CA2009917C - Cold shock protein, gene coding therefor, promoter for gene encoding cold shock and other proteins, methods and uses as antifreeze protein in agriculture and other applications - Google Patents

Abstract

The major cold shock protein of E. coli, which comprises a nucleotide sequence encoding cs7.4 with functional equivalents thereof, along with a nucleic acid molecule having a promoter sequence which is capable of demonstrating transcription of a gene at a temperature below normal growth temperature of E. coli. Consequently, construct and DNA
sequence in which include the gene encoding cs7.4 protein, a promoter designed to drive cs7.4 protein, a promoter designed to drive cs7.4 expression, and the cspA
gene are disclosed.
Also, contemplated are transformed competent hosts and transgenic plants. The invention also provides for various applications and method in protein synthesis.

Description

C,OLD SHOCK PROTEIN, GENE CODING THEREFOR, PROMOTER FOR
GENE ENCODING COLD SHOCK AND OTHER PROTEINS, METHODS AND USES AS ANTIFREEZE PROTEIN IN
AGRICULTURE AND OTHER APPLICATIONS

This invention relates generally to the field of biotechnology, more specifically to a novel and valuable protein which on the basis of evidence to date, is believed to be capable of protecting cells, e.g., plant cells against the adverse and injurious effects of low temperature (an antifreeze protein) and is stable at physiological temperatures. The invention also relates to methods of making same.
The invention further relates to a novel promoter which controls the expression of the gene encoding the protein or of heterologous proteins. The invention further relates to a cold shock structural gene the expression of which is capable of being regulated by a heterologous promoter. Additionally, the invention relates further to transformed competent hosts, contemplates transgenic plants which can express the antifreeze protein and to several other useful applications in agriculture and other fields.

Damage to crops by frost is one of the leading causes of loss in agricultural output due to the natural phenomenon of weather variability in the . a.., .
R A STAPtFR
Ir[ .ee ~r rlrltc~
,/M, N I.IOt -=.1M1.f A

world. It has been estimated that from 5 to 15% of the gross world agricultural product may be lost to frost damage in one year. In some regional areas the loss may approach 100%. The yearly economic crop loss due to frost damage in the United States has been reported to be greater than $5 billion. Most of this damage is induced by freezing initiated by certain species of natural ice-nucleating bacteria, such as species of Pseudomonas, such as syringae, coronafaciens, piai, tabaci, or fluorescens, Xanthomonas such as translucens, or Erwinia such as herbicola. The presence of such natural epiphytic bacteria on the plant surface can promote the nucleation and formation of ice crystals at temperatures slightly i0 below 0 C. Such ice nucleation capable ( INA') bacteria are responsible for the frost damage on a wide variety of important agricultural crops, such as corn, soybeans, wheat, tomatoes, deciduous fruit trees such as pears, almond, apple, cherry, and many subtropical plan-ts such as citrus and avocado.

The removal of ice-nucleating bacteria from frost sensitive plants has obvious immediate economic benefits. This need had spawned a number of technologies that might be used to prevent frost injury to crops. One technology is based upon the removal of the ice gene from bacteria and reintroducing these genetically engineered microorganisms ( GEMs ) to crops. When these GEMs colonize on the plants, they displace the natural ice nucleating bacteria thereby providing a measure of protection against frost. Some of the patents dealing with attempts to solve that problem are discussed further below. This invention in one of its important embodiments, suggests an approach to a solution to this problem.
There is therefore, an urgent and economic need in the United States and throughout the world to provide the means for controlling damage to plants, and to other biological . e..~.
R B STAPLER
wre +ee nrtmaM sr ~..~ r. ..aa . ~ssu~a - t -materials. The treatment of plants with bacterial strains is subject to regulatory and public response iri the United States and elsewhere, and the present invention suggests in one of its important embodiinents an alternative to applying non-ice nucleation bacterial strains. The invention, as will be described in further detail herein provides a protein which is thought to function on the basis of evidence available, as an antifreeze protein; also the invention contemplates the transformation of plants to render them less susceptible or resistant to low temperature by incorporating the DNA sequence carrying the gene into recipient crop host cells which will then synthesize the antifreeze protein of the invention, or one of similar antifreeze properties.

There is another important area to which this invention relates.
There are known instances where proteins produced by recombinant DNA or fermentation techniques are enzymatically degraded at physiological temperatures resulting in modification, diminution or destruction of the desired biological activity of the protein. Furtliermore, there is recezit evidence (27) that indicates that proteins produced at normal growth temperatures for E. coli ( 37 C) can sometimes be folded improperly resulting in a complete or partial loss of the desired property of the proteins (e. g. , biological activity). This invention in another of its important embodiments, may indicate a solution to these problems by the production of the desired protein at temperatures below the normal growth temperature.

Thus, the ability to control a gene encoding a protein of commercial value such that it is produced only after the temperature has been reduced below the normal growth temperature, would allow the expression of the target protein :R A sTAPLU
km , ..,,...~ ,.
w~. _'.'Ot ,..,,.., to proceed at optimal temperature with no ill effects on the desired physiological activity of the protein.

With respect to the field of genetic engineering a considerable wealth of literature (including United States and foreign) has been published. When appropriate to assist one skilled in the art, reference shall be made to such literature either within the body of the description or towards the end hereof. A number of patent and literature references are noted at the end of this section of the description under the heading "References".

United States Patent No. 4,766,077 (1988) deals with ice-nucleation deficient (INA-) microorganisms which have induced non-reverting mutations within a genomic DNA
sequence (INA gene) which encodes for polypeptide(s) responsible for ice-nucleation activity (INA). The INA- microorganisms disclosed are applied to a plant part so that they become established prior to the colonization of the plant by the INA+ microogranisms. Treatment in accordance with the patent, is apparently the subject of a notice of application for permission with the United States government to release Pseudomonas syringae pv. s n ae and Erwinia herbicola carrying in vitro generated deletions of all or part of the genes involved in ice-nucleation.

U.S. Patent No. 4,375,734 (1983) also deals with an ice nucleation-inhibiting compositions using non-phytotoxic virulent bacteriophages which are species specific to the ice-nucleating bacteria normally present on plants. A

particularly useful strain is a virulent bacteriophage strain, Erh 1, which is species specific to Erwinia herbicola.

U.S. Patent No. 4,464,473 (1984) provides for the isolation of DNA
segments encoding for ice nucleation activity, which DNA segments may then be introduced into an appropriate vector. The ice-nucleating microorganisms can be used for preventing super cooling of water in various commercial applications.

U.S. Patent No. 4,161, 084 (1979) provides for a method for reducing the temperature at which freezing takes place in plants to reduce frost damage.
This is performed by the addition of non-ice-nucleating bacteria to plants prior to the onset of freezing temperature and preferably while the plants are in their seedling stage.

Reference is also made to earlier U.S. Patent No. 4,045,910 (1977), which describes the treatment of plants with Erwinia herbicola before the onset of freezing temperature.

It can be seen from this review of some of the United States' patent literature that the problem of frost damage to agricultural crops has of course been recognized and several proposals made to alleviate this serious problem.
However, none of these patents teach or suggest the subject matter of the present invention.

A review of the technical literature has brought out the following publica tions .

Publications have been noted which deal with proteins which are synthesized in microorganisms when growing cultures are subjected to an increase in heat, yielding what are called "heat-shock" proteins, or to a decrease in growing temperatures yielding what is called a "cold-shock" protein.
=M OPIIC[f ER & $TMLEA aunc soo o P~KMTI ST
~. .. 'O'0=
fw rVs~s w 1 Where the full citation does not appear in the text herein, a numeral in parentheses refers to a list of references at the end of this text.

NEIDHART, F.C., et al, The Genetics and Regulation of Iieat-Shock Proteins, Ann. Rev. Genet., Vol. 18, pp. 295-329, (1984), discusses the heat-shock response in procaryotic and eucaryotic cells . Heat-shock proteins identified in E. coli are des cribed .

COWLING, D.W., et al, Consensus Sequence for Escherichia coli Heat Shock Gene Promoters, Proc. Natl. Acad. Sci., Vol. 82, pp. 2679-2683 (1985).
The article identifies the consensus sequence for the E. coli heat-shock promoters and the gene encoding a heat-shock protein. Transcription from each promoter is heat-inducible in vivo, and is recognized in vitro by RNA polymerase containing the Q; factor encoded by rpoH(htpR) but not by RNA polymerase containing the major E. coli 6 factor.

The induction of transcription of heat-shock proteins has been reported to be acconiplished primarily by an alternate a subunit of RNA
polymerase encoded by rpoH(HtpR) Grossman et al (1); Strauss et al (2).

For a review of heat-shock response in various organisms, see Lindquist, The Heat Shock Response, Ann. Rev. Biochem., Vol. 55, pp. 151-1101 (1986); Neidhardt, et al, The Genetics and Regulation of Heat Shock Proteins, Ann. Rev. Genet., Vol. 18, pp. 295-329 (1984).

Broeze, et al (24) report the differences in protein synthesis by coli and P. fluorescens after a temperature shift to 5 C. In the mesophilic E. coli , protein synthesis was reported to decrease for one hour and then cease. The accumulation of 70s ribosomes that were found after such a temperature shift has beeri interpreted to indicate a block in initiation of translation. A shift to 10 C, NM OII CLf M&S7wrLER sUre sne w .vicerTM $* iCLM.... '*'03 t.r rs~aa ' 2009917 on the other liand, results in a gi=owth lag of 4 hours followed by renewed growth.
Ng, et al (4) and Jones, et al, cited above.

For additional background on antifreeze proteins, see Hew, et al (5) and Duman, et al (6). Such proteins are low molecular weight proteins commonly found in high concentrations in the serum of polar dwelling marine fishes and In the hemolymph of insects which winter in subfreezing climates.

For background information dealing generally with control of transcription, see for instance Protein-Nucleic Acid Interactions in Transcription:
A Molecular Analysis, Hippiel, P.H., et al, Ann. Rev. Biochem., Vol. 53, pp.

440 (1984). For other publications to which reference may be made in conjunction with this description, see the list of references at the end hereof. For certain patents in the genetic engineering field which use terminology and techniques also referred to herein, reference may be made to U. S. Patent No. 4,624,926 entitled "Novel Cloning Vehicles for Polypeptide Expression in Microbial Hosts" to Masayori Inouye and Kenzo Nakamura, 1986; U.S. Patent No. 4,666,836 entitled "Novel Cloning Vehicles for Polypeptide Expression in Microbial Hosts" to Masayori Inouye and Kenzo Nakamura, 1987; U. S. Patent No. 4,643,969 entitled "Novel Cloning Vehicles for Polypeptide Expression in Microbial Hosts" to Masayori Inouye and Yoshihiro Masui, 1987; and U.S. Patent No. 4,757,013 entitled "Cloning Vehicles for Polypeptide Expression in Microbial Hosts" to Masayori Inouye and Yoshihiro Masui, 1988.

Other publication. Recently, an article has been published which is of interest. JONES, P. G. , et al, Induction of Proteins in Response to Low Temperatures in Escherichia coli, The Journal of Bacteriology, Vol. 169, pp.

2095 (1987). This article discusses the synthesis of a set of proteins involved in .. C...C[9 an et sTAPL"
ans see G /iTL[MIM ,t 14Mn. -. ,.07 200~917 transcription and translation and possibly mRNA degz-adation. Proleins are reported to be synthesized during a growth lag when the growth temperature for the bacteria is decreased from 37 to 10 C. About thirteen proteiris were noted.
Twelve identified proteins are synthesized during the growth lag (after the temperature is decreased from 37 C); and five are unidentified; one of the cold-shock proteins (designated F10.6) is detectably synthesized during growth at low temperature. There is no indication that this is a transient synthesis.

hithin the scope of the invention are provided for genetically transforming microorganisms, particularly bacteria, to produce genotypical capability, particularly to produce "cold-shock" or "antifreeze" and other proteins. Also provided are segments of DNA ("promoter") that contain signals that direct the proper binding of the RNA polymerase holoenzyme and its subsequent activation to a form capable of initiating specific RNA
transcription.
The promoter which is described herein is cold-induced and capable of controlling the expression of the cspA gene which encodes a cold-shock or antifreeze or other proteins. Practical applications are referred to hereinafter.

Genetic systems are provided for expressing proteins called cold-shock or antifreeze proteins, particularly a cold-shock protein of E. coli designated cs7.4.

The invention provides a novel polypeptide which is synthesized in E.
coli in response to a decrease of the temperature below ambient, or physiological A.:,.k , gruwth temperature. The polypeptide (or protein) is a 7.4 kdal protein induced under cold-shock and has been designated as "cs7. 4" .

A noteworthy aspect of the polypeptide is that it is stable at temperatures above the cold temperature at which it was induced.

The invention also provides the gene encoding the cs7.4 protein. The invention provides further the cold-induced promoter which controls the expression of the gene encoding cs7.4 and which promoter also is capable of initiating transcription of proteins other than cs7.4 in response to a shift in temperature below the microorganism growth temperatures.

The invention also provides a system for expressing the gene encoding the antifreeze protein under the direction of a promoter other than the promoter of the invention.

The invention further provides various DNA constructs, including cloning vectors, e.g., plasmids which contain the promoter, the structural gene and other necessary functional DNA elements, and transformed hosts.

The invention also contemplates various applications of the products of the inveiition in the field of preventing or alleviating the injurious or lethal effects of low temperature, e. g. , freezing of microbiological and plant cells. It is contemplated that the protein of the invention be used as an "antifreeze"

compound, for instance on crops; or that an innocuous microorganism transformed with the gene or portions thereof encoding for es7.4 protein of the invention be used in agricultural or other applications. It is also contemplated that DNA
containing a sequence encoding the cs7.4 protein be transferred to crop host cells to produce there the cs7.4 antifreeze protein. and thus protect the crop from frost injury.
tww WnC[s KfR & $7MlFR
w" eoe W -[sw+w Sr ,enn.n no~
s.s. rrswa .

= ,,, ~009917 ~

The invention provides a cold-stiock induced promoter (the "native"
promoter) which is capable of regulating the expression of a cold-shock induced gene encoding ari antifreeze protein.

The invention provides further a proinoter ("native") which is capable of controlling the expression of a gene encoding an antifreeze protein or another protein at temperature below physiological temperatures. Although cs7. 4 is frequently referred to herein, it is contemplated that any protein can be produced by the promoter of the invention.

The invention also provides for the expression of a gene encoding an antifreeze protein under the control of a heterologous (non-native) promoter at physiological temperatures.

The invention further contemplates that having further elucidated the promoter sequence, the DNA sequence of the promoter can be generated synthetically; such promoter will be useful to regulate the expression of proteins at low temperatures, i.e., temperatures below physiological temperature.

It is a noteworthy aspect of the invention that the promoter can be "uncoupled" in the sense that it can be used without the native structural gene and conversely, the structural gene can be controlled by a heterologous promoter.

Other aspects of the invention will become apparent from the description which follows.

uw ornecs um & SrArtm w,c .ee w -to- ar wpUMlll M I9I02 QIM ~i - 10 Embodiments of the invention will be described with reference to the accompanying drawings in which:

FIG 1 shows the major cold-shock protein induction. The arrow on the right indicates the induced major cold-shock protein, cs7.4.

FIG 2 (A and B) shows transient induction of cs7.4. The numbers indicated are as follows: 1, pulse-labeled from 0 to 30 minutes after temperature shift; 2, 30 to 60 minutes; 3, 60 to 90 minutes; 4, 90 to 120 minutes; 5, 120 to 150 minutes; 6, 150 to 180 minutes. The arrows are described in FIG 1.

FIG 3 shows the stability of cs7.4. The arrow indicates cs7.4.
FIG 4 shows the 2-dimensional gel utilized in purification of cs7.4.
FIG 5 shows a Southern Blot analysis for cspA.

FIG 6A shows the DNA sequence of cspA (restriction map and sequencing strategy).

FIG 6B shows the partial nucleotide sequence of the cloned HindIIl fragmerit. The region encoding cspA and the corresponding amino acid sequence of cs7.4 are shown in bold type. The underlined AGG is probably the Shine-Delgarno sequence. Regions underlined with half an arrow indicate inverted repeats.

FIG 7 is a schematic representation of a plasmid pJJG01 cEirrying the cspA gene ( shown by arrow).

F'IG 8 is a schematic representation of pJJG12.
FIG 9 is a schematic representation of pJJG04.

.., 2009917 . ; -Figure 1(FIG 1) - Major Cold-Shock Protein Inductioii.

Aliquots of a cell culture growing at 30 C were transferred to 420C, 30 C, 25 C, and 18 C and immediately pulse-labeled with ["S ] methionine for 10 minutes. Samples were subjected sodium dodecyl sulfate-polyacrylamide gel electrophoresis and the autoradiogram is shown here. Molecular weight standard sizes are indicated on the left in kilodaltons. The arrow on the right indicates the induced major cold-shock protein.

Figure 2A and 2B (FIG 2A and FIG 2B )- Transient Induction of cs7.4.

Cell cultures growing at 370C were transferred to either 10 C or C. Aliquots were then pulse-labeled with [ 1SS ] methionine for 30 minute time intervals and electrophoresed as described in FIG 1. FIG 2A. Above the autoradiogram shown here, C indicates a control where an aliquot was pulse-15 labeled for 5 minutes at 37 C before the temperature shift. The numbers indicated are as follows: 1, pulse-labeled from 0 to 30 minutes after temperature shift;
2, 30 to 60 minutes; 3, 60 to 90 minutes; 4, 90 to 120 minutes; 5, 120 to 150 minutes;
6, 150 to 180 minutes. The arrows are described in FIG 1. FIG 2B. The autoradiogram in A was subjected to scanning densitometry and the percent methionine-labeled cs7.4 protein in the whole cell was determined for each time . olnccs X & STAPLER
uR+t eoo :.wt[.~r s. :n.=... sm -r sseasa ~ 12 ,,.. _ iriterval. Each time point on the graph is the quarititation for the percent methionine-labeled cs7.4 protein at the end of each thirty minute interval.
For example, between 30 and 60 minutes (60 minute time point on the ordinate), cs7.4 accounted for 10% of the total methionine-labeled protein in the cell at 10 C. The 0 time point accounts for the five minute pulse at 37 C, which is described in A.
Figure 3 (FIG 3) - Stability of cs7. 4.

A cell culture growing at 370C was transferred to 15 C. After 30 minutes, the culture was pulse-labeled with ['SS] Translabel for 30 minutes.
The culture was then chased with nonradioactive methionine and cysteine for various lengths of time indicated above the autoradiogram shown here. The samples were electrophoresed as described in FIG 1. The 37 C sample was prepared as described in FIG 2. The arrow indicates cs7.4.

Figure 4 (FIG 4) - 2-dimensional Gel Utilized in Purification of cs7.4.

A cell culture growing at 37 C was transferred to 14 C for 4 hours.
The culture was then harvested, fractionated, and the cytoplasmic fraction was subjected to 2-dimensional gel electrophoresis. The first dimension is isoelectric focusing and the second dimension is SDS-polyacrylamide gel electrophoresis.
The gel was electroblotted onto a PVDF membrane which was stained with Coomassie Blue dye. The arrow indicates cs7.4.

,.. a.~.
5/SER & sTAPLER WK foo w n..ca+= n ,nourw... ~wa It11 ~91iM1 . .~ 2009917 Figure 5 (FIG 5) - Southern Blot Analysis for cspA.

E. coli chromosomal DNA was digested with various restriction enzymes and the DNA was transferred from an agarose gel to nitrocellulose paper.
Hybridization was carried out usirig the degenerate probe described in the text, and the autoradiogram is shown here. The restriction digests are as follows:
S, SalI; P, PstI; B, BamHI; E, EcoRI; H, HindIII. indicates lambda DNA digested with HindIII, which was used as a size standard. Chromosomal DNA digested with HindI1I was also fractionated by agarose gel electrophoresis, and fractions 1 through 12 are shown.

Figure 6A and 6B (FIG 6A and 6B )- DNA Sequence of cspA.
Approximately one half of the 2.4kb HindIIl fragment from clone pJJG01 was sequenced. FIG 6A. Shown here is the restriction map and the sequencing strategy. The restriction enzyme sites are as follows: H, HindIII;
D, Dral; S, SmaI; B, Bg1I; A, ApaLI; P, PvuII; X, XmnI. The thick arrow indicates the region encoding cspA. FIG 6B. Shown here is the partial nucleotide sequence of the cloned Hind1II fragment. The region encoding cspA and the corresponding amino acid sequence of cs7.4 is in bold type. The underlined AGG is the probable Shine-Delgarno sequence. Regions underlined with a half arrow indicate inverted repeats.

FIGS 7, 8 and 9 are described further below.
uw o.rlecs LSEA & STAPIER wn[ xo p nn[[rrw ft .p[LM.. N 110=
1tp ~1i~f] .

The invention provides a niethod for producing a "cold-shock"

protein, a promoter therefor and various constructs. In one embodiment that will be described hereinafter, the gene encoding the cold-shock protein is expressed under the regulation of a heterologous promoter. In another embodiment, the cold-shock induced promoter is used to control the synthesis of a heterologous protein in response to lowering of the growth temperature.

The method of the invention to induce and produce the es7.4 protein of the invention comprises growing in a nutrient rich medium at an exponential rate an appropriate microorganism, for instance an E. coli, to a desired growth density at physiological growth temperature for the particular microorganism. For E.
coli such temperature may be in the range of about 10 to about 50 C, preferably in the range of 20 to about 40 C. Each microorganism is known to have its optimum growth temperature; for E. coli raising the temperature above about 40 C or lowering it below 20 C results in progressively slower growth, until growth ceases, at the maximum temperature of growth, about 49 C, or the minimum, about 8 C.

When the desired degree of growth is attained (monitored by an appropriate inethod, such as spectrophotometrically), the temperature is rapidly shifted to a lower temperature above abdut 10 and below about 20 C, preferably below about 150C and above about 8 C. Lower temperatures generally do not sustain practical growth rates. If desirable, a shift to lower temperature but above the temperature at which no growth of the microorganism takes place may orrccs A STAPLER
n[ foo r/[[wrM ~T w..= wa oTMaoa also be performed. The culture is grown in the lower temperature range for the appropriate period of time for optimum production of the polypeptide of the invention. The kinetics of polypeptide induction are followed by appropriate method such as pulse labeling with radioactive methionine, harvesting the culture, processing and separation by two-dimensional gel electrophoresis and determining by autoradiography the amount of protein synthesized.

it was found that the protein of the invention is not synthesized at physiological growth temperature at which the microorganism normally grows, in this case the E. coli; the polypeptide is synthesized in the lower temperature range. Sudden induction of the synthesis of the polypeptide takes place within approximately the first 30 minutes after temperature shift to 10 C or 15 C.
Maximal induction and rate of synthesis is temperature dependent after temper=ature shift. After shift to 15 C, maximal synthesis is attained at 30-ininutes post temperature shift; maximal rate of synthesis is approximately 13.1%

of total protein synthesis. See FIGS 2A and 2B. Shift to 10 C gives a maximal rate of the synthesis of approximately 8.5% of total protein synthesis at 60 to 90 minutes post-shift. Adjustment of the temperature therefore allows for adjusting the rate of synthesis and/or yield of the polypeptide as being suited for the objective of the invention. After the maximum total polypeptide yield lias been reached, the rate of synthesis thereof drops off, ultimately reaching a fraction, e. g. , about a fifth of tha maximum in the case of the culture shifted to 15 C and about three-fifths of the maximum in the case of the culture shifted to 10 C.

A noteworthy characteristic of the cs7.4 protein of the invention is its stability at temperatures above the temperature range at which it was induced and synthesized. Such physiological temperature may range from about above 15 C to sEx & SrAn.eR
Nll.c !GG

10 11ITm.rM ST
XLMiI " H1G=
ttN ff3iM- 16 -HGg9 17 about 40 C, or higher. The data in FIG 3 shows the protein to be stable after synthesis at 15 C for 20 hours, (only about 30% of the protein degraded), and stable at 37 C( for at least 1.5 hours).

The stability of the protein of the invention at physiological temperatures lias important practical applications. It permits synthesis of the protein at physiological temperatures with a promoter other than the promoter of the invention. It also facilitates applications of the protein in agricultural formulations on crops at ambient temperatures before the protein starts functioning in its freezing or frost damage prevention role.

Other elements of the invention will be described hereinafter. The promoter of the invention is believed to be located on the cloned HindIII
fragment between nucleotides 1 and 605. The first 997 bp of the cloned HindIII fragment contains all the necessary elements of the functiorial gene for regulated expression including the ribosome binding sites.

There is evidence of a promoter sequerice at -35 and -10 upstream of the coding region, at positions 330 and 355, respectively. Another characteristic of the promoter is that it responds to a drop in temperature.

The promoter of the invention is activated at reduced temperature and directs transcription of the gene of the invention.

The promoter of the invention is cold-inducible in vivo and is recognized in vivo by RNA polymerase. Although the inventors do not wish to be bound to any particular theory or principles of mode of action, or function, several hypotheses are being presently considered. The inventors believe that there could be three possibilities (conceivably not mutually exclusive) for the uw orsecs .
W!f$ER & STAPLER
[Yn[ 'JOe isC s0 ~[[MfH fI
hSYO[l/M.. r. 19102 ai~ naaa -inechanism of regulation of the promoter of the invention. First, the possibility exists that a cold activated inducer induces expression from the promoter at lower temperatures. Secondly, a cold serisitive repressor may be inactivated at cold temperatures resulting in expression of the gene. Thirdly, the gene may be coritrolled by a cold induced alternate sigma factor (other than a standard sigma factor like the d factor) which would allow the RNA polymerase to recognize a novel promoter sequence upstream of the structural gene. Other mechanisms may be postulated, especially if one considers that the transformed host need not be a member of the Enterobacteriaceae family.

The invention further provides a cold-induced cytoplasmic protein, designated cs7.4 which is stable at growth temperature of a microorganism, e.g., E. coli. The polypeptide has the following partial amino acid sequence SGKMTG(X)VKWFNADKGFGFI wherein X is leucine or isoleucine. Both isoleucine and leucine have been identified (64% and 36%, respectively). Thus, the invention includes either and both polypeptides. The polypeptide of the invention is a amino acid residue protein. The calculated molecular weight is 7402 daltons and the calculated pI is 5.92. The polypeptide is very hydrophylic, containing over 20% charged residues. Lysine residues make up 10% of the protein. No homology was detected with any other sequence in the NBRF data base.

With respect to secondary structure determination carried out in furtherance of the invention, the rules of Chou and Fasman (1978 )(11) did not reveal any predominant secondary structural conformation; however, if the amino acid residues are plotted on a helical net 12 of the 16 charged residues were determined to be adjacent as oppositely charged pairs. Also, folding of the protein into an a-helix would result in juxtaposition of oppositely charged residues u. w.ets OVE6ER & STAPLER wnc aoo a so aneewrr sr MRbO[1M11. I. 19lOi a.snas a -_ _ 18 ~ ..

for 12 of the 16 charged amino acid residues in the protein. These data suggest that a large portion or essentially all of the protein of the invention may be in an a-helical configuration.

A recent crystallographic study of the secondary structure of an antifreeze polypeptide from the Fish Winter Flounder shows the molecule to be a single a-helix. See, Crystal Structure of an Antifreeze Polypeptide and its Mechanistic Implications, Yang, et al, Nature, Vol. 333, 19 May 1988, pp. 232-237 (25). A mechanism of antifreeze protein binding is proposed which is based on the fact that all surfaces of ice crystals are densely populated with atoms that can hydrogen bond to the protein surface, and that due to the flexibility of the side chain many patterns of hydrogen bonding can exist. The mechanism suggested requires that, after an antifreeze polypeptide induces local ordering of the ice lattice, the dipole moment from the helical structure dictates the preferential alignment of the peptide to the c-axis of the ice nuclei; shifts of the lielical conformation can then take place and torsional movement of the side chains of the hydrophilic amino acids strenghtens the bonding of the protein with the ice surface.

Further evidence of the helical structure of the polypeptide of the invention would clarify whether the polypeptide cs7.4 of the invention is the first antifreeze protein cold-induced in E. coli that can be produced by genetic engineering methods. Work on the secondary structure of cs7. 4 would also open other possibilities. It can be postulated for instance, that the only portion of the polypeptide which has a-helix configuration would be essential for the antifreeze function; and likewise, that only the portion of the nucleotide sequence which ,... a.~.
wF.Mlt ~ stAPl.ER
,..~ .~
sao w r.+cc.rw s.
MIOLVMI M 110=

encodes such polypeptide fraction would be essential for such antifreeze applicatio.n.

Tlie cloned 2.4 kb HindIII fragment containing the gene for cs7.4 was isolated from pUC9 by digesting with HindI1I and separating on a 5%
polyacrylamide gel. The fragment was then subcloned into M13. DNA sequencing was .performeli by the chain termination method (Sanger et al, 1977). DNA sequencing was accomplished using [35S] dATP and the enzyme, Sequenase*, by the method provided by the manufacturer (United States Biochemical Corporation).

The partial nucleotide sequence of the cloned HindIll fragment includes the sequence encoding cs7.4 and the promoter therefor. The nucleotide sequerice encoding the polypeptide of the invention cspA includes the following sequence of 210 nucleotides.

ATGTCCGGTAAAATGACTGGTATCGTAAAATGGTTCAACGCTGACAAAGGCTTCG
GCTTCATCACTCCTGACGATGGCTCTAAAGATGTGTTCGTACACTTCTCTGCTAT
CCAGAACGATGGTTACAAATCTCTGGACGAAGGTCAGAAAGTGTCCTTCACCP.TC
GAAAGCGGCGCTAAAGGCCCGGCAGCTGGTAACGTAACCAGCCTG

The corresponding amino acid sequence encoded by cspA is as follows.
MetSerGlyLysMetThrGlyIleValLysTrpPheAsnAlaAspLysGlyPheGlyPheIleThrPro AspAspGlySerLysAsp Va1PheValHisPheSerAlaIleGlnAsnAspGlyTyrLysSerLeuAsp G1uGlyGlnLysValSerPheThrIleGluSerGlyAlaLysGlyProAlaAlaGlyAsnValThrSerLeu The sequence is shown in FIG 6B, it contains an open reading frame beginning with an ATG codon at nucleotide 617 of the cloned HindIII fragment and extending for 210 nucleotides eriding with a TAA termination codon. This open *Trade mark _ 20~9917 .

reading frame is the coding region of the gene herein designated cspA
responsible for es7.4 synthesis. The invention includes within its scope the nucleotide sequence or any partial sequence thereof which codes for the polypeptide cs7.4 or a polypeptide having the properties of cs7.4 (functional equivalent). The invention also includes any equivalent nucleotide sequence wherein one or more codons have been substituted by certain other codons, which equivalent nucleotide sequence codes for the cs7. 4 polypeptide, or a functional equivalent thereof.

In the work in connection with this invention, some evidence was adduced that suggests to date that there may be two copies (cspA and cspB) of the gene encoding the cold-induced polypeptide cs7.4. The evidence is further discussed below. The invention includes within its scope such other possible gene which encodes the cs7.4 polypeptide or its functional equivalent. There are examples in molecular biology of multiple genes encoding the same protein in E.
coli, such as elongation factor Tu (tufA and tufB), and the ornithine carbamoyltransferase, (ar~ and ar i) . If there were two genes encoding cs7.
4, this would be the first finding of a two-gene cold-induced polypeptide.

In accordance with the invention, it is conceivable that from the 997 bp fragment of the cloned HindIII fragment, the cspA structural gene can be removed and be replaced by a foreign gene. If necessary, the inverted repeat at the 3' end at 857-866 and 869-878 may be conserved; but if not, the HindIII
fragment would not need to contain the base pairs upstream of the TAA stop codon. The foreign gene (or part thereof) would be inducible by the cold-inciuced promoter (or its equivalent) and be capable of encoding a target protein.

, ~.. ~.
t & s'IAPfFll ne wo ,..ccrn., sr.
MM. M t~lOi IlM1~) In another embodiment of the invention the cold-shock protein would be expressed by the gene coding for it under the control of the promoter of the invention.

In yet another embodiment of the invention, a promoter other than the native promoter can regulate expression of the cs7.4 gene at physiological temperatures, i.e., within the temperatures range at which bacteria exponentially grow. Thus, in accordance with the invention, a heterologous promoter, an E.
coli lac promoter, has been used to regulate the expression of the cs7. 4 gene.
The cspA structural gene was subcloned into a high level expression vector, pINIII (lppp'') (7). The resulting construct, pJJG12 is schematically shown in FIG
8. Upon addition of isopropylthiogalactoside ( IPTG ), expression of the cs7.

protein at 37 C was detected by SDS polyacrylamide gel electrophoresis of whole cell lysate. The expression of the protein was 5-10 fold less than that obtained from expression regulated by the native promoter at 150C.

The fact, however, that expression of the protein was obtained at a higher temperature with a promoter other than the native promoter is significant particularly since the protein is normally not expressed at 370C. This opens a number of intriguing new possibilities. It can be contemplated that promoters other than the lac promoter might be more effective in controlling expression of the gene. Also, the growth of cells at low temperature (15-10 C) ranges is slower than at optimum growth temperature for the selected microorganisms, e.g., E. ~
coli. Thus, while the yield may be less at optimum growth temperature, the faster growth rate of the bacterium is likely to compensate for a possible lower yield.

When a promoter stronger than the lac promoter is used to regulate the expression WElSEf & SrwrLEx sunc ~ao f]C i0 ...ecMIM s,. ~L-.- 14102 asrisassa ~.:=.

of the cs7.4 gene, it can be contemplated that high yields of a valuable antifreeze protein like cs7.4 can be obtained within satisfactory time periods on a commercial scale. Thus, large amounts of the antifreeze protein will be made available.
The property described above, namely that the protein can be produced and still be active as an aritifreeze protein at physiological temperature, is therefore very significant.

As the result of this teaching, one skilled in the art will appreciate that other suitable promoters other than the lac promoter, such as the trp, tac, promoter, lambda pL, ompF, 2M, and other promoters may be used to regulate the expression of the gene coding for the desired protein. When other transformed microorganisms such as yeast are used to express the proteins, promoter like GAL10 and others may be suitable.

Furthermore, as described briefly above, the cspA promoter of the invention which is active at low temperatures, can be used to control the expression of a protein other than the cs7.4 cold-shock protein. Thus, this properly opens up yet other possibilities. This may be of particular interest where a particular protein which would be useful but for the fact that it is enzymatically ( e. g., proteolytically ) degraded at physiological temperatures, could be expressed at low temperatures at which it is less susceptible to enzyme degradation. A like possibility exists for proteins that could be useful for the fact that they may be improperly folded so that they are not biologically active when produced at physiologically active temperature. It may be advantageous to produce the proteins properly folded and active under the control of the cspA
promoter of the invention.

uw orsiccs WE75FR & S7APLER wrr[ wo zao w sr*ccr.*r n wuot.nw. -uoa as~ssaz~z These observations do not apply only to antifreeze proteins but to the expression of any proteins which heretofore could not be expressed in the desired conformation at physiological temperatures; these proteins, it can be visualized, could be expressed at lower non-injurious temperatures with the assistance of the promoter of the invention.

In the above-described embodiment of the invention, the cspA promoter of the invention has been used in a classic model to control the expression of B-galactosidase. For this purpose, a plasmid (pKM005) (21) containing the lac Z structural gene without promoter was compared with the plasmid containing the cspA promoter on an 806 bp HindIIl-PvuI1 fragment (pJJG04). See FIG 9.

A second plasmid, pJJG08, was constructed which contains a smaller nucleotide fraction of the upstream region of the csnA gene, terminating at the ApaLl site (bp 534). The results are shown in Table I.

TABLE I

RESULTS OF EXPRESSION IN A LAC STRAIN
TEMPERATURE AFTER SHIFT AFTER SHIFT
Plasmid 370 to 15 to 10 pKM005 6.7 4.1 3.7 pJJG04 549.0 900.0 851.0 pJJG08 40.7 45.6 56.1 Temperatures are in C; other numerals refer to "Units" of enzyme activity.

i I

The difference in yields between pJJG04 and pJJG05 would tend to suggest that the promoter or other regulating elements are in the 0 to 534 base pair fragment; the region from 534 to the start of the gene may also embody regulatory elements. Likewise, the region downstream of the gene to bp 878 may also embody regulatory elements.

The results show that the cspA promoter is capable to directing a heterologous gene to express a selected protein.

The following examples are only illustrative of the invention; they are not to be construed as a limitation thereof. One skilled in the art can readily make variations and substitutions to obtain equivalent results.

Cultures of E. coli SB221 (lpi) hsdR trpE5 IacY recA/F' lacl'= lac+
pro+) (7) were grown to a density of approximately 2 X 108 cells/ml in a 10 ml culture volume prior to temperature shift. 1.1. ml aliquots of the cell culture growing at 30 C
were transferred to beakers at 42 C, 30 C, 25 C and 18 C containing 10 uCi of [35S]
methionine (Amersham Corp.,>1000 Ci/mmol) or [35S] Translabel* (ICN
Radiochemicals, Irvine, CA) and pulse-labeled for 10 minutes. All samples were collected by centrifugation and the pellets were dried by lyophilization.
Samples were then subjected to sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) on a 17.5% resolving gel. The gel was dried and exposed to X-ray film.

Trade mark zu0?917 , - _ The resultant autoradiogram indicated a protein of 8 kdal apparent molecular weight produced only after shift to 250C. No corresponding band was seen in the pre-shift or 43 C shifted cultures. Ttus protein is designated cs7. 4.

Isolation of csp gene In constructing the plasmid containing the cold-shock protein coding sequence and its regulatory elements, it is necessary to first identify and isolate the locus. In order to prepare an oligonucleotide probe, a partial amino terminal sequence of the protein is obtained. A 10 ml culture of E. coli SB221 (7) was grown to a density of approximately 2 X 10" cells / ml at 37 C and transferred to 14 C for 4 hours. Cells were then harvested and fractionated for the soluble fraction as previously described (9). A trace of protein pulse-labeled for 30 minutes after shift to 15 C as described above was then mixed with 250 ug of soluble fraction protein. Two-dimensional electrophoresis was then performed with isoelectric focusing in the first dimension (ampholines pH 3-10, 1.5%; pH 6-8, 0.5%) and SDS-polyacrylamide gradient gel electrophoresis (10-18.4%
acrylamide, 2.7% crosslinking) in the second dimension according to the method of O'Farrell (15). Separated protein was electrophoretically transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore Corp., Bedford, MA) using a semidry blotter apparatus (Saritorius GmbH, Goettinggen, FRG) and 48mM Tris, 39mM
glycine, 1.3mM SDS, 20% (v/v) methanol pH 9.2 as the transfer buffer. The membrane was then stained for protein with Coomassie Blue R-250, dried, and w os.ic[s R & SiAPLFJt uT[ aee n.asw. s.
11M.. N 1~\Cf ~ /1i~1]

200q917 subjected to autoradiography. The autoradiogram clearly identified a heavily labeled protein at approxiunately the same molecular weight previously observed for cs7.4 (FIG 4). The autoradiographic spot was used to identify the cs7.4 spot on the stained membrane, which was then excised from the blot. Automated Edman degradation was performed directly on the stained membrane fragment according to the method of Matsudaira (1987) using an Applied Biosystems Model 470 gas-phase sequenator. The amino acid sequence obtained is described above.

A mixed degenerate oligonucleotide probe for Southern blot analysis was made to match a short region of the amino acid sequence as shown below:

...K W F N A...
5' -AA"TGGTTTAA'GC-3' a c a For Southern blot analysis, chromosomal DNA was prepared from overnight cultures of E. coli SB221 (7). The cells were collected by centrifugation and washed with 10mM Tris-HC1 (pH 8) and lysozyme in 0.25M Tris-HCl (pH 8) was added to a concentration of 3.3 mg/ml. The sample was then incubated at 0 C
for minutes followed by the addition of RNaseA to a concentration of 60mM. After 5 more minutes on ice 10% SDS was added to a concentration of approximately 1%.
The sample was then mixed rapidly, and the same volume of RNaseA that was 20 added previously was again added along with pronase in 25mM Tris-HCl (pH 8) to a concentration of 0.1 mg/ml. The sample was then incubated at 37 C for 30 minutes followed. by phenol extraction, chloroform-isoamyl alcohol (24:1) extraction, and ethanol precipitation. The sample was then further subjected to phenol extraction, ether extractions, and ethanol precipitation. Chromosomal DNA
. O/.C[9 II& sT,VLFi a" ow jrll M I~IOf = .1F~iR

was subjected to drop dialysis using Millipore Type VS 0.025 um filter before restriction enzyme digestion.

Chromosomal DNA fractionation was carried out by digesting at least 50 ug DNA with HindIII, Sall, BamHI, Pstl, and EcoRl and electrophoresing on a 0.7% agarose gel.

Southern transfer of DNA from the agarose gel to nitrocellulose paper was done by the method described in the manual by Maniatis et al (26) with the following exceptions. Acid depurination to partially hydrolyze the DNA was accomplished by washing the gel only once for 15 miriutes in 0.25M HCI.

IO Furthermore, the dish in which the transfer was carried out was filled with SSC instead of 10 X SSC.

Hybridization was carried out according to Maniatis et al (26) with the following exceptions. Both the prehybridization and hybridization solution contained by volume/mi solution: 0.1 ml 50 X Denhardt's, 0.2 ml 30 X NET, 0.5 ml 20% Dextran Sulfate, and 0.05 ml 10% SDS. These solutioris are described in Inouye and Inouye, (19). The oligomer that was used for the probe is shown above. The ["P ]-labeled probe was made according to Inouye and Inouye,(19 ), and the prehybridization and the hybridization was carried out at 32 C. The filter was washed and dried according to Inouye and Inouye, (19). 20 The autoradiogram from Southern blot hybridization with the mixed oligonucleotide probe indicated at least one distinct band in each digest. In particular, the HindIII digest yielded one band with a size of 2.4 kb (See FIG
5). The 2.4 kb HindIII fragment was isolated in the following manner. A

HindIII digest of chromosomal DNA was fractionated on a 0.7% agarose gel. Gel Fe[s It sTAilFR

R[[IIIN /T
Y. /Ipt 1lJ1tt _ _ 28 20a01917 slices were then excised at every 0.5 cm from the top of the gel.. Each gel slice was frozen at -20 C for at least 20 minutes and then centrifuged in an Eppendorf tube for 10 minutes. This was repeated three times, the last time adding some 1mM Tris, 0.1mM EDTA (pH 7.5) before freezing, and the supernatant was collected after each centrifugation. The samples were then phenol extracted three times, ether extracted, and ethanol precipitated.

Each fraction was subjected to Southern blot analysis with the probe.
DNA fragments from fractions 7 and 8 clearly hybridized with probe corresponding well with the 2.4 kb HindIII band in the original chromosomal digest.

Cloning of cspA gene pUC9 plasmid DNA was digested with HindllI and ligated with fraction 7 of the HindIII chromosomal digest (see Example 2) using T4 DNA ligase. E.
coli strain JM83 (ara,& (lac- rp oAB ) rpsL 80 lacM15 )(13 ) was then transformed, and the cells screened on L-agar plates containing 50 ug/mi ampicillin spread with 25u1 of 40mg/ml xgal. White colonies were picked onto Whatman filter paper and subjected to a colony hybridization screen as described by Inouye and Inouye, (19). The probe used was the same one used for Southern blot analysis (see Example 2). The hybridization temperature was 32 C. A colony which lighted up upon autoradiography was subjected to a second screening by colony hybridization to ensure that the clone had been obtained.

=osnccs ' '&$rAMFR
rre oee FWJCprr ww. ti ~oa .
ss~ a 2009?17 4 _ Use of csp Promoter to Direct Heterologous Protein Synthesis The csp promoter was used to direct the synthesis of B-galactosidase in E. coli from the plasmid pJJG04. This plasmid was constructed as follows.
The 2.4 kb HindIII fragment containing the gene was digested with PvuII. The resultant 806 bp fragment was separated on 0. 8% agarose gel, the band excised and the DNA recovered by electroelution using a salt-bridge electroelution apparatus manufactured by IBI, Inc. as per manufacturer's instructions. This fragment was then ligated with T4 DNA ligase into the promoter-proving vector (pKMOO5 (Masui et al) (21) after treatment of the vector fragment with XbaI restriction enzyme and Klenow fragment of DNA polymerase I. The E. coli lac deletion strain SB4288 (21) was transformed and cells carrying the recombinant plasmid were selected as blue colonies on L-agar plates containing 50 ug/ml ampicillin and 40 mg/ml Xgal.

Cultures of E. coli SB4288 harboring plasmid pJJG04 were grown at 37 C and shifted to 10 C or 15 C. B-galactosidase activity before and after the shift using the substrate o-nitrophenyl-B-D-galactoside as described by Miller (22). The results indicate a 64% increase in B-galactosidase activity upon shift of the culture to 15 C, evidencing induction of transcription from the cloned cspA
promoter and subsequent expression of f3-galactosidase.

This example illustrates well the versatility of the,promoter sequence of the invention.

...a..~.
Ee & srnrLEn vu~ sm ~ .RTKwTM {1 RN..... '.'Ci . .,,..., 2'00991I

Expression of cs7. 4 Structural Gene at 37 C.

The cspA structural gene was subcloned into a higlr level expression vector, pIN1II (lpp"") (23) using arr Xbal site created just upstream of tlre structural gene using oligonucleotide directed site specific rnu lagerresis .
Upon addition of IPTG, expression of the cs7.4 protein could be detected by SDS-PAGE
analysis of whole cell lysates.

For vector that carr be used to clone a DNA fragment carryirrg a promoter and to examine promoter efficacy, see Masui et al, (21).

LO It is understood that other competerrt nricroorganism lic,sls (eucaryotic and procaryotic) can be transforrned genetically in accordance witlr the invention.
Bacteria which are susceptible to transf'ormation, itrclude wembers of' the Enterobacteriaceae, such as E. coli, Salmonella; Bacillaceae, such as subtilis, Pneumococcus; Streptococcus; yeasts strains arrd others.

l5 Of particular interest niay be the transformation of yeast cells, such as Saccharomyces cerevisiae with the structural gene of the invention or of all or part of the nucleotide sequence slrown in FIG 6. Basic tectrniques of yeast genetics, appropriate yeast cluriing arrd expression vectors aricl lransfornration protocols are discussed in Currerit Protocols iri Molecular Biolc~#;y, Sulrplement 5 20 (1989 )(23) which is specifically incorporated hereirt by reference.

Likewise, vertebrate cell cultures may be trattsforined with the structural gene of the inverttiori or part thereof or with part or all of the nucleotide sequerrce shown in FIG 6. Otre skilled in the art will select atr ~
& STAFIBR
r[ soo IIiClIIIM 91 IU. PA I9107 9MiM7 appropriate cell culture such as a COS-71ine of monkey fibroblasts.
Appropriate techniques for the transfection of DNA into eucaryotic cells are described in Current Protocols, Section 9.
Illustrated protocols are shown to work well with such cell lines as HeLa, BLAB/c 3T3, N1H
3T3 and rat embryo fibroblasts.

Additional vectors and sources are listed in Perbal (22) (pages 277-296) including yeast cloning vectors, plant vectors, viral vectors, with scientific appropriate literature references, and cloning vectors from commercial sources.

Numerous suitable microorganisms are available from the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD, 20852-1776.

From the teaching of this disclosure, it will have become apparent to one skilled in the art that the invention contemplates nucleotide sequences which encode a protein which has biological properties of, or similar enough to be essentially a functional equivalent, of the protein of the invention. Likewise, the invention contemplates a promoter sequence which performs essentially the same function as that described herein. The invention thus intends to cover and covers the functional equivalent of the functional elements described and taught herein.

... ~1;'= .. ... r.r: . - . 4 :,' ' = y ., , y.,. REFERENCES

1. Grossrnran, A. h. ; I,r=icltsor-, J . W. ; .arrc.l (;ross, C. A. (1987).
'I'he 10.10i Gene Produce of E. coli is a Sigu-a Factor for Ileat-Slrock Promoters. Cell, 38, 383-390.

2. Straus, ll.13.; Watter, W.A.; and Crosse, C.A. (1987). '1'the Ileat Stiock Response in E. coli is Regulated by Cliariges irr the Concentration of Q" .
Nature, 329, 348-351.

3. - Bahl, H.; Echol.s, H. ; Straus, D.I3. ; Court, ll. ;(.,ruwl, lt. ; an(i Georgopoulos, C.D. (1987). lriductiorr of the Heat Shock Resporrse of E. coli ) Through Stabilization of o" by the Phage larnbda cIII Protein. Genes &
Dev., 1, 57-64.

4. Ng, H.; Ingraham, J. L. ; and Marr, A. G.(1962) . Damage anrl llerepression in Escherichia coli Resulting frorn Growth at Low '1'en-peratures. J.
Bacteriol. 84, 331-339.

5. Hew, C.L.; Scott, G.K.; aird llavies, P.L. (1986). Molecular Biology of Antifreeze. In Living irr the Cold: Physiological and Biochernical Adaptations. H.C. Heller, ed. (Elsvier Scierice Publishing Co., lnc. N.Y.), pp. 117-123.

6. Duman, J.; and Horwath, K. (1983). '1'}re Itole of Ilemolymph Proteins in the ) Cold Tol.eratice of lnsects. Anr-. Rev. Physiol., 45, 261-270.

7. Nakamura, K.; Masul, Y.; and lnouye, M. (1982). Use o~ Lac Promoter-Operator Fragment as a Transcriptional. Control Switch for the Expression of the Corrstitutive lpp Gene in Esc}rerichia coli. J. Mol. Applied Gen., 1, 289-299.

8. Vlasuk, G.P.; Inouye, S.; ito, H. ; lt.akura, K.; and Inouye, M. (1983).
Effects of Complete Removal of Basic Amino Acid Residues i'rcn the Signal Peptide ori Secretion of .Lipuproteitr in lisclrericlricx coli. J. L'iul.
Clreru., 258, 7141-7148.

9. Lehnhardt, S.; 1'c,llitt, S.; aricl lnc~i.ayc:, M. (1987). '1'he Uil'fore.nLial ECfect on Two Hybritl Proteins oF lleletion Mutations within the llyc.lr=ol,trohic lteg.icrn of the Escherichia coli OnipA Sigrial Peptide. ~). Biol. Clr(:nr., 262, 1716-1719.

10. lrrouye, S. ; Soberorr, X. ; Frarrcesct-irri, '1'. ; llakura, K.; rirrd Inouye, M.
(1982). Role of Positive Cliarge at tihe Amino Ternrinal ltegion oF the Sigrial Peptide for Protein Secretiori Across the Mernbrane. Proc. Nat.l. Acad. Sci.
USA. , 79; 3438-3441.

cgs TAPLER

[MTM fT
.. 110!
~M1 11. Chou, P.Y.; arrd Fasrnan, G.D. (1979). Ernl.rirical Pt=edicl.icis of Protein Conformaticrrt. Aurr. Itev. 13ioclreur., 47, 251-276.

12. Messing, J.; Crea, R.; and Seeburg, P. H. (1981.). A Systenr for Shotgun DNA Sequetrcing. Nucleic Acids Res., 9, 309-321.

13. Yanisch-Perron, C.; Vieria, J.; artd Messing, J. (1985). Improved M13 Phage Cloning Vectors and 1-Iost Strains: Niacleotide Sequences of the M13111p18 anct pUC19 Vectors. Cene, 33, 103-119.

14. Kreuger, J.H.; and Walker, G.C. (1984). groEL and drraK Genes of Escherichia coli and Induced by UV Irradiation and Nalidixic Acid in a 0 - htpR"-Dependent Fashion. Proc. Nall. Acad. Sci. USA, 81, 1499-1503.

15. O'Farrell, P.11. (1975). High Resolution Two-Dirnerisional Electrophoresis of Proteins. J. Biol. Chem., 250, 4007-4021.

16. Feeney, R. E. ; atrd Burc}raiii, 'r . S. (1986). Antifreeze Glycoproteins from Polar Fish Blood. Ann. Rev. Biopltys. Chem., 15, 59-78.

5 17. Inokuchi, K. ; Furukawa, Il. ; Nalcaiirura, K. ; and Mizustrirna, S.
(1984).
Characterization by Deletion Mutagertesis in Vitro of the 1'roruoter Regiort of oinpf, a Positively Regulated Gene of Escherichia coli. J. Mol. Bio. , 178, 653-668.

18. DeVries, A.L. (1983). Anlifreeze Peptides and Glycopeplicies irt Cold-Water 0 Fishes. Ann. Rev. Physiol., 45, 245-60.

19. Inouye, S.; and lnouye, M. (11187). Olil;orruc:leotide-llirected Site-Specific Mutagenesis using Double-Strancled Plasnud DNA. ln Synthesis and Applications of DNA and RNA Synthesis. S.A. Nararig, ed. (Academic Press, Inc., Orlarido), pp. 181-206.

5 20. Inouye, S.; and Inouye, M.(1985 ). Up-proruoter Mutatiorrs in the jPR
gene of Escherichia coli. Nucleic Acids Research, Vol. 13, No. 9, pp. 3101-3110.
21. Masui, Y.; Colernan, J.; and lr~ouye, M. (1983). Experirnenlal Marlipulation of Gene Expression, Acacleur_y Press, ed. lnouye.

22. Perbal, B. (1988) . A Pr:-c:t ic;il CkuicJc to MOlcc.ular Clonint,=. John Wiley airrd 0 Sons, Wiley-lrrterscience, New York, NY.

23. Ausubel, F.M. et al, eds. (1987). Current Protocols in Molecular Biology (Current 1'rol.oculs), l;ruoklyn, NY and Wiley arrcl Sorts Irrlerscietrce, New York, NY ( Supplemertts 1-5 ) .

Cf!
STAPLEA
.oo [M1M 11 -. 11102 $ 7-. ... . y ;y: .
' ~k.t:.t ~ hr[~.:'v'ti. '.al:=f~

24. Broeze, It.a.; ;ioIoinort, (;..I.; -tti(i I'ow!, I).II. (.15178).
I?ITqwl:; of I,uw '1'einperalur=e on lit Vivc., .tncl Iit Vitro l'rulein Syiitltesis in I:t;c:het.=icaria e:oli and Pseuaottiottas fluoresce-ts. J. Lacteriol., 134, 861-874.

25. Yang, el al (.1988). Cryslal Struct+ire of an /ltttifreeze Polyl.)cl)ti(le atrd its Mechanistic lniplications. Nature, Vol. 333, pp. 232-237.

26. Maniatis, T. ; Fritch, E. F. ; and Sainbrouk, J. (1982). Mctleciil;tr Cloning.
A Laboratory Manual. Cold Spring IlarVur Labor=ator_y, Col(1 Shring 11arbUr, NY, pp. 383-389.

27. Bio/Technology, 6, pp. 291-294, Schein, C. H. ; Noteborn, M.I1.M., 1988.
co :TAPLER
~
ewtw si =~ n~o~
Ma

Claims (30)

WE CLAIM:

1. An isolated protein which has the following amino acid sequence:
MetSerGlyLysMetThrGlyIleValLysTrpPheAsnAlaAspLysGlyPheGlyPheIleThr ProAspAspGlySerLysAspValPheValHisPheSerAlaIleGlnAsnAspGlyTyrLysSerLeu AspGluGlyGlnLysValSerPheThrlleGluSerGlyAlaLysGlyProAlaAlaGlyAsnValThr SerLeu.

2. The protein of claim 1 whose amino acid sequence is free of the initial Met residue.

3. A nucleic acid molecule comprising a promoter sequence which is capable of initiating transcription of a gene at a temperature below normal growth temperature of E. coli, wherein said promoter sequence contains at least a portion of nucleotides 1 through 605 as shown in FIG. 6B.

4. The nucleic acid molecule of claim 3 which is capable of initiating the transcription of a gene which encodes a protein which lessens at least one adverse effect of low temperature on E. coli live cells.

5. The nucleic acid molecule of claim 4 which initiates the transcription of a gene at a temperature below the normal growth temperature of E. coli, which gene encodes a protein which lessens at least one adverse effect of low temperature on live E. coli cells.

6. The nucleic acid molecule of claim 5 wherein the transcription of the gene which is initiated at low temperature, is a homologous gene.

7. The nucleic acid molecule of claim 6 wherein the gene is cSnA.

8. The nucleic acid molecule of claim 3 wherein said gene is a heterologous gene.

9. The nucleic acid molecule of claim 5, wherein said promoter is located upstream of the coding region of cs7.4 and between nucleotides 1 and 605 as shown in FIG. 6B.

10. The DNA fragment shown in FIG. 6B.

11. The DNA fragment shown in FIG. 6B from nucleotides 1 through 997.

12. The DNA fragment which contains the nucleotide sequence of FIG. 6B which includes the gene encoding for a protein which is capable of lessening at least one adverse effect of low temperature on live E. coli cells, and the nucleotide sequence of FIG. 6B encoding a promoter which is capable of initiating the transcription of said gene at low temperature.

13. A nucleic acid molecule having a DNA sequence which encodes the protein of claim 1.

14. The nucleic acid molecule of claim 13 which has the following nucleotide sequence:

ATGTCCGGTAAAATGACTGGTATCGTAAAATGGTTCAACGCTGAC
AAAGGCTTCGGCTTCATCACTCCTGACGATGGCTCTAAAGATGTGTTCGTA

CACT
TCTCTGCTATCCAGAACGATGGTTACAAATCTCTGGACGAAGGTCAGAAA
GTGTC

CTTCACCATCGAAAGCGGCGCTAAAGGCCCGGCAGCTGGTAACGTAACCA
GCCTG.

15. A nucleic acid molecule constituting a gene encoding a protein which is induced when E. coli is grown at a temperature below a normal growth temperature for E. coli, the transcription of the gene being regulatable by a promoter which is induced when E. coli is grown at a temperature below a normal growth temperature for E. coli, wherein said nucleic acid molecule comprises a nucleotide sequence encoding cs7.4.

16. The nucleic acid molecule of claim 15 which encodes the protein of claim 1.

17. The nucleic acid molecule of claim 15 which is designated as cspA.

18. The nucleic acid molecule of claim 15, wherein the transcription of the nucleic acid molecule of claim 15 is also regulatable by a promoter other than by a cold-inducible promoter.

19. The nucleic acid molecule of claim 18 wherein the promoter other than the cold-inducible promoter, is a lac promoter.

20. The nucleic acid molecule of claim 19 which encodes a protein at a normal growth temperature of E. coli.

21. A recombinant plasmid comprising the nucleotide sequence encoding the protein of claim 1.

22. The plasmid of claim 21 which contains the cspA gene shown in FIG. 7.

23. The plasmid of claim 22 which contains a promoter region sequence which is capable of initiating the transcription of the gene.

24. The plasmid of claim 23 which further comprises a DNA sequence upstream of the promoter region capable of binding a transcriptional regulatory protein.

25. The plasmid of claim 24 which further comprises a regulatory protein binding site.

26. An Enterobacteriaceae cell transformed with the nucleotide sequence encoding the protein of claim 1 from an extra-chromosomal element.

27. The cell of claim 26 which is an E. coli.

28. A process for isolating a nucleic acid molecule encoding cs7.4 which is capable of being induced at a temperature below a normal growth temperature of E. coli and which protein lessens at least one adverse effect of low temperature on growing E. coli, said nucleic acid molecule further including a promoter sequence which is capable of initiating transcription of a gene encoding said protein comprising:

growing a culture of E. coli at a temperature below a normal growth temperature for E. coli thereby causing the synthesis of said protein, discontinuing the growth of said culture, isolating said protein therefrom, obtaining a partial amino acid sequence of said protein, synthesizing at least one oligonucleotide probe encoding said partial amino acid sequence, probing a preparation of bacterial DNA treated with restriction enzymes with said probe, selecting a DNA fragment that hybridizes to said probe, and isolating said DNA fragment, which fragment contains at least the gene encoding said protein and the promoter sequence which initiated the transcription of said gene.

29. An isolated protein whose synthesis is induced in E. coli at a temperature below a normal growth temperature of E. coli, said protein having a molecular weight of 7.4 kDa and being encoded by a nucleic acid molecule that hybridizes to a probe having a sequence 5'-AARTGGTTYAAYGC-3' in a solution having, by volume/ml, 0.1 ml 50 X Denhardt's solution, 0.2 ml 30 X NET, 0.5 ml 20% dextran sulfate, and 0.05 ml 10% SDS at 32°C, wherein R is A or G, and Y is T or C.

30. A nucleic acid molecule having a DNA sequence which encodes a protein having a molecular weight of 7.4 kDa, wherein the synthesis of said protein is induced in E. coli at a temperature below a normal growth temperature of E. coli, said nucleic acid hybridizes to a probe having a sequence 5'-AARTGGTTYAAYGC-3' in a solution having, by volume/ml, 0.1 ml 50 X Denhardt's solution, 0.2 ml 30 X
NET, 0.5 ml 20% dextran sulfate, and 0.05 ml 10% SDS at 32°C, wherein R is A
or G, and Y is T or C.