CA2221684A1 - Novel cathepsin and methods and compositions for inhibition thereof - Google Patents

Abstract

Methods for inhibiting the secretion of .beta.-amyloid peptide (.beta.AP) from cells comprise administering to the cells certain compounds which inhibit the activity of an approximately 31 kD protease involved in .beta.AP secretion. The 31 kD protease has been designated Cathepsin Y. Screening methods for .beta.AP inhibitors rely on determining the activity of test compounds in the presence of Cathepsin Y and a suitable peptide substrate. This invention is also directed to a nucleic acid sequence that encodes Cathepsin Y and the expression and isolation of Cathepsin Y.

Description

WO 96/39194 PCT~US96/06211 NC)VEL CAl~;~lN AND l~OETE3tODS
AND C03!IPOSll~IONS I~OR INHIBlTION ll~JKEOF

S BACKGROUND OF THE INVENTION
Field of the Invention This invention relates ~PnP~lly to methods and conlposiLions for inhibiting ,B-amyloid peptide (,~AP) production in cells. In particular, this invention relates to compounds which are capable of inhibiting the int~cç~ r 10 prodllcticn of ,~AP, and the use of such compounds in methods for inhibiting ,~AP production.
This invention also relates to an i~ol~d novel protein, C~thepsin y, which is a novel carboxypeptidase involved in the generation of ~BAP. Methods for isolation of this protein are provided. DNA isolates coding for Cathepsin Y
15 a~d methodc of obL~ .g such DNA are provided, to~gether with e~ s~ion ~y~ ls for recombinant production of Cathepsin Y useful in therapeutic or nostic compositions.

State of the Art ~l~hPimer7s Disease (AD) is a de~generative brain disorder ch~ tp~i7pli clini~lly by progressive loss of memory, cognition, reasoning, judgment and emotional stability that gradually leads to profound mental deterioration and, lfim~tPly, death. AD is a very common cause of progressive mental failure (~ernPnti~) in aged hum~n~ and is believed to re~lesellt the fourth most common 25 mt~ l cause of death in the United States. AD has been observed in races and ethnic groups worldwide and ~rese..t~ a major present and future public health problem. The disease is ~;u~ tly es~im~tPd to affect about two to three ~ million individuals in the United States alone. AD is at present incurable. No l~r~ that effectively ~ .lt~ AD or reverses its ~y.nplu,.,s and course is ~ 30 cull~ntly known.

The brains of individuals with AD exhibit characteristic lesions termed senile (or amyloid) plaques, amyloid angiopathy (amyloid deposits in blood vessels) and neurofibrillary tangles. Large numbers of these lesions, particularly amyloid plaques and neurofibrillary tangles, are generally found in5 several areas of the human brain i~ ol~nt for memory and cognitive function in patients with AD. Smaller numbers of these lesions in a more restricted anatomical distribution are also found in the brains of most aged hum~nc who do not have clinical AD. Amyloid plaques and amyloid angiopathy also characterize the brains of individuals with Trisomy 21 (Down's Syndrome) and 10 Hereditary Cerebral Hemorrhage with Amyloidosis of the Dutch-Type (HCHWA-D). At present, a definitive diagnosis of AD usually requires observing the aforementioned lesions in the brain tissue of patients who have died with the disease or, rarely,- in small biopsied samples of brain tissue taken during an invasive neuro-surgical procedure.
The principal ~hemic~l con.~titl~ent of the amyloid plaques and vascular amyloid deposits (amyloid angiopathy) char~cteri~tic of AD and the other disorders mentioned above is an a~l~imately 4.2 kilodalton (kD) protein of about 39-43 amino acids ~e~ign~t~ the ~-amyloid peptide (,l~AP) or sometim~,s A,~, A,~P or ,B/A4. ,BAP is a fragment of a large membrane-sp~nning glycopro~ , referred to herein as the ,~-amyloid precursor protein (APP), comprising approximately 39-43 amino acid recidues. This protein fragment was first purified, and a partial amino acid sequence was reported in, Glenner and Wong, Bioc~em. Biophys. Res. Commun. 120:885-890 (1984). The isolation procedure and the sequence data for the first 28 amino acids are described in U.S. Patent No. 4,666,829.
,~AP is further characterized by its relative mobility in SDS-polyacrylarnide gel electrophoresis or high p~lrollllallce liquid chrolllalography (HPLC). ,~3AP can occur in a fil~m~ntous polymeric form which exhibits the Congo-red and thioflavin-S dye-binding ch~r~cteri~tics of amyloid. ~AP can also occur in a non-fil~m~ntous form ("preamyloid" or "amorphous" or "diffuse" deposits) in tissue, in which form no ~ t~t~hle birefringent st~ining W O 9613~194 PCT~US96/06211 by Congo red occurs. A portion of this protein in the insoluble form obtained from meningeal blood vessels is described in U.S. Patent No. 4,666,829.
APP is normally produced by cells in many tissues of various ~nim~
inclu-linf~ hllm~nc APP is encoded by a gene on the long arm of human 5 chromosome 21. Knowledge of the structure of the gene encoding APP has in~ tffl that ,~AP arises as a peptide fr~gm~nt from cleavage of APP by at least one heretofore unidPntifi~d protease. This cleavage appears to occur in the lysosomes. The precise biochemical pathway by which the ,~AP fr~m~nt is cleaved from the APP and subsequently deposited as amyloid plaques is still 10 under investigation.
Several lines of evidence indicate that ~r~g,~ssi~e cerebral deposition of ~BAP plays a sçmin~l role in the pathogenesis of AD and can precede cognitive symptoms by years or llec~-les (for a review, see Selkoe, (1991) Neuron 6:487).
Recently, it has been shown that ,BAP is released from neural cells grown in 15 culture as well as into cerebral spinal fluid of both normal individuals and AD
p:~ti~ntc Certain inherit~rl mutations which occur in the APP gene are also known to cause AD and AD-related conditions. For example, mis-sense DNA
mutations at amino acid 717 of the 770-amino acid isoform of APP can be 20 found in ~ffecte~ members but no~ in lln~ffect~ members of several f~,mi1i~c with a genetif~lly determined (f~mili~l) form of AD (Goate et al., Nature 349:704-706 (1991); Chartier Harlan et al., Nature 353:844-846 (1991); and Murrell et al., (1991) Science 254:97-99). A double mutation çh~ngin~
lysine595-methionine596 to asparagine595-leucine596 (with reference to the 695-25 arr~ino acid isoform of APP) found in a Swedish family was r~o.~d in 1992~[ullan et al., (1992) Nature Genet 1:345-347) and is referred to as the Swedish variant or mutation.
Genetic linkage analyses have demonstr~tP~ that these mut~tionC, as well as certain other mllt~tionC in the APP gene, are the specific molecular cause of30 AD in the affected members of such f~mili~o.s In addition, a mut~tion at amino acid 693 of the 770-amino acid isoform of APP has been i(lçntifi~d as the cause , W O 96/39194 PCT~US96/06211 of the ,BAP deposition disease, HCHWA-D, and a change from alanine to glycine at amino acid 692 appears to cause a phenotype that resembles AD in some p~tientc but HCHWA-D in others. See, Younkin, et al., Science 259:5 14-5 16 (1993).
Despite the l~rog~ss which has been made in understanding underlying mP~h~nicmc of AD and other,~AP-related ~licP~ces~ there remains a need to develop compositions and methods for tre~tment of the disease(s).

SUMMARY OF THE INVENTION
This invention is directed, in part, to methods for inhibiting ,B-amyloid peptide production in cells producing ~B-amyloid peptide. Specifically, the methorl$ of this invention are directed, in part, to the discovery that specificcompounds, as defined below, are effective in inhibiting ,5-amyloid peptide production in cells tA~,essing ,B-amyloid peptide. Reç~-se ~B-amyloid peptide production is ~soc;~tP~ with deposition of amyloid plaques in m~mm~lc and ~l7heimPr's disease in humans, the compounds described herein are also useful in inhibiting deposition of such plaques and in treating ~l7hpimpr~s disease.
This invention is further directed, in part, to the icl~ntific~tion of a novel protease, Cathepsin Y, and to nucleic acids which encode this protease. This invention is also directed to methotlc for the recombinant ~A~ression of Calh~sin Y.
Accordingly, in one of its method aspects, this invention is directed to a method of inhibiting ~B-amyloid peptide production in cells producing ,B-amyloidpeptide, comprising ~lminictering to such cells an inhibitory amount of a co~ ol,nd of formula I:

RI (X) m - Y - NR1H-- CNR' 1H-- R4 wherein:
R is selected from the group concicting hydrogen, allyl of from 1 to 6 carbon atoms, and where R and R2 are joined to form a ring structure of from 4 CA 02221684 1997-ll-20 W ~ 96~9194 PCTAUS96/06211 to 10 carbon atoms, R' is s~le~t~l from the group consisting hydrogen, alkyl of from 1 to 6 carbon atoms and where R' and R3 are joined to form a ring structure of from 4 to 10 carbon atoms, S R' is sele~ted from the group con~i~ting of alkyl of from 1 to 4 carbon atoms substituted with from 1 to S
substituent.c selPct~d from the group con~i~ting of (a) aryl of from 6 to 10 carbon atoms, (b) aryl of from 6 to 10 carbon atoms substituted with 1 to 3 substituent.~ sçlçcted from the group consisting of alkyl of from 1 to 6 carbon atoms, aryl of from 6 to 10 carbon atoms, alkoxy of from 1 to 6 carbon atoms, aryloxy of from 6 to 10 carbon atoms, hydroxy, cyano, halo and amino, (c) cycloalkyl of from 3 to 8 carbon atoms and (d) heterocycles of from 3 to 14 carbon atoms having from 1 to 3 heteroatoms .s~l~c.t~i from the group con.~ ting of nitrogen, oxygen and sulfur wherein said subsLituled alkyl group is optionally further substituted with from 1 to 2 hydroxyl groups, alkenyl of from 2 to 4 carbon atoms substituted with from 1 to 4 substituent~ sPle~t~l from the group CO~ ting of (a) aryl of from 6 to 10 carbon atoms, (b) aryl of from 6 to 10 carbon atoms substituted with 1 to 3 substitl~ent.c s~lected from the group consisting of alkyl of from 1 to 6 carbonatoms, aryl of from 6 to 10 carbon atoms, alkoxy of from 1 to 6 carbon atoms, aryloxy of from 6 to 10 carbon atoms, hydroxy, cyano, halo and amino, (c) cycloalkyl of from 3 to 8 carbon atoms and (d) heterocycles of from 3 to 14 carbon atoms having from 1 to 3 heteroatoms .selected from the group con~ ting of nitrogen, oxygen and sulfur, aryl of from 6 to 10 carbon atoms, aryl of from 6 to 10 carbon atoms sub~ u~ed with 1 to 3 substituent~ st~lP~t~d from the group con~i~ting of alkyl of from 1 to 6 carbon atoms, aryl of from 6 to 10 carbon atoms, alkoxy of from 1 to 6 carbon atoms, aryloxy of from 6 to 10 carbon atoms, hydroxy, cyano, halo and amino, nu~ yl~

W O 96~9194 PCT~US96/06211 heterocycles of from 3 to 14 carbon atoms having from 1 to 3 ht;Leroato,.ls sele~ted from the group con~ tin~ of nitrogen, oxygen and sulfur;R2 and R3 are indeFendently D- or L-amino acid side chains of at least 2 carbon atoms with the proviso that said amino acid side chains do not include the proline side chain;
R4 is selected from the group consisting of -C(O)CH =N=N, -CH20H, -C=NOH, and -C(o)R5 where R5 is hydrogen, alkyl of from 1 to 6 carbon atoms, haloalkyl of from 1 to 6 carbon atoms and 1 to 2 halo groups, alkoxy of from 1 to 6 carbon atoms, -NR6R7 where R6 and R7 are indepenclently selected from the group conci.ctin~ of hydrogen and alkyl of from 1 to 6 carbon atoms, and -N(CH3)0CH3;
X is s~lect~ from the group consisting of -O-, -NR9-, and -S- where R9 is selected from the group consisting of hydrogen, alkyl of from 1 to 6 carbon atoms and aryl of from 6 to 10 carbon atoms;
Y is select~l from the group consisting of -C(O)- and -C(S)-;
m is equal to zero or one; and n is equal to zero to two, . or pharm~-.eutic~lly acceptable salts thereof with the proviso that when R' is l-naphthyl, R2 is -CH(CH3)2 (L-isomer), R3 is -CH2~ (L-isomer), Y is -C(O)-, m is zero and n is one, then R4 is not -N(CH3)0CH3, with the further proviso that when Rl is diphenylmethyl, R2 is p-(benzyloxy)benzyl (L-isomer), Y is -C(O)-, and m and n are zero, then R4 is not -N(CH3)0CH3, and with still the further proviso that when R' is (1,2-diphenyl)ethenyl, Y is -C(O)-, R2 is -CH2~ (L-isomer), and m and n are zero, the R4 is not -N(CH3)0CH3.
In another of its method ~pect~, this invention is directed to a method of inhibiting the deposition of amyloid plaque in a .. ~.. ~l, compri~ing W O 96~79l~94 PCT~US96/06211 arlmini~t~ring to such a m~mm~l an effective amount of a compound of formula r above.
In still another of its method aspects, this invention is directed to a method of preventing, treating or inhibiting the onset of ~l7heimer'5 disease S (AD) in a m~mm~l which comprises ~lmini~t.Qrin~ to such a m~mm~l an effective amount of a compound of formula I above.
P.'~f~l~d compounds for use in the mçthorl~ described herein include, by way of example, the following compounds as defined by formula II below, including all isomers thereof, wherein the amino acid side chain for R2 and R3 0 is inrli~ted beneath the R2 and R3 substitllp-nt R2 o R3 Rl (X) m--~l--NHCH CNH CH --R4 II

R' X m Y R2 nR3 R4 20~-cHr o 1-c(o)- -CH(CH3)2 1-cHr~ -C(O)CH=N=N
(valine) (phenylalanine) ~-CH2- 0 1-C(O)- -CH2CH(CH3)2 1 -CH2~ -C(O)CH=N=N
(leucine) (phenylalanine) (0rCH- - O-C(O)- -CH2~ 0-- -C(O)H
(phenylalan~ne) ~-(CHJ4 - O-C(O)- -CH2~ 0-- -C(O)H
'Y
(03-C- - O-C(O)- -CH2~ 0 -- -C(O)H
(phenylalanine) 25(o2cH- - o-c(o)- -CH2CH2~ 0-- -C(O)H
alanine) ~CH=C(O - O -C(O)- -CH2~ 0 -- -C(O)H
(phenylalaninc) (orCH- - O-C(O)- -CH2-(3-indolyl) 0 -- -C(O)H
(t,~t"' ~-CHr O 1-C(O)- -CH2~ 1-CH(CH3)2 -C(O)H
(phenylalanine) (valine) 30~-cHr o 1-c(o~ -CH(CH3)2 1-CH2CH(CH3)2-C(O)H
(valine) (leucine) W O 96/39194 PCT~US96/06211 In one of its product aspects, this invention is directed to an isolated and purified polypeptide having the enzymatic activity of Cathepsin Y
~ protein.
In another of its product aspects, this invention is directed to a S purified and i.col~ted nucleic acid sequence which sequence encodes for C~ y.
In still another of its product ~CpectC, this invention is directed to a purified and isolated nucleic acid sequence capable of hyb~i-li7ing to Cathepsin Y comprising:
a) a nucleic acid sequence substantially homologous to the nucleic acid sequence of FIG. 4, wherein T can also be U, b) a nucleic acid sequence substantially complementary to the sequence of FIG. 4, wherein T can also be U, or c) fr~gmPntc of the nucleic acid sequence of FIG. 4, wherein T
can also be U or nucleic acid sequences complementary to the sequence in PIG. 4, that are at least 12 bases in length and that do not hybridize to the nucleic acid sequences encoding Cathepsin genes other than Cathepsin Y but which will selectively hybridize DNA encoding Cathepsin Y.
In another of its method aspects, this invention is directed to a method for eA~lessiilg Cathepsin Y which method comprises transfecting a host cell with a nucleic acid sequence which sequence encodes for C~thP.psin Y, cult~ring the transfected cell under conditions which express 25 C~th~.pcin Y and recovering Cathepsin Y from the cell culture.
In another of its method aspects, this invention is directed t~ a method of detecting the eA~ s~ion of ~thppsin Y comprising a) icol~ting RNA from a m~mm~ n tissue or cell, b) hybri~li7ing to the isolated RNA a l~hPllP{l nucleic acid sequence 30 capable of hyhri~ ing to t~thPE~cin Y compricing -~CT~ q~/0621L
IPEA,'.~ 3 3 J~
_ i) a nucleic acid sequence substantially homologous to the nucleic acid sequence of FIG. 4, wherein T can also be U, ii) nucleic acid sequences substantially complementary to the sequence of FIG. 4, wherein T can also be U, or iii) fr~m~nt~ of the nucleic acid sequence of FIG. 4, wherein T
can also be U or nucleic acid sequences comp'- -nt~ry to the sequence in FIG. 4, that are at least 12 bases in length and that do not hybridize to nucleic acid sequences of other c~thPps;n genes but which will selectively hybridize to m~mm~ n DNA
encoding C~th~cin y c) dct~ g whether the labelled nucleic acid sequence binds to the isolated RNA.

BRIEF DESCR~ION OF THE DRAWING
FIGs. 1 and 2 illll$tr~te reaction 5rh~omes used to prepare some of the cornpounds described herein.
FIGs. 3A-3C illllstr~fe typical pl~rifi~ti~n profiles, analyzed by Western bloffing, of C~ Y.
FIGs. 4A-E depicts the an~ino acid (SEQ ID NO:3) and DNA
sequence (SEQ ID NO:2) of human C~thPE~sin Y.
FIG. 5 shows the restriction map of plasmid poCK751.
FIG. 6 shows the restriction map of plasrnid poCKcatY.
FIG. 7 illllsfr~t~s a standard OPA curve for fluorescence with ~5 varying concentrations of valine.

DESCRUPq~O N OF I~IE P~UEFFRRF.~ E~BO Dr~DErrrS
This invention is directed, in part, to the inhibition of ,B-amyloid peptide production in cells producing ,B-amyloid peptide by a~mini~tering specific compounds to the cells which inhibition can be employed to retard deposition of amyloid plaques and to treat Al7heim~r's disease in m~m m~l~

~S~EET' W O96~9194 PCT~US96/06211 This invention is also directed in part to the identification of a novel protein, Cathepsin Y, and to nucleic acids which encode this protein. This invention is also directed to methods for the recombinant e~ ssion of Cathepsin Y.
S However, prior to discussing this invention in further detail, the following terrns will first be defined:

Definitions The following terms and phrases set forth in the specification and claims are defined as follows.
The term ",B-amyloid peptide (,BAP)" as used herein refers to an approximately 4.2 kD protein which, in the brains of subjects suffering from AD, Down's Syndrome, HCHWA-D and some normal aged subjects, forms a subunit of the amyloid fil~mentc compri~ing the senile (amyloid) plaques and the amyloid deposits in small cerebral and meningeal blood vessels (amyloid angiopathy). ~3AP can occur in a filamentous polymeric form (in this form, it exhibits the Congo-red and thioflavin-S dye-binding char~ct~ri~ti--s of amyloid). ~AP can also occur in a non-fil~mentous form ("preamyloid" or "amorphous" or "diffuse" deposits) in tissue, in which form no detect~hle birefringent st~ining by Congo red occurs. A portion of this protein in the insoluble form obtained from meningeal blood vessels-is described in U.S. Patent No. 4,666,829, the full disclosure of which is ~ncorporated herein by reference.
",~AP" as used herein specifiç~lly refers to an approximately 39-43 arnino acid peptide that is subst~nti~lly homologous ~o the form of the peptide produced by the method described in the '829 patent, but which can a]so be found in soluble form in the eYtr~ r fluid (conditioned nn eAinm) of cultured cells grown in vitro and in body fluids of hllm~nc and other ..,~..""~1~, in~lu-ling both normal individuals and individuals suffering 30 from ,~AP-related cc-n~ition~ Thus"~AP also refers to related ~BAP
sequences that result from mutations in the ,~AP region of the normal gene.

W ~ 96/39t94 PCT~US96/06211 In whatever form"BAP is an approximately 39-43 amino acid fragment of a large membrane-sp~nning glycoprotein, referred to as the ~-amyloid precursor protein (APP), encoded by a-gene on the long arm of human chromosome 21. ,BAP is further char~t~n7~ by its relative mobility in 5 SDS-polyacrylamide gel electrophoresis or in high ~lrol"lallce liquid chromatography. The 43-amino ~AP acid sequence (SEQ ID No. 1) is:

Asp Ala Glu Phe Arg His Asp Ser Gly Tyr Glu Val His His Gln Lys Leu Val Phe Phe Ala Glu Asp Val Gly Ser Asn Lys Gly Ala Ile Ile Gly Leu Met Val Gly Gly Val Val Ile Ala Thr ,~AP also refers to sequences that are substantially homologous to this 43-amino acid sequence.
The term ",B-amyloid precursor protein" (APP) as used herein is defined as a polypeptide that is encoded by a gene of the same name localized in humans on the long arm of chromosome 21 which includes ,~AP within the carboxyl one-third of its length. APP is a glycosylated, single-membrane-sp~nning protein eA~ressed in a wide variety of cells in many m~mm~ n tissues. Examples of specific isotypes of APP which are cullc;nLly known to exist in hllm~n~ are the 695-amino acid polypeptide described by Kang et al., Nature 325:733-736 (1987) which is deci~n~t~
as the "normal" APP; the 751-amino acid polypeptide clesçrihed by Ponte et al., Nature 331:525-527 and Tanzi et al., Nature 331:528-530 (1988); and the 770-amino acid polypeptide described by Kitaguchi et al., Nature 331:530-532 (1988). Examples of specific variants of APP include point mut~tioll~ which can differ in both position and phenotype (for review of known variant mutations see Hardy, Nature Genet. 1:233-234 (1992)).

W O 96/39194 PCT~US96/06211 The term ",~AP-related conditions" as used herein is defined as inclll(ling ~17hPimer's disease (which includes f~mili~ heimpr~s disease), Down's Syndrome, HCHWA-D, and advanced aging of the brain.
The terms "conditioned culture mP~illm" and "culture meAillm~ as 5 used herein refer to the aqueous extracellular fluid which surrounds cells grown in tissue culture (in vitro) and which cont~in~, among other conctituents, proteins and peptides secreted by the cells.
The term "body fluid" as used herein refers to those fluids of a m~mm~ n host which may contain measurable amounts of ,~AP and ,BAP
10 fragments, specifically including blood, cerebrospinal fluid (CSF), urine, and peritoneal fluid. The term "blood" refers to whole blood, as well as blood plasma and serum.
The term "Swedish mutation" refers to a mutation in the human gene encoding APP which results in an inherited, f~mili~l form of ~l~heimer's disease. The mutation occurs at LYS59s-MET596 of the normal APP gene, where a substitution to ASN59s-LEU596 occurs. It has been found that human cell lines transfected with this mutation will overproduce ,~AP, secl~Ling the ,~AP into the conditioned culture mPAillm.
The term "heterocycles conL~ining from 3 to 14 carbon atoms and 1 20 to 3 hetereoatoms sPlectPcl from the group con~i~ting of nitrogen, oxygen and sulfur" refers to saturated and unsaturated heterocyclic groups having the requisite number of carbon atoms and heteroatoms. Suitable heterocyclic groups include, by way of example, furazanyl, furyl, imiti~701idinyl, imi~l~701yl, imidazolinyl, indolyl, isoLhiazolyl, isoxazolyl, 25 morpholinyl (e.g. morpholino), oxazolyl, pipe~zinyl (e.g. l-~ 7h~yl), piperidyl (e.g. l-piperidyl, piperidino), pyranyl, pyrazinyl, pyr~701i~ yl, pyra_olinyl, pyrazolyl, pyridazinyl, pyridyl, pyrimidinyl, pyrrolidinyl (e.g.
l-pyrrolidinyl), pyrrolinyl, pyrrolyl, quinoxalinyl, thi~ 7olyl, thiazolyl, thienyl, thiomorpholinyl (e.g. thiomorpholino), triazolyl, and x~nth~nilyl.
30 These heterocyclic groups can be ~lbslilu~ed or unsubstitut~P~. Where the heterocyclic group is subs~ trcl~ the substih~ent~ are SPl~ctP~d from alkyl of from 1 to 6 carbon atoms, alkoxy of from 1 to 6 carbon atoms, aryl of from 6 to 10 carbon atoms, aryloxy of from 6 to 10 carbon atoms, and halo.
Preferred heterocycles include well known cyclic aromatic groups 5 cc,.,~;.-ing heteroatoms within the cyclic structure. Such groups include, by way of eY~mple, furyl, imi~ olyl, oxazolyl, pyrazolyl, pyridyl, pyrimidinyl, thiazolyl, and triazolyl.
The term "alkyl" refers to straight and branched chain alkyl groups such as methyl, ethyl, n-propyl, iso-propyl, n-butyl, tert-butyl, sec-butyl, 10 iso-butyl, n-pentyl, n-hexyl, 2-methylpentyl, and the like; whereas the term "alkoxy" refers to -0-alkyl substit~lentc.
The term "aryl" re~ers to aromatic substituent~ comprising carbon and hydrogen such as phenyl, naphthyl and the like whereas the term aryloxy refers to -0-aryl substituents where aryl is as defined above.
The term "halo" or "halogen" refers to fluorine, chlorine, bromine and iodine and preferably fluorine and chlorine.
The term "pharm~reutir~lly acceptable salts" refers to the non-toxic alkali metal, ~lk~line earth metal, and ammonium salts commonly used in the pharm~reutir~l industry inrllllling the sodium, potassium9 lithium, 20 c~lçium, m~gn~ci-lm, barium, ammonium, and protamine zinc salts, which are pr~aled by methods well known in the art. The term also in~lucles non-toxic acid addition salts, which are generally prepared by reacting the compounds of this invention with a suitable organic or inorganic acid.
Re~resen~;,l;~le salts include the hydrochloride, hydlobru.l.ide, sulfate, 25 bi~l~lf~t~, acetate, oxalate, valerate, oleate, laurate, borate, ben7o~te~
lactate, phosphate, tosylate, ~itrate, m~lr~tP, rL~ e, succin~tr~ tartrate, and napsylate salts, and the like. The particular salt employed is not critical.
The term "DNA" refers to deoxyribonucleic acid. The term "RNA"
30 refers to ribonucleic acid.

W O 96~9194 PCTrUS96/06211 Naturally occurring amino acid residues in peptides described herein are abbreviated as recommended by the IUPAC-IUB Biochemical Nom~nrl~tl-re Commi~cion as follows: Phenyl~l~nine is Phe or F; Leucine is Leu or L; Isoleucine is Ile or I; Methionine is Met or M; Norleucine is S Nle; Valine is Val or V; Serine is Ser or S; Proline is Pro or P; Threonine is Thr or T; Alanine is Ala or A; Tyrosine is Tyr or Y; ~ictillinP is His or H; Glut~minto is Gln or Q; Asparagine is Asn or N; Lysine is Lys or K;
Aspartic Acid is Asp or D; Glutamic Acid is Glu or E; Cysteine is Cys or C; Tryptophan is Trp or W; Arginine is Arg or R; and Glycine is Gly 10 orG.
Naturally occurring nucleosides in nucleic acids described herein are abbreviated as recommend~d by the IUPAC-IUB Biological Nom~ncl~tllre Commi~sion as follows: Adenosine is A; Gu~no~ine is G; Cytidine is C;
Thymidine is T and Uridine is U. The abbreviation where the nucleotides 15 are either Cytidine or Thymidine (Uridine) is Y; Adenosine or Guanosine is R; Adçno~ine. or Thymidine (Uridine) is W; Adenosine or Cytidine is M;
and Guanosine or Thymidine (Uridine) is K.
The term "Cathepsin Y" as used herein is defined as a polypeptide that is encoded by a gene of the same name. Cathepsin Y is a 20 carboxypeptidase having a molecular weight of appro~im~tely 31 kD.
C~theFsin Y is able to cleave carboxy-terminal amino acids, with particular activity against aliphatic carboxy-terminal amino acids. Preferably, C~theF~in Y is a polypeptide having a qualitative biological activity in common with the Cathepsin Y of FIG. 4 and which is greater than about 25 70% homologous, more preferably greater than 85% homologous and most preferably greater than 90% homologous with the Cathepsin Y sequence of FIG. 4. It is contempiated that the ~th~p~in Y of the present invention may be subs~ t;~lly homologous to the sequence of Fig. 4., typically being greater than 90% homologous, preferably greater than 95% homologous 30 and som~time greater than 99% homologous provided that the Cathepsin Y
retains at least a portion of biological activity of the Cathepsin Y of Fig. 4.

W O 96/39~94 PCTnUS96~621I

Included within the scope of term "Cathepsin Y" as that term is used herein are proteins having the amino acid sequence as set forth in FIG. 4, deglycosylated or unglycosylated derivatives of the sequence in FIG. 4, and homologous genP~tP~ variants and derivatives of ~thPpsin Y, provided S that the morlific~tions do not destroy the biological activity in common with the Cathepsin Y of FIG. 4.
"Homologous" is defined as the percc--Ldge of residues in the c~n~ te sequence that are illentie~l with the residues in the disclosed sequence after ~ ning the sequences and introducing gaps, if necesc~ry, to 10 achieve the maximum percent homology. A nucleic acid sequence is subsf~nti~lly homologous to the nucleic acid sequence of the disclosed sequence, where it is greater than 80% homologous, preferably greater than 90% homologous and most preferably greater than 95% homologous.
"Complement~ry" is defined as the ability of a nucleic acid sequence 15 to hybridize to a disclosed nucleic acid sequence. A nucleic acid sequence is "subss~nti~lly complementary" to the ~ lose~l nucleic acid sequence if the sequence is able to hybridize to greater than 80% of the reci(llles, ~ligning the sequences and introducing gaps if n~ce~-y to achieve maximum complemPnt~nty. Preferably, a subst~nti~lly co,l,plcmentary sequence is 20 greater than 90%, most preferably it is greater than 95% complement~ry.
C~thPp~in Y biological activity is defined as the sequential removal of the carboxy-tel-llinal amino acids from a peptide without endopeptidase activity, one amino acid at a time.
The ~m "~'arlS.f~.'~iO~n" refers t.c introduciP.g DNA ir.to ~.
25 organism or host cell so that the DNA is replicable, either as an Pytr~hromosomal elPment or by chromosomal integration.
The term "transfection" refers to the introduction of DNA into a host cell. It is contemplated that coding sequences may be c~lcssed in r~l~i cells. Numerous mPtho-is of transfection are known to the 30 o~lina liy skilled artisan, for example CaPO4 and elecL-u~oldtion.

WO 96/39194 PCT~US96/06211 Amyloid Production Suppressors This invention is based, in part, on the discovery of compounds that have been found to inhibit ~-amyloid (,BAP) secretion in cells. This invention provides methods for inhibiting ~AP secretion in cells, inhibiting S the deposition of plaque and treating ~l7h~imer~s rii~e~ce.
In one embodiment, this invention provides a method of inhibiting ~-amyloid production in cells producing ~AP, comprising ~iminictering to such cells an inhibitory amount of a compound of formula I:

Rl (X) n,_Y_NR1H--CNR' 1H--R4 or pharm~e~ltit~lly acceptable salts thereof.
In formula I, R is hydrogen, alkyl of from 1 to 6 carbon atoms or can be joined with R2 to form a ring structure of from 4 to 10 carbon atoms and R' is hydrogen, alkyl of from 1 to 6 carbon atoms or can be joined with R3 to form a ring structure of from 4 to 10 carbon atoms. Preferably, R and R' in formula I are hydrogen.
R' can be alkyl of from 1 to 4 carbon atoms substituted with from 1 to S substit~ ntc s~lect~ from the group concicting of aryl of from 6 to 10 carbon atoms, aryl of from 6 to 10 carbon atoms substituted with 1 to 3 substituents sele~ted from the group consisting of alkyl of from 1 to 6 carbon atoms, aryl of from 6 to 10 carbon atoms, alkoxy of from 1 to 6 carbon atoms, aryloxy of from 6 to 10 carbon atoms, hydroxy, cyano, halo and amino, cycloalkyl of from 3 to 8 carbon atoms and heterocycles of from 3 to 14 carbon atoms having from 1 to 3 heteroatoms selected from the group concicting of nil.ugen, oxygen and sulfur wherein said substituted alkyl group is optionally further substituted with from 1 to 2 hydroxyl groups, aL~enyl of from 2 to 4 carbon atoms substituted with from 1 to 4 substituentc st-l~octed from the group concisting of aryl of from 6 to 10 W O 96/39~94 PCTAJS96/06211 carbon atoms, aryl of from 6 to 10 carbon atoms substituted with 1 to 3 snhstit~lents sPlpct~rl from the group conci~ting of alkyl of from 1 to 6 carbon atoms, aryl of from 6 to 10 carbon atoms, alkoxy of from 1 to 6 carbon atoms, aryloxy of from 6 to 10 carbon atoms, hydroxy, cyano, halo 5 and amino, cycloalkyl of from 3 to 8 carbon atoms and heterocycles of from 3 to 14 carbon atoms having from 1 to 3 h~Lel~aton,s selected from the group con~i~tin~ of nitrogen, oxygen and sulfur, aryl of from 6 to 10 carbon atoms, aryl of from 6 to 10 carbon atoms substituted with 1 to 3 10 substituents selected from the group consisting of alkyl of from 1 to 6 carbon atoms, aryl of from 6 to 10 carbon atoms, alkoxy of from 1 to 6 carbon atoms, aryloxy of from 6 to 10 carbon atoms, hydroxy, cyano, halo and amino, fluorenyl, and heterocycles of from 3 to 14 carbon atoms having from 1 to 3 hele~oal~.,.s sele~t~d from the group conci~tin~ of ni~n~ge.~, oxygen and sulfur.
Preferred values ~or Rl include benzyl, trityl, diphenylmethyl, 4-phenylbutyl, 2-phenylethyl, naphthyl, pyridyl, fluorenyl"~ntl~ ilyl, and 20 the like.
R2 and R3 are independently side chains of a D- or L- amino acid having at least 2 carbon atoms with the proviso that R2 and R3 are not proline. Such side chains refer to the R8 substituent found on naturally occurring and synthetic amino acids of the formula H2NCHR8COOH. Side 25 chains of n~t~ lly occ~-rring amino acids include, by way of example only, those where R8 is the L-isomer of (CH3)2C~I- (valine), (CH3)2CHCH2-(leucine), CH3CH2CH(CH3)- (isoleucine), ~CH2- (phenyl~l~nine), (3-indolyl)-CH2- (tryptophan), CH3SCH2CH2- (methionine), CH3CH(OH)-e), p-HO-~-CH2- (tyrosine), H2NC(O)CH2- (~p~ inP), 30 H2NC(O)CH2CH2- (~ t~mine), HOC(O)CH2- (aspartic acid), HOC(O)CH2CH2- (~ t~mic acid), H2NCH2CH2CH2CH2- (lysine), H2NC(NH)NHCH2CH2CH2- (arginine), 4-imidazolyl-CH2- (hi.~ti~linP) and the like.
Side chains of synthetic amino acids include the D-isomer of the above noted naturally occurring amino acids as well as those where R8 is 5 selected from the group consi~ting of alkyl of from 2 to 6 carbon atoms (where the alkyl group does not occur in naturally occurring amino acids), cycloalkyl of from 3 to 8 carbon atoms, and alkyl of from 1 to 6 carbon atoms substituted with from 1 to 2 substit~lent~ selected from the group conci~ting of aryl of from 6 to 10 carbon atoms, aryl of from 6 to 10 carbon atoms substituted with from 1 to 3 substituents selectt-d from the group concicting of alkyl of from 1 to 6 carbon atoms, alkoxy of from 1 to 6 carbon atoms, aryl of from 6 to 10 carbon atoms, and aryloxy of from 6 to 10 carbon atoms, and heteroaryl of from 3 to 14 carbon atoms having from 1 to 3 heteroatoms sele~t~i from the group consisting of nitrogen, oxygen and sulfur (where the substituted alkyl group does not occur in n~tnr~lly occ~ ng amino acids).
Preferred amino acid side chains include the D- and L-isomers of 20 valine, leucine, phenyl~l~nine, tryptophan and isoleucine.
R4 can be -C(O)CH=N=N, -CH20H, -C=NOH, and -C(o)R5 where R5 is hydrogen, alkyl of from 1 to 6 carbon atoms, haloalkyl of from 1 to 6 carbon atoms and 1 to 2 halo groups, alkoxy of from 1 to 6 carbon atoms, -NR6R7 where R6 and R7 are indepPn~lpntly select~l from the group 25 C~ n~i~tin~ of hydrogen, alkyl of from 1 to 6 carbon atoms and aryl of from 6 to 10 carbon atoms, and -N(CH3)0CH3. Preferably, R4 is -CH=N=N or -C(O)H.
X can be -O-, -NR9- or -S- where R9 is selected from the group conci~tin~ of hydrogen, alkyl of from 1 to 6 carbon atoms and aryl of from 30 6 to 10 carbon atoms. Preferably X is -O-.
Y can be -C(O)- or -C(S)- and is pfere~ably -C(O)-.

W O 96J39194 PCT~US96/06211 m is an integer equal to zero or one and n is an integer equal to zero to two. Preferably, n is an integer equal to zero or one.

III. Synthesis of ~-Amyloid S~ 501~
S Generally, the compounds of the invention are synthesi7P~I using standard techniques and reagents. The linkages between the various groups in these co1-1pounds comprise, for example, a carbon atom linked to a nitrogen atom of an amide, a l-hio~mi~e, a carb~m~tP, a thioca.l,a1"ate, a urea, a thiourea, etc. The methods and reagents for forming such bonds lO are well known and readily available. See, e.g., March, Advanced Organic Chemistry, 4th Ed. (Wiley 1992), Larock, Comprehensive Organic Transformations (VCH 1989); and Furniss, et al. and Furniss, Vogel's Textbook of-Practical Or~anic Chemistry 5th ed. (Longman 1989), each of which is incorporated herein by reference. In addition, any functional 15 groups present may require prote~;Lion and d~1-~tecLion at dir~.ent points in the synthesis of the compounds of the invention. Such techniques are well known (see, e.g., Green and Wuts, Protective Groups in Organic Chemistry (Wiley 1992), also incorporated herein by reference).
The synthesis of the compounds of this invention can start with, for 20 .oy~mple, an amino acid (in the case where n is 0), a dipeptide (in the case where n is 1) or a tripeptide (in the case where n is 2).
Reaction Scheme l below illustrates one eY~mple of the synthesis of compounds wherein n is 1, Y = -C(0)- and R4 is -C(O)H which employs as starting m~t~n~l a dipeptide structure. It is understood, however, that, 25 for con.~ounds where n is 0 or 2, similar syntheses can be used with the - exception that either an amino acid is employed as the starting m~t~ l (for n equal to 0) or a tripeptide is employed for n equal to 2.
As shown in Reaction Scheme l, dipeptide 1 is reacted with at least - a stoi~iliometric amount of Rl(X)mC(O)Z, where Rl, X and m are defined 30 as above and Z is suitable leaving group such as a halo group under con~litions suitable to form dipeptide 2 terminally N-capped with the W O 96/39194 PCTrUS96/06211 Rl(X)mC(O)- substituent. Alternatively, R'(X)mC(S)Z substituents can be used to prepare compounds where Y is -C(S)-.
Depending upon the reaction conditions employed, it may be nece ~l y or desirable to protect the carboxyl group of dipeptide 1 with a 5 conventional removable blocking group such as conversion to as an alkyl or aryl ester. Likewise, any reactive substituen~c found on the amino acid side chains R2 and R3 of dipeptide 1 will require blocking and subsequent deblocking with a conventional removable blocking group.
The reaction is conducted in the presence of a suitable inert diluent 10 typically in the presence of a base to scavenge any acid generated during the reaction, particularly if Z is halo. Suitable inert diluents include, by way of example, methylene chloride, chloroform, toluene, pyridine, etc.
Suitable bases include triethylamine, diethylisopropylamine, pyridine, and the like. The reaction is typically cond~lct~ci at from about 0~C to about 25~C and is typically complete in from about 1 to about 12 hours. The resultin~ dipeptide 2 can be recovered by conventional means such as till~tinn~ cl~ lla~ography, filtration, etc. or alternatively is converted to aldehyde compound 3 without recovery and/or purification.
Dipeptide 2 is then reduced to provide the desired aldehyde 3 via conventional methods such as those described in March or Larock, supra.
Such m~thorl~ include, for example, direct reduction of the carboxyl group of dipeptide 2 to alcohol 4, by, e.g., reaction of the acid with di-(iso-butyl)~luminumhydride (DIBALH) (see, e.g., J. Gen. Chem. USSR
34:1021(1964)),ordi-(N-methylpi~ yl)aluminumhydride (see,e.g., J. Org. Chem. 49:2279 (1984)) followed by partial reoxidation to the aldehyde. See, e.g., Luly, et al., Journal of Organic Chemistry, S2(8): 1487 et seq. (1987).
Alh."ali~rely, the aldehyde may be formed via the acid chloride using, e.g., thionyl chloride, followed by reduction using, for ex~mple, hydr.~n and a p~ lium catalyst, tri-(t-butoxy)lithium aluminum hydride, sodium borohydride (alone or with pyridine or ç~millm chloride).

W096)391194 PCT~/lJS96fO6ZI~

Preferably, however, the carboxyl group of dipeptide 2 is first converted to the co~ onding N,O-dimethylhydroxamide 5 which is then reduced by, for example, lithium aluminum hydride to provide for aldehyde 3. The N,O-dimethylhydroY~mit~e 5 is formed, for example, by S reaction of dipeptide 2 with at least a stoichiometric amount of ben;~otliazol-l-yloxy-tris(dimethylamino)phosphonium heY~fl~1orophosphate (BOP) and 4-methyl morpholine in an inert diluent at a le,l.~eldl.lre of from about 10~C to about 40~C for a period sl~fficiçnt to form the activated ester. Suitable inert diluents include, by way of example, N,N-dimethyl-10 form~mi~e, pyridine, etc. The product is preferably not recovered butrather the reaction solution is used to convert the activated ester to the N,O-dimethylhydroxylamide 5.
The activated ester is converted tO the N,O-dimethylhydroxylamide 5 by reaction with at least a stoichiometric amount of N,O-15 dimethylhydroxylamine hydrochloride at a ~e...pt;ldtllre of from about 10~Cto about 40~C for a period sllfflcient to form the desired N,O-dimethylhydroxylamide 5. The resl-lting product can be recovered by conventional methods such as chlor-atogld~hy, ~ till~tic)n~ filtration, etc.
or, al~l,~ ely, used directly in the next step of the synthesis which 20 converts the N,O-dimethylhydroxylamide 5 to aldehyde 3 by conventional reduction using a suitable re~u~ing agent such as lithium aluminum hydride.

CA 02221684 1997-ll-20 ReAction 1 ~ CH N ~ ~ C

Rl(x)mc(o)z o R O R3 Il l 11 1 R (X)mC N ~ C ~ C ~ N ~ CH ", OH

R R O

2 . ~

O R ~ R3 CH3 ll l ll ( ) m ~ CH~ C ~ N ~ CH ~ C~NOCH3 ~ 5 R (X)mC~ N ~ fH' C ~ N ~ ~ CH'' 4 ~

Il l 11 1 R (X)mC N ~ CH~ C ~ N ~ CH ~ c,H

In the case of amino acids, the conversion of commercially available N-pçolecled amino acids (n = O) to the col~es~nding N-plotec~d N',O-dimethylhydroxylamide and subsequent reduction to aldehyde 3 follows the procedure set forth above. The first step in this process is illustrated in FIG. 1 and involves conversion of N~ LecL~d amino acid 6 to the col,e.,~onding N~ tected N',O-dimethylhydroxylamide 7. Preferably, the S N-plotecLillg group on such amino acids is of the formula R~(X)mC(O)- such that, upon reduction, the r~snltin~ compounds are of formula I above and, in the case of FIG. 1 is illustrated as ~CH2OC(O)-. Alternatively, however, the N-lJr~te~ g group can be removed by conventional methods and the res-llting free amine N',O-dimethylhydroxylamide 8 can be reacted with Rl(X)mC(O)Z and subsequently reduced to provide for compounds of formula I above (not shown).
The free amine N',O-dimethylhydroxylamide 8 obtained by deprotecting the N-plute;led N',O-dimethylhydroxyl~mi~ies can also be used to form compounds of formula I where n = 1 as also illustrated in FIG. 1. Spe~ific~lly, in this figure, the free amine 8 is coupled to the free acid of amino acid 9 having a R'(X)"~C(O)- [e.g., ~CH2OC(O)-] group ~tt~l'.h~?d to form dimer 10 which, upon subsequent conventional reduction with, for ~Y~mpl~, lithium aluminum hydride (LAH) forms aldehyde 11.
Conversion of the aldehydes 3 and 11 to the col~es~ol-ding oximes or the coll~s~onding diazoketones can be accomplished using chemi~try known per se in the art. For example, oxime formation is accomplished via reaction of aldehydes 3 and 11 with hydroxylamine whereas diazoketones were ~ aled using the procedure reported by Shaw (Green, George D.J., Shaw, Elliot (1981) J. Biol. Chem. 256, 1923-1928.
Compounds 2 and 6 can be readily converted via art recQgni7~i ~n~tho~l~ to provide for R5 = alkoxy of from 1 to 6 carbon atoms and R5 =
NR6R~ where R6 and R7 are independen~ly hydrogen, alkyl of from 1 to 6 carbon atoms or aryl of from 6 to 10 carbon atoms. Likewise, compounds 2 and 6 can be readily converted to ketones (R5 = alkyl of from 1 to 6 carbon atoms) via methods known per se in the art.
-CA 0222l684 l997-ll-20 The starting materials employed in Reaction Scheme 1 are known in the art. For example, dipeptides 1 may be purchased commercially (e.g., from R~rhem Bioscience, Inc., Phil~-lçlphia, PA) or synthtoci7Yl from standard procedures, such as those described in Syn~hetic Peptides: A
5 User's Guide, Grant, Ed. (Freeman, 1992), Solid Phc.~se Peptide Synthesis:
A Practical Approach, Atherton, et al., Eds. (Oxford 1989) or Synthesis of Opt.cally Active ~-Amino Acids, Williams (Pergammon 1989). Generally, dipeptides are synthesi7ed from amino acids which themselves are commercially available (e.g., from Bachem or Aldrich, Milwaukee, WI) 10 by, for example, the methods described above or by using known methods such as the Strecker method (see, e.g., March, or Williams, supra).
Typically, the coupling of the amino acids to form dipeptide 1 requires the blocking of the ~x-amino moiety of the N-terminal amino acid, and any other potentially reactive groups present on the side chain, from 15 reaction with the activated carboxyl group of the C-terminal amino acid.
Conventional N-terminal amino pl.tectillg groups include, by way of example, t-butyloxycarbonyl (BOC) or benzyloxycarbonyl (Cbz).
Similarly, reagents of the formula R'(X)mC(O)Z are also known per se in the art and some of these materials are also commercially available.
20 For example, benzoyl chloride (R' = -~, m= 0, Y = -C(O)- and Z--Cl), phenyl chloroformate (Rl = ~, X = O, m = 1, Y = -C(O)- and Z = Cl), benzyl chlolofoill,a~e (R' = ~, X = O, m = 1, Y = -C(O)- and Z = Cl), diphenyl acetyl chlori~le (Rl = (O2CH-, m = 0, Y = -C(O)- and Z = Cl) are all commercially available reagents as are phenyl chlorothionoformate 25 (Rl = ~, m = 1, X = O, Y = -C(S)- and Z = Cl) and phenyl chlorodi-thioformate (Rl = ~, m = 1, X = S, Y = -C(S)- and Z = Cl).

IV. Pharmaceutical Formulations When employed as pharm~reutic~ the compounds of formula I
30 above are usually ~lmini~trred in the forrn of pharm~reutir~l col"positions.
These co"lpounds can be ~-lmini~tered by a variety of routes including oral, CA 02221684 1997-ll-20 rectal, tr~ncdprmal7 subcut~nçous, intravenous, intramuscular, and intranasal. These compounds are effective as both injectable and oral compositions. Such compositions are prepared in a manner well known in the pharm~eutic~l art and comprise at least one active compound.
S This invention also includes pharm~euf~ co,n~o~itions which contain, as the active ingr_dient, one or more of the compounds of formula I above ~csoci~ted with pharm~ceutic~lly acceptable carriers. In making the compositions of this invention, the active ingredient is usually mixed with an excipient, diluted by an excipient or Pnclosed within such a carrier which can be in the form of a capsule, sachet, paper or other container.
When the excipient serves as a diluent, it can be a solid, semi-solid, or liquid m~teri~l, which acts as a vehicle, carrier or medium for the active ingredient. Thus, the compositions can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), ointments co.~ in;.-g, for eY~mple, up to 10% by weight of the active compound, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders.
In plcp~ing a formulation, it may be nPcPsC~ry to mill the active compound to provide the a~,ropliate particle size prior to combining with the other ingrecli~ontc. If the active compound is substantially insoluble, it oldi-lalily is milled to a particle size of less than 200 mesh. If the active compound is subst~nti~1ly water soluble, the particle size is normally adjusted by milling to provide a subst~nti~lly uniform distribution in the formulation, e.g. about 40 mesh.
Some examples of suitable excipients include lactose, dextrose, sucrose, sorbitol, ...~mitol, starches, gum acacia, ç~lçium phosphate, in~t~s, ~g~ nth, gelatin, ~ ~1cium silicate, microcrystalline cç11ll1Ose, polyvinylpyrrolidone, cellulose, water, syrup, and methyl cellulose. The 30 formulations can ~ itio~11y inclucle: lubnc~ting agents such as talc, m~gn~ ,L~dte, and min~r~l oil; wetting agents; emulsifying and W O 96/39194 PCTrUS96/06211 s~spen~ing agents; preserving agents such as methyl- and propylhydroxy-bP-n7o~t~s; sweetening agents; and flavoring agents. The compositions of the invention can be formulated so as to provide quick, s--~t~inçd or delayed release of the active ingredient after ~lmini~tration to the patient S by employing procedures known in the art.
The compositions are preferably formulated in a unit dosage form, each dosage containing from about S to about 100 mg, more usually about 10 to about 30 mg, of the active ingredient. The term "unit dosage forms"
refers to physically discrete units suitable as unitary dosages for human 10 subjects and other m~mm~l~, each unit cont~ining a predetermined quantity of active material calculated to produce the desired therapeutic effect, in ~o-i~tinn with a suitable pharm~elltic~l excipient.
The active compound is effective over a wide dosage range and is generally ~imini~t~red in a pharm~-~e~-ti~lly effective amount. It, will be 15 understood, however, that the amount of the compound actually ~rlmini~tered will be determined by a physician, in the light of the relevant circum~t~nces, inclurling the condition to be treated, the chosen route of ~lmini~tration~ the actual compound ~rlnnini~ttored7 the age, weight, and response of the individual patient, the severity of the patient's symptoms, 20 and the like.
For preparing solid compositions such as tablets, the principal active ingredient is mixed with a pharm~eutic~l excipient to form a solid u,.l.~llation composition containing a homogeneous mixture of a compound of the present invention. When referring to these 25 ~lt;ru~...ulation co...~o~ilions as homogeneous, it is meant that the active ingredient is dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective unit dosage forms such as tablets, pills and capsules. This solid ~lcÇol-~ulation is then subdivided into unit dosage forms of the type described above cont~ining 30 from, for example, 0.1 to about S00 mg of the active ingredient of the present invention.

w ~ 96/39194 PCT~US96/06211 The tablets or pills of the present invention may be coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action. For example, the tablet or pill can comprise an inner dosage and an outer dosage component, the latter being in the form of an S envelope over the former. The two col~lponents can se~ t~d by enteric layer which serves to resist ~ integration in the stomach and permit the inner co---ponent to pass intact into the duodenum or to be delayed in release. A variety of materials can be used for such enteric layers or co~tings~ such materials including a number of polymeric acids and ~ ulc;s of polymeric acids with such materials as shellac, cetyl alcohol, and cellulose acetate.
The liquid forms in which the novel compositions of the present invention may be incorporated for ~lmini~tration orally or by injection include aqueous solutions suitably flavored syrups, aqueous or oil s-lspen~ions, and flavored emulsions with edible oils such as cottonseed oil, sesame oil, coconut oil, or peanut oil, as well as elixirs and similar pharm~ceutit~l vehicles.
Compositions for inh~l~ti~n or in~ffl~tiQn include solutions and sl-spencions in pharm~re~tic~lly acceptable, aqueous or organic solvents, or mixtures thereof, and powders. The liquid or solid compositions may contain suitable pharm~e-ltic~lly acceptable excipients as described supra.
Preferably the co,-,posilions are ~(lmini~t~red by the oral or nasal re~ildlc,ly route for local or systemic effect. Compositions in preferably pharm~euti~lly acceptable solvents may be nebulized by use of inert gases. Nebulized solutions may be breathed directly from the nebulizing device or the nebulizing device may be ~tt~ PA to a face masks tent, or inL~ ~",illent positive pressure breathing m~rhine. Solution, suspen~ion, or puwde~ compositions may be ~imini~tPred, preferably orally or nasally, - from devices which deliver the formulation in an app,ol"iate manner.
The following formulation ex~mples illustr~te the pharm~e~ti~l col..po~;l;ons of the present invention.

W O 96/39194 PCT~US96/06211 Formulation Example 1 Hard gelatin capsules colltainillg the following ingredients may be prepared as follows:
Quantity In~redient (m~/capsule) Active Ingredient 3 o . o Starch 305 0 M~gn~ium stearate 5 . 0 The above ingredients are mixed and filled into hard gelatin capsules in 340 mg quantities.

Formulation Example 2 A tablet form may be pr~a c;d using the ingredients below:
Quantity In~redient (m~/tablet) Active Ingredient 2 5 . o Cellulose, microcrystalline 200.0 Colloidal silicon dioxidelo. o Stearic acid 5 . o The co-llpollents are blended and co",p.~ ssed to form tablets, each weighing 240 mg.

Formulation Example 3 A dry powder inhaler formulation may be prepared cont~ining the following col"pol~ents:
Tn~redient Wei~ht %
Active Ingredient 5 T ~rtose 9 5 The active mixture is mixed with the lactose and the mixture is added to a dry powder inh~ling appliance.

Formulation Example 4 Tablets, each cont~ining 30 mg of active ingredient, may be p~ d as follows:
Quantity Ingredient (mg/tablet) Active Ingredient 30.0 mg Starch 45.0 mg Microcrystalline cPll--lose 35.0 mg Polyvinylpyrrolidone (as 109~o solution in water)4.0 mg Sodium carboxymethyl starch 4.5 mg M~nPsillm stearate 0.5 mg Talc 1.0 mg Total 120 mg The active ingredient, starch and cellulose are pass_d through a No.
20 mesh U.S. sieve and mixed thoroughly. The solution of polyvinyl-pyrrolidone is mixed with the result~nt powders, which are then passed through a 16 mesh U.S. sieve. The granules so produced are dried at 50~
to 60~C and passed through a 16 mesh U.S. sieve. The sodium carboxymethyl starch, m~gnP~ium stearate, and talc, previously passed through a No. 30 mesh U.S. sieve, are then added to the granules which, after mixing, are co~"pl~ssed on a tablet m~hine to yield tablets each weighing 150 mg.

Formulation Example 5 Capsules, each cont~ining 40 mg of mP~iic~ment may be made as follows:
Quantity ~ Tn~redient (m~/capsule) Active Ingredient4 o . o mg Starch lo9. 0 mg M~ .... s~ t~ l . o mg W O 96/39194 PCT~US96/06211 Total 150. o mg The active ingredient, starch and m~gnçcillm stearate are blended, passed through a No. 20 mesh U.S. sieve, and filled into hard gelatin 5 c~ps~ s in 150 mg quantities.

Formulation Example 6 Suppositolies, each cont~ining 25 mg of active ingredient may be 10 made as follows:

Ingredient Amount Active Ingredient 25 mg Saturated fatty acid glycerides to 2, ooO mg The active ingredient is passed through a No. 60 mesh U.S. sieve and suspended in the saturated fatty acid glycerides previously melted using 20 the minimum heat n~e~,y. The Illi~UlC; iS then poured into a suppository mold of nominal 2.0 g capacity and allowed to cool.

Formulation Example 7 S~lspen~ions, each cont~ining 50 mg of meAi~m~ont per 5.0 ml dose may be made as follows:
Tn~redient Amount Active Ingredient 50. 0 mg Xanthan gum 4 . 0 mg Sodium carboxymethyl cellulose (l l %) Microcrystalline cellulose (89%)so. o mg Sucrose 1. 7s g Sodium b~-n70~t~ 10 . o mg Flavor and Color q.v.
Purified water to 5. o ml W O 96J3919~ PCT~US96/06211 The medic~m~nt sucrose and xanthan gum are blended, passed through a No. l0 mesh U.S. sieve, and then mixed with a previously made solution of the microcrystalline cellulose and sodium carboxymethyl cellulose in water. The sodium ben7o~tç, flavor, and color are dilutcd with 5 some of the water and added with stirring. Sufficient water is then added to produce the required volume.

Formulation Example 8 Capsules cont~ining l~ mg of me~iic~m~nt may be made as follows:
Quantity Ingredient (mg/capsule) Active Ingredient 15 . o mg Microcrystalline Cellulose 135. 0 mg Starch 4 07 . 0 mg ~gnç~illm stearate 3 . o m~
Total 4 2 5 . o mg The active ingredient, c~ lcse, starch, and In~gn~sillm stearate are blended, passed through a No. 20 mesh U.S. sieve, and filled into hard gelatin capsules in 560 mg q~l~ntiti~S.

Formulation Example 9 An intravenous formulation may be ~lc~ d as follows:
Tn.~redient Ouantity Active Ingredient 2 5 o . o mg Isotonic saline 1000 ml Formulation Example l0 A topical formulation may be prepared as follows:

W O 96/39194 PCTrUS96/06211 In~redient Quantity Active Ingredient l-lo g Emulsifying Wax 3 o g Liquid Paraffin 20 g White Soft Paraffinto 100 g The white soft paraffin is heated until molten. The liquid paraffin 10 and emulsifying wax are incorporated and stirred until dissolved. The active ingredient is added and stirring is continued until dispersed. The Lul~ is then cooled until solid.
Another prcr~,led formulation employed in the methods of the present invention employs transdermal delivery devices ("patches"). Such 15 transdermal patches may be used to provide continuous or discontinuous infusion of the compounds of the present invention in controlled amounts.
The construction and use of transdermal patches for the delivery of pharrn~eutical agents is well known in the art. See, e.g., U.S. Patent 5,023,252, issued June 11, 1991, herein incol~ol~led by reference in its 20 entirety. Such patches may be constructed for continuous, pulsatile, or on dern~nd delivery of pharm~reutical agents.
Frequently, it will be desirable or necess~ry to introduce the pharm~ce~lti-~l composition to the brain, either directly or indirectly.
Direct techniques usually involve pl~cemPnt of a drug delivery catheter into 25 the host's ventricular system to bypass the blood-brain barrier. One such implantable delivery system used for the transport of biological factors to spe~ific anatomical regions of the body is described in U.S. Patent 5,011,472 which is herein incorporated by reference in its entirety.
Indirect techniques, which are generally plerelled, usually involve 30 form~ tin~ the compositions to provide for drug l~tPnti~tion by the conversion of hydrophilic drugs into lipid-soluble drugs. T ~tPnti~tion is ~en~r~lly achieved through blocking of the hydroxy, carbonyl, sulfate, and primary amine groups present on the drug to render the drug more lipid soluble and ~mPn~hle to transportation across the blood-brain barrier.
Alternatively, the delivery of hydrophilic drugs may be çnh~nce~l by intra-arterial infusion of hypertonic solutions which can tr~n~i-ont1y open the blood-brain barrier.

. Cathepsin Y Compositions Cathepsin Y is a novel carboxypeptidase having a molecular weight 10 of a~lo~cimately 31 kD and the amino acid sequence set forth in SEQ ID
No. 3. Cathepsin Y is involved in the release of ~BAP from ,~AP-producing cells. The ~AP production inhibition provided by the compounds of formula I described above a~peal~ to at least partially occur through inhibition of Cathepsin Y. Cathepsin Y is able to cleave a wide variety of 15 carboxy-terminal amino acids, with particular activity against aliphatic carboxy-Lell.linal amino acids. The ability of C~thPpsin Y to cleave the t~l,linal amino acid is strongly affected by the nature of the amino acid residue located two positions away from the terminal amino acid being cleaved. Such specificity is ch~raçtPristic of the papain super family of 20 cysteine p.uteases.
Cathepsin Y according to the present invention can be obtained from both natural and synthetic sources. Natural ~thPpsin Y may be i~ol~t~i and purified from a variety of n ~mm~ n cellular sources, inclu-ling human 293 cells, human HS683 cells, human brain etc. Cells from these 25 sources may be collected and disrupted to produce a lysate. ~Plllll~r and other debris from the reslllting lysate may be sel)~dtt d, for example, by centrifugation, and the reslllting s~ell~a~nt subjected to a series of conventional pllrific~tion steps. Specific methods for isolating and at least - partially l~u~irying ~thepsin Y from natural sources are set forth in detail 30 in the FYrerimPnt~l section hereinafter. C~thepsin Y compositions of the present invention will be at least partially purified, typically being at least 10% by weight (w/w) pure and being free from cont~min~nts and substances which would interfere with the enzymatic activity. Usually the C~thPpcin Y coln~o~ilions will be at least 25% w/w pure, more usually being at least 50% w/w pure, and preferably being at least 75% w/w pure, 5 or higher. In many cases it will be desirable to obtain subst~nti~lly pure (homogeneous) colllpo~ilions of the C~thçpcin Y of the present invention, typically being greater than 90% w/w pure, preferably being greater than 95% w/w pure and sometimes being 99% w/w pure or higher.
Compositions having such high purity can be obtained using conventional 10 protein purification techniques in conjunction with assays for the desired Cathepsin Y activity, as described in the Experimental section hereinafter.
Synthetic preparation of the Cathepsin Y colllposi~ions may be based on either the cDNA sequence (SEQ.ID No. 2) or the amino acid sequence (SEQ.ID No. 3) of the native Cathep~in Y. C~thepcin Y from other 15 m~mm~lc, as well as allelic forms of Cathepsin Y, may be idçntified using degener~t~ oligonucleotide probes to screen suitable human and non-human libraries. Suitable libraries are available from a number of sources. cDNA
libraries may be screened by a variety of conventional techniques to identify cDNAs which encode Cathepsin Y of the present invention. Such 20 techniques include direct hybri~li7~tic-n, polymerase chain reaction (PCR)-amplified hybri~li7~tion~ the use of anti-c~th~qpcin Y antibodies, and the like. The id.ontific~tion of other C~thçpcin Y cDNA sequences can be confirmed by introducing the identified DNA inserts into an a~lupliate pl~cmi~ vector for ~,.p-ession in an a~,~,iate host, with the rçslllting 25 recombinant c;~ession vector being mapped by restriction enzyme cleavage and Southern blotting. Internally concict~nt clones may then be sequ~n~ed, with an internally concict~nt sequence being confirmed for Cathepsin Y.
Purified C~thepcin Y co~ o~ilions of the present invention may be 30 n~tllr~l, i.e., including the entire Cathepsin Y enzyme or fr~gmPntc thereof icol~tf~A from the natural source, as described above, or may be synthetic, W O 96/39194 PCT~US96/06Zll ~35 i.e., including the entire protein or fragment or analog thereof, prepared by the techniques described below. In the case of both the natural and synthetic Cathepsin Y, the fr~mçntc and analogs will preferably retain at least a portion of the native biological activity, i.e., usually ret~ining at 5 least the native proteolytic activity.
Synthetic polypeptides r~lçsçnting intact Cathepsin Y or biologically active fr~mentc or analogs thereof may be ~ cd by either of two general approaches. First, polypeptides may be syntheci7~d using conventional solid-phase methods employing automated, commercial 10 systems. The second and generally preferred method for syntheci7in~
Cathepsin Y polypeptides according to the present invention involves the ression in cultured cells of recombinant DNA molecules encoding for the cAplession of all or a portion of the Cathepsin Y protein. The recombinant DNA molecule may incoIporate either a natural or synthetic 15 gene, with natural genes and cDNA being obtainable as described above.
Synthetic polynucleotides may be prepared using solid phase techniques and auLol,lated commercial synthPci7Prs. Double-stranded fragments may then be obtained either by syntheci7ing the complement~ry strand and ~nne~lin~
the strands together under a~l,r~liate conditions, or by adding the 20 complern~ont~ry strand using DNA polymerase with an a~r~liate primer sequence.
Natural or synthetic DNA fr~gmentc encoding the desired Cathepsin Y protein, fr~m~nt, or analog thereof will be incorporated in the DNA
construct capable of introduction to and eApression in an in vitro cell 25 culture. Usually, the DNA constructs will be suitable for replication in a llni~ r host, such as yeast or bart~ri~ Alternatively, the DNA
constructs may be suitable for introduction into and integr~tion within ,,,~,,,,,,~li~n cells, preferably human cells, by a variety of now well known techniques. The eA~lession of the C~thepsin Y protein from such 30 constructs will be pc~rul~-ed under con~litions wl-~.ein the Cathepsin Y is ~A~r~ss~d It is understood that such conditiûns will depend on the vector W O 96/39194 PCT~US96/06211 and the host cell used and can be determined by a person skilled in the art in light of the circumstances.
The nucleic acid may be directly labelled with any detectable label known the art, includin~ radioactive nuclides such as 32p, 3H and 24S, 5 fluol~,scent ,I-alkt;l~ such as fluorescein, Texas Red, AMCA blue, lucifer yellow, rhodamine and the like or any cyanin dye which is cletect~hle with visible light. The nucleic acid may be directly labelled using methods such as PCR, random priming, end labelling, nick translation and the like.
Alternatively, nucleic acids may be indirectly labelled by incorporating a 10 nucleotide covalently linked to a hapten or other molecule such as biotin or digoxigenin (Boehringer l~nnhPim, rn~ n~r~olis, IN) and l~elrol,lling a sandwich hybridization with a labelled antibody or other molecule directed to that hapten. For example, where biotin is incorporated into the nucleic acid avidin conjugated so a detactable label can be used.
The isolated and purified Cathepsin Y polypeptides of the present invention may be utilized as proteases in a variety of biological and chPmic~l systems. Additionally, the Cathepsin Y polypeptides may be used in sclce-~ g assays for identifying test compounds which have ,BAP
inhibition activity. It is further contemplated that Cathepsin Y can be used 20 ~ nosti~ y to evaluate a patient's risk for AD based on the presence and amount of this enzyme present in the patient's body fluid.
The isolated and purified nucleic acids substantially homologous to the sequence of FIG. 4, nucleic acids substantially complementary to the sequence of FIG. 4 and fr~p:mentc of the sequence of FIG. 4 can be used to 25 probe spe~ifi~lly for the presence of Cathepsin Y RNA or DNA in tissues or cloned libraries. The purified nucleic acids can be used to identify those tissues or cells which express RNA encoding for C~thep~in Y. The ~l~r~,llcd size of the nucleic acid fr~mPntc of FIG. 4 is at least 12 base pairs, preferably the fr~mPnts are at least 20 base pairs, more preferably of the 30 fr~gmPnt~ are at least 50 base pairs. The nucleic acid may be RNA or DNA.

CA 02221684 1997-ll-20 W O 96/39194 PCT~US96/06211 VI. Screening Assays for ~AP Inhibition Activity Cathepsin Y can be used in quantitative assays for the identification of compounds having ,BAP-production inhibition activity based on inhibition of the carboxypeptidase activity of the Cathepsin Y. Such assays are 5 ~lrull"ed by observing the ability of Cathepsin Y to cleave the carboxy-b~rminal residue on a suitable oligopeptide substrate. Test compounds which are able to inhibit such carboxypeptidase activity are considered ~ill iitizitoS for further testing to determine their ,~AP-production inhibitionactivity. Those test compounds which are unable to inhibit the 10 carboxypeptidase activity are considered less likely candidates for further testing. An exemplary assay for ~AP-production inhibition activity using Cathepsin Y is described in detail in the Experimental section below.
The following synthetic and biological examples are offered to illustrate this invention and are not to be construed in any way as limiting 15 tlhe scope of this invention. Unless otherwise stated, all ~ lpe,dtures are in degrees Celsius. Also, in these examples, unless otherwise defined below, the abbreviations employed have their generally accepted m~ ining BOP Reagent = benzotriazol-l-yloxy-tris(dimethylamino)phosphonium h- xziflllorophosphate bp = base pairs CBZ = carbobenzyloxy D~ = dithiothreitol DMF = N,N-dimethylform imide DMSO = dimethylsulfoxide dNlP = deoxynucleoside triphosphate DPDS = dipyridykli~ulfide EDTA = ethylene riizimine tetraacetic acid g = gram HPLC = high pelro,lllance liquid chromatography LAH = lithium aluminum hydride M = molar MES buffer = 2-[N-morpholino]eth,ineslllfonic acid mg = mi~ rr,im mL = millilit~r mM = millimolar mmol = millimol CA 02221684 1997-ll-20 W O 96/39194 PCT~US96/06211 ~M = micromolar N = Normal ng = nanogram pM = picomolar psi = pounds per square inch PVDF = polyvinylidene difluoride RGW = reagent grade water rpm = rotations per minute ~,g = mi~l~gld,-, ,uL = microliters ,uM = micromolar 293 cells were obtained from the American Type Culture Collection A Tr~ ~--15T 1 C7'2~
J I -JJ -293 751 SWE cells were obtained from K293 cells (human kidney cell line) stably transfected with the APP751 CDNA having the Swedish mutation.
Brij 35 was obtained from Boehringer ~nnheim.

EXAMPLES
The syntheses outlined in General Procedures A-D are illustrated in 25 FIG. 1 and depicts the synthesis of N-substituted dipeptide aldehydes.

General Procedure A -- Synthesis of carbobenzyloxy (CBZ) prote~te-l amino N,O-Dimethylhydroxyamides, 7 (20 mmole - scale) The N,O-dimethylhydroxyamides illustrated in FIG. 1 were synthP~i7PA on a 20 mmol scale according to the following general procedure. The CBZ protected amino acid 6 (20 mmol), BOP Reagent (30 mmol) and 4-methyl morpholine (100 mmol) were added to 100 mL of DMF
35 and all were stirred under an atmosphere of nitrogen for 1 hour at ambient L~ .dLule. At this time N,O-dimethylhydroxylamine hydrochloride (24 mmol) was added and all were stirred for an additional 12 hours at ambient t~ ~ldlul~,. The reaction was poured into water (200 mL) then extracted with ethyl acetate (3 X 200 mL). The combined organic layers were washed 40 with SdlUldtPd aqueous citric acid (2 X 200 mL), saturated aqueous sodium W O 96/39194 PCT~US96/06211 :39 bic~l,onate (2 X 200 mL), and brine (1 X 300 mL). The organic layer was dried using MgSO4, filtered, and concentrated to yield the desired CBZ
p~vte~;led N,O-dimethylhydroxylamide 7. When n.~cç~ r the product was cl...,.ll~lographed using 50% ethyl acetate/hçx~n.os Purified yields were 5 typically 70%-85%.

General Procedure B -- Synthesis of amino-N,O-Dimethylhy~l~v~y~mides 8 The removal of the CBZ protecting group on the CBZ ploLe.;~ed N,O-dimethylhydroxylamide 7 was done on a 15 mmol scale according to the following general procedure to provide for the title compound. The CBZ
protected amino acid (15 mmol) was sll~pen~ed in ethanol (20 mL) in a parr bottle. To this was added 10 weight percent of p~ iium on activated 15 carbon (10% palladium). This mixture was subjected to 50 psi of hydrogen for 3 hours on a parr shaker. The solution was then deg~se~l, filtered through a pad of celite, then concentrated to afford the desired amino N,O-dimethylhydroxyamide 8 (yields typically 60%-68%). This isolated m~t~
was used without further purification.

General Procedure C -- Synthesis of CBZ ~ led ~ epti~ N,O-Dimethylhydroxyamides 10 This coupling was done on a 15 mmol scale according to the 25 following general procedure to provide for the title co",~ound. The CBZ
protected amino acid 9 (15 mmol), BOP Reagent (22.5 mmol) and 4-methyl morpholine (75 mmol) were added to 75 mL of DMF and all was stirred under an atmo~hcr~ of nillogen for 1 hour at ambient temperature. At this time, the N,O-dimethylhydroxylamide 8 (15 mmol) was added and all was 30 stirred for an additional 12 hours at ambient t~ el~lu~e. The reaction was poured into water (150 mL) then extracted with ethyl acetate (3 X 150 mL).
The organic layers were combined and washed with .5~t~ ted aqueous citric acid (2 X 150 mL), s~tllr~t~l aqueous sodium bic~lonate (2 X 200 mL), W O 96/39194 PCT~US96/06211 and brine (1 X 225 mL). The organic layer was dried using MgSO4, filtered, and concentrated to yield the desired CBZ protected dipeptide N,O-dimethylhydroxyamide 10. When necessary, the crude product was cl,lu,,,atogl~hed using 50% ethyl acetate/hçx~nes Purified yields were 5 typically 67%-81% .

General Procedure D - Synthesis of CBZ protected dipeptide aldehydes 11 The reduction of N,O-dimethylhydroxyamide 10 was done on a 10 mmol scale according to the following general procedure to provide for the title compound. The N,O-Dimethylhydroxyamide 10 (10 mmol) was suspended in diethyl ether (65 mL) and cooled to 0~C under an atmosphere of nitrogen. To this vigorously stirred solution was added LAH (40-75 15 mmol), and the suspension was stirred for 1 hour at 0~C, then 1 hour at ambient L~lllp~ldture. The reaction was q~lenched with 10% aqueous citric acid (30 mL) and stirred for an additional 30 minutes. This was washed with diethyl ether (3 X 50 mL). The combined organic layers were washed with saturated aqueous sodium bicarbonate (1 X 50 mL), water (1 X 50 mL), 20 brine (1 X 50 mL), dried over MgSO4, filtered, and concentrated to yield crude aldehyde. Chromatography with 50% ethyl acetate/hexanes yielded the desired purified aldehyde 11. Purified yields were typically 45%-75%.
The syntheses outlined in General Procedures E-G are illllstr~tPd in FIG. 2 and depicts the syntheses of N-substituted amino acid aldehydes.

General Procedure E -- Synthesis of carbobenzyloxy (CBZ) protected amino N,O-Dimethylhydroxyamides 12 (+50 mmol scale) The N,O-dimethylhydroxyamides synthto~i7ed on a +50 mmol scale were ~,~ared according to the following general procedure to provide for the title compound. The CBZ protec~d amino acid 6 (50 mmol) was added to a 2:1 methylene chloride/tetrahydlurul~ul solution (500 mL) and all was cooled to -20~C under an atmosphere of nillogen. N-methylpiperidine (52.5 mmol) was added followed by the dropwise addition of methylchlol~foll,late (52.5 mmol). After 10 minutes, a solution of N,O-dimethylhydroxylamine (75 mmol, fre~b~l with 75 mmol of N-methylpiperidine~ in methylene 5 chloride (50 mL) was added dropwise at a rate to m~int~in the internal ~Ill~ldture of the reaction at -20~C. After the addition was complete, the reaction was allowed to warm to ambient IPIIIPe.,lillle and stirred for 3 hours. The reaction was washed with 0.2N HCl (3 X 125 mL), 0.2N
NaHCO3 (1 X 125 mL), water (1 X 125 mL), dried over MgSO4, filtered 10 and concentrated to yield the desired CBZ protected N,O-dimethyl-hydroxylamide 12 (yields were typically 80%-90%). This m~t~ri~l was very pure and was used without further purification.

~eneral Procedure F -- Synthesis of amino-N,O-Dimethylhy~l~.,A~mides 13 The removal of the CBZ protecting group was done on a 15 mmol scale according to the following general procedure to provide for the title compound. The CBZ ~ te~;led amino acid 12 (15 mmol) was su~pendçd in ethanol (20 mL) in a parr bottle. To this was added 10 weight percent of 20 p~ m on activated carbon (10% palladium). This mixture was subjected to 50 psi of hydrogen for 3 hours on a parr shaker. The solution was then rlçg~, filtered through a pad of celite, then con~çntrated to afford the desired the desired amino N,O-dimethylhydroxyamide 13 (yields were typically ~0-68%). This isolated m~t~ri~l was used without further pllrifit~ti~,m General Procedure G -- Synthesis of amino s~ lell N,O-Di[nethylhyd,~.A~mides 15 This coupling was done on a 2.6 mmol scale according to the 30 following general procedure to provide for the title cû.l.~ou--d. The carboxylic acid 14 (2.9 mmoles) BOP Reagent (2.9 mmol) and 4-methyl morpholine (10.4 mmol) were added to 35 mL of DMF and all was stirred under an atmosphere of niLluge.l for 1 hour at ambient l~...pe,dLur~. At this W O 96/39194 PCT~US96/06211 time the N,O-dimethylhydroxylamide 9, (2.6 mmol) dissolved in methylene chloride (5 mL) was added and all was stirred under nitrogen for 12 hours at ambient L~,-,peldture. The reaction was poured into water (50 mL) then PYtr~rted with ethyl acetate (3 X 50 mL). The organic layers were combined and washed with saturated 0.2N aqueous HCl (2 X 100 mL), saturated aqueous sodium bicarbonate (1 X 200 mL), and brine (1 X 200 mL). The organic layer was dried using MgSO4, filtered, and concentrated to yield the desired N-substituted N,O dimethylhydroxyamide 15. When nloces~ry, the crude product was chromatographed using 50% ethyl acetate/he~nes.
Purified yields were typically 60%-90%.

General Procedure H -- Synthesis of amino cllhstitl~terl aldehydes 16 The reduction of the N,O-dimethylhydroxyamide was done on a 0.5 mmol scale according to the following general procedure to provide for the title compound. N,O-Dimethylhydroxyamide 1~ (0.5 mmol) was suspended in tetra-hydrofuran (30 mL) and cooled to 0~C under an atmosphere of nitrogen. To this vigorously stirred solution, LAH (1.3 mmol) was added portion wise over a 30 minute period. Diethyl ether (60 mL) was then added followed by ice-cold 10% aqueous citric acid (80 mmol). After 30 minutes of vigorous stirring the reaction mixture was extracted with diethyl ether (5 X 20 mL). The combined organic portions were washed with saturated aqueous sodium bicarbonate (1 X 50 mL), water (1 X 50 mL), brine (1 X 50 mL), dried over MgSO4, filtered, and concentrated to yield crude aldehyde.
Chlu,.,atography with 50% ethyl acetate/hPY~es yielded the desired purified aldehyde 16. Purified yields were typically 31~o-65%.

General Procedure I -- Preparation of Di~7O'-Ptones Dia_oketones were prepared according to the procedure set forth by Green et al., J. Biol. Chem., "Peptidyl Diazomethyl Ketones are Specific Inactivators of Thiol Proteinases", 256(4):1923-1928 (1981). Spe~ifi~lly, diazometh~nP was freshly plt;;palcd by the slow portion wise addition of 1-methyl-3-nitro-1-nitrosog~ni-line (17 mmol) into a solution of diethyl ether (50 mL) that contains a 40% aqueous KOH (15 mL) at 5~C. After allowing the solution to stand for 10 minuteS the diethyl ether was ~ nt~l off and 5 dried over KOH pellets. The pr~tecLed amino acid or dipeptide (5.0 mmol) and N-methyl morpholine (5.0 mmol) were added to THF (25 mL) and all was cooled to -10~C. Isobutylchlorofo,l"ate (5.0 mmol) was added dropwise and the solution was stirred for an additional S minutes. The reaction was filtered then added dropwise to the freshly prepared solution of diazomethane 10 (as abos~e). All were allowed to sit undisturbed for 1 hour at 0~C then overnight at room Lcll~e-ature. The diethyl ether was washed with water (3 X 40 mL) then brine (40 mL), dried over MgSO4 and concentrated to yield the desired diazoketone.- Yields were typically between 55-72%.

15 General Procedure J -- Preparation of AlcohoLc C-terminal alcohols were prepared from the colles~onding C-terminal aldehydes by conventional re~lctio~ with LAH. For ex~mplP, the aldehyde is combined with LAH (about 4 equivalents) in THF at approximately 0~C.
20 Diethyl ether is then added followed by ice-cold 10% aqueous citric acid.
After 30 minutes of vigorous stirring the reaction mixture is extracted with diethyl ether. The combined organic portions are washed with saturated aqueous sodium bicarbonate, water, brine, dried over MgSO4, filtered, and conce~.t~ ed to yield crude alcohol. Chrol-latography with 50% ethyl 25 acetate/hf y~nes yields the desired purified alcohol.

Gene~l Procedure K -- Preparation of Esters C-lelll-inal esters were prepared from the colle~onding C-terminal 30 carboxyl groups via conventional esterific~ticn conditions.

~enP~l Procedure L -~ lion of Ami~Pc W O 96/39194 PCTrUS96/06211 C-terminal amides were p~ dlc;d from the coll~onding C-terminal carboxyl groups or C-terminal esters via conventional ~mi(l~tiQn conditions.
For example, the N-protected amino acid (20 mmol), BOP Reagent (30 mmol) and 4-methyl morpholine (100 mmol) are added to 100 mL of DMF
5 and all was stirred under an atmosphere of nitrogen for 1 hour at ambient tell,pe~dtulc. At this time, 1 equivalent of amine (e.g., ethyl methylamine) is added to the reaction mixture and stirred at ambient ~en~yeldture until reaction completion (e.g., 12 hours).

10 Examples 1-80 -- Synthes~ of C o m pounds of For m ula I
Following General Procedures A-L, the Compounds 1-75 (Ex. 1-75) as found in Table I below were yl~;yared. Additionally, Compounds 76-80 (Ex. 76-80) found in Table II were purchased from commercial vendors.

W ~ 961~9~94 PCTrUS96/06ZlI

Z ~ O

~_~ -- _ _ _ _ _ _ _ _ _ _ V
' ' ' ' ' V V
o 82 < O V
~, ~
O O C O C o -- -- o X ~ ~ ~ U

~ ~ o o o o o 6 o o o o y V, ~ V ~ V ~

~ -- o o C C o C o -- -- C
O ~ o o SUBSTlllJTE SHEEl- (RUI F 26) W O 96/39194 PCTrUS96/06211 K O ~ ~ ~ ~ ~ ~-- X 0~ _ -- C~l ~1 -~ 8 -- c ~

E J _ _ _ ' ' .l ' ' ' ' _ 5 _ _ - 5 5 = _ _ O O O O O C -- O -- C O O O O
~ V C_) V C~ Z--V o ~ V ~) V V
~ _ q V q V ~ ~~-- -- V --~

S o _ _ _ _ _ __ _ _ _ _ ~ - ~ U ~ - - - - = -V -- V V ~ ~)V ~_) y V

O O O O O O OO O O O O
~,) V y ~_) V V ~ V ~V C_) ~: o _ _ _ _ o oo O O

X ~ O O O O . .~ ~ ~ O O

S ~ , ~C C -- .~ V V

SUBSTITU~E SHEET (Rl~E 26) W O 96139194 PCT~US96/06211 C ~ ~r: ~ ~ ~ ~ C ~ ~ ~

X ~ - - ' ~ 2 ~ ~ ~ ' ~
._ ._ U U C, Z O Z ~ ~ -- O o _ U _ =
C,) C,~ C") ~ y ~S~ S ~ V V V V q S S ~
V y Y

~-- _ _ _ _ _ _ _ _ _ o ~ U - U _ _ 5 = e u ~ ~ ~ ~
Y ~ o y y y V - y V

X O O O O O O O O O O

SUBSTITUTE SHEET ~R~H E 26) W O 96/39194 PCTrUS96/06211 X o ~t V~ ~ ~ C
Z

A~

O ~ --Z _~
Z _ _!r _ _ _ _ O
_ _ Z ~~ Z ~ O
~ ~ O ~ O ~ O O ~ O
y ~ ) y y' y ~ _ _ _ _ O O O ~ ~ ~

~_ ~ O O O O O O OO O

~ _ _ _ _ O -- O ~ ~ ~
X O O O O ~ O

C~ S -- -- S ~ S

SUE~STITUTE SHEET (RULE 26) CA 02221684 1997-ll-20 W O 96~9194 PCTAJS96/06211 ~c o e~ x a~ O --. 7 ' ~ ' 7 : 7 I ~ ~ 7 = _ _ S 5 S ~ 5 Z ;~ ~Z ;,) ~_; Z~ Z~ Z_~ Z~
O ' O ' O O O O

~ 3 ! 7~ 77 7 1 7 ~,~

- O O -- -- o o O O O

:'~ ~ ~ ~ O O O O ~ O

~: O o -- _ o O O O O
X ' ' O O

SUBST~TlJTE SHFET ~RUl E 26~

CA 02221684 1997-ll-20 W 0 96/39194 PCTtUS96tO6211 , ~0 K O ~ ~ U~ '~

-- , t .8 ~

~y o o o o -- o -- -- o C -- o o C ~ ~ ~ ~

~ ~ , . j j . . i i ~ o o o o o oo o o S ~, ~, q ~, " q ~ q~

o o o o 6 ~ o o ~ o y ~) y ~ y Y

~ o o o o o oo o o X

U~ U
~U~IIIJlt~tt ~UL~g~.

W O 96/39~94 PCT~US96/06211 ~ Z 'D

~.
_ ~ , 5 t ._ ~ E _ ~ ~ ~ ' ~ ~ ~

~ = = _ =_'_ O _ ~ _ _ _ o o o o o o o o U U ~ ,c ~J ~ . -- U

~ ~ UU ~, U U V

~ ~ o o o o o o o o X

~O U K K
X O~ X C~ ~ ~ ~ ;,~

WO 96/39194 PCT~US96/06211 X o C _ U~ Z t~

C , , -o _l .

C~: ~ -- O O
o ~: o o o S~4 --o ~ O o o X

SUBSr~TUTE SH~T ~

W O 96139194 PCT~US96/06211 T~

IIIL~ r~ 'c ~0.

C~N--P~ }Il' 1 N ~

~ ~ ~ F 76 SUBSTITUTE SHEET (RULE 26~

W O 96/39194 PCTrUS96/06211 TARr.~ II ~n-.~;.,....l C~ wu~i r~vlc No.

3--~ _;~ N ~ F

~ T7 0 ~LU rU_ F

~_oJJ~N~l~N~F 79 ~0 0--O~N~N~F 80 o W~ 96139194 PCT~US96~06211 General Procedure J -- Cellullar Screen for the Detection of Inhibitors of ,B-Amyloid Pro~ ctiQr~
Compounds of this invention were assayed for their ability to inhibit ,~-amyloid production in a cell line poc~Pc~ing the Swedish mutation (293 751 SWE cells). This screening assay employed 293 751 SWE cells which were derived from K293 cells (human kidney cell line) which were stably transfected with the gene for amyloid pl~cul~or protein 751 (APP751) con~ g the double mutation Lys65~Met652 to Asn65~Leu652 (APP751 numbering) in the manner describe~d by Sch~nk et al., Tnt~n~tinnal Patent Application Publication No. 94/10569, nMethods and Compositions for the Detection of Soluble ,~-Amyloid Peptide", published 11 May 1994 and Citron, et al., Nature, ~:672-674 (1992) the disclosures of which are incorporated herein by reference in their entirety. This mutation is commonly called the Swedish mutation and the cells, deci~n~t~d as "293 751 SWE", were plated in Corning 96-well plates at 1.5-2.5 x 104 cells per well in Dulbecco's minim~l e~enti~l media plus 10% fetal bovine serum. Cell number is illlp~ t in order to achieve ~-amyloid ELISA results within the linear range of the assay (--0.2 to 2.5 ng per mL).
Following overnight incubation at 37~C in an incubator equilibrated with 10% carbon dioxide, media were removed and replaced with 200 ~L of a peptide, dipeptide or tripeptide described herein (drug) cont~ining media per well for a two hour ~e~ rnt period and cells were incub~te~ as above. Drug stocks were pr~,d in 100% dimethylsulfoxide such that at the final drug conrentr~tion used in the tre~tmrnt, the concentration of dimethylsulfoxide did not exceed 0.5% and, in fact, usually equaled 0.1%.
At the end of the prell~e~l~"rnt period, the media were again removed and replaced with fresh drug cont~ining media as above and cells were incub~led for an additional two hours. After tre~tmrnt~ plates were ~ 30 ce"t,iÇuged in a Reckm~n GPR centrigfuge at 1200 rpm for five minlltes at room t~l"~; dture to pellet cellular debris from the cont1itiollpd media. From each well, 100 ~L of conditioned media or ap~.~-iate dilutions thereof were CA 02221684 1997-ll-20 transferred into an ELISA plate precoated with antibody 266 against amino acids 13-28 of ,B-amyloid peptide as described by Schenk, et al. in International Patent Application Publication No. 94/10569 supra. and stored at 4~C overnight. An ELISA assay employing labelled antibody 6C6 against 5 amino acids 1-16 of ,B-amyloid peptide was run the next day to measure the amount of ,B-amyloid peptide produced.
Cytotoxic effects of the cGIl~pounds were measured by a mo~lific~tion of the method of Hansen, et al., J. Immun. Meth., 119:203-210 (1989) which is incol~oldLed herein by reference in its entirety. To the cells rçm~ining in the tissue culture plate was added 25 ~L of a 3,(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) stock solution (S mg/mL) to a final concentration of 1 mg/mL. Cells were incub~ted at 37~C for one hour, and cellular activity was stopped by the addition of an equal volume of MTT lysis buffer (20% w/v sodium dodecylsulfate in 50%
dimethylform~mide, pH 4.7). Complete extraction was achieved by overnight ~h~king at room ~el~peldture. The difference in the OD562"", and the OD65,h" was measured in a Molecular Device's UVnux microplate reader as an indicator of the cellular viability.
The results of the ~-amyloid peptide ELISA were fit to a standard curve and ~r.,i,sed as ng/mL ~-amyloid peptide. In order to normalize for ~;y~OtOAiCity~ these results were divided by the Ml~ results and e,~pr~ssed as a percentage of the results from a drug free control. All results are the mean and standard deviation of at least six replicate assays.
The test co---pounds were assayed for ~-amyloid peptide production inhibition activity in cells using this assay. The results of this assay demon~trate that, among others, the compounds of FY~mples 1-80 each were able to reduce ,~-amyloid peptide production as colupared to control.
Moreover, these compounds did not have a ~ignifi~nt cytotoxic effect on the 293 751 S W E cells.
Thus, the colllpounds of this invention are useful for re~ucing W O 96/39194 PCTrUS96/06211 ,B-amyloid peptide production in cells and, accordingly, would be useful in treating humans in vivo for AD.

Summary of CaLh~in Y (31kD) Purification and Characterization The strong inhibition of ,~AP release observed with the peptide (and non-peptide) aldehydes suggested the existence of a specific protease which is the ~arget for these inhibitors. In order to isolate such an enzyme, an affinitymatrix was constructed using a modified version of the prototype aldehyde inhibitor. The col..poulld NH2-Val-Phe-semicarbazone was synthPci~P~A, then coupled to an epoxy Sepharose'lD matrix as described below, following which the semic~rbazone functionality was chemi~lly converted to the aldehyde.
The binding of an active protease to the aldehyde column involves the equilibrium formation of a reversible covalent bond, between the active site cysteine residue of the protease with the aldehyde or other equivalent functionality. Elution of the protease in this case was achieved by using DPDS, which forms a ~ fide linkage with the active site cysteine, and thus displaces the enzyme from the column. Recovery of enzymatic activity following elution is achieved by inrub~ting in an excess of redu~ing agents such as ,~-mercaptoeth~nol or dithiothreitol.
The i(l~ntific~tion of ~hepsin Y was f~cilit~tPcl by the serendipitous observation that a polyclonal antibody to human Cathepsin B ("anti-cat B") recognized an a~ro,~imately 31 kD band as the most strongly reactive band recognized on a Western blot of fractions eluted from the aldehyde affinity matrix. Figures 3A - 3C show a typical pllrific~tion profile, analyzed by both Western blotting with the anti-cat B as well as protein st~ining of the purified fractions. The Western blot of fractions from the affinity matrix (FIG. 3A) shows that the anti-cat B antibody reacts strongly with three major bands in the soluble cell extract ("load"), of which the middle band (a~r~kimately 31 kD),binds most strongly to the matrix, being e~Pnti~lly yu~ ely ~eplP-teA in the flow through ("FT"). Elution with the DPDS
results in the recovery of both the 31 ldD band as well as the partly bound W O 96/39194 PCT~US96/06211 lower MW (cellular Cathepsin B). The 31 kD band is then purified away from the cont~min~fing Cathepsin B using a concanavalin A column, which results in the selective binding and subsequent elution of the 31 kD protein band (FIG. 3B). Analysis of the fractions eluted from the concanavalin A
column by Coomassie blue revealed a single protein band co-migrating exactly with the Western blot reactivity (FIG. 3C).

Preparation of ValPhe-aldehyde affinity matrix 3.2 gm of Epoxy Sepharosea9 (Pharmacia) was swelled in 50 mL of reagent grade ~lictille~ water (RGW) for at least 20 minutes at room ~"")eldture, and washed on a coarse Buchner filter funnel with one liter of RGW. At no stage in any of the washes was the resin cake allowed to go to complete dryness. 4.2 mL of 0.2 M sodium borate, pH 9.5, was added to 1.05 mL of 25 mg/mL valylphenylalanylcPnni~.lJazol-e (ValPheSC), and the washed Epoxy Se~harose was added to the resulting solution. The snsp~ncion was inc~b~tP~I with rotation at 37 C for 24-26 hours. The Se~ha~.se was se~limPnted by centrifugation at 550 rpm in a GSR rotor for 5 .-.;.-.,l~s, then resuspended in 40 mL of 1.0 M ethanolamine, pH 8.2, and inl~u~tPIl as before overnight (16-18 hours). The coupled Sepharose (ValPheSC-S~hal~,se) was washed on a coarse RuchnPr filter funnel with 350 mL of 33% DMSO, then with 350 mL of RGW. The semicarbazone was converted to the colle~ol~ding aldehyde by incub~tion in 80 mL of meth~nol:acetic acid:formaldehyde (5:1:1) at room te"lpc;ldture, with rotation, overnight. The S~haluse was sçAimPntçd by centrifugation as above, and incubated with fresh meth~nol:acetic acid:formaldehyde as above, for 10 hours. The ValPhe-Sepharose was washed as above with 600 mL of RGW, and stored at 4 C as a 50% slurr,v in 0.05% sodium azide.

Pl~a,alion of Cathel; sin Y
All operations, unless noted, were pe,~l,lled at 4 C or on ice.
Frozen, pelleted wild-type derived 293 cells were thawed and rçsn~pPn-lP~ in CA 02221684 1997-ll-20 W O 96/39194 P ~ MS96~06~II

~ 59 S volumes of MES buffer (20 mM MES, 2 mM EDTA, 0.1% Brij 35, pH
6.0). The sUsp~rtcinn was homogenized for 30 secondc using either a Brinkm~n PT 1200 or a Tissue Tearor 985-370. The homogenate was cenll;ruged at 15,000 rpm (31,000 x g) for 20 minutes. The supernate was collected, received 5 mM DTT, and was applied to a ValPhe column cont~ining the ValPhe aldehyde prepared as above. The column was pre-equilibrated with MES buffer cont~inin~ 0.1 M NaCl. Typically, 20 mL of 293 cell ~upc. IlAtf' was applied to a 1.0 mL column, although over 60 mL of le per mL of column can be applied without saturation of the column.
The column was washed with one bed volume of 0.1 M NaCl in MES
buffer, then with 10 bed volumes of 0.2 mL NaCl in MES buffer, followed by 10 more bed volumes of O. l M NaCl-MES buffer. The column received 0.75 volumes of 2 mM dipyridyl-licl~lfide (DPDS) in 20 mM sodium acetate, pH 4.5, and was plugged and stored overnight. The column then received 1.25 volumes of the DPDS solution; the fraction collected at this point contained the bulk of the eluted C~th~.cin Y and B. The column was eluted with at least 3 more volumes of DPDS solution, followed by 5 volumes of 6 M urea. Fractions of one column volume were collected.
The peak of the DPDS eluted mattori~l received 0.1 M NaCl, 1 mM
MnCl2, and 1 mM CaCl2, and was applied to a 1.0 mL column of ~onc~n~valin A-agarose equilibrated with wash buffer (0.1 M NaCl, 50 mM
MES, 1 mM MnCl2, 1 mM CaCl2, pH 6.0). After the starting m~teri~1 had been applied, the column was washed with 5 mL of wash buffer, followed by 1 mL of 0.1 M m~nnose in the same buffer; this was the first eluted fraction (El). Bound m~t~ l was eluted with 0.5 M a-methyl mann~yld"oside in wash buffer, in portions of 0.8 mL (E2), 1.2 mL (E3), and 4-5 portions of 1.0 mL (E4-E9). Cathepsin Y was eluted as a broad peak bt;lw~n 0.8 and 6 mL of elution buffer.

r~.7~",~lic Activity W O 96/39194 PCT~US96/06211 Purified 31 kD protease (Cathepsin Y) was without effect on various APP prep~r~tions, including purified recombinant APP constructs as well as membrane-bound full-length APP. No ~i~nific~nt activity was seen also with known synthetic substrates commonly used for assaying Cathepsin B, L or S.
5 These results suggested that Cathepsin Y does not have the standard endopeptidic activity associated with such proteases. In an effort to identify whether the enzyme has other proteolytic activity, a number of randomly st~lect~ synthetic oligopeptides were inC~lb~t~3 with purified ~th~in Y at pH 5.5 or 4.5. Specifically, purified Cathepsin Y was incu~t~d with the s~lected synthetic oligopeptides (50 ~g/mL) at either pH 4.5 or pH 5.5, for 1 hour at 37~C. Samples were quenched by the addition of trifluoroacetic acid to 1% final concentration, then analyzed by reverse phase HPLC on a Vydac C18 column, using a gradient of increasing acetonitrile in 0.1%
trifluoroacetic acid. Individual pt~ks (parent and new product(s)) were 15 collected, then analyzed by acid hydrolysis folowed by amino-acid analysis.
The results are sl~mm~ri7~1 below:
Parent Sequence Product(s) LFYDQSPTATI (SEQ ID NO:5) LFYDQSPTAT (aa 1-10 of SEQ ID NO:5) LFYDQSPTA (aa 1-9 of SEQ ID NO:5) LFYDQSPT (aa 1-8 of SEQ ID NO:5) YKRDMVGGWIA YKRDMVGGVVI (aa 1-11 of SEQ ID
(SEQ ID NO:6) NO:6) YKRDMVGGVV (aa 1-10 of SEQ ID
NO:6) EGYYGNYGV (amino acids 1-9 EGYYGNYGV (aa 1-9 of SEQ ID
of SEQ ID NO: 7) NO:7) EGYYGNYGVYA EGYYGNYGVY (aa 1-10 of SEQ ID
(SEQ IDNO:7) NO:7) EGYYGNYGV (aa 1-9 of SEQ ID NO:7) FFDEPNPGVTIY (SEQ ID NO:8) FFDEPNPGVT (aa 1-10 of SEQ ID NO:8) -CA 0222l684 l997-ll-20 W O96139194 PCT~US96/06211 [The above peptides, as well as other peptides recited herein, are listed, per convention, from amino terminus to the carboxyl terminus.]

The results from a number of such experim~-nt~ (all not shown) suggest that the only proteolytic activity of Cathepsin Y is a sequential removal of thecarboxy t~ ,inal amino-acids which is direct evidence for carboxypeptidase activity. No evidence of any endopeptidase or aminopeptidase activity was seen with any of these substrates. These data strongly suggest that the predolllinantproteolytic activity manifested by Cathepsin Y is carboxypeptidase activity.
The quantitative analysis of carboxypeptidase activity of Cathepsin Y is based on the ~l~tçctinn of the new free amino-terminus generated on cleavage of a s~lPctçd substrate. This is accomplished by reacting with the reagent o-ph~h~ ehyde in an ~lk~line solution in the presence of 2-me,~loell.~llol ~Simons, et al., JACS, 98:7098-7099, (1976)). The peptide, EGYYGNYGV (aa 1-9 of SEQ ID NO:7), was synthe~i7çd acetylated on its amino-terminus so that on cleavage by C~thepsin Y, the only free amino-terminus will be present in the reaction mixture will be that of ~he valine residue, cleaved off by the carboxy~tidase activity of the protease.
A standard curve was constructed by incub~ting varying concPntr~tions of valine (0-20 ~M) in 0.25 M sodium borate, pH 10, cont~ining 0.05% 2-r~p~oeth~nol and 60 ,ug/mL o-phth~ çhyde~ in individual wells of a 96 well microtiter plate. The res~ltin~ fluorescçnre is read in a plate reading Cytofluor (ex 340, em 460 nm). There is a linear increase in the signal pl~o-lional to theamount of free valine present (FIG. 7).
In order to determine the pH optimum of the enzyme, reaction mixtures were set up with enzyme and substrate (0.2 mg/mL) in a total reaction volume of 0.1 mL) in individual wells of 96-well microtiter plates, in 20 mM sodium acetate buffers at different pHs, with 0.1 % 2-mercaptoethanol present. Control wells were set iclçntit~.~lly except for the presence of enzyme. At various time-points after il~cub~;on at room le~ tlJre~ the reactions were quçnched by the ad~li*~n of an equal volume of 0.45 M sodium borate, pH 10, with 0.25 mg/mL
-o-phth~ dehyde~ and the fluorçscçnce measured. In the absence of added enzyme, no m~cllr~hle fluorescçnce is gen~-~ted above background, even with extended incubations. In the presence of enzyme, there is a time-dependent increase in fluorçscçnce. Based on this analysis, the pH optimum for 5 carboxypeptidase activity was determined to be about 4.5, with the activity dropping off at both lower and higher pHs.
Using this assay at pH 4.5, the ability of a number of compounds to inhibit the activity of Cathepsin Y was tested, by adding the desired concentration of the inhibitor in the incubation mixture along with enzyme and substrate, and 10 m~o~cllring the decrease in fluorescence (if any) relative to enzyme control. Each of the compounds of Examples 3, 4, 7, 15, 24, 45, 47, 59, 64 and 75 tested in this analysis indicated inhibition of Cathepsin Y activity.

Protein Sequence Analysis Direct sequencing of the 31 kD protein band following electroblotting onto PVDF membranes revealed the following sequence (SEQ ID No. 4):
(S) L P K S W (G,D) (N,V) R N V D G (V,N) N Y A S I (R,T) }2ecidues in parenthesPs are uncertain amino acid ~ccignm~ntc. However, this limited amino-terminal sequence information showed clear homology to a 20 known cysteine protease, rat C~thPpsin C, which suggested that this new enzyme may belong to the papain superfamily of cysteine proteases, which also includes the c~thepsinc B, L and S. Therefore, degenerate oligonucleotide primers were decign~d using known conserved sequences in the cysteine proteases and from the newly discovered amino-terminal sequence, in order to use PCR to clone out the 25 new enzyme.

Cathepsin Y Cloning To obtain an initial DNA clone of this protease, degenerate PCR was pt roll-.ed using degenerate oligonucleotides encoding the amino acids of this 30 newly discovered amino-terminal sequence and en~ in~ oligonu~leQtide sequences conserved in the cystein proteases of the papain family. cDNA was made from RNA of human HS683 (human glioma cell line: ATCC #HTB138) cells using the Perkin Elmer GeneAmp RNA PCR kit as described by the ~ manufacturer and denatured in a boiling water bath. The PCR reaction contained 1 ~g of poly A+ RNA, lx Perkins-Elmer-Cetus PCR buffer 1, 25 pM of each of oligonucleotides "Acys5" and "I Mer5"
Acys5 (SEQ ID NO:9) =
TG.TAC.CCG.GGC.(AGC)(TC)A.(AG)CA.IGA.(AT)CC.G
çnco~ing amino acids CGSC(YW) (SEQ ID NO: 10) I Mer5 (SEQ ID NO: 11) =
C.GTA.GGA.TCC.CTI.CCX.AA(GA).AGC.TGG
encoding amino acids (S)LPKSW (SEQ ID NO:12) 50 ~M each dNTP, and 0.5 units Taq polymerase in the 25 ~L total volume.
The PCR reaction was subjected to 30 cycles each con~i~tin~ of 95~C for 45 seconds, 45~C for 1.5 minutes, a slow 1 minute rise in le~ dl~lre up to 70~C, and 70~C for 30 seconds followed by 8 minutes at 72~C. Acrylamide gel electrophoresis displayed multiple PCR products so the entire PCR redction was subcloned and mllltiple clones sequenced. One out of 82 clones eY~minPA, hCatZ.82 (nucleotides 299-366 of SEQ ID NO:2) enco~lecl the amino acids of this newly discovered amino-terminal sequence.
A larger DNA clone of C~th~psin Y was obtained by degenerate PCR
using sequence from hCatZ.82 (nucleoti~es 299-366 of SEQ ID NO:2) and conserved sequences of the cystein proteases of the papain family. PCR
oligonucleotides used were 1683 (nucleotides 298-319 of SEQ ID NO:2) =

5' . .TGG.GAC.TGG.CGC.AAT.GTG.GAT.G. . .3' and L~#4 (also called Bcys2) (SEQ ID NO:13) =
5'. .GAC.TGA.ATT.CTT.NAC.NAG.CCA.GTA. . .3'.
The con-iition~ for cDNA synthesis and PCR were as described above except that the ~nn~lin,~ e-~dture was increased to 50~C and the 70~C ~Yt~n~ion incllb~tis~n was for 45 secQrl~1s The PCR reaction yielded a single 528 bp band which was subcloned and sequenced, and the sequence of the resl-lting clone (CatZ(+)3) (nucleotides 299-867 of SEQ ID NO:2) is in~ic~t~d in FIG. 4.
To obtain further 5' sequence, PCR reactions were performed on phage from a HeLa cell cDNA library (in lambda zap 2 vector from Stratagene). 5 ~L
5 of phage at lx101~ phage/mL were boiled for 2 ...in-~les and placed on ice. Hot Start PCR was ~lrolllled according to the manufacturer (Perkin Elmer/Cetus ) using oligonucleotide RACE31-NC (SEQ ID NO:20) = CAG GAG GGT GGA GGG CCA CGC TCC
CT
10 and an oligonucleotide corresponding to the lambda vector (788-1) 788-1 (SEQ ID NO: 14) = GGAAACAGCTATGACCATGAT
under the following conditions; 50 pM RACE31-NC oligonucleotide (SEQ ID
NO:20), 25 pM of 788-1 oligonucleotide (SEQ ID NO:14), lx PCR buffer II, 100 ~M dNTPs, 2.5 mM MgCl2, and 1.25 units of Taq polymerase in a reaction volume of 50 ~LL. The reaction was heated to 80~C for 10 minutes and then subjected to 30 cycles of 94~C for 1 minute, 55~C for 45 seconds, a 1 minute ramp up to 72~C and 1 minute at 72~C, followed by a final single extension at 72~C for 8 minlltes A second nested Hot Start PCR reaction was done under the same con-~ition~ on 1 ~L of the PCR products using 25 pM of an 20 oligonucleotide col,cs~onding to the lambda vector (872) 872 (SEQ ID NO:15) = CCC.TCA.CTA.AAG.GGA.ACA
and 50 pM oligonucleotide NestR31-nc (reverse complement of nucleotides 385-411 of SEQ ID NO:2)). Southern analysis on the PCR products with oligonucleotide 1705 (nucleotides 301-366 of SEQ ID NO:2) as a probe displayed 25 reactive products and PCR products of the a~lup~iate size. These were subcloned and clones containing a diagnostic ApaI site (shown at nucleotides 380-385 of SEQ ID NO:2) of FIG. 4 were sequenced and the sequence of clone cat Y
P3-25 (nucleotides 202-411 of SEQ ID NO:2) is shown on FIG. 4.
In order to obtain additional 3' and 5' sequence of this clone, 3' and 5' 30 RACE PCR techniques were used (Frohman et al., (1988), PNAS USA
85:8998-9002.) For 3' RACE reactions cDNA was synthçci7Fd from polyA+ RNA from human HS683 cells (Frohman et al., (1988) PNAS USA 85:8998-9002) using the cDNA synthesis conditions in Clontech 5'AmpliFINDER ~RACE kit protocol with the following mo-lifica~ions: 2 ~g of RNA was used in 100 ~L volume and S the adaptor primer described below was used to prime synthesis. The adapter primers were a mo-~ific~tion of that described by Frohman, et.al., (1988), PNAS
USA 85:8998-9002.
dTI7 + adapter for first strand synthesis:
primer - 1576 (Sl~Q ID NO: 16) =
5'-GGA CTC GAG TCG ACT CTA GAG CGT 1~ ~T Tl~
TIT TTT TT-3' Adapter (XhoI-SalI-XbaI):
primer -1577 (SEQ ID NO:17) =
5'-GAC TCG AGT CGA CTC TAG AGC GT -3' Hot Start PCR was performed using the adapter primer 1577 and intern~
primer Nestr31-c (FIG. 4) (nucleotides 343-366 of SEQ ID NO:2) at an ~nnP~ling tenlpFidture of 55~C. Hot Start conditions were mor1ifi~tions of Perkin-Elmer AmpliWax~ protocol. Final concçnt~tions of all reagents, after combining both layers: Lower mix is 1.25X PCR buffer (lOX PCR buffer II
rPerldn Elmer Cetus, Norwalk, Cl~ is 500 mM KCl, 100 mM Tris-HCl pH8.3), 2 mM MgCl2 (Perkin Elmer Cetus), 200 ~LM dNTP (Perkin Elmer Cetus), 1 ~M
each primer in total volume of 12.5 ~LL. Upper mix is 1.25X PCR buffer, 1.25U
AmpliTaq0 DNA Polymerase (Perlcin Elmer Cetus), 1 ,uL template DNA in 37.5 ~L total volume. Ampliwax'U PCR Gem 50 (Perkin Elmer Cetus) is addcd to the lower mix which is brought to 80~C for S ,llir,~ ,s, then held at 25~C until theaddition of the upper mix. PCR conditions included initial d~n~t~ tion at 95~C
~ for 2 ~ s followed by 30 cycles of 94~C for 45 seconds, 55~C for 45 sFxonds, 72~C for 2 I"il~lulFs, and then a final single extension at 72~C for 8 Illillul~S.

W O 96/39194 PCT~US96/06211 Southern blot analysis of RACE reactions using radiolabelled oligonucleotide 1758 (nucleotides 553-577 of SEQ ID NO:2) (FIG. 4) as probe showed bands at approximately 800 and 1100 bp. These bands were gel-isolated and cloned into pT7Blue (Novagen, La Jolla, CA). Novablue cells (Novagen, 5 I~Jolla, CA) were transformed and colonies positive for Cathepsin Y sequence by PCR analysis were sequenced. The larger fragment proved to contadin the stop codon and polyA tail, and its sequence is shown on FIG. 4 (in~ t~l in Figure 4 by "3'RACE") (nucleotides 343 to 1558 of SEQ ID NO:2).
All 5'RACE reactions were done from S'RACE-ReadyTM human liver 10 cDNA (Clontech). The cDNA is generated by random-priming and is provided with an anchor sequence ligated to the amino terminus.

CLONTECH Anchor region (SEQ ID NO: 18):
3 ' -NH3-GGAGACTTCCAAGGTCTTAGCTATCACTTAAGCAC-P-5 ' Anchor primers:
pnmer - 1821 (SEQ ID NO:l9) =
5 '-CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG-3 ' primer - 1823 (nucleotides 14-38 of SEQ ID NO: 19) =
5 ' - CCTCTGAAGGTTCCAGAATCGATAG-3 ' To obtain a clone encoding region 1 (FIG. 4) (nucleotides 175-411 of SEQ ID NO:2), PCR was done under the above Hot Start conditions with oligonucleotides NestR31-nc (FIG. 4) (reverse complement of nucleotides 385-411 of SEQ ID NO:2) to 1821 (SEQ ID NO:19) using 65~C ,tnne~ling p~ e. PCR conditions inçluded initial denaluldlion at 94~C for 2 ...;t.l~f s; then 35 cycles of 94~C for 45 seconds, 60~C for 45 seconds, 72~C
for 2 .--;nl~f~ S and then a final extension at 72~C for 8 ...in~ 5, A Southern blot was probed with 32P-kinased oligonucleotide 1810 (FIG. 4). DNA of cul-esponding size was gel-i~ol,tt~d and cloned directly W O 96/39194 PCT~US96/06211 into pT7Blue. Novablue cells (Novagen, LaJolla, CA) were transformed and colonies positive for Cathepsin Y sequence by PCR analysis with the largest inserts were sequçnce~l One clone of 63 screened contained the sequence idPntifi~l as region 1 (nucleotides 175-411 of SEQ ID NO:2).
To obtain a clone encoding region 2 (nucleotides 133-270 of SEQ ID
NO:2), primary PCR was done using the above Hot Start conditions (with the subsitution of 7-deaza-GTP:GTP at a ratio of 3: 1 instead of standard GTP in the dNTP mix) with oligonucleotides 1685 (FIG. 4) (nucleotides 316-348 of SEQ ID NO:2) and 1821 (SEQ ID NO:l9), annealing at 60~C. PCR
conditions included initial denaturation at 95~C for 2 minutes, followed by 35 cycles of 95~C for 45 seconds, 60~C for 45 seconds, 72~C for 1.5 minutes, and then a single final extension at 72~C for 8 minlltçs PCR
products run on a 2% agarose gel showed a smear of DNA. DNA greater than 200 bp in size was isolated and purified using GenecleanTM (Bio 101, Madison, WI). This DNA was used as a template for nested PCR using oligonucleotides 1810 (FIG. 4) (nucleotides 243-270 of SEQ ID NO:2) and :L823 (nucleotides 14-38 of SEQ ID NO: 19) under the above Hot Start conditons with the addition of 1 ,uL of single-strand binding protein (USB) in the lower layer along with the template DNA and Hot Start ~ ature of 5~5~C rather than 80~C. The primers were added to the upper mix, and PCR
proceeded with ~nnP~ling a~ 60~C. A Southern blot of the PCR product was probed with 32P-kin~cPd oligonucleotide 1846 (FIG. 4) (nucleotides 175-204 of SEQ ID NO:2) and a~r~liate sized DNA was isolated from the gel, l;gated into pT7Blue, and transformed into SURE cells (Stratagene, La Jolla CA). 7 colonies were positive for C~th~E?sin Y sequence by PCR analysis out of 27 screened. The one clone sequenced contained the sequence idçntifi~d as region 2 (~IG. 4) (nucleotides 133-270 of SEQ ID NO:2).
To obtain a clone encoding region 3, primary PCR was done and ~ >lale for secondary PCR was ~f~aled as for region 2 (nucleotides 133-270 of SEQ ID NO.2), but using oligonucleotide NestR31-nc (FIG. 4) (reverse complement of nucleotides 385-411 of SEQ ID NO:2) instead of CA 0222l684 l997-ll-20 W O 96/39194 PCT~US96/06211 1685 (nucleotides 316-348 of SEQ ID NO:2). Secondary PCR was done using oligon-lcle~tides Kyl (FIG. 4) (nucleotides 140-159 of SEQ ID NO:2) and 1823 (nucleotides 14-38 of SEQ ID NO: 19) under standard Hot Start conditions but with the addition of 1 ~LL of single-strand binding protein in S the lower layer along with the DNA template, then a Hot Start temperature of 100~C for one minute. Deep Vent DNA Polymerase (NEB) was used for PCR which allowed denaturation at 100~C, instead of 94-95~C. For Vent PCR, Perkin-Elmer PCR buffer and MgCl2 were replaced by NEB 10X Vent polymerase buffer (100 mM KCl, 200 mM Tris-HCl pH 8.8, 100 mM
NH,]2SO4, 20 mM MgS04, 1.0% Triton X100) at the a~p.opliate concentrations. Deep VentR'19 DNA Polymerase (NEB) was used at 2U per 50 ~L reaction. ~nn~ling was done at 60~C. The PCR product was blunt ended with Klenow, digested with EcoRI and gel purified. Fr~gml~.nt~ of 100-150 bp and 150-200 bp were isolated separately and ligated into 15 ~QRI/E~cQRV digested pBR322. SURE cells were then transformed and colonies positive for Cathepsin Y sequence by PCR analysis with the largest inserts were sequenced yielding clones cont~ining the sequence in-lic~ted as region 3 in FIG. 4 (nucleotides 0-159 of SEQ ID NO:2).
Northern analysis under stringent conditions show that in various 20 tissue and cell sources a single sized mRNA species of approximately 1600 bp encodes Cathepsin Y. Thus even though some sequences in FIG. 4 are from differing sources (Hs683 and liver) it is thought that the sequence of C~thtop~in Y is not cignific~ntly dirr~,ent among those sources. The above techniques have been used to identify additional independçntly derived clones 25 from various sources that verify the validity and contiguity of the sequence shown in FIG. 4. The size encoded by the sequence in FIG. 4 is s~-fficient to encode the entire mRNA, and the open reading frame in-lic~t~l starts with a signal peptide as would be expected for a cystein protease of the papain family. This intlic~t~s that this is the entire encoding region of C~thep~in y.
- Cathepsin Y Expression W ~ 96~9194 PCT~US96/06211 The BamHI fragment cont~ining the entire coding region of the hep~in Y was blunt ended and cloned into the vector poCK751 cut with ~I and ~peI (blunt ended) (FIG. 5) so that the ,BAPP sequences were removed and repl~r-e~l with those of Cathepsin Y to form the plasmid poCK
5 catY (FIG. 6).
Transfection of this resu1ting plasmid using the Boheringer ~nnh,o.im DOTAP transfection kit into human 293 kidney cells resulted in the e~ion of active C~thepsin Y protein. This intli~tPs that this clone encodes the entire coding region of C~thepsin Y, and that active Cathepsin Y
10 protein can be generated from this clone.
Varying amounts of Cathepsin Y cDNA in the poCK expression vector were transfected transiently into 293 cells, in 6 well plates.
Transfection was carried out using DOTAP (Boehringer l~nnheim), using protocols suggested by the manufacturer. 48-72 hours following t:r~n.cfiection, the cells were washed with cold PBS, then lysed in 1 mL of 20 mM MES, pH 6, 0.1% Brij-35, 2 mM EDTA. l0 ~L aliquots of the lysate (following centrifugation to remove cell debris) were electrophoresed using SDS-PAGE, followed by transfer of the proteins onto a PVDF membrane.
The membrane was probed with the anti-cathepsin B antibody for Western 20 blot analysis. A dose-dependent increase in the ~31 kDa immunoreactive Cathepsin Y band was seen as a result of transient e,~lc;ssion of the Cathepsin Y cDNA.
300 ~LL of the lysates were then absorbed with 20 ~L of the Val-Phe-aldehyde affinity matrix. This resulted in complete loss of the--31 25 kDa immunoreactive ~thçp~in Y band from the cleared lysates, in~lic~tin~
that the o~,e.c~ ssed protein is active and compet~nt to bind to the inhibitor affinity matrix. Elution of the matrix with DPDS showed that there was a I~NA dose-depçndçnt increase in C~thçpsin Y carboxypeptidase activity in the transfection studies. The increase in e*~,es~ion directly correlated with 30 the arnount of cDNA transfected into the cells.

These data confirm that w~lession of the cDNA clone for Cathepsin Y results in overt:A~lession of enzym~ti~lly active Cathepsin Y, migrating on SDS-PAGE at ~ 31 kDa, and able to bind and elute from the inhibitor affinity matrix.
Although the foregoing invention has been described in detail for ~ul~oses of clarity of underst~n~ling, it will be obvious that certain modifications may be practiced within the scope of the appended claims.

Claims (30)

WHAT IS CLAIMED IS:

1. A method of inhibiting .beta.-amyloid peptide production in cells producing .beta.-amyloid peptide, comprising administering to such cells an inhibitory amount of a compound of formula I:

I

wherein:
R is selected from the group consisting hydrogen, alkyl of from 1 to 6 carbon atoms, and where R and R2 are joined to form a ring structure of from 4 to 10 carbon atoms, R' is selected from the group consisting hydrogen, alkyl of from 1 to 6 carbon atoms and where R' and R3 are joined to form a ring structure of from 4 to 10 carbon atoms, R1 is selected from the group consisting of alkyl of from 1 to 4 carbon atoms substituted with from 1 to 5 substituents selected from the group consisting of (a) aryl of from 6 to 10 carbon atoms, (b) aryl of from 6 to 10 carbon atoms substituted with 1 to 3 substituents selected from the group consisting of alkyl of from 1 to 6 carbon atoms, aryl of from 6 to 10 carbon atoms, alkoxy of from 1 to 6 carbon atoms, aryloxy of from 6 to 10 carbon atoms, hydroxy, cyano, halo and amino, (c) cycloalkyl of from 3 to 8 carbon atoms and (d) heterocycles of from 3 to 14 carbon atoms having from 1 to 3 heteroatoms selected from the group consisting of nitrogen, oxygen and sulfur wherein said substituted alkyl group is optionally further substituted with from 1 to 2 hydroxyl groups, alkenyl of from 2 to 4 carbon atoms substituted with from 1 to 4 substituents selected from the group consisting of (a) aryl of from 6 to 10 carbon atoms, (b) aryl of from 6 to 10 carbon atoms substituted with 1 to 3 substituent selected from the group consisting of alkyl of from 1 to 6 carbon atoms, aryl of from 6 to 10 carbon atoms, alkoxy of from 1 to 6 carbon atoms, aryloxy of from 6 to 10 carbon atoms, hydroxy, cyano, halo and amino, (c) cycloalkyl of from 3 to 8 carbon atoms and (d) heterocycles of from 3 to 14 carbon atoms having from 1 to 3 heteroatoms selected from the group consisting of nitrogen, oxygen and sulfur, aryl of from 6 to 10 carbon atoms, aryl of from 6 to 10 carbon atoms substituted with 1 to 3 substituents selected from the group consisting of alkyl of from 1 to 6 carbon atoms, aryl of from 6 to 10 carbon atoms, alkoxy of from 1 to 6 carbon atoms, aryloxy of from 6 to 10 carbon atoms, hydroxy, cyano, halo and amino, fluorenyl, heterocycles of from 3 to 14 carbon atoms having from 1 to 3 heteroatoms selected from the group consisting of nitrogen, oxygen and sulfur;
R2 and R3 are independently D- or L-amino acid side chains of at least 2 carbon atoms with the proviso that said amino acid side chains do not include the proline side chain;
R4 is selected from the group consisting of -C(O)CH=N=N, -CH2OH, -C=NOH, and -C(O)R5 where R5 is hydrogen, alkyl of from 1 to 6 carbon atoms, haloalkyl of from 1 to 6 carbon atoms and 1 to 2 halo groups, alkoxy of from 1 to 6 carbon atoms, -NR6R7 where R6 and R7 are independently selected from the group consisting of hydrogen and alkyl of from 1 to 6 carbon atoms, and -N(CH3)OCH3;
X is selected from the group consisting of -O-, -NR9-, and -S- where R9 is selected from the group consisting of hydrogen, alkyl of from 1 to 6 carbon atoms and aryl of from 6 to 10 carbon atoms;

Y is selected from the group consisting of -C(O)- and -C(S)-;
m is equal to zero or one; and n is equal to zero to two, or pharmaceutically acceptable salts thereof with the proviso that when R1 is 1-naphthyl, R2 is -CH(CH3)2 (L-isomer), R3 is -CH2~ (L-isomer), Y is -C(O)-, m is zero and n is one, then R4 is not -N(CH3)OCH3, with the further proviso that when R1 is diphenylmethyl, R2 is p-(benzyloxy)benzyl (L-isomer), Y is -C(O)-, and m and n are zero, then R4 is not -N(CH3)OCH3, and with still the further proviso that when R1 is (1,2-diphenyl)ethenyl, Y is -C(O)-, R2 is -CH2~ (L-isomer), and m and n are zero, the R4 is not -N(CH3))OCH3.

2. The method of claim 1, wherein R1 is alkyl of from 1 to 4 carbon atoms substituted with from 1 to 5 substituents selected from the group consisting of aryl of from 6 to 10 carbon atoms.

3. The method of claim 1, wherein R1 is selected from the group consisting of benzyl, trityl, diphenylmethyl, 4-phenylbutyl, 2-phenylethyl, naphthyl, and pyridyl.

4. The method of claim 1, wherein R2 is selected from the group consisting of the d- and l-isomers of valine, leucine, phenylalanine, tryptophan and isoleucine.

5. The method of claim 1, wherein R3 is selected from the group consisting of the d- and l-isomers of valine, leucine, phenylalanine, tryptophan and isoleucine.

6. The method of claim 1, wherein R4 is selected from the group consisting of -C(O)CH=N=N or-C(O)H.

7. The method of claim 1, wherein said compound is

8. The method of claim 1, wherein said compound is

9. The method of claim 1, wherein said compound is

10. The method of claim 1, wherein said compound is

11. The method of claim 1, wherein said compound is

12. The method of claim 1, wherein said compound is

13. The method of claim 1, wherein said compound is

14. The method of claim 1, wherein said compound is

15. The method of claim 1, wherein said compound is

16. The method of claim 1, wherein said compound is

17. The method of claim 1, wherein said compound is

18. The method of claim 1, wherein said compound is

19. The method of claim 1, wherein said compound is

20. The method of claim 1, wherein said compound is

21. A method of inhibiting the deposition of amyloid plaque in a mammal, comprising administering to such mammal an effective amount of a compound of Formula I as defined in claim 1

22. A method of preventing or treating Alzheimer's disease (AD) in a mammal, comprising administering to a mammal in need thereof an effective amount of a compound of Formula I as defined in claim 1.

23. A method for screening test compounds for the ability to inhibit the release of .beta.-amyloid peptide (.beta.AP) from cells, said method comprising:

exposing an oligopeptide to Cathepsin Y under conditions wherein the Cathepsin Y will cleave a carboxy terminal amino acid of the oligopeptide;
and detecting such cleavage in the presence of the test compound, wherein absence of cleavage indicates that the test compound inhibits the production of .beta.AP.

24. A method as in claim 23, wherein the oligopeptide cleavage is detected by reaction of o-pthalaldehyde with a free amino terminus released by the cleavage in the presence of .beta.-mercaptoethanol at elevated pH.

25. An isolated and purified polypeptide having an enzyme activity which is the same as that possessed by the polypeptide of FIG. 4.

26. The isolated and purified polypeptide of Claim 25, having the amino acid sequence set forth in FIG. 4.

27. An isolated and purified nucleic acid sequence which sequence encodes for Cathepsin Y.

28. An isolated and purified nucleic acid sequence capable of hybridizing to Cathepsin Y which sequence is selected from the group consisting of:
a) a nucleic acid sequence substantially homologous to the sequence of FIG. 4, wherein T can also be U, b) a nucleic acid sequence substantially complementary to the sequence of FIG. 4, wherein T can be U, and c) fragments of the sequence of FIG. 4 that are at least 12 bases in length and that do not hybridize to the nucleic acid of sequences encoding cathepsin genes other than Cathepsin Y but which will selectively hybridize to mammalian DNA encoding Cathepsin Y.

29. A method for expressing Cathepsin Y which method comprises a) transfecting a host cell with a nucleic acid sequence which sequence encodes for Cathepsin Y, b) culturing the transfected cell under conditions which express Cathepsin Y, and c) recovering Cathepsin Y from the cell culture.

30. A method of detecting the expression of Cathepsin Y comprising a) isolating RNA from a mammalian tissue or cell, b) hybridizing to the isolated RNA a labelled nucleic acid sequence capable of hybridizing to Cathepsin Y which sequence is selected from the group consisting of i) a nucleic acid sequence substantially homologous to the sequence of FIG. 4, wherein T can also be U, ii) a nucleic acid sequence substantially complementary to the sequence of FIG. 4, wherein T can be U, and iii) fragments of the nucleic acid sequence of FIG.
4 that are at least 12 bases in length and that do not hybridize to the nucleic acid of sequences encoding cathepsin genes other than Cathepsin Y but which will selectively hybridize to mammalian DNA encoding Cathepsin Y, and c) determining whether the labelled nucleic acid sequence binds to the isolated RNA.