JPH11506923A - New cathepsins and methods and compositions for their inhibition - Google Patents

Abstract

  (57) [Summary] Methods for inhibiting β-amyloid peptide (βAP) secretion from cells include administering to the cells a specific compound that inhibits the activity of a protease of about 31 kD that is involved in βAP secretion. The 31 kD protease has been referred to as cathepsin Y. Screening methods for βAP inhibitors rely on determining the activity of the test compound in the presence of cathepsin Y and a suitable peptide substrate. The present invention also relates to the nucleic acid sequences encoding cathepsin Y and the expression and isolation of cathepsin Y.

Description

DETAILED DESCRIPTION OF THE INVENTION         New cathepsins and methods and compositions for their inhibition                                Background of the Invention Field of the invention   The present invention generally inhibits production of β-amyloid peptide (βAP) in cells Methods and compositions. In particular, the invention inhibits βAP intracellular production And methods for inhibiting βAP production. It relates to the use of the compounds.   The present invention also relates to a new carboxypeptidase that is involved in the production of βAP, It relates to a new protein, cathepsin Y, which has been released. The isolation of this protein Methods are provided. DNA isolates encoding cathepsin Y and Such a method of obtaining DNA may be useful for cathepsin Y in therapeutic or diagnostic compositions. It is provided with an expression system for recombinant production. Technology status   Alzheimer's disease (AD) is clinically Progression of memory, cognition, reasoning, judgment, and emotional stability leading to death Is a degenerative brain disorder characterized by loss of AD is progressive mental failure in the elderly (Dementia) and is the fourth most common cause in the United States It is believed to represent a significant cause of medical death. AD is found in races and ethnic groups worldwide And presents major current and future public health issues. The disease is currently It is estimated that about 2 to 3 million individuals are affected in the United States alone. AD It is an incurable disease for now. Effectively prevents AD or its symptoms and course There is currently no known action to reverse.   The brain of an individual suffering from AD has senescent (or amyloid) plaque, amyloid blood vessels Disorders (amyloid deposits in blood vessels) and characteristic lesions called neurofibrillary tangles Is shown. These lesions, especially amyloid plaques and neurofibrillary tangles, are commonly Many areas of the human brain are important for memory and cognitive function in AD patients Be discovered. With a more restricted anatomical distribution, a smaller number of these lesions It is also found in the brains of most elderly people without clinical AD. Amyloid puller And amyloid vasculopathy also include trisomy 21 (Down syndrome) and It is also a feature of the brain of patients with hereditary cerebral hemorrhage associated with gender type amyloidosis (HCHWA-D) . At present, the definitive diagnosis of AD involves the tissue in the brain of patients who have died of the disease, Or a small biopsy specimen of brain tissue taken during an invasive or rarely invasive neurosurgical procedure It is required that the above-mentioned lesions be observed.   Amyloid plaques and blood vessels characteristic of AD and other disorders mentioned above The major chemical component of amyloid deposits (amyloid vasculopathy) is β-amyloid Peptide (βAP), or about 39-43, sometimes called Aβ, AβP or β / A4 It is a protein of about 4.2 kilodaltons (kD) of amino acids. βAP is approximately 39-43 Large amino acid residues, referred to herein as β-amyloid precursor protein (APP) It is a fragment of glycoprotein that spans the membrane. Flag of this protein Is first purified, and the partial amino acid sequence is determined by Glenner and Wong, Bioch. em. Biophys. Res. Commun. 120: 885-890 (1984). First 28 Isolation procedures and sequence data for the amino acids of U.S. Pat. It has been described.   βAP can be obtained by SDS polyacrylamide gel electrophoresis or high-performance liquid chromatography. It is further characterized by its relative mobility in HPLC (HPLC). βAP is Filament polymerization of amyloid showing Congo Red and Thioflavin-S dye binding properties It can exist in body form. βAP is expressed in a non-filamentous form (“preamyloid” or “ "Amorphous" or "sporadic" deposits); No detectable birefringent staining with red occurs. Insoluble from meningeal vessels A portion of this protein in its form is described in U.S. Pat.No. 4,666,829. ing.   APP is usually produced by cells in numerous tissues of various animals, including humans. Be born. APP is encoded by a gene on the long arm of human chromosome 21. Call APP Knowledge of the structure of the genes that Peptide fragments from cleavage of APP by an unspecified protease It was shown to occur. This cleavage is likely to occur in the lysosome. The βAP fragment is cleaved from APP and subsequently deposited as amyloid plaque More precise biochemical pathways are still being studied.   Several lines of evidence suggest that progressive brain deposition of βAP may Play a fundamental role and can precede cognitive symptoms by years or decades (For a review, see Selkoe (1991), Neuron 6: 487) See). Recently, βAP was released from neurons grown in culture as well as from normal It has been shown to be released into the cerebrospinal fluid of both individuals and AD patients.   Some heritable mutations occurring in the APP gene also cause AD and AD-related diseases. It is also known to cause it. For example, amino acid 7 of the 770-amino acid isoform of APP Missense DNA mutation at 17 has a genetically determined (familial) form of AD Can be found in affected members of some families but not affected Cannot be discovered by members (Goate et al., Nature 349: 704-706 (1991); ChartierHa rlan et al., Nature 353: 844-846 (1991); and Murrell et al., (1991) Science 254: 97-. 99). Lysine found in Swedish family⁵⁹⁵-Methionine⁵⁹⁶The aspa Lagin⁵⁹⁵-Leucine⁵⁹⁶Double mutation (695-amino acid isoform of APP) Is reported in 1992 (Mullan et al., (1992) Nature Genet 1: 345-34). 7), and are called Swedish mutants or mutations.   By analyzing genetic linkage, these mutations and identification within the APP gene Other mutations in AD specific molecules in affected members of such families It was proved to be the cause. In addition, amino acids of the 770 amino acid isoform APP A mutation in acid 693 has been identified as the cause of the disease HCHWA-D due to βAP deposition, and The change from alanine to glycine at amino acid 692 is associated with AD in some patients. Causes a phenotype similar but HCHWA-D in other patients It seems to be. See Younkin et al., Science 259: 514-516 (1993).   Gained in understanding the mechanisms underlying AD and other βAP-related diseases Despite advances that have been made, there is a need to develop compositions and methods for the treatment of disease. The need remains.                                 Summary of the Invention   The present invention relates, in part, to β-amyloid in cells that produce β-amyloid peptide. A method for inhibiting the production of id peptide. Specifically, the method of the present invention In some cases, certain compounds emit β-amyloid peptides, as defined below. It is effective in inhibiting the production of β-amyloid peptide in appearing cells. About discovery. β-amyloid peptide production is amyloid in mammals. Doppler deposition and related to Alzheimer's disease in humans The compounds described herein inhibit the deposition of such plaques, and It is also useful in treating Zuheimer's disease.   The present invention further provides for the identification of a new protease, Cathepsin Y, It relates in part to nucleic acids encoding proteases. The present invention also relates to cathepsin Y It relates to a method for recombinant expression.   Accordingly, the present invention provides in one of its method aspects a β-amyloid peptide In a producing cell, a method for inhibiting the production of β-amyloid peptide, This method involves the following Formula I: An inhibitory amount of the compound or a pharmaceutically acceptable salt thereof is administered to such cells. Including the step of here:   R is hydrogen, alkyl of 1 to 6 carbon atoms, and R and R^TwoAre combined to 4 ~ Selected from the group consisting of forming a ring structure of 10 carbon atoms,   R 'is hydrogen, alkyl of 1 to 6 carbon atoms, and R' and R3 are Selected from the group consisting of forming a ring structure of up to 10 carbon atoms,   R¹But,     (a) aryl of 6 to 10 carbon atoms, (b) alkyl of 1 to 6 carbon atoms, 6 Aryl of 10 to 10 carbon atoms, alkoxy of 1 to 6 carbon atoms, 6 to 10 carbon atoms Group consisting of aryloxy, hydroxy, cyano, halo, and amino Aryl of 6 to 10 carbon atoms substituted with 1 to 3 substituents selected from: (c) cycloalkyl of 3 to 8 carbon atoms, and (d) nitrogen, oxygen and sulfur A heterocyclic group of 3 to 14 carbon atoms having 1 to 3 heteroatoms selected from the group consisting of: 1 to 4 carbon atoms substituted with 1 to 5 substituents selected from the group consisting of Child alkyl,   Wherein the substituted alkyl group is optionally substituted with one to two hydroxyl groups. Further substituted with a group,     (a) aryl of 6 to 10 carbon atoms, (b) alkyl of 1 to 6 carbon atoms, 6 Aryl of 10 to 10 carbon atoms, alkoxy of 1 to 6 carbon atoms, 6 to 10 carbon atoms Group consisting of aryloxy, hydroxy, cyano, halo, and amino Aryl of 6 to 10 carbon atoms substituted with 1 to 3 substituents selected from: (c) cycloalkyls of 3 to 8 carbon atoms, and (d) nitrogen, oxygen and sulfur A group of 3 to 14 carbon atoms having 1 to 3 heteroatoms selected from the group consisting of 2 to 4 carbon atoms substituted with 1 to 4 substituents selected from the group consisting of Alkenyl of an atom,     Aryl of 6 to 10 carbon atoms,     Alkyl of 1 to 6 carbon atoms, aryl of 6 to 10 carbon atoms, 1 to 6 An alkoxy of 6 carbon atoms, an aryloxy of 6 to 10 carbon atoms, hydroxy, Substituted with 1 to 3 substituents selected from the group consisting of cyano, halo, and amino Aryl of 6 to 10 carbon atoms,     Fluorenyl,     1 to 3 heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur A heterocyclic ring of 3 to 14 carbon atoms,   Is selected from the group consisting of:   R^TwoAnd R^ThreeMust independently include no proline side chain in the amino acid side chain. A D- or L-amino acid side chain of at least 2 carbon atoms, provided that   R^FourIs     −C (O) CH = N = N,     −CH_TwoOH,     −C = NOH, and     −C (O) R^Five(Where R^FiveIs hydrogen, alkyl of 1 to 6 carbon atoms, 1 to 6 A haloalkyl of 1 to 2 halo groups, an alha of 1 to 6 carbon atoms Koxy, -NR⁶R⁷(Where R⁶And R⁷Is independently hydrogen and 1 to 6 carbon atoms And -N (CH_Three) OCH_ThreeIs) ,   Is selected from the group consisting of:   X is -O-, -NR⁹-, And -S- (where R⁹Is hydrogen, an alkyl of 1 to 6 carbon atoms Selected from the group consisting of kill and aryl of 6 to 10 carbon atoms) Selected from the group consisting of:   Y is selected from the group consisting of -C (O)-and -C (S)-;   m is equal to zero or one; and   n is equal to 0-2,   Where R^lIs l-naphthyl and R^TwoIs -CH (CH_Three)_Two(L-isomer) and R^ThreeBut -CH_Two φ (L-isomer), Y is -C (O)-, m is zero, and n is 1 If R^FourIs -N (CH_Three) OCH_ThreeNot, and R¹Is diphenylmethyl, and R^Two Is p- (benzyloxy) benzyl (L-isomer), Y is -C (O)-, and If m and n are zero, then R^FourIs -N (CH_Three) OCH_ThreeNot, and even R¹ Is (1,2-diphenyl) ethenyl, Y is -C (O)-, and R is^TwoBut -CH_Twoφ (L-isomer Field) and if m and n are zero, then R^FourIs -N (CH_Three) OCH_ThreeNot And   In another of its method aspects, the invention relates to a method for preparing amyloid in a mammal. A method of inhibiting the deposition of Doppler plaque, comprising administering an effective amount of a compound of formula I as described above And administering to such a mammal.   In yet another method aspect, the present invention relates to a method for treating Alzha in a mammal. A method of preventing, treating, or inhibiting the onset of Immer's disease (AD), comprising: Administering an effective amount of a compound of formula I to a mammal as described above. You.   Preferred compounds for use in the methods described herein include: By way of example, including all its isomers, the following chemical formula as defined in Formula II below Compounds are included. Where R^TwoAnd R^ThreeThe amino acid side chain for is R^TwoAnd R^ThreeReplace Shown below the group;   In one of its product aspects, the invention relates to an enzyme for the cathepsin Y protein. The present invention relates to isolated and purified polypeptides having activity.   In another product aspect, the invention encodes cathepsin Y Purified and isolated and relates to nucleic acid sequences.   In yet another product aspect, the invention provides: a) a nucleic acid sequence substantially homologous to the nucleic acid sequence of FIG. 4, wherein T may also be U; b) a nucleic acid sequence substantially complementary to the sequence of FIG. 4, wherein T may also be U; Or c) a cathepsin of at least 12 bases in length and other than cathepsin Y It does not hybridize to the nucleic acid sequence encoding the gene, but cathepsin Y The nucleic acid of FIG. 4 that selectively hybridizes to the encoding DNA, where T may also be U A fragment of the nucleic acid sequence complementary to the sequence or the sequence of FIG. A purified and isolated nucleic acid sequence capable of hybridizing to cathepsin Y comprising About the columns.   In another aspect of the present invention, the present invention relates to a nucleus encoding cathepsin Y. Transfecting a host cell with an acid sequence, comprising expressing cathepsin Y; Culturing the transfected cells under the conditions, and A method for expressing cathepsin Y, comprising recovering tepsin Y. I do.   In another of its method aspects, the invention provides a) isolating RNA from mammalian tissues or cells; b) For the isolated RNA,     i) a nucleic acid sequence substantially homologous to the nucleic acid sequence of FIG. 4, wherein T may also be U;    ii) a nucleic acid sequence substantially complementary to the sequence of Figure 4, wherein T may also be U, Or   iii) at least 12 bases in length and other cathepsin gene nuclei Mammalian DN that does not hybridize to the acid sequence but encodes cathepsin Y The nucleic acid sequence of FIG. 4 which selectively hybridizes to A, wherein T may also be U Is a fragment of the nucleic acid sequence complementary to the sequence of FIG. 4, And a labeled nucleic acid sequence capable of hybridizing to cathepsin Y. The process of bridging, c) determining whether the labeled nucleic acid sequence binds to the isolated RNA And a method for detecting the expression of cathepsin Y.                              BRIEF DESCRIPTION OF THE FIGURES Figures 1 and 2 are used to prepare some of the compounds described herein. Shows the reaction scheme used. 3A-3C are representatives of cathepsin Y analyzed by Western blotting. 1 shows a typical purification profile. 4A-4E show the amino acid (SEQ ID NO: 3) and DNA sequence (sequence of human cathepsin Y) Number 2) is drawn. FIG. 5 shows a restriction map of plasmid poCK751. FIG. 6 shows a restriction map of plasmid poCKcatY. FIG. 7 illustrates a standard OPA curve for fluorescence with varying concentrations of valine. You.                           Description of the preferred embodiment   The present invention provides, in part, certain compounds for cells that produce β-amyloid peptide. Of the production of β-amyloid peptide in these cells This inhibition delays the deposition of amyloid plaques and in mammals It can be used to treat Alzheimer's disease.   The present invention also provides, in part, the identification of a new protein, Cathepsin Y, and And nucleic acids encoding this protein. The invention also relates to the set of cathepsins Y The present invention relates to a method for recombinant expression.   However, before discussing the present invention in further detail, the following terms are first defined: RU:Definition   The following terms and phrases appearing in the description and claims are intended to Is defined as   As used herein, the term “β-amyloid peptide (βAP)” refers to AD, down In the brains of subjects suffering from the syndrome, HCHWA-D and some normal elderly subjects, Senile (amyloid) plaque and amyloid deposits in blood vessels of the cerebellum and meninges Of amyloid filament subunits including substances (amyloid angiopathy) About 4.2 kD protein. βAP can exist in a filamentous polymer form (this In form, βAP is amyloid's Congo Red and Thioflavin-S dye-binding properties Is shown). βAP also causes non-filamentous bears (“preamyloid” or “amorphous "Shape" or "sporadic" deposits), in this form No detectable birefringent staining occurs. An insoluble form obtained from meningeal vessels The entire disclosure of which is incorporated herein by reference. No. 4,666,829.   As used herein, “βAP” refers, in particular, to those described in the '829 patent. Is substantially homologous to the form of the peptide produced by the method, but Fluids in humans and other mammals, including both individuals with And soluble form in extracellular fluid (conditioned medium) of cultured cells grown in vitro A peptide of about 39 to 43 amino acids which can also be found in the form of a peptide. Therefore, βAP Also refers to the related βAP sequence resulting from mutations in the βAP region of the normal gene .   In any form, βAP is encoded by a gene on the long arm of human chromosome 21. A large membrane-bound sugar called β-amyloid precursor protein (APP) About 39-43 amino acid fragments of the protein. βAP is also SDS-poly Acrylamide gel electrophoresis or its phase in high performance liquid chromatography. Characterized by reciprocal mobility. The 43 amino βAP acid sequence (SEQ ID NO: 1) Is as follows: βAP also refers to a sequence substantially homologous to this 43 amino acid sequence.   As used herein, the term “β-amyloid precursor protein” (APP) Human on the long arm of chromosome 21, containing βAP within one-third of the carboxyl in length Encoded by a gene with the same name localized in Is defined as APP is responsible for a wide variety of cells in many mammalian tissues. Is a glycosylated single-membrane protein expressed in Current Examples of certain APP isotypes known to exist in humans include: Described by Kang et al., Nature 325: 733-736 (1987), referred to as "normal" APP. 695-amino acid polypeptides; Ponte et al., Nature 331: 525-527, and Tanzi et al. , 751-amino acid polypeptides described by Nature 331: 528-530 (1988); And 770-amino acids described by Kitaguchi et al., Nature 331: 530-532 (1988). There are polypeptides. Examples of specific variants of APP include both positional and phenotypic Point mutations that may differ in rdy, Nature Genet., 1: 233-234 (1992)).   As used herein, the term “βAP-related disease” refers to Alzheimer's disease (home disease). Tribe, Alzheimer's disease), Down's syndrome, HCHWA-D, and progressive brain It is defined as including age.   As used herein, the terms “conditioned culture medium” and “culture medium” refer to tissue culture media. Surround cells grown in vitro (in vitro) and, among other components, cells An aqueous extracellular fluid containing secreted proteins and peptides.   As used herein, the term "body fluid" includes, in particular, blood, cerebrospinal fluid (CSF), urine, and Mammals can contain measurable amounts of βAP and βAP fragments, including serum and peritoneal fluid Refers to the fluid of the host. The term "blood" refers to whole blood as well as plasma and serum.   The term "Swedish mutation" refers to hereditary familial Alzheimer's disease Refers to a mutation in the human gene encoding APP that results in morphology. Mutation is normal A LYS of PP gene₅₉₅-MET₅₉₆Occurs in the here ASN₅₉₅-LEU₅₉₆Substitution occurs. A human cell line transfected with this mutation overproduces βAP, Has been found to secrete into the conditioned culture medium.   The term "3 to 14 carbon atoms and selected from the group consisting of nitrogen, oxygen, and sulfur A heterocycle containing from 1 to 3 heteroatoms selected is selected from the group consisting of the required number of carbon atoms and Refers to saturated and unsaturated heterocyclic groups having a hydrogen atom. Suitable heterocyclic groups include, for example, As frazanil, furyl, imidazolidinyl, imidazolidinyl , Imidazolinyl, indolyl, isothiazolyl, isoxazolyl, morpho Linyl (eg, morpholino), oxazolyl, piperazinyl (eg, 1-piperazi Nil), piperidyl (eg, l-piperidyl, piperidino), pyranyl, pyrazini , Pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyridyl, Limidinyl, pyrrolidinyl (eg l-pyrrolidinyl), pyrrolinyl, pyrrolyl, Quinoxalinyl, thiadiazolyl, thiazolyl, thienyl, thiomorpholinyl ( Eg thiomorpholino), triazolyl, and xanthanilyl Is included. These heterocyclic groups may be substituted or unsubstituted. The heterocyclic group is When substituted, the substituents are alkyl of 1 to 6 carbon atoms, 1 to 6 carbon atoms Alkoxy, aryl of 6 to 10 carbon atoms, aryl of 6 to 10 carbon atoms Selected from oxy, and halo.   Preferred heterocycles include well-known cyclic aromatic groups containing a heteroatom in the cyclic structure. included. Such groups include, by way of example, furyl, imidazolyl, oxazo Ryl, pyrazolyl, pyridyl, pyrimidinyl, thiazolyl, and triazolyl Is included.   The term “alkyl” refers to methyl, ethyl, n-propyl, isopropyl, n-butyl , Tertiary butyl, secondary butyl, isobutyl, n-pentyl, n-hexyl, 2-methyl Refers to straight and branched chain alkyl groups such as rupentyl and the like; "Xy" refers to the -O-alkyl substituent.   The term "aryl" includes carbon and hydrogen such as phenyl, naphthyl, and the like Refers to an aromatic substituent, while the term aryloxy refers to an -O-aryl substituent Wherein aryl is defined as above.   The terms “halo” or “halogen” refer to fluorine, chlorine, bromine, and iodine, And preferably fluorine and chlorine.   The term "pharmaceutically acceptable salt" is prepared by methods well known in the art. Sodium, potassium, lithium, calcium, magnesium, barium Commonly used in the pharmaceutical industry, including zinc, ammonium, and protamine zinc salts Refers to non-toxic alkali metal, alkaline earth metal, and ammonium salts . The term also refers to reacting a compound of the present invention with a suitable organic or inorganic acid. As well as non-toxic acid addition salts generally prepared by As typical salts, salt Acid salt, hydrobromide, sulfate, bisulfate, acetate, oxalate, valerate, oleate Inate, laurate, borate, benzoate, lactate, phosphate, tosylate Tosylate, citrate, maleate, fumarate, succinate, tartrate , And napsylate salts and the like. The particular salt used is It does not matter.   The term "DNA" refers to deoxyribonucleic acid. The term "RNA" refers to ribonucleic acid.   The naturally occurring amino acid residues in the peptides described herein are IU As recommended by the PAC-IUB Biochemical Nomenclature Commission, Abbreviated: phenylalanine is Phe or F; leucine is Leu or Or L; isoleucine is Ile or I; methionine is Met or M Yes; norleucine is Nle; valine is Val or V; serine is Ser or Or S; proline is Pro or P; threonine is Thr or T Alanine is Ala or A; tyrosine is Tyr or Y; histidine is Glutamine is Gln or Q; Asparagine is Asn or Is N; lysine is Lys or K; aspartic acid is Asp or D Glutamic acid is Glu or E; cysteine is Cys or C; Tophan is Trp or W; arginine is Arg or R; Is Gly or G.   Naturally occurring nucleosides within the nucleic acids described herein are IUPAC-IU B As recommended by the Biochemical Nomenclature Commission, Omitted: A for adenosine; G for guanosine; C for cytidine; T for thymidine; And uridine is U. If the nucleotide is cytidine or thymidine (uridine Abbreviation is Y; adenosine or guanosine is R; Adenosine or thymidine (uridine) is W; adenosine or cytidine is M; And guanosine or thymidine (uridine) is K.   The term "cathepsin Y" as used herein is defined by the gene of the same name. Is defined as a polypeptide encoded by Cathepsin Y is a molecule of about 31 kD Carboxypeptidase in a quantity. Cathepsin Y is an aliphatic carboxy Cleaving the carboxy terminal amino acid with specific activity on the terminal amino acid Can be. Preferably, cathepsin Y is a qualitative organism common to cathepsin Y of FIG. 4. More than about 70% homology with the cathepsin Y sequence of FIG. Or more than 85% homology, and most preferably more than 90% homology Is a polypeptide. Cathepsin Y of the present invention is substantially homologous to the sequence of FIG. Thus, typically, cathepsin Y has at least one of the biological activities of cathepsin Y of FIG. Greater than 90% homology, preferably greater than 95%, provided that portions are retained Intended to have a lot of homology, and sometimes more than 99% homology .   Within the scope of the term “cathepsin Y” as used herein, FIG. A protein having an amino acid sequence as shown in FIG. And non-glycosylated derivatives, and homologous production of cathepsin Y Mutants and derivatives made. However, in this case, the modification is cathepsin of FIG. And the common biological activity is not destroyed.   "Homologous" aligns sequences and achieves maximum percentage homology if necessary A residue identical to a residue in the disclosed sequence after introducing a gap to Defined as the percentage of residues in the complement sequence. The nucleic acid sequence has more than 80% Homosexual, preferably greater than 90% homology, and most preferably greater than 95% homology If so, they are substantially homologous to the nucleic acid sequence of the disclosed sequences.   "Complementary" refers to the ability of a nucleic acid sequence to hybridize to a disclosed nucleic acid sequence. Defined as force. The nucleic acid sequence is such that the sequence aligns the sequence and Introduce gaps to achieve maximum complementarity and increase To the disclosed nucleic acid sequences if they can hybridize to Complementary ". Preferably, substantially complementary sequences are greater than 90%, most preferably Or more than 95% complementarity.   Cathepsin Y biological activity is derived from peptides without endopeptidase activity. Defined as sequential removal of the carboxy terminal amino acid (one amino acid at a time) You.   The term “transformation” is used as an extrachromosomal element or by chromosomal integration. The DNA into the organism or host cell so that the DNA is replicable To do.   The term "transfection" refers to the introduction of DNA into a host cell. Tran It is thought that the coding sequence can be expressed in the transfected cells. Have been. One skilled in the art will appreciate the numerous transfection methods (eg, CaPO_FourAnd And electroporation) are known. II.β-amyloid production suppressor   The present invention relates, in part, to inhibiting intracellular β-amyloid (βAP) secretion. Is based on the finding of the compound in which The present invention inhibits βAP secretion in cells, Provided are methods for inhibiting plaque deposition and treating Alzheimer's disease .   In one embodiment, the present invention provides a compound of formula I: An inhibitory amount of the compound or a pharmaceutically acceptable salt thereof to cells producing βAP. Inhibit the production of β-amyloid peptide in such cells, including Provide a way to harm.   In formula I, R is hydrogen or alkyl of 1 to 6 carbon atoms Or R^TwoAnd can form a ring structure of 4 to 10 carbon atoms, and R ′ is hydrogen, alkyl of 1 to 6 carbon atoms, or R ′^ThreeCombined with To form a ring structure of 4 to 10 carbon atoms. Preferably, in formula I R and R 'are hydrogen.   R¹Is aryl of 6 to 10 carbon atoms, alkyl of 1 to 6 carbon atoms, 6 to Aryl of 10 carbon atoms, alkoxy of 1 to 6 carbon atoms, 6 to 10 carbon atoms From the group consisting of the atoms aryloxy, hydroxy, cyano, halo and amino Aryl of 6 to 10 carbon atoms substituted with selected 1 to 3 substituents, 3 to 3 The group consisting of cycloalkyls of 8 carbon atoms and nitrogen, oxygen and sulfur A heterocyclic ring of 3 to 14 carbon atoms having 1 to 3 heteroatoms selected from Of 1-4 carbon atoms substituted with 1-5 substituents selected from the group consisting of Alkyl (wherein the substituted alkyl group is optionally substituted with one or two Further substituted with a droxyl group);   Aryl of 6 to 10 carbon atoms, alkyl of 1 to 6 carbon atoms, 6 to 10 Aryl of carbon atoms, alkoxy of 1 to 6 carbon atoms, of 6 to 10 carbon atoms Selected from the group consisting of aryloxy, hydroxy, cyano, halo and amino Aryl of 6 to 10 carbon atoms substituted with 1 to 3 substituents, 3 to 8 Selected from the group consisting of cycloalkyls of carbon atoms and nitrogen, oxygen and sulfur A heterocyclic ring of 3 to 14 carbon atoms having 1 to 3 heteroatoms Alk of 2 to 4 carbon atoms substituted with 1 to 4 substituents selected from Nil,   Aryl of 6 to 10 carbon atoms,   Alkyl of 1 to 6 carbon atoms, aryl of 6 to 10 carbon atoms, 1 to 6 Alkoxy of carbon atoms, aryloxy of 6 to 10 carbon atoms, hydroxy, Substituted with 1 to 3 substituents selected from the group consisting of ano, halo and amino Aryl of 6 to 10 carbon atoms,   Fluorenyl, and   Has 1 to 3 heteroatoms selected from the group consisting of nitrogen, oxygen and sulfur A heterocyclic ring of 3 to 14 carbon atoms.   R¹Preferred meanings for benzyl, trityl, diphenylmethyl, 4-phenyl Enylbutyl, 2-phenylethyl, naphthyl, pyridyl, fluorenyl, xane And tanilyl.   R^TwoAnd R^ThreeIs independently D or L amino having at least 2 carbon atoms The side chain of the acid, where R^TwoAnd R^ThreeIs not proline. Such side chains have the formula H_Two NCHR₈R found on naturally occurring and synthetic amino acids of COOH⁸A substituent U. As a side chain of a naturally occurring amino acid, by way of example only,⁸Is (C H_Three) CH- (valine), (CH_Three)_TwoCHCH_Two-(Leucine), CH_ThreeCH_TwoCH (CH_Three)-(Isoleucine ), ΦCH_Two-(Phenylalanine), (3-indolyl) -CH_Two-(Tryptophan) , CH_ThreeSCH_TwoCH_Two-(Methionine), CH_ThreeCH (OH)-(threonine), p-HO-φ-CH_Two-(H Rosin), H_TwoNC (O) CH_Two-(Asparagine), H_TwoNC (O) CH_TwoCH_Two-(Glutamine), HOC (O) CH_Two-(Aspartic acid), HOC (O) CH_TwoCH_Two-(Glutamic acid), H_TwoNCH_TwoCH_TwoCH_TwoCH_Two (Lysine), H_TwoN C (NH) NHCH_TwoCH_TwoCH_Two-(Arginine), 4-imidazolyl-CH_2-(Histidine) Side chains that are L-isomers are included.   As the side chain of a synthetic amino acid, the D-isomer of the above-described naturally occurring amino acid R⁸Is an alkyl of 2 to 6 carbon atoms (where the alkyl group is naturally occurring Absent in amino acids) cycloalkyl of 3 to 8 carbon atoms, and Alkyl of 1 to 6 carbon atoms   Aryl of 6 to 10 carbon atoms,   Alkyl of 1 to 6 carbon atoms, alkoxy of 1 to 6 carbon atoms, 6 to 10 Aryl of 6 carbon atoms and aryloxy of 6-10 carbon atoms Aryl of 6 to 10 carbon atoms substituted with 1 to 3 substituents selected from And   Has 1 to 3 heteroatoms selected from the group consisting of nitrogen, oxygen and sulfur 1 to 2 positions selected from the group consisting of heteroaryl of 3 to 14 carbon atoms Alkyl substituted with a substituent (where the substituted alkyl group is a naturally occurring alkyl) Side chains that are not present in amino acids).   Preferred amino acid side chains include valine, leucine, phenylalanine, trip And D- and L-isomers of tophan and isoleucine.   R^FourIs -C (O) CH = N = N, -CH_TwoOH, -C = NOH and C (O) R^Five(Where R^FiveIs hydrogen, 1 Alkyl of 1 to 6 carbon atoms, 1 to 6 carbon atoms and 1 to 2 halo groups Loalkyl, alkoxy of 1 to 6 carbon atoms), = NR⁶R⁷(Where R⁶You And R⁷Is independently hydrogen, alkyl of 1 to 6 carbon atoms, 1 to 6 carbon atoms And -N (CH_Three) OCH_ThreeCan be Preferably, R^FourIs -CH = N = N or -C (O) H.   X is -O-, -NR⁹-, Or -S-, where R⁹Is hydrogen, 1-6 carbons Selected from the group consisting of alkyl of atoms and aryl of 6 to 10 carbon atoms . Preferably X is -O-.   Y can be -C (O)-or -C (S), and is preferably -C- (O)-.   m is an integer equal to zero or one, and n is an integer equal to 0-2. Like Alternatively, n is an integer equal to 0 or 1. III.Synthesis of β-amyloid suppressor   Generally, the compounds of the present invention are synthesized using standard techniques and reagents. this Bonds between the various groups in these compounds include, for example, amides, thiols Bonds to nitrogen atoms in amides, carbamates, thiocarbamates, ureas, thioureas, etc. Carbon atoms and the like. Methods and trials for forming such bonds Drugs are well known and are readily available. For example, March, Advanced Organic Ch emistry, 4th edition (Wiley 1992), Larock, Comprehensive Organic Transformatio ns (VCH 1989); and Furniss et al. and Furniss, Vogel's Textbook of Practica. l See Organic Chemistry, 5th Edition (Longman 1989), each of these Are incorporated herein by reference. In addition, any functional groups present Protection and deprotection may be required at various points in the synthesis of the clear compounds. Such techniques are well known (eg, Green and Wuts Protective Groups in O rganic Chemistry (Wiley 1992), incorporated herein by reference. Is done).   The synthesis of the compound of the present invention can be performed, for example, by using amino acids (when n is 0), dipepti Can start with n (if n is 1) or tripeptide (if n is 2) .   Reaction Scheme 1 below uses a dipeptide structure as a starting material, where n is 1, Y = -C (O)-and R^FourShows an example of the synthesis of a compound wherein is —C (O) H. However, if n is 0 or For compounds where is 2, amino acids are used as starting materials (if n is equal to 0) Is used or if n is equal to 2, the tripeptide is used With the exception of misalignment, we can use a similar composition. Understood.   As shown in Reaction Scheme 1, dipeptide 1 has R¹(X)_mEnd with C (O) -substituent Under conditions suitable to form an N-capped end dipeptide 2, R¹, X And m are defined as above, and Z is a suitable leaving group such as a halo group. At least stoichiometric R^l(X)_mReacts with C (O) Z. Or R¹(X)_mC (S) Z substituent Can be used to prepare compounds wherein Y is -C (S)-.   Conversion to alkyl or aryl ester, etc., depending on the reaction conditions used A conventional removable blocking group such as It may be necessary or desirable to protect the group. Similarly, for dipeptide 1 Amino acid side chain R^TwoAnd R^ThreeAny reactive substituents found above are conventionally removable Blocking with a suitable blocking group and subsequent deblocking are required.   The reaction eliminates any acid generated during the reaction, especially when Z is halo. For this purpose, it is carried out in the presence of a suitable inert diluent, typically in the presence of a base. Appropriate Examples of inert diluents are, by way of example only, methylene chloride, chloroform, Examples include toluene and pyridine. A suitable base is triethylamine , Diethylisopropylamine, pyridine and the like. The reaction is typically Is performed at about 0 ° C. to about 25 ° C., and is typically completed in about 1 to 12 hours. Get Dipeptide 2 can be obtained by conventional means such as distillation, chromatography, filtration, etc. Or aldehyde conversion without recovery and / or purification Converted to compound 3.   Dipeptide 2 was then prepared according to the method described in March or Larock (supra). Reduced to provide the desired aldehyde 3 by conventional methods such as Such methods include, for example, di- (isobutyl) aluminum hydride (DIBALH) (eg, For example, J. Gen. Chem. See USSR 34: 1021 (1964)) or di- (N-methylpi Perazinyl) aluminum hydride (see, for example, J. Org. Chem. 49: 2279 (1984)). ) And the alcohol 4 of the carboxyl group of dipeptide 2 by the reaction of Direct reduction to aldehyde followed by partial reoxidation to aldehyde. For example, See Luly et al., Journal of Organic Chemistry, 52 (8): 1487 et seq. (1987).   Alternatively, the aldehyde is, for example, an acid chloride using thionyl chloride, followed by For example, hydrogen and palladium catalysts, tri- (t-butoxy) aluminium hydride Lithium, sodium borohydride (alone or in pyridine or cadmium chloride) With reduction).   However, preferably, the carboxyl group of dipeptide 2 first corresponds to It is converted to N, O-dimethylhydroxamide 5, which is then converted, for example, to aluminum hydride Reduced by lithium to provide aldehyde 3. N, O-dimethylhydro The oxamide 5 is, for example, from about 10 ° C. to about 10 ° C. for a time sufficient to form an activated ester. At a stoichiometric amount of benzotriazole in an inert diluent at a temperature of 40 ° C. -l-yloxy-tris (dimethylamino) phosphonium hexafluorophosphine Reacting dipeptide 2 with sulfate (BOP) and 4-methylmorpholine Thus, it is formed. Suitable inert diluents are, by way of example only, N, N-dimensions. Tilformamide, pyridine and the like. This product is preferably recovered But rather convert the activated ester to N, O-dimethylhydroxylamide 5 Can be used for   The activated ester is used to form the desired N, O-dimethylhydroxylamide 5 At least a stoichiometric amount of N, O-dimethyl hydride at a temperature of about 10 ° C. to about 40 ° C. for a sufficient time N, O-dimethylhydroxylamine by reacting with Roxylamine hydrochloride Converted to Mid5. The resulting products are chromatographic, distillation, filtration, etc. Can be recovered by conventional methods or lithium aluminum hydride N, O-dimethylhydroxylamide by conventional reduction using a suitable reducing agent such as Can be used directly in the next step of the synthesis to convert aldehyde 5 to aldehyde 3.   For amino acids, after the above procedure, the corresponding N-protected N ', O-dimethylhydrido Conversion of commercially available N-protected amino acids (n = 0) to roxylamide and subsequent Reduction to aldehyde 3 is performed. The first step of this process is illustrated in FIG. And the N-protection to the corresponding N-protected N ', O-dimethylhydroxylamide 7 Protected amino acid 6 conversion. Preferably N-protection on such amino acids The group has the formula R¹(X)_mHaving C (O)-, whereby upon reduction, the resulting compound has the formula I, and in the case of FIG._TwoIndicated as OC (O)-. Or, however, N The protecting group can be removed in a conventional manner and the resulting free amine N ', O-dimension Tylhydroxylamide 8 to R¹(X)_mReacted with C (O) Z and then reduced to The compounds of formula I described above can be provided (not shown).   Obtained by deprotecting the N-protected N'O-dimethylhydroxylamide. The free amine N ', O-dimethylhydroxylamide 8 is also shown in FIG. Can be used to form compounds of formula I where n = 1, as Wear. Specifically, in this figure, the free amine 8 is attached to the bound R¹(X)_mC (O)-[Eg If φCH_TwoThe dimer 10 is coupled to the free acid of the amino acid 9 having an OC (O)-] group. Which can be formed by subsequent conventional conversion, for example with lithium aluminum hydride (LAH). Aldehyde 11 is formed on its own.   Conversion of aldehydes 3 and 11 to the corresponding oxime or the corresponding diazoketone Transposition can be accomplished using chemistry known in the art per se. An example For example, oxime formation involves the reaction of hydroxylamine with aldehydes 3 and 11. While the diazoketones were obtained from Shaw (Green, George D.J., Shaw, Elliot ( 1981) J. Biol. Chem. 256, 1923-1928) Was done.   Compounds 2 and 6 can be readily converted by art-recognized methods to give R^Five= Alkoxy and R from 1 to 6 carbon atoms^Five= -NR⁶R⁷(Where R⁶And R⁷Is German To hydrogen, alkyl of 1 to 6 carbon atoms, or alkyl of 6 to 10 carbon atoms. Reel). Similarly, compounds 2 and 6 are themselves known in the art. And the ketone (R^Five= 1 to 6 carbon atoms) Can be converted.   The starting materials used in Reaction Scheme 1 are known in the art . For example, dipeptide 1 is commercially available (eg, Bachem Bioscience, Inc., P hi ladelphia, PA), or “Synthetic Peptides: A  User's Guide, Grant (Freeman, 1992), Solid Phase Peptide Synthesis : A Practical Approach, edited by Atherton et al. (Oxford 1989) or "Optrcally Activ e γ-Amino Acids, '' as described in Williams (Pergammon 1989). It can also be synthesized from various standard procedures. Generally, a dipeptide is, for example, Either by the methods described above or by the Strecker method (eg, March or Williams, supra, By using known methods such as Amino acids (eg, Bachem or Aldricn, Milwaukee, WI).   Typically, the coupling of amino acids to form dipeptide 1 involves C N-terminal amino acid from the reaction of the terminal amino acid with the activated carboxyl group The alpha amino moiety and any other potentially reactive groups present on the side chain Locking is required. Conventional N-terminal amino protecting groups are, by way of example only, t- Butyloxycarbonyl (BOC) or benzyloxycarbonyl (Cbz) You.   Similarly, the formula R¹(X)_mC (O) Z reagents are also known per se in the art. And some of these materials are also commercially available. For example, chloride Benzoyl (R¹= -φ, m = O, Y = -C (O)-, and Z = Cl), phenyl chloroformate (R¹= φ , X = 0, m = 1, Y = -C (O)-, and Z = Cl), benzyl chloroformate (R¹= -φ, X = 0, m = 1, Y = -C (O)-and Z = Cl), diphenylacetyl chloride (R¹=-(φ)_TwoCH-, m = 0, Y = -C (O)- , And Z = Cl) are all phenyl chlorothionoformates (R^l= -φ, m = 1, X = 0, Y = -C (S)- , And Z = Cl) and phenyl chlorodithioformate (R¹= -φ, m = 1, X = S, Y = -C (S)-, And Z = Cl) are commercially available reagents. IV.Pharmaceutical preparations   When used as a medicament, the compounds of formula I described above are usually administered in the form of a pharmaceutical composition. Given. These compounds are available orally, rectally, transdermally, subcutaneously, intravenously, intramuscularly and Administration can be by various routes, including intranasally. These compounds are injected It is effective as both a possible composition and an oral composition. Such a composition is Prepared in a manner well known in the pharmaceutical art, and comprising at least one activation Including compounds.   The present invention also relates to a pharmaceutical composition which is combined with a pharmaceutically acceptable carrier as an active ingredient. Includes pharmaceutical compositions containing one or more of the compounds of formula I described above. The composition of the present invention In making, the active ingredient is usually mixed with an excipient or diluted with an excipient. Or in the form of capsules, sachets, paper or other containers Enclosed in a carrier. If the excipient acts as a diluent, A solid, semi-solid or liquid that acts as a vehicle, carrier or medium for the active ingredient It can be a body substance. Thus, the composition comprises tablets, pills, powders, lozenges, sachets, Cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (solid Ointment containing up to 10% by weight of active compound, e.g. Soft or hard gelatin capsules, suppositories, sterile injectable solutions, and sterile It may be in the form of a packaged powder.   In preparing the formulation, provide the appropriate particle size before combining with other ingredients. It may be necessary to mill the active compound to provide. Active compound is substantial This is usually milled to a particle size of less than 200 mesh when insoluble in It is. If the active compound is substantially water-soluble, the particle size will Adjusted by milling to provide an even distribution (eg, about 40 mesh).   Examples of suitable excipients include lactose, dextrose, sucrose, sol Bitol, mannitol, starch, gum arabic, calcium phosphate, algi Nate, tragacanth gum, gelatin, calcium silicate, microcrystalline cellulose, Polyvinylpyrrolidone, cellulose, water, syrup and methylcellulose I can do it. The formulation may further include: talc, magnesium stearate Lubricants such as mineral oil; wetting agents; emulsifying and suspending agents; Preservatives, such as droxybenzoate; sweeteners; and fragrances. The composition of the present invention Effective after administration to a patient by using procedures known in the art. It can be formulated to provide rapid, sustained or delayed release of minutes.   The compositions are preferably formulated in a unit dosage form, each dosage being from about 5 to about 100 mg, more preferably It usually contains about 10 to about 30 mg of active ingredient. The term "unit dosage form" Is physically suitable as a single dose for human subjects and other mammals. Separated units, each unit being desirable in relation to a suitable pharmaceutical excipient It contains a predetermined amount of active substance calculated to produce a therapeutic effect.   The active compound is effective over a wide dosage range and is generally pharmaceutically effective. Is administered. However, the actual amount of compound administered will depend on the condition being treated, the choice Route of administration, actual compound administered, age of individual patient, body weight and responsiveness Determined by the physician, taking into account relevant circumstances, including the severity of the patient's symptoms .   For preparing solid compounds as tablets, the main active ingredient is combined with pharmaceutical excipients. Mix to form a solid pre-formulated composition comprising a homogeneous mixture of a compound of the present invention. Form. When we refer to these pre-formulated compositions as homogeneous, this means that the active ingredient is Evenly distributed throughout the composition, thereby allowing tablets, pills, and capsules It can be easily subdivided into such equally effective unit doses. means. The pre-formulated solid is then, for example, from 0.1 mg to about 500 mg of the instant invention. It is subdivided into unit dosage forms of the type described above containing a light active ingredient.   The tablets or pills of the present invention provide a dosage that affords the advantage of prolonged action. Can be coated or otherwise synthesized to provide form . For example, tablets or pills can contain internal and external dosage components, with the latter Is the form of an envelope that covers the former. These two components disintegrate in the stomach And the internal components pass intact into the duodenum or release It can be separated by an enteric layer that acts to be able to be delayed. This Various materials can be used for enteric layers or coatings such as Such materials include many polymeric acids and these polymeric acids and cell Materials and mixtures such as cellulose, cetyl alcohol, and cellulose acetate. I will.   New compositions of the invention can be incorporated for administration orally or by injection Liquid forms include aqueous solutions, suitably flavored syrups, aqueous or oily suspensions. Suspensions, and edible oils, such as cottonseed oil, sesame oil, coconut oil or peanut oil, And fragranced emulsions with elixirs and similar pharmaceutical vehicles. You.   Compositions for inhalation and insufflation include pharmaceutically acceptable aqueous or organic solvents Solutions and suspensions or mixtures and powders thereof. Liquid or solid The composition can contain pharmaceutically acceptable excipients as described above. Good Preferably, the composition is administered orally or nasally to obtain a local or systemic effect. Administered by tract. Preferably, the composition in a pharmaceutically acceptable solvent is inert Can be nebulized using a neutral gas. The sprayed solution is drawn directly from the spray device. Or use a spray device with a mask tent or intermittent positive pressure call. It is also possible to attach it to a suction machine. Solution, suspension or powder compositions may be suitable Administered orally or nasally from devices that deliver the formulation in a manner be able to.   The following formulation examples illustrate the pharmaceutical compositions of the present invention.                                 Formulation Example 1   Hard gelatin capsules containing the following ingredients can be prepared as follows :Component                                 Amount (mg / capsule) Active ingredient 30.0 Starch 305.0 Magnesium stearate 5.0   The above ingredients are mixed and filled into hard gelatin capsules in a quantity of 340 mg. You.                                 Formulation Example 2   A tablet form can be prepared using the following ingredients:Component                                   Amount (mg / tablet) Active ingredient 25.0 Cellulose, microcrystalline 200.0 Colloidal silicon dioxide 10.0 Stearic acid 5.0   The ingredients are compounded and compressed to form tablets each weighing 240 mg.                                 Formulation Example 3   A dry powder inhaler formulation can be prepared that contains the following ingredients:Component                                 weight% Active ingredient 5 Lactose 95   Mix the active mixture with lactose and add the mixture to a dry powder inhaler .                                 Formulation Example 4   Tablets each containing 30 mg of active ingredient can be prepared as follows:Component                                   Amount (mg / tablet) Active ingredient 30.0mg Starch 45.0mg Microcrystalline cellulose 35.0mg Polyvinyl pyrrolidone 4.0mg (as 10% in water) Sodium carboxymethyl starch 4.5mg Magnesium stearate 0.5mg Talc1.0mg Total 120mg   Pass the active ingredient, starch and cellulose through a No. 20 mesh U.S. sieve, And mix carefully. Mix the solution of polyvinylpyrrolidone with the resulting powder This is then passed through a 16 mesh U.S. sieve. The granules thus produced are Dry at 50-60 ° C. and pass through a 16 mesh U.S. sieve. Next, the 30th menu Carboxymethyl starch sodium which has been passed through a U.S. sieve Magnesium stearate and talc are added to the granules and, after mixing, Compress on-press to produce tablets weighing 150 mg each.                                 Formulation Example 5   Capsules each containing 40 mg of drug can be made as follows:Component                               Amount (mg / capsule) Active ingredient 40.0mg Starch 109.0mg Magnesium stearate 1.0mg Total 150.0mg   No. 20 mesh with active ingredients, starch and magnesium stearate Through a U.S. sieve and filled into hard gelatin capsules in 150 mg portions .                                 Formulation Example 6   Suppositories, each containing 25 mg of active ingredient, can be made as follows:Component                                          amount Active ingredient 25mg Until the total amount of saturated fatty acid glyceride reaches 2000 mg   Pass the active ingredients through a No. 60 mesh U.S. sieve and use the minimum heat required And suspended in a pre-melted saturated fatty acid glyceride. The mixture is then Pour into a 2.0 g nominal dose suppository mold and cool.                                 Formulation Example 7   Make a suspension containing 50 mg of each drug per 5.0 ml dose as follows: You can:Component                                            amount Active ingredient 50.0mg Xanthan gum 4.0mg Sodium carboxymethylcellulose (11%)   Microcrystalline cellulose (89%) 50.0mg 1.75g sucrose Sodium benzoate 10.0mg Air freshener and colorant optional amount Purified water until the total volume reaches 5.0 ml   No. 10 mesh U.S. sieve containing drug, sucrose and xanthan gum And then prepare the microcrystalline cellulose and carboxymethyl cellulose Mix with an aqueous solution of sodium salt. Sodium benzoate, fragrance and coloring Is diluted with some water and added with stirring. Then add enough water To generate the required quantity.                                 Formulation Example 8   Capsules containing 15 mg of drug can be made as follows:Component                                     Amount (mg / capsule) Active ingredient 15.0mg Microcrystalline cellulose 135.0mg 407.0mg starch Magnesium stearate 3.0mg 425.0mg in total   Contains active ingredients, cellulose, starch and magnesium stearate, Pass through a No. 20 mesh U.S. sieve and fill in hard gelatin capsules in the amount of 560 mg. Refill.                                 Formulation Example 9   An intravenous formulation can be prepared as follows:Component                          Quantity Active ingredient 250.0mg Isotonic saline 1000ml                                 Prescription example 10   Topical formulations can be prepared as follows:Component                           Quantity Active ingredient 1-10g Emulsifying wax 30g 20g liquid paraffin White soft paraffin until the total amount becomes 100 g   Heat the white soft paraffin until it melts. Liquid paraffin and emulsifying filter Stir until dissolved. Add and disperse the active ingredient Continue stirring until complete. The mixture is then cooled until it becomes solid.   Another preferred formulation used in the methods of the invention is a transdermal delivery device ("" Patches)). Such transdermal patches contain the compound of the present invention in controlled amounts. Can be used to provide continuous or discontinuous digestion of For delivery of drugs The construction and use of transdermal patches of is well known in the art. For example, 1991 See U.S. Patent No. 5,023,252, issued June 11, 1980, the disclosure of which is incorporated herein by reference. The whole is incorporated by reference. Such patches provide a continuous, pulsatile distribution of the drug. Or for delivery on demand.   Often, introducing a pharmaceutical composition into the brain, either directly or indirectly Is desirable or necessary. Direct techniques usually bypass the blood-brain barrier Placing a drug delivery catheter in the host's ventricular system. body This is used to transport biological factors to specific anatomical regions of the One such implantable delivery system is described in U.S. Pat. No. 5,011,472. And is incorporated herein by reference in its entirety.   Generally preferred indirect techniques usually involve converting a hydrophilic drug into a liposoluble drug. It involves formulating the composition to provide more drug potential. Latent is In general, it makes drugs more lipophilic and can be more easily transported across the blood-brain barrier. Hydroxy, carbonyl, sulfate and primary amines present on the drug Achieved by blocking groups. Alternatively, the delivery of the hydrophilic drug It can be enhanced by infiltration of hypertonic fluid into arteries that can transiently release the blood-brain barrier it can. V.Cathepsin Y composition   Cathepsin Y has a molecular weight of about 31 kD and an amino acid sequence described in SEQ ID NO: 3. New carboxypeptidase. Is cathepsin Y a βAP producing cell? Are involved in the release of βAP. ΒAP production provided by the compound of formula I above Bioinhibition appears to occur, at least in part, through inhibition of cathepsin Y. Will be Cathepsin Y is particularly active on aliphatic carboxy terminal amino acids However, a wide variety of carboxy terminal amino acids can be cleaved. Cut terminal amino acid Cathepsin Y's ability to cleave is two positions away from the amino acid being cleaved. It is strongly influenced by the nature of the amino acid residues located at the bottom. Such specificity , A feature of the papain superfamily of cysteine proteases.   Cathepsin Y according to the invention can be obtained from both natural and synthetic sources Can be. Natural cathepsin Y is used in human 293 cells, human HS683 cells, human brain, etc. Can be isolated and purified from a variety of mammalian cell sources, including: These sources Can be collected and disrupted to create a lysate. As a result Cells or other debris from the resulting lysate can be separated, for example, by centrifugation; The resulting supernatant is subjected to a conventional series of purification steps. From natural sources For specific methods for isolating and at least partially purifying cathepsin Y, see Are described in detail in the experimental section below. The cathepsin Y composition of the present invention comprises At least partially purified, typically at least 10% by weight (w / w) pure, Contains no contaminants and substances that interfere with enzyme activity. Usually cathepsin The Y composition is at least 25% by weight (w / w) pure, and more usually at least Also have a purity of 50% by weight, preferably at least higher than 75% by weight. Many In many cases, typically at least 90% by weight purity, preferably at least 95% by weight. The substance of cathepsin Y of the invention having high purity, sometimes higher than 99% by weight It is desirable to obtain a highly pure (homogeneous) composition. Has such high purity Such a composition provides the desired cathepsin Y activity as described in the experimental section below. Can be obtained using conventional protein purification techniques in conjunction with You.   The synthetic preparation of the cathepsin Y composition comprises the native cathepsin Y cDNA sequence (SEQ ID NO: No. 2) or the amino acid sequence (SEQ ID NO: 3). Other feeding Cathepsin Y and alleles of cathepsin Y from appropriate Degenerate oligonucleotide probes for screening human libraries Can be identified. Obtaining the right libraries from a number of sources Is possible. Variety for identifying cDNA encoding cathepsin Y of the present invention CDNA libraries can be screened by any conventional technique. Such techniques Surgery includes direct hybridization, polymerase chain reaction (PCR) -amplification Hybridization, the use of anti-cathepsin Y antibodies, and the like. Other mosquitoes Identification of the tepsin Y cDNA sequence involves expressing the identified DNA insert in a suitable host. By introducing the plasmid into an appropriate plasmid vector. Note that Here, the resulting recombinant expression vector was digested with restriction enzymes and Mapped by blotting. Then an internally consistent array Internally consistent clones confirmed with cathepsin Y Can be sequenced.   The purified cathepsin Y composition of the present invention may be natural or That is, those whole cathepsin Y enzymes isolated from natural sources as described above. Element or a fragment thereof) or synthetic (ie, The whole protein or its fragment prepared by the technique described below Or its analogs). In the case of both natural and synthetic cathepsin Y , Fragments and analogs preferably have at least a portion of the endogenous biological activity (Ie, retain native protein separation activity).   Intact cathepsin Y or a biologically active fragment or analog thereof The synthetic polypeptides represented are prepared by either of two general approaches. Can be First, using a conventional in-phase method utilizing an automated commercial system, To synthesize a polypeptide. According to the present invention, cathepsin Y polypeptide is synthesized. A second and generally preferred method for producing a cathepsin Y protein Of a recombinant DNA molecule encoding for expression of all or a portion of Expression in the vesicle is involved. Recombinant DNA molecules can be either natural or synthetic Offspring, where the native gene and cDNA can be obtained as described above. Can be. Using solid-phase technology and automated commercial synthesizers, synthetic polynuclear A nucleotide can be prepared. The complementary strand is then synthesized and the strand is By annealing together or with appropriate primer sequences Double-stranded flag by either adding a complementary strand using a polymerase You can get a comment.   Encoding a desired cathepsin Y protein, fragment or analog thereof Natural or synthetic DNA fragments can be introduced into and cultured in in vitro cell culture. Is incorporated into a DNA construct that can be expressed in E. coli. Usually, DNA constructs are Or suitable for replication in a unicellular host such as a bacterium. Alternatively, the DNA construct is The cells can be introduced into mammalian cells, preferably human cells, by various techniques now known. And may be suitable for incorporation therein. Cathepsin Y from such constructs The expression of the protein is performed under the condition that cathepsin Y is expressed. Such an article Depends on the vector and host cell used, and It is understood that it can be determined by the person.   Nucleic acids are³²P,^ThreeH and^{twenty four}Radionuclides like S, fluorescein, Texas Or fluorescent marker such as AMCA Blue, Lucifer Yellow, Rhodamine Any known in the art, including any cyanine dye that can be detected with visual light Can be directly labeled with a detectable label. Nucleic acid is used for PCR, random Direct labeling using methods such as imaging, end labeling, and nick translation Can be done. Alternatively, the nucleic acid is biotin or digoxigenin (Boehringer Mann Nuc covalently linked to a hapten or other molecule such as heim, Indianapolis, IN) Labeled antibodies or other molecules that take up leotide and are directed to the hapten Indirect labeling by performing sandwich hybridization in Can be For example, if biotin is incorporated into a nucleic acid, it will come into contact with a detectable label. Combined avidin can be used.   The isolated and purified Cathepsin Y polypeptide of the present invention can be used in various organisms. In biological and chemical systems. In addition, βAP In screening assays to identify test compounds with harmful activity , Cathepsin Y polypeptide may be used. This enzyme is present in the patient's body fluids Diagnosis to assess patient risk for AD based on presence and quantity of It is further contemplated that cathepsin Y can be used as   An isolated and purified nucleic acid substantially homologous to the sequence of FIG. Using substantially complementary nucleic acids and fragments of the sequence of FIG. About the presence of cathepsin Y RNA or DNA in the cloned library Probe specifically. Using purified nucleic acid, cathepsin Y Tissues or cells that express the RNA to be loaded can be identified. The nucleic acid fragment of FIG. Preferred sizes are at least 12 base pairs, and preferably, fragments are small. It is at least 20 base pairs, more preferably at least 50 base pairs. Nucleic acid is RNA Or DNA. VI.Screening assay for βAP inhibitory activity   ΒAP production inhibitory activity based on the inhibition of carboxypeptidase activity of cathepsin Y Cathepsin Y was used in a quantitative assay to identify compounds with Can be Such assays are performed on the appropriate oligopeptide substrate at the carboxy terminus. This is done by observing the ability of cathepsin Y to cleave residues. like this A test compound that can inhibit carboxypeptidase activity is its β It is considered a candidate for further testing to determine AP production inhibitory activity. Cal Test compounds that cannot inhibit boxypeptidase activity will require additional testing. It is considered a less suitable candidate for the strike. ΒAP using cathepsin Y Examples of assays for production inhibitory activity are described in detail in the experimental section below.   The following synthetic and biological examples are provided to illustrate the invention. Nothing in this manner should be construed as limiting the scope of the invention. other Unless otherwise noted, all temperatures are given in degrees Celsius. Also, these examples In, the abbreviations used have their generally accepted meanings: BOP reagent = benzotriazol-1-yloxy-tris (dimethylamino) Phosphonium hexaal phosphate bp = base pairs CBZ = Carbobenzyloxy DTT = dithiothreitol DMF = N, N-dimethylformamide DMSO = dimethyl sulfoxide dNTP = deoxynucleoside triphosphate DPDS = dipyridyl disulfide EDTA = ethylenediaminetetraacetic acid g = grams HPLC = High Performance Liquid Chromatography LAH = lithium aluminum hydride M = mole MES buffer = 2- [N-morpholino] ethanesulfonic acid mg = milligram mL = milliliter mM = mmol mmol = millimol μM = micromol N = Regulation ng = nanogram pM = picomolar psi = pounds per square inch PVDF = polyvinylidene difluoride RGW = reagent grade water rpm = number of revolutions per minute μg = microgram μL = microliter μM = micromol   American Type Culture Collection n) 293 cells were obtained from (ATCC CRL 1573).   Stable transfection with APP751 cDNA with Swedish mutation 293 751 SWE cells were obtained from K293 cells (human kidney cell line) that received the heat.   Brij 35 was obtained from Boehringer Mannheim.                                   Example The synthesis schematically shown in General Procedures AD is illustrated in FIG. It depicts the synthesis of peptide aldehyde. General Procedure A-Amino N, O-dimethylhydrido protected with carbobenzyloxy (CBZ) Synthesis of roxyamide, 7 (20 mmole scale).   The N, O-dimethylhydroxyamide illustrated in FIG. 1 was prepared according to the following general procedure. And synthesized on a 20 mmol scale. Amino acid 6 (20 mmol), BOP reagent (30 mmol) and 4-methylmorpholine (100 mmol), and add The mixture was stirred at room temperature for 1 hour in a nitrogen atmosphere. At this point, N, O-dimethylhydroxyl Amine hydrochloride (24 mmol) was added and all was stirred at room temperature for a further 12 hours. Anti The reaction was poured into water (200 mL) and then extracted with ethyl acetate (3 × 200 mL). Match The saturated organic layer was washed with a saturated aqueous citric acid solution (2 x 200 mL) and a saturated aqueous sodium bicarbonate solution. Washed with liquid (2 × 200 mL) and brine (1 × 300 mL). MgSO_FourUsing organic Dry the layers, filter and concentrate to the desired CBZ protected N, O-dimethylhydroxyl Amide 7 was obtained. If necessary, use 50% ethyl acetate / hexane to Was chromatographed. Purified yields are typically between 70% and 85%. Was. General Procedure Synthesis of B-amino-N, O-dimethylhydroxyamide 8   CBZ protected N, O-dimethyl on a 15 mmol scale according to the following general procedure Removal of the CBZ protecting group on hydroxyamide 7 gave the title compound. CBZ protected The amino acid (15 mmol) was suspended in ethanol (20 mL) in a parr bottle. This To this was added 10 weight percent palladium on activated carbon (10% palladium) . The mixture was subjected to 50 psi of hydrogen on a parr shaker for 3 hours. Then the solution is Degas, filter in celite pad, then concentrate to desired amino N, O-dimethyl This gave the hydroxyamide 8 (typically 60% -68% yield). This isolated material Was used without further purification. General Procedure C-CBZ Protection of Dipeptide N, O-Dimethylhydroxyamide 10 Success   This coupling was performed on a 15 mmol scale according to the following general procedure and the title The compound was obtained. CBZ protected amino acid 9 (15 mmol), BOP reagent (22.5 mmol) and 4- Methyl morpholine (75 mmol) is added to 75 mL of DMF and all is stirred at room temperature for 1 hour. The mixture was stirred under a basic atmosphere. At this point, N, O-dimethylhydroxyamide 8 (15 mmol) Was added and everything was stirred at room temperature for a further 12 hours. Pour the reaction into water (150 mL) And then extracted with ethyl acetate (3 × 150 mL). Combine the organic layers and saturate Aqueous solution of enic acid (2 × 150 mL), saturated aqueous solution of sodium bicarbonate (2 × 200 mL) and Washed with brine (1 × 225 mL). The organic layer is dried over MgSO_FourDry using and filter And concentrated to give the desired CBZ-protected dipeptide N, O-dimethylhydroxyamide 10 I got If necessary, use 50% ethyl acetate / hexane to remove the crude product. Chromatography. Purified yields were typically 67% -81%. General Procedure Synthesis of D-CBZ protected dipeptide aldehyde 11.   The reduction of N, O-dimethylhydroxyamide 10 is 10 mmol according to the following general procedure Performed on a scale to give the title compound. N, O-dimethylhydroxyamide 10 (10 mmol) Was suspended in diethyl ether (65 mL) and cooled to 0 ° C. under a nitrogen atmosphere . LAH (40-75 mmol) is added to the vigorously stirred solution and the suspension is brought to 0 ° C. for 1 hour. The mixture was stirred for one hour and then at ambient temperature for one hour. The reaction was treated with 10% aqueous citric acid (3 (0 mL) and stirred for an additional 30 minutes. This is added to diethyl ether (3 × 50 mL ). The combined organic layers were washed with a saturated aqueous sodium bicarbonate solution (1 x 50 mL), water (1 × 50 mL), washed with brine (1 × 50 mL),_FourDried on top, filtered, Concentration gave the crude aldehyde. Chromatography with 50% ethyl acetate / hexane Thus, the desired purified aldehyde 11 was obtained. Purification yield typically 45% -75% Met.   The synthesis schematically shown in general procedure EG is illustrated in FIG. 2 and is N-substituted 1 shows the synthesis of amino acid aldehydes. General Procedure E-Carbonbenzyloxy (CBZ) protected amino N, O-dimethyl Synthesis of droxyamide 12 (+50 mmol scale).   N, O-dimethylhydroxyamide synthesized on the +50 mmol scale Prepared according to the general procedure to give the title compound. Amino acid 6 protected by CBZ (50 mmol ) Was added to a 2: 1 methylene chloride / tetrahydrofuran solution (500 ml) and The solution was cooled to −20 ° C. under a nitrogen atmosphere. Add N-methylpiperidine (52.5 mmol) After that, methyl chloroformate (52.5 mmol) was added dropwise. After 10 minutes, methyl chloride N, O-dimethylhydroxyamine (75 mmol, 75 mmol N-methylpipe Lysine free-based solution), maintain the internal temperature of the reaction at -20 ° C. It was added dropwise at such a ratio. After the addition is complete, warm the reaction to room temperature. And stirred for 3 hours. The reaction was washed with 0.2N HCl (3 × 125 mL), 0.2N NaHCO_Three( 1 × 125 mL), water (1 × 125 mL), MgSO 4_FourDried over, filtered and concentrated To give the desired CBZ protected N, O-dimethylhydroxyamide 12 (alternative). The representative yield was between 80% and 90%). This material is very pure and can be further purified Used without. General Procedure F-Amino-NO-dimethylhydroxyamide 13 synthesis.   Removal of the CBZ protecting group was performed on a 15 mmol scale according to the following general procedure and The title compound was obtained. CBZ protected amino acid 12 (15 mmol) was added to ethanol in a parr bottle. (20 ml). This includes 10% by weight palladium on activated carbon (10% Radium) was added. This mixture was hydrogenated at 50 psi for 3 hours on a parr shaker. Attached. The solution is then degassed, filtered through a celite pad and then concentrated To give the desired amino N, O-dimethylhydroxyamide 13 (typical yields are 60-68). %Met). This isolated material was used without further purification. General Procedure G-Synthesis of amino-substituted N, O-dimethylhydroxyamide 15.   This coupling was performed on a 2.6 mmol scale according to the following general procedure and The title compound was obtained. Carboxylic acid 14 (2.9 mmoles), BOP reagent (2.9 mmol), and 4-methyl Rumorpholine (10.4 mmol) is added to 35 mL of DMF and everything is nitrogen atmosphere for 1 hour at room temperature Stir underneath. At this point, N, O-dimethylhydrogen dissolved in methylene chloride (5 mL) was used. Droxylamide 9 (2.6 mmol) is added and all is stirred at room temperature under nitrogen for 12 hours. Stirred. Pour the reaction into water (50 mL) and then extract with ethyl acetate (3 × 50 mL) did. Combine the organic layers and add saturated aqueous 0.2N HCl (2 × 100 mL), saturated aqueous bicarbonate Washed with aqueous thorium (1 × 200 mL) and brine (1 × 200 mL). This MgSO_Four, Filtered and concentrated to give the desired N-substituted N, O-dimension. Tylhydroxyamide 15 was obtained. If necessary, 50% ethyl acetate / hexane The crude product was chromatographed using. Purified yields are representative Between 60% and 90%. General Procedure Synthesis of H-amino substituted aldehyde 6.   Substitution of the N, O-dimethylhydroxyamide is 0.5 mmol according to the following general procedure Performed on a scale to give the title compound. N, O-dimethylhydroxyamide 15 (0.5 mmol ) Is suspended in tetrahydrofuran (30 mL) and cooled to 0 ° C under a nitrogen atmosphere. Rejected. LAH (1.3 mmol) was added to this vigorously stirred solution over 30 minutes. did. Then, dimethyl ether (60 mL) was added, and then ice-cold 10% aqueous citric acid solution The liquid (80 mmol) was added. After vigorous stirring for 30 minutes, the reaction mixture was treated with diethyl ether ( 5 × 20 mL). The combined organic portions were combined with a saturated aqueous sodium bicarbonate solution (1 × 50 mL), water (1 × 50 mL), brine (1 × 50 mL),_FourDry on And filtered and concentrated to give the crude aldehyde. In 50% ethyl acetate / hexane Chromatography produced the desired purified aldehyde 16. Purification yield , Typically 31-65%. General Procedure I-Preparation of Diazoketone   Diazoketones are described in Green et al. Biol. Chem., "Peptidyldiazomethylketo Is a specific inactive compound of thiol proteinase '' 256 (4): 1923-1928 (198 It was prepared according to the procedure described in 1). Specifically, a 40% aqueous KOH solution (15 ° C. 1 mL) in a solution of diethyl ether (50 mL) containing 1-methyl-3-nitro-1-nitroso. By adding guanidine (17 mmol) slowly and batchwise, fresh diazometa Was prepared. After allowing the solution to stand for 10 minutes, decant diethyl ether and add And dried over KOH pellets. Protected amino acids or diamines in THF (25 mL) Peptide (5.0 mmol) and N-methylmorpholine (5.0 mmol) are added, all at −10 ° C. Cooled down. Isobutyl chloroformate (5.0 mmol) was added dropwise and a further 5 The solution was stirred for minutes. The reaction is filtered, then the freshly prepared diazomethane (As described above) was added dropwise. All undisturbed for 1 hour at 0 ° C And then left overnight at room temperature. Diethyl ether in water (3 × 40 mL) Then washed with brine (40 mL) and dried over MgSO_FourAnd dried on top and concentrated to Azoketone was obtained. Yields were typically 55-72%. General Procedure J-Preparation of Alcohol   Preparation of C-terminal alcohol from corresponding C-terminal aldehyde by conventional reduction with LAH Made. For example, combining an aldehyde with LAH (about 4 equivalents) in THF at about 0 ° C You. Then diethyl ether is added, followed by ice-cold 10% aqueous citric acid. After stirring vigorously for 30 minutes, the reaction mixture is extracted with diethyl ether. Saturated heavy Wash the combined organic portions with aqueous sodium carbonate, water, and brine and wash with MgSO_FourAbove Dry, filter and concentrate to obtain the crude alcohol. In 50% ethyl acetate / xane Chromatography gives the desired purified alcohol. General Procedure Preparation of K-ester   Via conventional esterification conditions, the corresponding C-terminal carboxyl group is Tell was prepared. General Procedure Preparation of L-amide   Via conventional amidation conditions, the corresponding C-terminal carboxyl group or C-terminal The C-terminal amide was prepared from tell. For example, 100 mL of DMF contains N-protected amino acids (20 mol), BOP reagent (30 mmol) and 4-methylmorpholine (100 mmol) Was stirred at room temperature for 1 hour under a nitrogen atmosphere. At this point, one equivalent of the amine (eg, For example, ethyl methylamine) is added to the reaction mixture until the reaction is complete (eg, 12 H) Stir at room temperature. Example 1-80-Synthesis of Compounds of Formula I   After general procedures A-L, compounds 1-75 (Examples 1-75) were prepared as shown in Table I below. Was. Further, the compound 76-80 (Example 76-80) in Table II was purchased commercially. General Procedure Cell Screen for Detection of Inhibitors of J-β-Amyloid Production   A compound of the present invention was transformed into a cell line having a Swedish mutation (293 751 SWE cells). Were assayed for their ability to inhibit the production of β-amyloid. This In their screening assays, their entire disclosures are incorporated herein by reference. Schenk et al., International Patent Application Publication No. 94/1056, published May 11, 1994. No. 9, "Methods and Compositions for the Detection of Soluble β-Amyloid Peptide" and Ci Double mutation L as described by tron et al., Nature, 360: 672-674 (1992). ys₆₅₁Met₆₅₂~ Asn₆₅₁LeU₆₅₂Amyloid precursor tamper containing (APP751 numbering) K293 cells stably transfected with the gene for protein 751 (APP751) (human 293 751 SWE cells derived from a renal cell line) were used. This mutation is generally Cells called a -den mutation and called "293 751 SWE" 1.5 to 2.5 x 10 per well in minimum essential medium + 10% fetal bovine serum^FourIn individual cells , Plated in Corning 96 well plates. Assay linear range (1m To achieve β-amyloid ELISA results within about 0.2-2.5 ng per L), cells Number is important.   Incubate overnight at 37 ° C in an incubator equilibrated with 10% carbon dioxide. After culturing, the medium was removed and during the 2 hour pretreatment period, the pepti described herein was used. Medium containing a peptide, dipeptide, or tripeptide (drug) (per well) 200 μL) and incubated the cells as described above. Used for processing At the final drug concentration, the dimethyl sulfoxide concentration does not exceed 0.5%, And in fact, 100% of dimethyl sulfoxide usually equals 0.1% A drug stock was prepared in.   At the end of the pretreatment period, the medium is removed again and fresh drug as described above Medium was replaced and the cells were incubated for an additional 2 hours. Processing Thereafter, to pellet cell debris from the conditioned medium, B at 1200 rpm for 5 minutes at room temperature. Plates were centrifuged in an eckman GPR centrifuge. 100 μL volume from each well The conditioned medium or a suitable dilution thereof is described in International Patent Application Publication No. 94/10569 (supra). Antibodies against amino acids 13-28 of β-amyloid peptide as described by Schenk et al. Transfer into ELISA plate pre-coated with body 266 and store at 4 ° C overnight Existed. The next day, to determine the amount of β-amyloid peptide produced, ELISA assay using 6C6 labeled antibody against amino acids 1-16 of myloid peptide Carried out.   Hansen et al., J. Mol. Immun. Meth.,  The cytotoxic effect of the compound was measured by the modified method of 119: 203-210 (1989). 25% of the remaining cells in the cell culture plate to a final concentration of 1 mg / mL. μL of 3, (4,5-dimethylthiazol-2-yl) 2,5-diphenyltetrazolium Lomid (MTT) stock solution (5 mg / mL) was added. Incubate cells at 37 ° C for 1 hour And in an equal volume of MTT lysis buffer (50% dimethylformamide, pH 4.7). 20% w / v sodium dodecyl sulfate) to stop cell activity Was. Complete extraction was achieved by shaking overnight at room temperature. OD_562nmAnd OD_{650 nm} The difference between this and Molecular Device UV_maxUse a microplate reader to It was measured as an indication of the viability of the vesicles.   The results of the β-amyloid peptide ELISA were fitted to a standard curve and ng / mL β-amyloid peptide. Expressed as amyloid pepti. To normalize for cytotoxicity, Results are divided by the MTT results and expressed as a percentage of the results from the no drug control. did. All results are the mean and standard deviation of at least 6 replicate assays is there.   Inhibition of β-amyloid peptide production in cells using this assay Test compounds were assayed. The results of this assay are, inter alia, those of Examples 1-80. Each of the compounds was able to reduce β-amyloid peptide production compared to controls Demonstrate. In addition, these compounds have significant cellular effects on 293 751 SWE cells. It had no disability effects.   Therefore, the compounds of the present invention reduce intracellular β-amyloid peptide production. And therefore useful in treating humans in vivo for AD. is there.Summary of purification and characterization of cathepsin Y (31kD)   The strong inhibition of βAP release observed with peptide (and non-peptide) aldehydes , The presence of specific proteases that are targets for these inhibitors was suggested. To isolate such enzymes, a modified version of the prototype aldehyde inhibitor must be Was used to construct an affinity matrix. Compound NH_Two-Val-Phe-semicarbazone Followed by chemical conversion of the semicarbazone functionality to an aldehyde.   The binding of the active protease to the aldehyde column Reversible sharing between the site cysteine residue and an aldehyde or other equivalent functional group. Equilibrium formation of covalent bonds is involved. In this case, the elution of the protease Use DPDS to form a disulfide bond with tein and thus remove the enzyme from the column Was achieved by Recovery of enzyme activity after elution was determined by β-mercaptoethanol In excess reducing agent, such as urea or dithiothreitol Achieved by:   Cathepsin Y was identified using a polyclonal antibody against human cathepsin B ("an ti-cat B ") is a western blot of fractions eluted from the aldehyde affinity matrix Approximately 31kD band recognized as the most reactive band recognized on the blot This has been facilitated by the unexpected observation that they did. Figures 3A-3C show the anti-cat B Analyzed by both estanbel blotting and protein staining of purified fractions 1 shows a representative purification profile. Of fractions from the affinity matrix Stern blots (Figure 3A) show that the anti-cat B antibody is soluble in cell extracts ("load"). ) Strongly reacts with the three major bands, of which the middle band (about 31 kD) Strongest binding to matrix and inherently quantitative in flow-through ("FT") To be depleted. Elution with DPDS shows a 31 kD band as well as partial Results in the recovery of both low MW (cell cathepsin B) bound to. Then, 31kD Band was purified from contaminated cathepsin B using a concanavalin A column. Selective binding of the 31 kD protein band and subsequent elution (Figure 3B). Eluted from Concanavalin A column with Coomassie Blue The analysis of the separated fractions is exactly a single One protein band was revealed (FIG. 3C).ValPhe- Preparation of aldehyde affinity matrix   3.2 gm Ep in 50 mL of reagent grade distilled water (RGW) for at least 20 minutes at room temperature Wash on filter funnel. At any stage of any wash, the tree The fat cake was not completely dried. 1.05 mL of 25 mg / mL valirfe 4.2 mL of 0.2 M sodium borate (nilalanyl semicarbazone (ValPheSC) pH 9.5) and washed Epoxy Sepharose was added to the resulting solution. Was. The suspension was incubated with rotation at 37 ° C. for 24-26 hours. GSR rotor The Sepharose was sedimented by centrifugation at 550 rpm for 5 minutes in the Resuspend in tanolamine, pH 8.2 and incubate overnight (16-18 hours) as before. Incubated. 350 g of coupled Sepharose (ValPheSC-Sepharose) Wash on a coarse Buchner filter funnel with mL 33% DMSO, then 350 mL RGW And washed. Semicarbazone was added to 80 mL of methanol: acetic acid: formaldehyde ( 5: 1: 1) by rotating overnight at room temperature while rotating in Converted to the corresponding aldehyde. Sepharose is sedimented by centrifugation as described above. And 10 hours with fresh methanol: acetic acid: formaldehyde as described above Incubated. Wash ValPhe-Sepharose with 600 mL RGW as described above And stored at 50C as a 50% slurry in 0.05% sodium azide.Preparation of cathepsin Y   All operations were performed at 4 ° C. or on ice unless otherwise noted. Frozen pelletized Thawed 293 cells from the wild type were allowed to thaw and 5 volumes of MES buffer (20 mM MES, 2 mM M EDTA, 0.1% Brij35, pH 6.0). Suspension, Brinkman PT 1 Homogenized for 30 seconds using either 200 or Tissue Tearor 985-370. E The mozinate was centrifuged at 15,000 rpm (31,000 xg) for 20 minutes. Collect the supernatant, Val containing 5 mM DTT and containing ValPhe aldehyde prepared as described above Applied to a Phe column. The column was pre-equilibrated with MES buffer containing 0.1 M NaCl . Typically, 20 mL of 293 cell supernatant is applied to a 1.0 mL column, but 1 mL of the supernatant is applied. More than 60 mL of supernatant per ram can be applied without saturating the column. Mosquito La The system is washed with one bed volume of 0.1 M NaCl in MES buffer, then 0.2 m in MES buffer. 10 bed volumes of L NaCl followed by an additional 10 bed volumes of 0.1 M NaCl-MES buffer And washed. The column was loaded with 2 mM dipyridyldiacid in 20 mM sodium acetate pH 4.5. 0.75 volumes of sulfide (DPDS) were charged and stoppered and stored overnight. Then the column Was charged with 1.25 volumes of the DPDS solution. The fraction collected at this point is a large amount of eluted Contains tepsin Y and B. Allow the column to contain at least an additional 3 volumes of DPDS And eluted with 5 volumes of 6M urea. Collect one column volume fraction Was.   0.1M NaCl, 1mM MnCl_Two, And 1 mM CaCl_TwoAdd Wash buffer (0.1 M NaCl, 50 mM MES, 1 mM MnCl_Two, 1 mM CaCl_TwoPH 6.0) A 1.0 mL column of equilibrated Concanavalin A-agarose was applied. Starting material After the application of, the column is washed with 5 mL of wash buffer, and then 0.2 ml in the same buffer. Washed with 1 mL of 1M mannose. This was the first eluted fraction (E1). Combined The material was added in 0.8 mL (E2), 1.2 mL (E3) portions, and 1.0 mL 4-5 portions (E4-E9). Eluted with 0.5 M δ-methyl mannopyranoside in wash buffer. Elution buffer 0.8 Cathepsin Y eluted as a broad peak between mL and 6 mL.Enzyme activity   Purified 31 kD protease (cathepsin Y) is purified recombinant APP No effect on various APP preparations, including constructs and membrane-bound full-length APP Was. Similarly, commonly used to assay cathepsin B, L, or S No significant activity was seen with any of the known synthetic substrates. These results are Psin Y enhances the standard endopeptide activity associated with such proteases. Suggested not to have. Whether the enzyme has other proteolytic activities In an effort to confirm, a large number of randomly selected synthetic oligopeptides were Incubation with purified cathepsin Y at pH 5.5 or 4.5. For details, Cathepsin Y at 37 ° C. for 1 hour at pH 4.5 or pH 5.5. Incubation was performed with the synthesized oligopeptide (50 μg / mL). To a final concentration of 1% Quench the sample by adding trifluoroacetic acid, then add 0.1% Vydac C18 column using a gradient of increasing acetonitrile in fluoroacetic acid Analyzed by reverse phase HPLC above. Collect individual peaks (parent and new products) And then analyzed by acid hydrolysis followed by amino acid analysis. The results are shown below. stop:Parent array                           Product LFYDQSPTATI (SEQ ID NO: 5) LFYDQSPTAT (amino acids 1 to 10 of SEQ ID NO: 5)                                LFYDQSPTA (amino acids 1 to 9 of SEQ ID NO: 5)                                LFYDQSPT (amino acids 1 to 8 of SEQ ID NO: 5) YKRDMVGGVVIA YKRDMVGGVVI (amino acids 1 to 11 of SEQ ID NO: 6) (SEQ ID NO: 6) YKRDMVGGVV (amino acids 1 to 10 of SEQ ID NO: 6) EGYYGNYGV (SEQ ID NO: 7 EGYYGNYGV (amino acids 1 to 9 of SEQ ID NO: 7) Amino acids 1-9) EGYYGNYGVYA EGYYGNYGVY (amino acids 1 to 10 of SEQ ID NO: 7) (SEQ ID NO: 7) EGYYGNYGV (amino acids 1 to 9 of SEQ ID NO: 7) FFDEPNPGVTIY (SEQ ID NO: 8) FFDEPNPGVT (amino acids 1 to 10 of SEQ ID NO: 8) [The above-mentioned peptides, as well as other peptides referred to herein, are customary And from the amino terminus to the carboxyl terminus]   Results from many such experiments (not all of which are shown) The only proteolytic activity of tepsin Y is directly related to carboxypeptidase activity. , Suggesting continuous removal of the carboxy terminal amino acid. this For any of these substrates, any endopeptidase activity or aminopeptidic activity No evidence of peptidase activity was found. These data are cathepsin Y Shows that the superior proteolytic activity is carboxypeptidase activity Strongly suggest.   Quantitative analysis of the carboxypeptidase activity of cathepsin Y is based on the selected substrate. Based on detection of new free amino termini generated upon cleavage. This is 2-merca Reacts with the reagent o-phthalaldehyde in alkaline solution in the presence of ptethanol (Simons et al., JACS, 98: 7098-7099 (1976)). peptide When EGYYGNYGV (amino acids 1 to 9 of SEQ ID NO: 7) is cleaved by cathepsin Y, The only free amino terminus that will be present in the reaction mixture is the protease Become the one of valine residue cleaved and removed from carboxypeptidase activity Was synthesized by acetylation at its amino terminus.   0.05% 2-merca in each well of a 96-well microtiter plate 0.25 M sodium borate containing ptethanol and 60 μg / mL o-phthalaldehyde Incubating various concentrations of valine (0-20 μM) in lium (pH 10) Built a standard curve. Obtain the fluorescence by plate reading Cytofluo Read in r (ex 340, em 460 nm). In proportion to the amount of free valine present, There is a linear increase in the signal (FIG. 7).   0.1% 2-mercaptoethanol is present to determine the optimal pH for the enzyme Condition, in a 20 mM sodium acetate buffer at different pH Enzyme and substrate (0.1 mL) in individual reaction volumes of 0.1 mL in individual wells of the (2 mg / mL) to set up the reaction mixture. Similarly, except for the presence of the enzyme, Control wells were set. At various times after incubation at room temperature 0.25 mg / mL o-phthalaldehyde in 0.45 M sodium borate, pH 10 The reaction was quenched by adding and the fluorescence was measured. The added enzyme With no bear, even if the incubation is extended, No measurable fluorescence is produced above. Time-dependent fluorescence in the presence of enzyme Increase is seen. Based on this analysis, carboxypeptidase activity The optimal pH was determined to be about 4.5, and the activity was determined at lower and higher pHs. Both descended.   Using this assay at pH 4.5, mix the incubation with enzyme and substrate. Add the desired concentration of inhibitor in the compound and fluoresce in relation to the enzyme control Inhibits cathepsin Y activity by measuring reduction (if any) The ability of a number of compounds was tested. Examples 3, 4, and 7 tested in this analysis , Each of 15, 24, 45, 47, 59, 64, and 75 compounds inhibits cathepsin Y activity showed that.Protein sequence analysis   Direct alignment of the 31 kD protein band after electroblotting on PVDF membrane The determination revealed the following sequence (SEQ ID NO: 4): (S) L P K SW (G, D) (N, V) R N V D G (V, N) N Y A S I (R, T).   Residues in parentheses are uncertain amino acid assignments. But this limited Amino acid terminal sequence information is available from rat cathepsin, a known cysteine protease. It showed clear homology to protein C. This means that this new enzyme Papain superfamily of cysteine proteases also including syn B, L and S Suggest that they may belong to Therefore, clone a new enzyme. Known conserved sequences within the cysteine protease to use PCR to And degenerate oligonucleotides using sequences from newly discovered amino-terminal sequences. Otide primers were designed.Cloning of cathepsin Y   In order to obtain the first DNA clone of this protease, this newly discovered It encodes the amino acid of the amino terminal sequence and is a cysteine pro Degenerate oligonucleotides encoding oligonucleotide sequences conserved in thease Degenerate PCR was performed using otide. Perkin as described by the manufacturer Human HS683 (human glioma cell line: ATCC) using Elmer GeneAmp RNA PCR kit  # HTB138) cDNA was made from cellular RNA and denatured in a boiling water bath. PCR The reaction was performed with 1 μg of poly A + RNA, 1 × Perkins-Elmer-Cetus PCR buffer 1, 25 pM Each oligonucleotide "Acys5" and "I Mer5",   (Acys5 (SEQ ID NO: 9) = encodes amino acid CGSC (YW) (SEQ ID NO: 10)   TG. TAC. CCG.GGC. (AGC) (TC) A. (AG) CA. IGA. (AT) CC. G   (I Mer5 (SEQ ID NO: 11) = encodes amino acid (S) LPKSW (SEQ ID NO: 12)   C. GTA. GGA. TCC. CTI. CCX. AA (GA). AGC. TGG), 50 μM of each dNTP, and 0.5 units of Taq polymerase were contained in a total volume of 25 μL . The PCR reactions were incubated at 95 ° C for 45 seconds, 45 ° C for 1.5 minutes, and 70 ° C for 1 minute each. 30 cycles of 30 seconds at 70 ° C., followed by 8 minutes at 72 ° C. Provided. Acrylamide gel electrophoresis shows a large number of PCR products and therefore the PCR reaction The entire product was subcloned and a number of clones were sequenced. Tested One of the 82 clones, hCatZ. 82 (nucleotides 299-366 of SEQ ID NO: 2) Encoded the amino acids of this newly discovered amino terminal sequence.   A larger DNA clone of cathepsin Y was designated as hCatZ. 82 (nucleotide of SEQ ID NO: 2 299-366) and a cysteine protease of the papain family Was obtained by degenerate PCR using the conserved sequence. PCR oligonucleotides used The results were as follows. 1683 (nucleotides 298-319 of SEQ ID NO: 2) =   5 '.. TGG GAC. TGG. CGC. AAT. GTG. GAT. G ... 3 'and LM # 4 (also called Bcys2) (SEQ ID NO: 13) =   5 '.. GAC. TGA. ATT. CTT. NAC. NAG. CCA. GTA ... 3 '. Conditions for cDNA synthesis and PCR were obtained by raising the annealing temperature to 50 ° C. And except that the extension incubation at 70 ° C was 45 seconds. It was as follows. The PCR reaction resulted in a single 528 bp band that was subcloned And sequenced. Sequence of the obtained clone (CatZ (+) 3) (nucleic acid of SEQ ID NO: 2) Reotide 299-867) is shown in FIG.   To obtain additional 5 'sequences, use the HeLa cell cDNA library (λ from Stratagene). PCR reaction was performed with phage from the zap2 vector). 1 × 10^TenPhage / mL 5 μL of phage was boiled for 2 minutes and placed on ice. Hot start PCR Oligonucleotides according to the manufacturer (Perkin Elmer / Cetus) RACE31-NC (SEQ ID NO: 20) = CAG GAG GGT GGA GGG CCA CGC TCC CT And oligonucleotides corresponding to λ vector (788-1) 788-1 (SEQ ID NO: 14) = GGAAACAGCTATGACCATGAT Was performed under the following conditions; 50 pM RACE31-NC oligonucleotide (SEQ ID NO: 20) in a 50 μL reaction volume, 25 pM 788-1 oligonucleotide (SEQ ID NO: 14), 1X PCR buffer II, 100 μM dNTP, 2 .5 mM MgCl_TwoAnd 1.25 units of Taq polymerase. Heat reaction to 80 ° C in 10 minutes Then at 94 ° C for 1 minute, 55 ° C for 45 seconds, 1 minute rise to 72 ° C and 1 hour at 72 ° C. For 30 minutes, followed by a final single extension at 72 ° C. for 8 minutes. λ Oligonucleotide 25 pM corresponding to vector (872), 872 (SEQ ID NO: 15) = CCC. T CA. CTA. AAG. GGA. ACA and 50 pM oligonucleotide NestR31-nc (SEQ ID NO: 2 nucleotides 385-411) for 1 μL of PCR product A second nested hot start PCR reaction was performed under the same conditions. Oligonuk PCR using Reotide 1705 (nucleotides 301-366 of SEQ ID NO: 2) as a probe Southern analysis of the products shows reactive and PCR products of appropriate size Was. These were subcloned and used for diagnostics in FIG.ApaI site (SEQ ID NO: 2 (Shown at nucleotides 380-385) were sequenced. And The sequence of clone cat Y P3-25 (nucleotides 202-411 of SEQ ID NO: 2) is shown in FIG. .   To obtain additional 3 'and 5' sequences for this clone, use the 3 'and 5' RACE PCR techniques. The technique was used (Frohman et al., (1988), PNAS USA 85: 8998-9002).   For the 3'RACE reaction, 2 μg of RNA in a 100 μL volume was used and synthesis was The use of the adapter primers described below With the change, Clontech 5'AmpliFINDER^TMCDNA synthesis protocol in the RACE kit protocol Was used to synthesize cDNA from poly A + RNA from human HS683 cells (Frohman et al., ( 1988), PNAS USA 85: 8998-9002). Adapter primers are described by Frohman et al. (1988). , PNAS USA 85: 8998-9002.   DT for first strand synthesis₁₇+ Adapter:   Primer-1576 (SEQ ID NO: 16) = 5'-GGA CTC GAG TCG ACT CTA GAG CGT TTT TT T TTT TTT TTT TT-3 '   Adapter (XhoI-SalI-XbaI):   Primer-1577 (SEQ ID NO: 17) = 5'-GAC TCG AGT CGA CTC TAG AGC GT-3 '.   Hot start PCR uses adapter primer 1577 at an annealing temperature of 55 ° C. And the internal primer Nestr31-c (FIG. 4) (nucleotides 343-366 of SEQ ID NO: 2) Was performed using Hot start conditions are Perkin-Elmer AmpliWax^TMProtoco Was a modification of the Final concentration of all reagents after combining both layers: , The lower mixture was 1.25 x PCR buffer (10 x PCR buffer II [Perk in Elmer Cetus, Norwalk, CT] is 500 mM KCl, 100 mM Tris-HCl pH 8.3) , 2 mM MgCl_Two(Perkin Elmer Cetus), 200 μM dNTP (Perkin Elmer Cetus), 1 μM Each primer of M. Top mixture is 1.25 x PCR buffer in a total volume of 37.5 μL , 1. Ampliwax for sub-mixture^TMAdd PCR Gem50 (Perkin Elmer Cetus) Bring to 80 ° C. for 5 minutes, then hold at 25 ° C. until addition of the top mixture. PCR Conditions included initial denaturation at 95 ° C for 2 minutes followed by 94 ° C for 45 seconds and 55 ° C for 45 seconds. 30 cycles of 2 minutes at 72 ° C, followed by a final extension at 72 ° C for 8 minutes Was included.   As a probe, radiolabeled oligonucleotide 1758 (SEQ ID NO: 2) Southern blot analysis of the RACE reaction using nucleotide 553-577) (Figure 4) Bands were shown at 00 and 1100 bp. These bands were gel isolated and pT7Blu e (Novagen, La Jolla, CA). Novablue cells (Novagen, LaJoll a, CA) and are positive for the cathepsin Y sequence by PCR analysis. Colonies were sequenced. Larger fragments contain stop codons and poly Proven to include A-tail. The sequence is shown in FIG. 4 (“3” in FIG. 4). 'RACE') (nucleotides 343-1558 of SEQ ID NO: 2).   All 5'RACE reactions are 5'RACE-Ready^TMPerformed from human liver cDNA (Clontech). This cDNA is generated by random priming and ligated to the amino terminus. An anchor sequence is provided. CLONTECH anchor region (SEQ ID NO: 18):   3'-NH_Three-GGAGACTTCCAAGGTCTTAGCTATCACTTAAGCAC-P-5 ' Anchor primer:   Primer-1821 (SEQ ID NO: 19) =   5'-CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG-3 '   Primer-1823 (nucleotides 14-38 of SEQ ID NO: 19) =   5'-CCTCTGAAGGTTCCAGAATCGATAG-3 '.   Clone encoding region 1 (FIG. 4) (nucleotides 175-411 of SEQ ID NO: 2) The 1821 (SEQ ID NO: 19) and oligo were used to obtain Nucleotide NestR31-nc (FIG. 4) (reverse orientation of nucleotides 385-411 of SEQ ID NO: 2) PCR) under the hot start conditions described above. PCR conditions include 94 ° C Initial denaturation for 2 minutes; then 35 seconds at 94 ° C for 45 seconds, 60 ° C for 45 seconds, 72 ° C for 2 minutes. Cycle followed by a final extension at 72 ° C. for 8 minutes.   Southern rod³²Probe with P-kinase oligonucleotide 1810 (Figure 4) did. DNA of the corresponding size was gel isolated and cloned directly into pT7Blue. Was. Transform Novablue cells (Novagen, LaJolla, CA) and perform categorical PCR analysis. Colonies with the largest insert that were positive for the Psin Y sequence were sequenced. Specified. One of the 63 clones screened was region 1 (SEQ ID NO: 2 nucleotides 175-411).   A clone encoding region 2 (nucleotides 133-270 of SEQ ID NO: 2) was obtained. The above hot start conditions (3: 1 ratio instead of standard GTP in the dNTP mixture) Ratio of 7-deaza-GTP: replaced with GTP) using oligonucleotide 1685 (FIG. 4) (FIG. 4) Nucleotides 316-348 of SEQ ID NO: 2 and oligonucleotide 1821 (SEQ ID NO: 1 In 9), primary PCR was performed by annealing at 60 ° C. PCR conditions include 95 ° C for 2 minutes Initial denaturation between 95 ° C for 45 seconds, 60 ° C for 45 seconds, 72 ° C for 1.5 minutes A cycle was included, followed by one final extension at 72 ° C. for 8 minutes. 2% agaro PCR products run on the sgel showed DNA smears. DNA larger than 200 bp And Geneclean^TM(Bio 101, Madison, WI). This D Add 1 μL of single-stranded binding protein (USB) to the lower layer together with NA, And under the above hot start conditions of 95 ° C hot start temperature instead of 80 ° C , Oligonucleotide 1810 (FIG. 4) (nucleotides 243-270 of SEQ ID NO: 2) and And oligonucleotides 1823 (nucleotides 14-38 of SEQ ID NO: 19) Used as a template for pad PCR. Add primer to top mix The PCR proceeded with annealing at 60 ° C. Southern blot of PCR products The³²P-kinase oligonucleotide 1846 (FIG. 4) (nucleotide of SEQ ID NO: 2) Probe 175-204) and the appropriate sized DNA is isolated from the gel and pT7B inside lue And transformed into SURE cells (Stratagene, La Jolla CA). S Seven of the 27 colonies that were cleaned were cathepsin by PCR. Positive for the Y sequence. One sequenced clone is region 2 (Fig. 4) Included was the sequence identified as (nucleotides 133-270 of SEQ ID NO: 2).   Primary PCR was performed to obtain a clone encoding region 3 and region 2 For (SEQ ID NO: 2 nucleotides 133-270), prepare a template for secondary PCR But instead of oligonucleotide 1685 (nucleotides 316-348 of SEQ ID NO: 2) The oligonucleotide Nest31-nc (FIG. 4) (of nucleotides 385-411 of SEQ ID NO: 2) The reverse complement) was used. The secondary PCR was performed using the oligonucleotide Kyl (FIG. 4) (sequence Nucleotides 140-159 of SEQ ID NO: 2) and oligonucleotide 1823 (SEQ ID NO: 19) Nucleotides 14-38) under standard hot start conditions. However Add 1 μL of single-stranded binding protein into the lower layer together with the DNA template, At a hot start temperature of 1 minute. Deep Vent DNA polymerase (NEB) Used for PCR that allowed denaturation at 100 ° C instead of 4-95 ° C. For Vent PCR Is the Perkin-Elmer PCR buffer and MgCl_TwoThe appropriate concentration of NEB 10X Vent polymer Rase buffer (100 mM KCl, 200 mM Tris-HCl pH8.8, 100 mM [NH_Four]_TwoSO_Four, 20mM MgSO Was used at 2 U per 50 μL reaction. Annealing was performed at 60 ° C. PCR production The product is blunt-ended with Klenow,EcoDigested with RI and gel purified. 100-150 bp and 150-200 bp fragments are isolated separately, andEcoRI /EcoDigest with RV And ligated into pBR322. The SURE cells are then transformed and the maximum Colonies that were positive for the cathepsin Y sequence by PCR The sequence shown in FIG. 4 as region 3 (nucleotides 0- 159).   Northern analysis under stringent conditions can be performed on a variety of tissue and cell sources. Among the sources, a single size mRNA species of about 1600 bp encodes cathepsin Y. Show. Thus, some of the sequences in FIG. 4 differ from different sources (Hs683 and liver). If not, the sequence of cathepsin Y differs significantly between these sources. It is thought that it is not. The technique described above provides the sequence certainty and continuity shown in FIG. Clones that are further independently derived from various sources Used to determine The size coded by the sequence in FIG. Open reading that is sufficient to code the entire NA and is shown Gframe is predicted for the papain family of cysteine proteases. Start with a signal peptide. This means that this is all cathepsin Y Indicates that the area is a coding area.Cathepsin Y expression   Includes all coding regions for cathepsin YBamMake the HI fragment blunt-ended AndNruI andSpeIn the vector poCK751 cut with I (blunt end) (Fig. 5) By cloning to remove the βAPP sequence and substituting for that of cathepsin Y The plasmid poCK catY (FIG. 6) was formed.   This result was obtained using the Boheringer Mannheim DOTAP transfection kit. Transfected plasmid into human 293 kidney cells This resulted in expression of the Tepsin Y protein. This means that this clone Encoding the entire coding region of Pssin Y; It shows that protein can be produced from this clone.   Various amounts of cathepsin Y cDNA in the poCK expression vector were plated on a 6-well plate. Transfected into 293 cells. Transfection Using the protocol suggested by the manufacturer, DOTAP (Boehringer Mannheim) Was performed using 48-72 hours after transfection, wash cells with cold PBS And then dissolved in 1 mL of 20 mM MES pH 6, 0.1% Brij-35, 2 mM EDTA. Aliquot a 10 μL aliquot of the lysate (after centrifugation to remove cell debris) on SDS-PAGE Was used for electrophoresis, and then the protein was transferred onto a PVDF membrane. Western bu The membrane was probed with anti-cathepsin B antibody for lot analysis. Cathepsin Y cD As a result of the transient expression of NA, a band of immunoreactive cathepsin Y of about 31 kDa was used. A dose-dependent increase was seen.   Then, with 20 μL of Val-Phe-aldehyde affinity matrix, 300 μL of lysate was Adsorbed. This resulted in approximately 31 kDa immunoreactive cathepsin from the clarified lysate. The Y band was completely lost. This is because the overexpressed protein is active And has the ability to respond to binding to the inhibitor affinity matrix. You. Elution of the matrix in DPDS was performed in the transfection studies. The presence of a DNA dose-dependent increase in the carboxypeptidase activity of psin Y showed that. Increased expression is directly related to the amount of cDNA transfected into cells. Correlated.   These data indicate that the expression of the cDNA clone for cathepsin Y was approximately 31 kDa. Move on SDS-PAGE and bind to the inhibitor affinity matrix, and Resulting in overexpression of enzymatically active cathepsin Y that can be eluted. Confirm.   Although the above invention has been described in detail for purposes of clarity of understanding, the appended claims Obviously, modifications that are within the scope can be made.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification code FI A61K 38/00 C12Q 1/68 A C12Q 1/68 C07D 209/20 // C07D 209/20 217/06 217/06 217/06 A61K 37 / 02 (81) Designated countries EP (AT, BE, CH, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), CA, JP (72) Inventor MacConlogue, Lisa United States of America California 94127, San Francisco, Juanita Way 283 (72) Inventor Tatsuno, Gwen United States of America 94611, Auckland, Pinewood Road 5910 (72) Inventor Anderson, John United States of America 94132, San Francisco, Basqueri Dry 21 (72) inventor Semco, Christopher M.. F. United States of America California 94539, Fremont, Carpenter Court 2361 (72) Inventor Chrysler, Susanna United States of America 94132, Brisbane, San Bruno Avenue 448-1 / 2.

Claims (1)

[Claims] 1. In cells that produce β-amyloid peptide, β-amyloid peptide A method of inhibiting production, comprising the following formula I: An inhibitory amount of the compound or a pharmaceutically acceptable salt thereof is administered to such cells. Including the step of here:   R is hydrogen, alkyl of 1 to 6 carbon atoms, and R and R^TwoAre combined to 4 ~ Selected from the group consisting of forming a ring structure of 10 carbon atoms,   R ′ is hydrogen, alkyl of 1 to 6 carbon atoms, and R ′ and R^ThreeJoins 4 Selected from the group consisting of forming a ring structure of up to 10 carbon atoms,   R¹But,     (a) aryl of 6 to 10 carbon atoms, (b) alkyl of 1 to 6 carbon atoms, 6 Aryl of 10 to 10 carbon atoms, alkoxy of 1 to 6 carbon atoms, 6 to 10 carbon atoms Group consisting of aryloxy, hydroxy, cyano, halo, and amino Aryl of 6 to 10 carbon atoms substituted with 1 to 3 substituents selected from: (c) cycloalkyl of 3 to 8 carbon atoms, and (d) nitrogen, oxygen and sulfur A heterocyclic group of 3 to 14 carbon atoms having 1 to 3 heteroatoms selected from the group consisting of: 1 to 4 carbon atoms substituted with 1 to 5 substituents selected from the group consisting of Child alkyl,   Wherein the substituted alkyl group is optionally substituted with one to two hydroxyl groups. Further substituted with a group,     (a) aryl of 6 to 10 carbon atoms, (b) alkyl of 1 to 6 carbon atoms, 6 Aryl of 10 to 10 carbon atoms, alkoxy of 1 to 6 carbon atoms, 6 to 10 carbon atoms Group consisting of aryloxy, hydroxy, cyano, halo, and amino Aryl of 6 to 10 carbon atoms substituted with 1 to 3 substituents selected from: (c) cycloalkyls of 3 to 8 carbon atoms, and (d) nitrogen, oxygen and sulfur A group of 3 to 14 carbon atoms having 1 to 3 heteroatoms selected from the group consisting of 2 to 4 carbon atoms substituted with 1 to 4 substituents selected from the group consisting of Alkenyl of an atom,     Aryl of 6 to 10 carbon atoms,     Alkyl of 1 to 6 carbon atoms, aryl of 6 to 10 carbon atoms, 1 to 6 An alkoxy of 6 carbon atoms, an aryloxy of 6 to 10 carbon atoms, hydroxy, Substituted with 1 to 3 substituents selected from the group consisting of cyano, halo, and amino Aryl of 6 to 10 carbon atoms,     Fluorenyl,     1 to 3 heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur A heterocyclic ring of 3 to 14 carbon atoms,   Is selected from the group consisting of:   R^TwoAnd R^ThreeMust independently include no proline side chain in the amino acid side chain. A D- or L-amino acid side chain of at least 2 carbon atoms, provided that   R^FourIs     −C (O) CH = N = N,     −CH_TwoOH,     −C = NOH, and     −C (O) R^Five(Where R^FiveIs hydrogen, alkyl of 1 to 6 carbon atoms, 1 to 6 A haloalkyl of 1 to 2 halo groups, an alha of 1 to 6 carbon atoms Koxy, -NR⁶R⁷(Where R⁶And R⁷Is independently hydrogen and 1 to 6 carbon atoms And -N (CH_Three) OCH_ThreeIs) ,   Is selected from the group consisting of:   X is -O-, -NR⁹-, And -S- (where R⁹Is hydrogen, an alkyl of 1 to 6 carbon atoms Selected from the group consisting of kill and aryl of 6 to 10 carbon atoms) Selected from the group consisting of:   Y is selected from the group consisting of -C (O)-and -C (S)-;   m is equal to zero or one; and   n is equal to 0-2,   Where R¹Is l-naphthyl and R^TwoIs -CH (CH_Three)_Two(L-isomer) and R^ThreeBut -CH_Two φ (L-isomer), Y is -C (O)-, m is zero, and n is 1 If R^FourIs -N (CH_Three) OCH_ThreeNot, and R¹Is diphenylmethyl, and R^Two Is p- (benzyloxy) benzyl (L-isomer), Y is -C (O)-, and If m and n are zero, then R^FourIs -N (CH_Three) OCH_ThreeNot, and even R¹ Is (1,2-diphenyl) ethenyl, Y is -C (O)-, and R is^TwoBut -CH_Twoφ (L-isomer Field) and if m and n are zero, then R^FourIs -N (CH_Three) OCH_ThreeNot And subject to the method. 2. R¹Is 1-5 selected from the group consisting of aryls of 6-10 carbon atoms The method of claim 1, wherein the alkyl is an alkyl of 1-4 carbon atoms substituted with a substituent. Law. 3. R¹Is benzyl, trityl, diphenylmethyl, 4-phenylbutyl, 2. The method of claim 1, wherein the group is selected from the group consisting of nilethyl, naphthyl, and pyridyl. The described method. 4. R^TwoIs valine, leucine, phenylalanine, tryptophan, and 2. The method of claim 1, wherein the method is selected from the group consisting of d- and l-isomers of leucine. . 5. R^ThreeIs valine, leucine, phenylalanine, tryptophan, and 2. The method of claim 1, wherein the method is selected from the group consisting of d- and l-isomers of leucine. . 6. R^FourIs selected from the group consisting of -C (O) CH = N = N or -C (O) H. The method described. 7. Wherein the compound is The method of claim 1, wherein 8. Wherein the compound is The method of claim 1, wherein 9. Wherein the compound is The method of claim 1, wherein 10. Wherein the compound is The method of claim 1, wherein 11. Wherein the compound is The method of claim 1, wherein 12. Wherein the compound is The method of claim 1, wherein 13. Wherein the compound is The method of claim 1, wherein 14． Wherein the compound is The method of claim 1, wherein 15. Wherein the compound is The method of claim 1, wherein 16. Wherein the compound is The method of claim 1, wherein 17． Wherein the compound is The method of claim 1, wherein 18. Wherein the compound is The method of claim 1, wherein 19. Wherein the compound is The method of claim 1, wherein 20. Wherein the compound is The method of claim 1, wherein 21. A method of inhibiting amyloid plaque deposition in a mammal, comprising the steps of: Administering to said mammal an effective amount of a compound of formula I as defined in claim 1. The process. 22. A method for preventing or treating Alzheimer's disease (AD) in a mammal The use of a compound of formula I as defined in claim 1 in a mammal in need thereof. Administering an amount. 23. Ability to inhibit β-amyloid peptide (βAP) release from cells A method for screening test compounds, comprising:   Under conditions where cathepsin Y cleaves the carboxy-terminal amino acid of the oligopeptide , Exposing the oligopeptide to the cathepsin Y; and   Detecting such cleavage in the presence of the test compound; Where the absence of cleavage indicates that the test compound is inhibiting βAP production. And show the method. 24. Cleavage of the oligopeptide is due to the presence of β-mercaptoethanol at high pH The free amino terminus released by cleavage below and O-phthalaldehyde 24. The method of claim 23, wherein the method is detected by reacting. 25. An isolated and having the same enzymatic activity as the polypeptide of FIG. Purified polypeptide. 26. 26. The isolated nucleic acid of claim 25 having the amino acid sequence set forth in FIG. Purified polypeptide. 27. An isolated and purified nucleic acid sequence encoding cathepsin Y. 28. a) a nucleic acid sequence substantially homologous to the sequence of FIG. 4, wherein T may also be U;   b) a nucleic acid sequence substantially complementary to the sequence of FIG. 4, wherein T may be U;   c) a cathepsin gene that is at least 12 bases in length and is not cathepsin Y Does not hybridize to the nucleic acid of the coding sequence, but encodes cathepsin Y. A fragment of the sequence of FIG. 4 that selectively hybridizes to mammalian DNA An isolated hybridizable to cathepsin Y selected from the group consisting of: Purified nucleic acid sequence. 29. A method for expressing cathepsin Y, comprising:   a) transfecting host cells with a nucleic acid sequence encoding cathepsin Y Process,   b) Culture the transfected cells under conditions that express cathepsin Y Step; and   c) recovering cathepsin Y from the cell culture; A method comprising: 30. A method for detecting the expression of cathepsin Y,   a) isolating RNA from mammalian tissues or cells,   b) For the isolated RNA,     i) a nucleic acid sequence substantially homologous to the sequence of FIG. 4, wherein T may also be U;     ii) a nucleic acid sequence substantially complementary to the sequence of Figure 4, wherein T may be U;     iii) Cathepsins other than cathepsin Y that are at least 12 bases in length Does not hybridize to the nucleic acid of the sequence encoding the gene, but encodes cathepsin Y. 4. A flag for the nucleic acid sequence of FIG. 4 that selectively hybridizes to mammalian DNA Ment, And a label capable of hybridizing to a cathepsin Y sequence selected from the group consisting of Hybridizing the nucleic acid sequence, and   c) determining whether the labeled nucleic acid sequence binds to the isolated RNA; About A method comprising: