conventional chemical synthetic method to synthesize HPIP siRNA.The positive-sense strand sequence is 5 '-TTCTAGGGAGTGGAGTGGAdTdT-3 ' (SEQ ID NO:3), and the antisense strand sequence is 5 '-TCCACTCCACTCCCTAGAA dTdT-3 ' (SEQ ID NO:4).Positive-sense strand and the antisense strand RNA of equivalent are dissolved in respectively 1 * annealing buffer (0.05M NaCl, 10mM dithiothreitol (DTT), 10mM MgCl
2, 10mM Tris-Cl, pH 7.5) in, making its concentration is 1 μ g/ μ L.The two mixing, 90 ℃ of heating 1min place 37 ℃ of water-bath 1h annealing to form double-stranded again.
2, based on the structure of the HPIP siRNA of non-virus carrier
According to siRNA target sequence screening design principle, the gene order of binding analysis people HPIP, analyze design system with the siRNA target sequence that Ambion company provides, select to determine 1 specific siRNA target sequence, namely the core sequence of HPIP cDNA is TTCTAGGGAGTGGAGTGGA.Utilize ncbi database, this sequence is carried out Blast analyze, proving with other knowns does not have homology, then designs positive-sense strand and the antisense strand of synthetic oligonucleotide.Be used for positive-sense strand based on the HPIP siRNA of non-virus carrier and be 5 '-GATCCGTTCTAGGGAGTGGAGTGGATTCAAGAGATCCACTCCACTCCCTAGAATTT TTTGGAAA-3 ' (SEQ ID NO:5), antisense strand is: 3 '-GCAAGATCCCTCACCTCACCTAAGTTCTCTAGGTGAGGT GAGGGATCTTAAAAAACCTTTTCGA-5 ' (SEQ ID NO:6).Positive-sense strand and the antisense strand of synthetic oligonucleotide fragment are carried out anneal.Namely first it is dissolved in respectively in the distilled water, waits mole number to mix rear 90 ℃ of heating 3min, naturally be cooled to 37 ℃ after, form the oligonucleotide of two strands.Synthetic hair fastener cDNA is inserted in the siRNA expression vector pSilencer 2.1-U6neo (available from U.S. Ambion company) of BamH I and Hind III (available from Britain Biolabs company) double digestion, be built into the HPIP siRNA recombinant plasmid based on non-virus carrier, and identify through dna sequence analysis.
3, based on the structure of the HPIP siRNA of lentiviral vectors
Be used for upstream primer based on the HPIP siRNA of lentiviral vectors and be 5 '-GATCCTTCTAGGGAGTGGAGTGGACTTCCTGTCAGATCCACTCCACTCCCTAGAAT TTTTG-3 ' (SEQ ID NO:12), downstream primer is: 3 '-GAAGATCCCTCACCTCACCTGAAGGACAGTCTAGGTGAGGTGAGGGATCTTAAAAA CTTAA-5 ' (SEQ ID NO:13).With synthetic upstream and downstream primer annealing, the two strands after the annealing is connected into pSIH1-H1-Puro carrier (available from U.S. System Biosciences company) behind BamHI and EcoRI double digestion, 16 ℃ of 6-8h.Connect product and transform DH5 α competent cell, and it is dull and stereotyped to be coated with the ammonia benzyl, 37 ℃ of incubator 16-20h choose cloning and sequencing and identify.
4, the packing of HPIP siRNA recombined lentivirus vector
Inoculation 3 * 10
6293TN cell (available from U.S. System Biosciences company) is in the 10cm culture dish, and cell density is that 50-70% is advisable.Carry out transfection behind the 24h, be about to 2 μ gHPIP siRNA recombined lentivirus vectors and 10 μ g pPack Packaging Plasmid Mix (available from U.S. System Biosciences company) mixings, add Lipofectamine 2000 transfection reagents (available from American I nvitrogen company) by company's explanation, after leaving standstill 20min transfection mixture is joined in the culture dish that contains conventional medium, place 37 ℃ of incubators.Collect supernatant behind the 48h, the centrifugal 10min of 3000rpm, the gained supernatant is packaged virus, is stored in-70 ℃.
5, the mensuration of HPIP siRNA recombinant slow virus titre
Inoculate H1299 cell (this cell is a kind of human lung carcinoma cell available from U.S. ATCC cell bank, cultivates with conventional cell culture medium) in 24 orifice plates, every hole 0.6-1 * 10
5Cell.Change the substratum that contains polybrene (8 μ g/ml) behind the 24h into, add virus, every kind of virus adds 3 holes, add virus quantity and be respectively 1 μ l (extension rate is 500), 10 μ l (extension rate is 50), 100 μ l (extension rate is 5) place 37 ℃ of incubators.Change the ordinary culture medium that does not conform to polybrene behind the 10h into.Cell is with 10 after 3 days
1, 10
2, 10
3, 10
4Dilution adds puromycin (1 μ g/ml) screening in the substratum, cultivated for 1 week in 37 ℃ of incubators, changes liquid once in per 2 days.Counting clone quantity after 1 week, virus titer calculates as follows:
Cell count during the cell count during virus titer (pfu/ml)=clone's number * cell dilution multiple * infection * viral dilution multiple/screening
6, the concentrated and infection of slow virus
According to company's explanation, the viral supernatant of collecting is mixed ice bath 12h with PEG-it Virus PrecipitationSolution (available from U.S. System Biosciences company) with 4: 1 ratios.4 ℃ of centrifugal 30min of 1500rpm, visible white or beige precipitation are virion, abandon supernatant, and it is resuspended to add an amount of PBS, is stored in-70 ℃ after the packing.
With slow virus with 5-20MOI (infection intensity, multiplicity of infection) cells infected.Infection inoculating cell the day before yesterday changes the substratum that contains polybrene (8 μ g/ml) into during infection in culture dish, add virus, changes ordinary culture medium behind the 10h into.
7, the transfection of mammalian cell
24h before MCF-7 cell (this cell is a kind of human breast cancer cell available from U.S. ATCC cell bank, cultivates with conventional cell culture medium) transfection is seeded in cell in the Tissue Culture Dish with the DMEM substratum that contains 10% new-born calf serum.Inoculating cell density during with transfection cell density reach 90% and be advisable.The specification sheets that provides by company carries out transfection with cell transfecting reagent Lipofectamine 2000 (available from American I nvitrogen company).
8, cell RNA extracts and the RT-PCR reaction
Collecting cell, explanation according to Invitrogen company, extract cell total rna with Trizol, reverse transcription: get the total RNA of 2 μ g, add 1 μ l, 1 μ g/ μ l random primer, DEPC water complements to 15.9 μ l, 70 ℃ of incubation 5min, add successively M-MLV 5 * buffer, 2.5 μ l10mM dNTP and 1.0 μ l M-MLV ThermoScript II (200U/ μ l) after the cooled on ice, 42 ℃ of incubation 60min, 95 ℃ of 5min termination reactions.Contrast as confidential reference items with β-actin, utilize RT-PCR to detect respectively HPIP and β-actin expression level variation.The forward primer sequence of HPIP is: 5 '-ATTCTAA CAGAGGAGACTGAGG-3 ' (SEQ ID NO:8), and the reverse primer sequence is: 5 '-CTCCCTGATCCAAGCTGCTTT-3 ' (SEQ IDNO:9); The forward primer sequence of β-actin is: 5 '-ATCACCATTGGCAATGAGCG-3 ' (SEQ ID NO:10), the reverse primer sequence is: 5 '-TTGAAGGTAGTTTCGTGGAT-3 ' (SEQ ID NO:11).
9, Western immunoblotting assay
(1) SDS-PAGE electrophoresis: the total protein with every hole 20 μ g after the total protein of cell of sex change is centrifugal carries out the SDS-PAGE electrophoresis; Voltage 120V, about 1.5h.
(2) transferring film: after electrophoresis finishes, with protein delivery to nitrocellulose filter; Voltage 15V shifts about 2h.
(3) sealing: 5% skim-milk (use the TBST solution preparation, TBST solution is to contain Tris 2.42g, NaCl 8g, Tween-2010ml, pH7.6 in every premium on currency solution) room temperature sealing nitrocellulose filter 1h or 4 ℃ of sealings are spent the night.
(4) primary antibodie combination: on nitrocellulose filter, (the anti-human HPIP antibody of rabbit is available from U.S. ProteinTech company to add the primary antibodie of diluting by a certain percentage with 5% skim-milk; The anti-human GAPDH antibody of rabbit is available from U.S. Santa Cruz Biotech company), room temperature jog 1h, TBST solution wash film 3 times, each 7min.
(5) two resistive connections close: on nitrocellulose filter, the IgG (goat anti-rabbit igg antibody is available from U.S. Santa Cruz Biotech company) that adds the horseradish peroxidase of diluting by a certain percentage with 5% skim-milk, room temperature jog 1h, TBST solution is washed film 3 times, each 7min.
(6) develop: the explanation (U.S. Pierce company) that provides by company, with the chemoluminescence method 5min that develops the color, compressing tablet develops.
(2) result
1, HPIP siRNA suppresses the evaluation of HPIP genetic expression
Show through dna sequence analysis mensuration based on the HPIP siRNA expression vector of non-virus carrier structure with based on the HPIP siRNA expression vector that lentiviral vectors makes up, be inserted into the cDNA sequence entirely true (referring to Fig. 1 and Fig. 2) of the target HPIP in the carrier, show and recombinate successfully.The titre of HPIP siRNA recombinant slow virus and corresponding contrast slow virus is respectively 1.1 * 10
8Pfu/ml and 1.2 * 10
8Pfu/ml.
With the HPIP siRNA of chemosynthesis and the HPIPsiRNA expression vector transfected with human breast cancer cell MCF-7 that makes up based on non-virus carrier, and will infect the MCF-7 cell based on the HPIP siRNA recombinant slow virus that lentiviral vectors makes up, and take corresponding empty carrier as contrast.The collecting cell lysate, utilize RT-PCR and Western blot to detect the effect that HPIP siRNA suppresses HPIP genetic expression at mRNA and protein level respectively and (referring to Fig. 3, show typically that wherein HPIP siRNA recombinant slow virus infects the expression that can suppress HPIP mRNA level and protein level behind the MCF-7 cell.The HPIP siRNA of chemosynthesis and the HPIP siRNA expression vector that makes up based on non-virus carrier have similar results, but data are unlisted).
(1) method
With Viola crystallina measuring HPIP siRNA to the kinds of tumor cells affects on the growth, step is as follows: with 0.25% pancreatin (available from U.S. Sigma-Aldrich company) digestion kinds of tumor cells, comprise breast carcinoma cell strain MCF7, hepatoma cell strain HepG2 and lung cancer cell line A549 (all available from U.S. ATCC cell bank).After the cell counting, be diluted to suitable concentration, 0.5ml enchylema is put into 24 orifice plates, make the cell count in every hole be about 10,000.HPIP siRNA expression vector these tumour cells of transfection that make up with the HPIP siRNA of chemosynthesis with based on non-virus carrier by method described in the embodiment 1 or infect these tumour cells with the HPIP siRNA recombinant slow virus of 5-20MOI, cultivate after 1-4 days, remove substratum, every hole adds 1% glutaraldehyde (stationary liquid) of 0.5ml, static 15-20min removes glutaraldehyde.Every hole adds 0.5ml Viola crystallina (available from U.S. Sigma-Aldrich company), place 15min (Viola crystallina is stored in room temperature), also wash several times with the tap water submergence, distilled water room temperature submergence 15min, abandon most distilled water, in air drying 24 holes (spending the night when needing), sorenson ' the s solution that every hole adds 0.5ml (contains in every premium on currency solution: Sodium Citrate 8.967g, 0.1N HCl0.195L, 90% ethanol 0.5L), shake 30min at horizontal shaking table, 100 μ l to 96 orifice plates are got in every hole, wavelength place at 590nm measures the OD value, represents the cell relative growth rate with the OD value.
(2) result
The result shows, HPIP siRNA can suppress the growth of above-mentioned all tumour cells (referring to Fig. 4, it shows that typically HPIP siRNA recombinant slow virus infects the growth that breast cancer cell line mcf-7, hepatoma cell strain HepG2 and lung cancer cell line A549 can suppress these cells, the HPIP siRNA of chemosynthesis and the HPIP siRNA expression vector that makes up based on non-virus carrier have similar results, but data are unlisted).
The grappling that embodiment 3, HPIP siRNA suppress kinds of tumor cells does not rely on growth
(1) method
Measure HPIP siRNA with soft agar assay the tumour cell grappling is not relied on affects on the growth.At first, the method described in the embodiment 1 of pressing is with the HPIP siRNA of chemosynthesis and the HPIP siRNA expression vector transfected with human tumor cell line that makes up based on non-virus carrier, and will infect human tumor cell line with 5-20MOI based on the HPIP siRNA recombinant slow virus that lentiviral vectors makes up, and take corresponding empty carrier as contrast.These tumor cell lines comprise breast cancer cell line mcf-7, hepatoma cell strain HepG2 and lung cancer cell line A549.Then adopt 60mm
2Tissue Culture Dish, in culture dish, add the DMEM substratum (available from American I nvitrogen company) that 3ml contains 0.7% agar, add 3ml after solidifying thereon and contain above-mentioned 20, the DMEM substratum of 000 tumour cell and 0.25% agar, every group of cell established 3 Duplicate Samples, cultivates 3 all rear colonies of counting every group of cell under inverted microscope and forms number.
(2) result
The result shows, the colony that HPIP siRNA can suppress above-mentioned all tumour cells forms (referring to Fig. 5, it shows that typically HPIP siRNA recombinant slow virus infects the grappling that human breast cancer cell strain MCF-7 can suppress cell and do not rely on growth, the HPIP siRNA of chemosynthesis and the HPIP siRNA expression vector that makes up based on non-virus carrier have similar results, but data are unlisted).
(1) method
Press the HPIP siRNA expression vector transfected with human breast cancer cell line mcf-7 that method described in the embodiment 1 will make up based on non-virus carrier, and take corresponding empty carrier as contrast.In addition, press the HPIP of method purifying described in the embodiment 1 siRNA recombinant slow virus.
With 1 * 10
7The cell of individual above-mentioned transfection or the cell of untransfected be inoculated in respectively 5 the week age female BALB/c nude mice mammary fat pad, be divided into 4 groups, the tumour cell group of the HPIPsiRNA expression vector transfection that namely makes up based on non-virus carrier and the tumour cell group of corresponding empty carrier transfection; The tumour cell group of the corresponding contrast virus with injection of tumour cell group of injection HPIP siRNA recombinant slow virus.Every group of each 10 nude mice.For slow virus group, treat tumor growth when being about 0.5cm, tumor locus direct injection slow virus, injected dose is 2 * 10
7Pfu.Observe inoculation position have or not ooze out, tumor growth and nude mice situation.Measure maximum diameter L (cm) and the minimum diameter D (cm) of tumour, be calculated as follows and respectively organize gross tumor volume V (cm
3) size: gross tumor volume (cm
3)=L
2* D * 1/2.Treat about 10 weeks of Transplanted cells, put to death each treated animal, get part knurl piece, clean with 0.9% ice-cold normal saline flushing, put into the 5ml centrifuge tube, add immediately 1ml and be chilled in advance 0 ℃ lysate (1 * PBS, 1%NP-40,0.5% Sodium desoxycholate, 0.1%SDS, 1/1000 proteinase inhibitor), homogenate in ice bath, the Western western blotting method of pressing among the embodiment 1 is analyzed HPIP protein expression in the knurl piece.
(2) result
After nude mice begins to occur the knurl piece, measure weekly the knurl piece size, it is long-pending to calculate the knurl block.The result shows that HPIP siRNA can suppress the growth (referring to Fig. 6, it shows that typically the injection of HPIP siRNA recombinant slow virus can suppress the tumor growth that breast carcinoma cell strain MCF7 implants) of above-mentioned tumour cell in the nude mice.The Western immunoblotting assay shows, the HPIP protein level reduces in the knurl piece of injection HPIP recombinant slow virus, and injects high expression level HPIP albumen (referring to Fig. 7) in the knurl piece of corresponding contrast adenovirus.
(1) method
With 1 * 10
6Individual cell is inoculated in the Tissue Culture Plate, the HPIP siRNA expression vector transfected with human breast cancer cell line mcf-7 that then will make up based on non-virus carrier, and take corresponding empty carrier as contrast.Behind the cell transfecting 24 hours, with oestrogenic hormon (10nM17 β-estradiol/E2) or estrogen antagonist (100nM ICI182,780) irritation cell 24 hours.Collecting cell, use respectively ERK1/2 antibody (the anti-human ERK1/2 antibody of rabbit by the method among the embodiment 1, available from U.S. Santa Cruz Biotech company), phos-ERK1/2 antibody (the anti-human phos-ERK1/2 antibody of rabbit, available from U.S. Santa Cruz Biotech company) and AKT antibody (the anti-human AKT antibody of rabbit, available from U.S. Santa Cruz Biotech company), phos-AKT antibody (the anti-human phos-AKT antibody of rabbit, available from U.S. Santa Cruz Biotech company) carry out the Western immunoblotting assay, detect the expression of corresponding protein in the above-mentioned MCF-7 cell.
(2) result
The result shows, the expression inhibiting of HPIP siRNA in the MCF-7 cell promote the MAPK of tumor development and the activation of AKT protein kinase, even the phosphorylation of MAPK and AKT (phos-ERK1/2 and phos-AKT) level reduces (referring to Fig. 8).
The HPIP protein level raises in embodiment 6, the tumour patient
(1) method
Utilize immunohistochemical method to detect the expression of HPIP in human breast carcinoma and liver cancer patient.Prepare according to a conventional method tissue paraffin section de, fix with 10% Paraformaldehyde 96, paraffin embedding, section.Use dimethylbenzene, ethanol dewaxes step by step.Use Citric Acid-Sodium Citrate-high-pressure process antigen retrieval, source catalase in minute removal of 3% hydrogen peroxide treatment number.37 ℃ of sealing 30min.37 ℃ of primary antibodies are hatched 2-3h, the two anti-and three anti-10min that all react, and the DAB colour developing, 15min, phenodin dye nuclear 1-2min, differentiation 1-2min.Ethanol-dimethylbenzene dewaters step by step, mounting, microscopy.
(2) result
The result shows that in 170 routine mammary cancer samples and 39 routine liver cancer samples, patient's cancerous tissue HPIP expression level of 75.3% (128 routine number/170) is higher than the other relatively normal mammary tissue of cancer in the mammary cancer sample; The patient HPIP of 21.2% (36 routine number/170) expression amount in the other relative normal mammary tissue of cancerous tissue and cancer is close; Only there is patient's cancerous tissue HPIP expression level of 3.5% (6 routine number/170) to be lower than cancer beside organism.In the liver cancer sample, patient's cancerous tissue HPIP expression level of 56.4% (22 routine number/39) is higher than the other relatively normal hepatic tissue of cancer; The patient HPIP of 25.6% (10 routine number/39) expression amount in the other relative normal hepatic tissue of cancerous tissue and cancer is close; Only there is patient's cancerous tissue HPIP expression level of 17.9% (7 routine number/39) to be lower than the other relatively normal hepatic tissue of cancer (referring to Fig. 9, representative show the expression level of HPIP in cancerous tissue and the other mutually normal tissue of cancer in 1 routine mammary cancer and the 1 routine liver cancer patient).These presentation of results, the HPIP protein level significantly raises in mammary cancer and the liver cancer patient, has statistical significance.
(1) method
Measure HPIP siRNA to the impact of cell resistance radiation with colony formation.At first, the method described in the embodiment 1 of pressing is with the HPIP siRNA of chemosynthesis and the HPIP siRNA expression vector transfection human cervical carcinoma cell lines Hela, breast cancer cell line mcf-7 and the normal lymphoblast strain of the people AHH-1 that make up based on non-virus carrier, and will infect these cells of people with 5-20MOI based on the HPIP siRNA recombinant slow virus that lentiviral vectors makes up, and take corresponding empty carrier as contrast.Carry out radiation behind the cell cultures 24h, radiation dose is respectively 0Gy, 2Gy, 6Gy, 8Gy, 10Gy.Immediately cell dissociation is counted after the radiation, spreading the clone with different extent of dilution respectively cultivates, every kind of cell, each extent of dilution parallel laid 3 ware, 2-4 are after week, when the cell clone naked eyes are visible, substratum is abandoned or adopted, add 5ml PBS washing 1-2 time, remove residual substratum, in order to avoid affect coloration result as far as possible.With the fixing 10min of Paraformaldehyde 96, distillation washing 1-2 time, with 1% violet staining 30min, the unnecessary staining fluid of the gentle flushing removal of distilled water.Dry rear counting clone number.Converse Surviving fraction (S coefficient) according to formula, S=forms clone's number/cell cover plant number * cover plant rate (cover plant rate=0Gy number of cell clones/100), according to S coefficient curve plotting figure.
(2) result
The result shows; HPIP siRNA can avoid radiation injury by Cell protection; namely suppressing cell after the expression of HPIP obviously reduces (referring to Figure 10 the susceptibility of radiation; it shows that typically HPIP siRNA recombinant slow virus infects human cervical carcinoma cell lines Hela, breast carcinoma cell strain MCF7 and the normal lymphoblast strain of people AHH-1 can reduce cell to the susceptibility of radiation; the HPIP siRNA of chemosynthesis and the HPIP siRNA expression vector that makes up based on non-virus carrier have similar results, but data are unlisted).
(1) method
To infect human cervical carcinoma cell Hela, human breast cancer cell MCF-7 and the normal lymphoblast strain of people AHH-1 with 5-20MOI based on the HPIP siRNA recombinant slow virus that lentiviral vectors makes up, and cultivate and carry out radiation after 24 hours, radiation dose is 10Gy.Radiation is collecting cell after 6 hours, use respectively H2AX antibody (the anti-human H2AX antibody of rabbit by the method among the embodiment 1, available from U.S. ProteinTech company), H2AX (Ser139) antibody (mouse-anti people H2AX (Ser139) antibody, available from U.S. Millipore company) and GAPDH antibody (the anti-human GAPDH antibody of rabbit, available from U.S. Santa Cruz Biotech company) carry out the Western immunoblotting assay, detect the expression of corresponding protein in the above-mentioned cell, GAPDH is as confidential reference items.
(2) result
The result shows, after cell is subject to radiation, HPIP siRNA can promote the activation of dna damage repair pathways core protein H2AX, even 139 serine phosphorylation levels of H2AX raise (referring to Figure 11, H2AX (Ser139) level raise after it showed human cervical carcinoma cell Hela raying typically, other cell strains have similar results, but data are unlisted).
The HPIP expression level raises after embodiment 9, the cell radiation
(1) method
With 1 * 10
6Individual human cervical carcinoma cell Hela, human breast cancer cell MCF-7 and the normal lymphoblast strain of people AHH-1 are inoculated in the Tissue Culture Plate, cultivate and carry out radiation after 24 hours, and radiation dose is respectively 0Gy, 2Gy, 5Gy, 10Gy and 20Gy.Respectively at radiation collecting cell after 6 hours and 12 hours, carry out the Western immunoblotting assay with HPIP antibody and GAPDH antibody respectively by the method among the embodiment 1, detect the expression of corresponding protein in the above-mentioned cell, GAPDH is as confidential reference items.
(2) result
The result shows, after cell was subject to radiation, the expression level of HPIP raises gradually in the mode that radiation dose relies on, and (referring to Figure 12, the HPIP expression level raise after it showed human cervical carcinoma cell Hela raying typically, other cell strains have similar results, but data are unlisted).
The many pieces of publications of quoting herein comprise patent document and non-patent document etc., and their disclosure all is incorporated herein by reference and in full.
Claims (12)
1. interferential RNA, its nucleotide sequence is as follows:
Positive-sense strand is:
5 '-GATCCGTTCTAGGGAGTGGAGTGGATTCAAGAGATCCACTCCACTCCCTAGAATTT TTTGGAAA-3 ', i.e. SEQ ID NO:5,
Antisense strand is:
3 '-GCAAGATCCCTCACCTCACCTAAGTTCTCTAGGTGAGGTGAGGGATCTTAAAAAAC CTTTTCGA-5 ', i.e. SEQ ID NO:6.
2. interferential RNA, its nucleotide sequence is as follows:
The positive-sense strand sequence is:
5 '-TTCTAGGGAGTGGAGTGGAdTdT-3 ', i.e. SEQ ID NO:3,
The antisense strand sequence is:
5 '-TCCACTCCACTCCCTAGAAdTdT-3 ', i.e. SEQ ID NO:4.
3. nucleic acid construct wherein comprises the nucleotide sequence of interferential RNA of claim 1 or 2 and the Expression element that is operatively connected with it.
4. the nucleic acid construct of claim 3, wherein said Expression element are promotor, terminator and optional enhanser.
5. expression vector wherein comprises the nucleic acid construct of claim 3 or 4.
6. the expression vector of claim 5, it is plasmid or viral form.
7. the expression vector of claim 6, it is adenovirus expression carrier, glandular associated virus expression vector or Lentiviral.
8. host cell, wherein transform or transfection each expression vector among claim 3 or 4 nucleic acid construct or the claim 5-7.
9. pharmaceutical composition wherein comprises among the interferential RNA, claim 3 of at least a claim 1 or 2 or 4 nucleic acid construct, the claim 5-7 each expression vector or the host cell of claim 8, and pharmaceutical acceptable carrier.
10. the non-methods for the treatment of of HPIP activity level in an external reduction cell, tissue or the organ, comprising with the amount of effective reduction HPIP activity level with each expression vector, the host cell of claim 8 among the nucleic acid construct of the interferential RNA of claim 1 or 2, claim 3 or 4, the claim 5-7, perhaps the pharmaceutical composition of claim 9 contacts with described cell, tissue or organ.
11. the host cell of each expression vector or claim 8 is for the preparation of prevention, treatment or alleviate purposes in the medicine of mammary cancer, liver cancer and/or lung cancer among the nucleic acid construct of the interferential RNA of claim 1 or 2, claim 3 or 4, the claim 5-7.
12. each expression vector or the purposes of host cell in the medicine of avoiding radiation injury for the preparation of Cell protection of claim 8 among the nucleic acid construct of the interferential RNA of claim 1 or 2, claim 3 or 4, the claim 5-7.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201010528175 CN102051362B (en) | 2010-11-02 | 2010-11-02 | Interference RNA (Ribonucleic Acid) of targeted HPIP (hematopoietic PBX-interacting protein) gene, medical composition containing same and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201010528175 CN102051362B (en) | 2010-11-02 | 2010-11-02 | Interference RNA (Ribonucleic Acid) of targeted HPIP (hematopoietic PBX-interacting protein) gene, medical composition containing same and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102051362A CN102051362A (en) | 2011-05-11 |
CN102051362B true CN102051362B (en) | 2013-10-16 |
Family
ID=43956161
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201010528175 Active CN102051362B (en) | 2010-11-02 | 2010-11-02 | Interference RNA (Ribonucleic Acid) of targeted HPIP (hematopoietic PBX-interacting protein) gene, medical composition containing same and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102051362B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DK3366775T3 (en) * | 2011-11-18 | 2022-08-01 | Alnylam Pharmaceuticals Inc | MODIFIED RNAI AGENTS |
CN103361379B (en) * | 2013-07-08 | 2015-04-08 | 汪运山 | Construction, screening and application of shRNAs expression vector of lung cancer targeted CHRNA5 gene |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008092081A3 (en) * | 2007-01-26 | 2009-02-12 | Immune Disease Inst Inc | Targeted delivery of sirna |
CN101705228A (en) * | 2009-12-11 | 2010-05-12 | 湖南师范大学 | SiRNA for inhibiting human AP-2alpha gene expression and anti-breast cancer application thereof |
-
2010
- 2010-11-02 CN CN 201010528175 patent/CN102051362B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008092081A3 (en) * | 2007-01-26 | 2009-02-12 | Immune Disease Inst Inc | Targeted delivery of sirna |
CN101705228A (en) * | 2009-12-11 | 2010-05-12 | 湖南师范大学 | SiRNA for inhibiting human AP-2alpha gene expression and anti-breast cancer application thereof |
Non-Patent Citations (2)
Title |
---|
徐小洁等.敲减人HPIP基因表达抑制细胞生长增殖.《中国生物化学与分子生物学报》.2011,第27卷(第2期),190-196. |
敲减人HPIP基因表达抑制细胞生长增殖;徐小洁等;《中国生物化学与分子生物学报》;20110228;第27卷(第2期);190-196 * |
Also Published As
Publication number | Publication date |
---|---|
CN102051362A (en) | 2011-05-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Wu et al. | miR-155 inhibits the formation of hypertrophic scar fibroblasts by targeting HIF-1α via PI3K/AKT pathway | |
EP1799826B1 (en) | siRNA-MEDIATED GENE SILENCING OF ALPHA SYNUCLEIN | |
JP4505749B2 (en) | Oligo double-stranded RNA that suppresses expression of Bcl-2 and pharmaceutical composition containing the same | |
Jang et al. | Suppression of adenine nucleotide translocase-2 by vector-based siRNA in human breast cancer cells induces apoptosis and inhibits tumor growth in vitro and in vivo | |
Fang et al. | MiR-744 functions as a proto-oncogene in nasopharyngeal carcinoma progression and metastasis via transcriptional control of ARHGAP5 | |
Ma et al. | Down-regulation of EBV-LMP1 radio-sensitizes nasal pharyngeal carcinoma cells via NF-κB regulated ATM expression | |
US20100086526A1 (en) | Nucleic acid constructs and methods for specific silencing of h19 | |
AU2003298724A1 (en) | Delivery of siRNAs | |
WO2012016139A2 (en) | Sirna compositions and methods for treatment of hpv and other infections | |
JP6727381B2 (en) | Composition for treating cancer associated with HPV infection | |
Zhang et al. | Adenovirus-mediated transfer of siRNA against peroxiredoxin I enhances the radiosensitivity of human intestinal cancer | |
JP2009541304A5 (en) | ||
CN102051362B (en) | Interference RNA (Ribonucleic Acid) of targeted HPIP (hematopoietic PBX-interacting protein) gene, medical composition containing same and application thereof | |
US20140128450A1 (en) | Cancer Therapy | |
Yuan et al. | Asymmetric siRNA: new strategy to improve specificity and reduce off-target gene expression | |
CN109364249B (en) | Application of MANF-targeted substance in preparation of product for treating intrahepatic bile duct cancer | |
KR101197627B1 (en) | Composition for treatment of HPV-related cancers | |
Dong et al. | Construction of a recombinant lentivirus containing human microRNA-7-3 and its inhibitory effects on glioma proliferation☆ | |
CN101962642B (en) | Interference RNA for targeting CCP22 gene, medicament composition containing interference RNA and application thereof | |
Ren et al. | Construction, modification and evaluation of apolipoprotein AI promoter-driven shRNA expression vectors against hTERT | |
CN113930423B (en) | SaRNA for protecting myocardial cells from stress injury and application thereof | |
Wang et al. | Targeting silencing androgen receptor gene by shRNA with low-intensity focused ultrasonic irradiation inhibits growth of prostate cancer xenografts in nude mice | |
CN114917344B (en) | WDR67 inhibitor and application thereof in inhibiting growth and metastasis of liver cancer cells | |
Chi et al. | Lentiviral vector-mediated downregulation of ornithine decarboxylase inhibits tumor cell growth in vitro and in vivo | |
CN1247608C (en) | Gene therapeutic drug hdm2-siRNA for breast cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |