KR101197627B1 - Composition for treatment of HPV-related cancers - Google Patents

Abstract

The present invention relates to a chemical or radiation sensitizer in the anticancer treatment of cancer caused by human papilloma virus (HPV) infection, specifically a small interfering RNA selected from the group consisting of SEQ ID NOs: 1-10 (small interfering RNA), shRNA (short hairpin RNA), or antisense oligonucleotides (Antisense oligonucleotide, ASO), including as an active ingredient, a chemical or radiation sensitizer in the treatment of cancer caused by HPV infection. The siRNA of the present invention has superior cervical cancer treatment effect than HPV-specific siRNA or chemotherapy or radiation therapy alone, and can maximize the apoptosis effect by enhancing the sensitivity of cervical cancer cells to radiation or anticancer agents. have.

Description

Composition for treatment of HPV-related cancers

The present invention relates to chemo or radiation sensitizers in the anti-cancer treatment of cancer caused by human papilloma virus (HPV) infection.

High-risk Human Papilloma Virus (HPV) types 16 and 18 are the leading causes of cervical cancer and cervical dysplasia and are associated with other genital and head and neck squamous cell carcinomas. Cause. Cervical cancer is one of the most common types of malignant tumors in women. The incidence of invasive cervical cancer is slowly decreasing, but it is the most frequent cancer for all women in developing countries, accounting for 25% of female cancers. HPV is a small DNA virus that causes benign malignancies with approximately 8,000 sequences. To date, more than 100 HPV subtypes have been identified according to genome differences, and approximately 90 HPV genotypes have been fully analyzed. Of these types, the high risk HPV types (eg, HPV-16, 18, 31, 33, 35, 45, 51, 52, 56) are responsible for nearly 90% of cervical cancers. More than 50% of cervical cancers infected with HPV are related to HPV-16 type, followed by HPV-18 (12%), HPV-45 (8%) and HPV-31 (5%) types. This HPV encodes two oncogenic proteins E6 and E7. These proteins are all involved in HPV-mediated immortalization and cell transformation. Carcinogenic E6 protein binds to wild type p53 tumor suppressor protein and degrades p53 via the ubiquitin pathway. E7 protein, on the other hand, directly binds to Rb for hyperphosphorylation. First, E6 complexes with E6-AP (E6-associated protein), an E3 ubiquitin-protein ligase. The E6 / E6-AP complex then binds to the p53 of the wild type and ubiquitizes, interfering with the p53-mediated cell response to DNA damage. Primarily, p53 tumor suppressor proteins are regulated by Mdm2 mediated ubiquitination, but in HPV-infected cervical cancer cells, the degradation of p53 is completely replaced by M6 and U6 ubiquitination. Thus, unlike many other cancers, cervical cancer infected with HPV almost all have the wild type p53 gene. But consistently degraded by the E6 protein, the expression level of the p53 protein is very low. In particular, HPV E6 protein has received considerable attention because it is a specific target capable of killing only cervical cancer cells. These strategies targeting E6 or E6 / E6-AP complexes involve a variety of treatments.

Peptide aptamers targeting the use of cytotoxin drugs, inhibitors of releasing zinc from E6 carcinogenic proteins of the virus, epitope peptides mimic E6-AP, anti-E6 ribozymes, peptide aptamers targeting E6 carcinogenic proteins of the virus And siRNAs targeting E6 oncogenic genes of viruses, and combinations thereof. Recently, siRNAs have been demonstrated that can not only selectively silence internal genes in animal cells, but also selectively silence genes of viruses among diseases caused by viruses. RNA interference caused by transfection of siRNAs (RNAi) has emerged as a new treatment for treating viral infections in humans. In cervical cancer cells infected with HPV, siRNAs targeting the genes of E6 and E7 cause accumulation of p53 and pRb, resulting in apoptosis or cell aging. For cervical cancer cell lines infected with HPV-16 and cell lines infected with HPV-18, RNAi targeting the E6 and E7 cancer genes of the virus was found to selectively silence the expression of these proteins.

The combination of cisplatin-based chemotherapy and radiation in 1999 significantly improved the survival of women with locally severe cervical cancer. Cisplatin is currently a DAN damaging drug widely used to treat cancers including ovaries, neck, head and neck, non-small cell lung cancer, and the like. More recently, the mechanism of action of platinum-based drugs has been investigated. However, the processes involving the control of drug uptake and excretion by treatment of cisplatin on cells, signaling of DNA damage, cell cycle tracking, DNA repair and cell death are not yet fully understood. After cisplatin treatment in HPV-18 HeLa cells, p53 protein escaped from E6-mediated degradation and accumulated preferentially in nuclear phosphorus. In addition, HPV-16 SiHa cells restored p53 function by simultaneous radiation therapy and cisplatin treatment, resulting in increased radiation sensitivity.

Accordingly, the present inventors have made efforts to find siRNAs specific for E6 / E7 that can be synergistic by being treated together when performing chemotherapy or radiation therapy, resulting in sense oligonucleotides selected from the group consisting of SEQ ID NOs: 1-10. And siRNAs formed by hybridizing antisense oligonucleotides complementarily binding to the sense sequence were treated in combination when performing chemotherapy or radiation therapy, thereby confirming that the synergistic effect was significantly higher than that of a single treatment. .

It is an object of the present invention to provide a chemical or radiation sensitizer which can have a synergistic effect when combined with chemotherapy or radiation therapy for the treatment of cancer caused by human papilloma virus (HPV) infection.

Another object of the present invention is to provide a method for enhancing sensitivity to chemotherapy or radiotherapy of cancer associated with HPV infection when performing chemotherapy or radiation therapy for the treatment of cancer caused by the HPV infection.

In order to achieve the above object, the present invention comprises an oligonucleotide having any nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10 as an active ingredient, cancer treatment caused by human papilloma virus (HPV) infection Provide chemical or radiation sensitizers.

In addition, the present invention includes a recombinant expression vector expressing a DNA fragment corresponding to an oligonucleotide having any one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10 as an active ingredient, cancer caused by HPV infection Therapeutic chemical or radiation sensitizers are provided.

In addition, the present invention includes the step of co-administering the sensitizer to cancer cells caused by HPV infection when performing chemotherapy or radiation therapy for the treatment of cancer caused by HPV infection, caused by HPV infection It provides a method for enhancing the sensitivity of chemotherapy or radiotherapy to cancer.

The siRNA of the present invention has superior cervical cancer treatment effect than HPV-specific siRNA or chemotherapy or radiation therapy alone, and can maximize the apoptosis effect by enhancing the sensitivity of cervical cancer cells to radiation or anticancer agents. have.

1 is a diagram showing the effect of inhibiting the cell proliferation of cervical cancer cell lines by siRNA treatment prepared by targeting HPV 18 E6 / E7:
a: effect on HeLa cervical cancer cell line infected with virus of HPV Form 18; And
b: Effect on CaSki cervical cancer cell line infected with HPV type 16 virus.
Figure 2 is a diagram confirming the synergistic effect of 426 siRNA and chemotherapy combined treatment in HeLa cervical cancer cell lines infected with cervical cancer cells and HPV type 18 virus:
a: cell proliferation inhibitory effect;
b: cell aging inducing effect; And,
c: Microscopic observation of the effect of inducing cellular senescence.
Figure 3 is a diagram confirming the synergistic effect of 497 siRNA and chemotherapy combination in SiHa cervical cancer cell line infected with HPV type 16 virus:
a: cell proliferation inhibitory effect;
b: cell aging inducing effect; And,
c: Microscopic observation of the effect of inducing cellular senescence.
Figure 4 is a diagram confirming the synergistic effect by radiotherapy combination with 426 siRNA or 450 siRNA in HeLa cell line:
a: cell proliferation inhibitory effect;
b: cell aging inducing effect;
c: microscopic observation of the effect of inducing cellular senescence; And,
d: microscopic observation of the morphological changes of the cells.
5 is a diagram confirming the synergistic effect on the inhibition of cell proliferation by 497 siRNA and radiotherapy combined treatment in SiHa cell line.
6 is a diagram confirming the synergistic effect of the combination of siRNA and cisplatin or irradiation by Chou-Talalay analysis:
a: 426 siRNA-HeLa cell line;
b: 497 siRNA-SiHa cell line;
c: 366 siRNA + cisplatin-CaSki cell line; And
d: 497 siRNA + radiation-SiHa cell line.

Hereinafter, terms used in the present invention will be described.

As used herein, the term “siRNA” refers to a double-chain RNA capable of inducing RNA interference (RNAi) through cleavage of mRNA of a target gene, and is homologous to mRNA of a target gene. It consists of a sense RNA strand having a sequence and an antisense RNA strand having a sequence complementary thereto. Since siRNA can inhibit expression of a target gene, it is provided by an efficient gene knockdown method or gene therapy method.

As used herein, the phrase “inhibition of gene expression” refers to the ability of gene silencing for the E6 / E7 gene of HPV18 or HPV16 of the siRNA of the invention. Inhibition of expression of the E6 / E7 gene is achieved when the test value based on the control is about 90%, preferably 50%, more preferably 25-0%. Suitable assay, for example, known to those skilled in the art techniques, for example, dot blot, Northern blot, in situ (in situ ) hybridization, ELISA, immunoprecipitation, enzyme function as well as investigation of protein or mRNA levels using phenotypic assays known to those of skill in the art.

As used herein, the term "specific" or "specific" refers to the ability to inhibit only target genes without affecting other genes in the cell, and is E6 / E7 specific in the present invention.

Hereinafter, the present invention will be described in detail.

It provides a chemical or radiation sensitizer for cancer treatment caused by HPV infection, comprising an oligonucleotide having any one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10 as an active ingredient.

In a specific embodiment of the present invention, the high-risk human papilloma virus (HPV) 16, 18 types of two oncogenic proteins E6 and E7 that can specifically bind to SiRNAs having a nucleic acid sequence as set forth in SEQ ID NOs: 1 to 10 were prepared. The cell proliferation inhibitory activity of cervical cancer cells of the prepared siRNA showed an excellent cell proliferation inhibitory effect on 103, 426, 450, 456 or 458 siRNA in HeLA cell line infected with HPV type 18 virus, and HPV 16. CaSki cell lines infected with the bun form of virus showed excellent cell proliferation inhibitory effects on 366, 448, 497, 573 or 752 siRNA. This is a proliferation of cell lines than the HPV siRNAs 18E6-1 (herein described as 18E6 / E7) and 16E6-1 (herein described as 16E6) published in the previous patent document (Korean Patent Publication No. 10-2008-0040412). The inhibitory activity was found to be remarkably superior (see FIG. 1). Thereafter, the siRNA was treated with cervical cancer cells and HeLa cervical cancer cell lines infected with HPV type 18 virus or SiHa cervical cancer cell lines infected with virus type HPV 16 alone; After treating the siRNA, the anticancer agent of cisplatin (CDDP) or nutlin-3 is used in combination; After irradiation, the siRNA was combined. As a result of measuring the cell proliferation inhibitory effect by the combined treatment of the cell line treated as above, the combination of chemotherapy and 426 siRNA in HeLa cells showed a synergistic effect on the inhibition of cell proliferation and induction of cell senescence than the group treated alone. As shown in Fig. 2, the combination of chemotherapy and 497 siRNA showed a synergistic effect on the inhibition of cell proliferation and induction of cell senescence compared to the monotherapy group (see FIGS. 2 and 3). In addition, the siRNA and radiotherapy combination group showed similar results. In particular, 426 siRNA showed better combination treatment effect than 450 siRNA (see FIGS. 4 and 5). In addition, the more accurate synergistic effect of the combination treatment was confirmed by Chou-Talalay analysis, which showed synergistic effect in the low concentration of siRNA in the HPV-18 HeLa cell line, HPV-16 SiHa cell line, and HPV-16 CaSki cell line and the combination of CDDP. The therapeutic effect was shown, and it was analyzed to show synergistic therapeutic effect in the combination of low concentration of siRNA and irradiation in the HPV-16 SiHa cell line (see FIG. 6). Thus, the siRNA described in SEQ ID NOS: 1 to 10 of the present invention may be usefully used as a chemical or radiation sensitizer that may have a synergistic effect when combined with chemotherapy or radiation therapy for the treatment of cancer associated with HPV infection. have.

Cancer caused by the HPV infection, but is not limited to cervical cancer, vagina cancer (vulgina cancer), vulva cancer (vulva cancer), anal cancer (anal cancer), penis cancer (penis cancer), tonsill cancer (tonsil cancer) ), Pharynx cancer, larynx cancer, head & neck and lung adenocarcinoma, preferably cervical cancer.

The oligonucleotide is a shRNA that is a single RNA strand of stem-loop structure in which a small interfering RNA (siRNA), in which a sense oligonucleotide and complementary antisense oligonucleotides are complementarily mixed, and an oligonucleotide and an antisense oligonucleotide are connected by a loop. short hairpin RNA), and an antisense oligonucleotide (ASO) is preferably any one selected from the group consisting of, but is not limited thereto. The siRNA can be easily produced by requesting siRNA manufacturers such as Ambion (//www.ambion.com), Dharmacon (//www.dharmacon.com), and SIGMA (//www.sigmaaldrich.com). Because of the short oligomers, it is easy to transduce common cell lines.

The siRNA is not limited to completely paired double-chain RNA portion paired with RNA, and may have a hairpin structure that forms a stem-loop structure, in particular, shRNA (short hairpin RNA). Refer. On the other hand, the double chain or stem region may include a portion not paired by mismatch (corresponding base is not complementary), bulge (the base does not correspond to one chain) and the like. The total length is 10 to 80 bases, preferably 15 to 60 bases, more preferably 20 to 40 bases. In addition, the loop region has no special meaning in the sequence, and only 3 to 10 bases are needed to connect the sense oligonucleotide and the antisense oligonucleotide at appropriate intervals. Examples of the conventionally used loop region of siRNA are as follows: AUG (Sui et al ., Proc . Natl . Acad. Sci . USA 99 (8): 5515-5520, 2002), CCC, CCACC or CCACACC (Paul et al ., Nature Biotechnology 20: 505-508, 2002), UUCG (Lee et al ., Nature Biotechnology 20: 500-505), CTCGAG, AAGCUU (Editors of Nature Cell Biology Whither RNAi, Nat Cell Biol. 5: 489-490, 2003), UUCAAGAGA (Yu et al ., Proc . Natl . Acad . Sci . USA 99 (9): 6047-6052, 2002) and TTGATATCCG (default spacer at www.genscript.com). siRNA terminal structures can be either blunt ends or cohesive ends. The cohesive end structure can be both a 3 'protruding structure and a 5' end protruding structure, and the number of protruding bases is not limited. For example, the number of bases may be 1 to 8 bases, preferably 2 to 6 bases. In addition, siRNA is a low-molecular RNA (e.g., a natural RNA molecule such as tRNA, rRNA, viral RNA or the like) in the protruding portion of one end in a range capable of maintaining the expression inhibitory effect of carcinogenic E6 / E7 protein, or Artificial RNA molecules). The siRNA terminal structure does not need to have a cleavage structure at both sides, and may be a stem loop type structure in which one terminal portion of the double chain RNA is connected by a linker RNA. The length of the linker is not particularly limited as long as it does not interfere with pairing of stem portions.

In addition, the present invention includes a recombinant expression vector expressing a DNA fragment corresponding to an oligonucleotide having any one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10 as an active ingredient, cancer caused by HPV infection Therapeutic chemical or radiation sensitizers are provided.

The cancer caused by the HPV infection may be selected from the group consisting of, but not limited to, cervical cancer, vaginal cancer, vulvar cancer, anal cancer, penis cancer, tonsil cancer, pharyngeal cancer, laryngeal cancer, head and neck cancer and lung adenocarcinoma. And preferably cervical cancer.

The oligonucleotide is a shRNA that is a single RNA strand of stem-loop structure in which a small interfering RNA (siRNA), in which a sense oligonucleotide and complementary antisense oligonucleotides are complementarily mixed, and an oligonucleotide and an antisense oligonucleotide are connected by a loop. short hairpin RNA), and an antisense oligonucleotide (ASO) is preferably any one selected from the group consisting of, but is not limited thereto.

The expression vector may be any expression vector known in the art capable of expressing any one selected from the group consisting of siRNA, shRNA and antisense oligonucleotides described in SEQ ID NOS: 1 to 10 of the present invention. For example, Promega products include the GeneClip ™ U1 Hairpin Cloning System (Cat. # 'S C8750, C8760, C8770, C8780, C8790), the siLentGene ™ U6 Cassette RNA Interference System (Cat. # C7800), and the T7 RiboMAX ™ Express RNAi System (Cat # P1700), siSTRIKE ™ U6 Hairpin Cloning Systems (Cat. # 'S C7890, C7900, C7910, C7920) and siLentGene ™ -2 U6 Hairpin Cloning Systems (Cat. #' S C7860, C8060, C8070, C8080) GenRNA products available include pRNA-U6.1 (Cat. # 'S SD1201, SD1202, SD1207), pRNATin-H1.2 (Cat. #' S SD1223, 1224) and pRNA-H1.1 / Adeno (Cat # SD12009).

In addition, the present invention includes the step of co-administering the sensitizer to cancer cells associated with HPV infection when performing chemotherapy or radiation therapy for the treatment of cancer caused by HPV infection, cancer caused by HPV infection It provides a method for increasing sensitivity to chemotherapy or radiotherapy.

In the case of combination therapy, the step of first administering the sensitizer several hours before the chemotherapy, preferably four hours before the chemotherapy is performed. In addition, in the case of radiotherapy, a step of administering a sensitizer twice a day over two days after irradiation.

The cancer caused by the HPV infection may be selected from the group consisting of, but not limited to, cervical cancer, vaginal cancer, vulvar cancer, anal cancer, penis cancer, tonsil cancer, pharyngeal cancer, laryngeal cancer, head and neck cancer and lung adenocarcinoma. And preferably cervical cancer.

The cancer cells caused by HPV infection may be isolated cells or cultured cells expressing the E6 / E7 gene, and may be included in mammals without being separated. Examples of mammals include non-human mammals (eg, dogs, cats, horses, pigs, sheep, cattle, goats, rodents; hamsters, mice, rats, and primates) and humans. In the present invention, HeLa and SiHa were used as cancers associated with HPV infection expressing the E6 / E7 gene.

SiRNA, shRNA, antisense oligonucleotide or expression vector included as an active ingredient in the sensitizer is usually administered as a pharmaceutical composition. The administration is desired in nucleic acid in vitro or in It can be carried out by commonly used gene introduction techniques, which are introduced into the target cells in vivo . In this case, the introduction of siRNA, shRNA or antisense oligonucleotide into the cell is not particularly limited, but may be an expression vector prepared by direct synthesis and then directly incorporated into a host cell, or siRNA, shRNA or antisense oligonucleotide is expressed in a cell or It is preferable to carry out by transforming or infecting cells with a PCR-based expression cassette or the like, and the expression vector is not particularly limited thereto.

Meanwhile, commonly used gene transduction techniques into target cells include calcium phosphate, DEAE-dextran, electroporation and microinjection and viral methods (Graham FL and van der Eb AJ Virol . 52: 456, 1973; McCutchan JH & Pagano JS J. Natl . Cancer Inst . 41: 351, 1968; Chu G et al ., Nucl . Acids Res . 15: 1311, 1987; Fraley R et al ., J. Biol . Chem . 255: 10431, 1980; Capecchi MR, Cell 22: 479, 1980). A recent addition to these techniques for introducing nucleotides into cells is the use of cationic liposomes (Felgner PL et al ., Proc . Nati . Acad . Sci. USA 84: 7413, 1987). Commercially available cationic lipid preparations are, for example, Tfx 50 (Promega) or Lipofectamin 20OO (Life Technologies). The method of directly incorporating siRNA, shRNA or antisense oligonucleotides capable of complementarily hybridizing to genes of oncogenic E6 / E7 proteins into the cells is not particularly limited, but cations per μg of siRNA, shRNA or antisense oligonucleotides 2-6 μg of sex liposomes are mixed and lipofection is performed for 15-40 minutes.

The sensitizer of the present invention further contains a pharmaceutically acceptable excipient. Pharmaceutically acceptable excipients are known in the art and are relatively inert substances which facilitate the administration of pharmaceutically active substances. For example, the excipient can impart shape or viscosity, or can act as a diluent. Suitable excipients include, but are not limited to, stabilizers, moisturizers, and emulsifiers, salts that can change the osmolality, encapsulating agents, buffers, and skin penetration enhancers. Excipients and formulations for oral and parenteral drug delivery are set forth in Remington, The Science and Practice of Pharmacy, 20th edition, Mack Publishing (2000). In addition, the sensitizer may be mixed with a suitable carrier and administered in any suitable manner, such as by injection, oral, topical, nasal, rectal application, and the like. The carrier can be any suitable pharmaceutical carrier. Preferably, a carrier is used that can increase the efficiency with which the RNA molecule is introduced into the target-cell. Suitable examples of such carriers are liposomes, especially cationic liposomes. More preferred method of administration is injection.

The sensitizer may be used for therapeutic application as a human medicine or a veterinary medicine, and the sensitizer may be in the form of a liquid such as an injectable solution, cream, ointment, tablet, suspension, and the like.

The effective concentration of siRNA, shRNA or antisense oligonucleotides is sufficient to provide a reduction in the expression of the E7 / E7 gene, a carcinogenic protein, relative to the level of expression detected in the absence of the desired effect, e.g., siRNA, shRNA or antisense oligonucleotides. Amount. siRNA, shRNA or antisense oligonucleotides may be introduced in an amount that allows delivery of at least one copy per cell. The higher the amount of double stranded material introduced (e.g., at least 5, at least 10, at least 100, at least 500 or at least 1000 copies per cell), the higher the inhibitory efficiency, the lower the amount of introduction for specific applications. It may be advantageous.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

< Example  1> Materials and Methods

<1-1> HPV18 E6 Of E7 siRNA Production

The siRNA of Table 1 below was obtained by customizing to Dharmacon (USA) Custom Service.

siRNA SEQ ID NO: Target base sequence Target transcript 426 One 5'- CAACCGAGCACGACAGGAA -3 ' HPV18 E6 / E7 450 2 5'- CCAACGACGCAGAGAAACA -3 ' HPV18 E6 / E7 103 3 5'- GCAAGACAGUAUUGGAACU -3 ' HPV18 E6 / E7 456 4 5'- ACGCAGAGAAACACAAGU -3 ' HPV18 E6 / E7 458 5 5'- GCAGAGAAACACAAGUAUA -3 ' HPV18 E6 / E7 366 6 5'- GCAAAGACAUCUGGACAAA-3 ' HPV16 E6 / E7 497 7 5'- GACCGGUCGAUGUAUGUCUUG -3 ' HPV16 E6 / E7 573 8 5'- CACCUACAUUGCAUGAAUAUA -3 ' HPV16 E6 / E7 752 9 5'- CUUCGGUUGUGCGUACAAAGC -3 ' HPV16 E6 / E7 448 10 5'- UCAAGAACACGUAGAGAAA -3 ' HPV16 E6 / E7 GFP 11 5'- GGCUACGUCCAGGAGCGCACC -3 '

<1-2> Cell Culture and siRNA  Transduction

HeLa cervical cancer cell line (HeLa; ATCC CCL-2) infected with cervical cancer cells and HPV type 18 virus, SiHa (SiHa; ATCC HTB-35) or CaSki (ATCC CRL-1550) infected with virus type HPV 16 Cervical cancer cell lines were dispensed into 6-well plates with cell numbers of 5 × 10 ⁴ or 1 × 10 ⁵ , and then cultured in RPMI1640 or DMEM medium for 24 hours at 37 ° C. and 5% carbon dioxide. After incubation for 24 hours and adsorbed on the surface of the cell culture vessel, 100 nM of each of the siRNA oligonucleotides of SEQ ID NOS: 1 to 10, prepared by the method of Example 1-1 as a control group and GFP RNA, was used as oligofectamine (invitrogen, USA). After transduction, the cells were incubated for 4 hours in 1 ml of medium. Then, put 500 μl of RPMI1640 or DMEM medium containing 30% bovine serum (Hyclone, USA) and incubated for 3-4 days.

<1-3> anticancer agent / radiation treatment

SiRNA was transduced into HeLa or SiHa cell lines cultured for 1 day by dispensing into 5 × 10 ⁴ or 1 × 10 ⁵ cells by the method of Example 1-2. After incubation for 4 hours, 30% bovine serum-containing medium was added, followed by treatment with cisplatin (CDDP) or nutlin-3 at a final concentration of 1.25 and 5 nM, respectively. DMSO was identified as a control.

In addition, the cell lines were dispensed at a concentration of 1 × 10 ⁶ or 5 × 10 ⁵ cells in a T25 flask, followed by a 60Co source (Gamma cell 220) (AtomicLanergyLof Canada Limited, Canada) in a HeLa or SiHa cell line cultured for 1 day. Gamma radiation was irradiated for 60 hours using ⁶⁰ Co as a source and a total dose of 2 Gy (dose rate 1.333 Gy / min). Thereafter, the cells were cultured for 6 days by dispensing 5 × 10 ⁴ or 1 × 10 ⁵ cells in 6 well-plates, followed by transducing siRNA by the method of Example 1-2, and further incubating for another day, and then again. SiRNA was transduced by the method of Example 1-2.

<1-4> β Related to Cell Aging Galactosidase ( SA -β- gal ) Active measurement

The method of Example 1-3 was cultured for 7 days after siRNA transduction and anticancer agent / radiation alone or in combination with HeLa or SiHa cell lines. It was washed with PBS using a cell aging measurement kit (BioVision, USA) and treated with SA-β-gal staining solution at 37 ° C. for 12 hours. Cells stained blue were observed at 100-200 times magnification using a general optical microscope.

<1-5> Cell Type Change Measurement

The method of Example 1-3 was cultured for 7 days after siRNA transduction and anticancer agent / radiation alone or in combination with HeLa or SiHa cell lines. On day 7, cell morphology was examined using a phase contrast microscope (AxioVision, Carl Zeiss, German).

< Experimental Example  1> siRNA Cell proliferation inhibitory effect

SiRNA targeting HPV18 E6 / E7 of Example 1-1 to the CaSki cervical cancer cell line infected with HeLa or HPV type 16 virus infected with HPV type 18 virus by the method of Example 1-2 above The cells were transduced and further cultured for one more day, and then siRNA was transduced again by the method of Example 1-2. After transduction, the cells were cultured for 3 days and the cell number was measured. At this time, 18E6-1 (SEQ ID NO: 12: 5'-UAACCUGUGUAUAUUGCAA-3 '), which is an HPV-specific siRNA disclosed in a prior patent document (Korean Patent Publication No. 10-2008-0040412) (described herein as 18E6 / E7, SiRNA targeting both genes E6 / E7 of HPV Form 18 and 16E6-1 (SEQ ID NO: 13: 5'-ACCGUUGUGAUUUGUUA-3 ') (described herein as 16E6, gene EV 16 of HPV Form 16) SiRNA targeting one) was used as a control.

As a result, as shown in FIGS. 1A and 1B, the HPV 18 HeLA cell line showed an excellent cell proliferation inhibitory effect in 103, 426, 450, 456 or 458 siRNA, and 103, 426, 448, 450, 456 or 458 siRNA were preceded. The proliferation of cell lines was significantly suppressed than that of 18E6-1 (herein described as 18E6 / E7), the siRNA targeting HPV 18 in the literature. In addition, HPV 16 CaSki cell line showed excellent cell proliferation inhibitory effect on 366, 448, 497, 573 or 752 siRNA, all 16E6-1 siRNAs targeting HPV No. 16 of the prior document (described herein as 16E6). More significantly inhibited proliferation of cell lines.

< Experimental Example  2> 426 siRNA Injury Effect of Combination with Chemotherapy

<2-1> Cell Proliferation Inhibitory Effect

The single treatment group (426 siRNA, cisplatin, nutlin respectively treated) and the combination group (426 siRNA and cisplatin or nutlin combined treatment) prepared for the HeLa cell line by the method of Example 1 were further incubated for 6 days Then, the cell number was measured.

As a result, as shown in Figure 2a, the group treated with chemotherapy and 426 siRNA in combination, the cell proliferation was drastically reduced than the siRNA alone or anticancer alone or in combination. In particular, the number of cells significantly decreased in the group treated with 426 siRNA and nutlin-3, and the group treated with 426 siRNA, CDDP and nutlin-3. These results indicate that the combination of chemotherapy and 426 siRNA in HeLa cells significantly increased the cytotoxic effect than the monotherapy group.

<2-2> Cell Aging Induction Effect

SA β-Gal activity was measured by the method of Example 1-4 on day 6 of the cell line treated by the method of Experimental Example 1-1.

As a result, as shown in FIGS. 2B and 2C, no active cell line was detected in the chemotherapy group, and almost all cells were stained dark blue in the combination of 426 siRNA and chemotherapy, resulting in strong SA-β Gal. Showed its activity. These results show that very low concentrations of cisplatin, nutlin-3 treatment synergistically increase the effect of 426 siRNA on cell aging.

< Experimental Example  3> 497 siRNA Injury Effect of Combination with Chemotherapy

<3-1> Cell Proliferation Inhibitory Effect

The single treatment group (only treated with 497 siRNA, cisplatin, and nutlin) and the combined treatment group (combined with 497 siRNA and cisplatin or nutlin) prepared for the SiHa cell line by the method of Example 1 were further incubated for 3 days. Then, the cell number was measured.

As a result, as shown in FIG. 3A, the group treated with the chemotherapy and the 497 siRNA decreased dramatically compared to the group treated with the siRNA alone or the anticancer agent alone or in combination. In particular, the number of cells significantly decreased in the 497 siRNA + CDDP treatment group, the 497 siRNA + nutlin-3 treatment group, and the 426 siRNA + CDDP + nutlin-3 combination group. These results indicate that the combination of chemotherapy and 497 siRNA significantly increased the cytotoxic effect in the SiHa cell line than in the monotherapy group.

<3-2> Cell Aging Induction Effect

SA β-Gal activity was measured by the method of Example 1-4 on day 6 of the cell line treated by the method of Experimental Example 3-1.

As a result, as shown in Figures 3b and 3c, although the activity of SA-β Gal also appeared strong in the combination group of cisplatin and nutlin-3, significantly increased the activity of SA-β Gal by treatment with 497 siRNA Appeared.

< Experimental Example  4> siRNA Injury Effect of Combination and Radiotherapy

<4-1> cell proliferation inhibitory effect

The single treatment group (426 siRNA, 450 siRNA, irradiated only) and the combination group (426 siRNA or 450 siRNA combined with irradiation) prepared for the HeLa cell line by the method of Example 1; Alternatively, the cells were measured after incubation for 4 days in the monotherapy group (497 siRNA, only irradiated only) and the combination group (combined 497 siRNA and irradiated together) prepared for SiHa cell lines.

As a result, as shown in FIG. 4A, the group treated with radiation therapy and 426 siRNA or 450 siRNA showed a sharp decrease in cell proliferation than the group treated with siRNA alone or with radiation therapy alone or in combination. In particular, 426 siRNA showed better combination effect than 450 siRNA. These results indicate that the combination of radiation therapy with 426 siRNA or 450 siRNA in HeLa cells significantly increases the cytotoxic effect than the monotherapy group.

In addition, as shown in FIG. 5, in the SiHa cell line of HPV 16 type, the result of the co-treatment with 497 siRNA was the same as that of the HeLa cell line of HPV 18 type.

<4-2> Cell Aging Induction Effect

On day 4 of the cell line treated by the method of Experimental Example 4-1, SA β-Gal activity was measured by the method of Example 1-4, and the morphological changes were observed by the method of Example 1-5. It was.

As a result, as shown in FIGS. 4B and 4C, no active cell line was detected in the monotherapy group, and almost all cells were stained dark blue in the 426 siRNA and radiation therapy combination group, indicating strong SA-β Gal activity. Showed. In addition, as shown in FIG. 4D, the morphology of the cells in the combination group of siRNA and radiation therapy was significantly changed. These results show that very low concentration of radiation synergistically increases the effect of 426 siRNA on cell aging.

< Experimental Example  5> Chou - Talalay  Synergistic of concomitant treatment by analysis synergistic A) cytotoxic effect analysis

<5-1> cell treatment

According to the method of Example 1, the experimental group was prepared for the HeLa, SiHa or Caski cell line with the following design. At this time, HeLa cell line was treated with 426 siRNA, SiHa cell line with 497 siRNA, and CaSki cell line with 336 siRNA, respectively:

1) siRNA treatment group: 0, 5, 25, 50, 100 or 200 nM;

2) CDDP (cisplatin) alone group: 0, 0.625, 1.25, 2.5, 5 or 10 μΜ; And

3) siRNA + CDDP (cisplatin) combination group: siRNA (0, 5, 25, 50, 100 or 200 nM) + CDDP 5 μM.

4) Radiation only group: 0, 1, 2, 4 or 6 Gy

5) siRNA + radiation combination group: siRNA (0, 25 or 50 nM) + radiation (2 or 4 Gy)

<5-2> in combination therapy with anticancer agent Chou - Talalay  analysis

Chou-Talalay analysis was performed to confirm the more synergistic therapeutic effect of the combination treatment. This assay is the most commonly used assay to demonstrate synergistic therapeutic effects in more than one combination.

&Quot; (1) &quot;

f a / f u = (D / Dm) ^m

D: the dose;

Dm: the dose required for 50% effect;

f a: the fraction affected by dose D; And

f u: the unaffected fraction (thus f a = 1 f u).

In this case, Equation 1 was converted to Equation 2 below.

&Quot; (2) &quot;

D = Dm [ f a / (1- fa )] ^{1 / m}

Using Equation 2, Equation 3 was prepared.

&Quot; (3) &quot;

log (D) = 1 / m × log [ f a / (1- fa )] + log Dm

Therefore, in the Median Effect plot, x = log (D), y = log (fa / fu), m is the slope, and log (Dm) can be calculated as the X-intercept. These values were used to calculate the concentrations of the drug combinations in combination with the concentrations of each drug exhibiting a therapeutic effect according to Equation 4 below.

&Quot; (4) &quot;

Combination Index (CI) = (D combi) ₁ / (D alone) ₁ + (D combi) ₂ / (D alone) ₂

(D combi) ₁ and (D combi) ₂ : concentrations showing the therapeutic effect ( f a) used in the combination treatment of the drug; And

(D alone) ₁ and (D alone) ₂ : Concentration of drug to obtain therapeutic effect ( f a) upon treatment with drug 1 or 2 alone, D alone = Dm [ f a / (1- f a)] ^{1 / m} .

In the Chou-Talalay analysis, when CI (Combination Index) value is finally CI <1, it shows synergistic treatment effect. If CI = 1, it shows additive effect, and CI> 1 is less than combination treatment effect ( sub-additive).

In the method of Experiment 5-1, a single treatment group prepared for HeLa, SiHa, or CaSki cell lines (siRNA and cisplatin were treated only) and a combination treatment group (siRNA and cisplatin combined) were further incubated for 2 days. Then, the cell number was measured.

As a result, as shown in FIG. 6A, CI values of 0.36, 0.47 and 0.56 were lower than 1 in the combination of low concentrations of 5, 25 or 50 nM and 5 μM CDDP of 426 siRNA in HPV-18 HeLa cell line, respectively. It was analyzed to show a synergistic therapeutic effect.

In addition, as shown in FIG. 6B, CI values of 0.60, 0.71, and 0.69 were synergistically lower than 1 in the HPV-16 SiHa cell line in the combination of low concentrations of 497 siRNA of 5, 25, or 50 nM and 5 μM CDDP, respectively. It was analyzed to show a therapeutic effect.

In addition, in the HPV-16 CaSki cell line as shown in Figure 6c 336 siRNA 5 nM + CDDP 2.5 μM, 336 siRNA 25 nM + CDDP 1.25 μM, 336 siRNA 50 nM + CDDP 5 μM or 336 siRNA 100 nM + CDDP 5 μM combination group CI values of 0.9, 0.9, 0.86 and 0,73 were lower than 1, respectively, indicating a synergistic therapeutic effect.

<5-3> in combination therapy with radiation therapy Chou - Talalay  analysis

After the culture of the single treatment group (459 siRNA, irradiated only) and the combined treatment group (siRNA and radiation therapy combined) prepared for the SiHa cell line by the method of Experimental Example 5-1 for three more days , The cell number was measured.

As a result, as shown in FIG. 6D, CI values of 063 and 0.71 in the combination of low concentrations of 459 siRNA 25, 50 nM and 2 Gy irradiation in HPV-16 SiHa cell line, respectively, and low concentration of 459 siRNA 50 In the combination of nM and 4 Gy irradiation, the CI value was 0.8 and lower than 1, indicating a synergistic treatment effect.

As described above, by combining the siRNA of the present invention in chemotherapy, it has a superior cervical cancer treatment effect than HPV-specific siRNA or chemotherapy or radiation therapy alone, and the treatment of cervical cancer cells against radiation or anticancer agents. Since it enhances the sensitivity to maximize the apoptosis effect, it can be usefully used in the development and production of chemical or radiation sensitizers in the anti-cancer treatment of cancer caused by HPV infection.

Attach an electronic file to a sequence list

Claims (10)

A chemical or radiation-sensitive composition comprising an oligonucleotide having any one nucleic acid sequence selected from the group consisting of SEQ ID NOs. 1 to 10 as an active ingredient and used for treating cancer caused by human papilloma virus (HPV) infection.
The oligonucleotide of claim 1, wherein the oligonucleotide comprises a stem-loop structure in which a small interfering RNA (siRNA), an oligonucleotide, and an antisense oligonucleotide, in which a sense oligonucleotide and complementary antisense oligonucleotides are complementarily mixed with each other, are connected by a loop. The composition is characterized in that any one selected from the group consisting of a single RNA strand (shRNA (short hairpin RNA), and antisense oligonucleotide (ASO)).
According to claim 1, wherein the cancer caused by HPV infection is cervical cancer, vagina cancer (vulgina cancer), vulva cancer (vulva cancer), anal cancer (anal cancer), penis cancer (penis cancer), tonsil cancer (tonsil cancer) ), Pharynx cancer, larynx cancer, head and neck, and lung adenocarcinoma.
A recombinant expression vector expressing the same DNA fragment as the oligonucleotide having any one nucleic acid sequence selected from the group consisting of SEQ ID NOS: 1 to 10 as an active ingredient, the chemistry used for treating cancer caused by HPV infection or Radiation-sensitive composition.
The method according to claim 4, wherein the oligonucleotide is a shRNA oligonucleotide and the complementary antisense oligonucleotides siRNA, oligonucleotides and antisense oligonucleotides complementary hybridization of the shRNA is a single RNA strand of stem-loop structure connected by a loop, And it is any one selected from the group consisting of antisense oligonucleotides.
According to claim 4, wherein the cancer caused by HPV infection is selected from the group consisting of cervical cancer, vaginal cancer, vulvar cancer, anal cancer, penis cancer, tonsil cancer, pharyngeal cancer, laryngeal cancer, head and neck cancer and lung adenocarcinoma A composition, characterized in that. delete delete delete delete

Images