EP0423264A1 - Recombinant cold shock protein, production and use in agriculture - Google Patents

Abstract

The invention relates to an E. coli protein that protects against cold shock, a structural gene encoding it, a promoter for the gene and for other proteins. DNA sequences have been developed comprising the gene encoding the protein, the promoter and other functional elements. The invention also relates to structures. We have considered suitable transformed hosts as well as transgenic plants. It further relates to various applications and methods in the synthesis of proteins.

Description

EECOMBINANT COLD SHOCK PROTEIN, PRODUCTION AND USE IN AGRICULTURE

TECHNICAL FIELD

This invention relates generally to the field of biotechnology, more specifically to a novel and valuable protein which on the basis of_N(evidence to date, is believed to be capable of protecting cells, e. g. , plant cells against the adverse and injurious effects of low temperature (an antifreeze protein) and is stable at physiological temperatures . The invention also relates to methods of making same. The invention further relates to a novel promoter which controls the expression of the gene encoding the protein or of heterologous proteins. The invention further relates to a cold shock structural gene the expression of which is capable of being regulated by a heterologous promoter. Additionally, the invention relates further to transformed competent hosts, contemplates transgenic plants which can express the antifreeze protein and to several other^ useful applicatioμs in agriculture and other fields.

BACKGROUND OF THE INVENTION

1. Field of the Invention .

Damage to crops by frost is one of the leading causes of loss in agricultural output due to the natural phenomenon of weather variability in the world. It has been estimated that from 5 to 15% of the gross world agricultural product may be lost to frost damage in one year. In some regional areas the loss may approach 100%. The yearly economic crop loss due to frost damage in the United States has been reported tp be greater than $5 billion. Most of this damage is induced by freezing initiated by certain species of natural ice -nucleating bacteria, such as species of Pseudomonas , such as syringae, coronaf aciens , pisi, tabaci, or fluorescens , Xanthomonas such as translucens , or Erwinia such as herbicola. The presence of such natural epiphytic bacteria on the plant surface can promote the nucleation and formation of ice crystals at temperatures slightly below 0°C. Such ice nucleation capable (INA^"*") bacteria are responsible for the frost damage on a wide variety of important agricultural crops, such as corn, soybeans, wheat, tomatoes, deciduous fruit trees such as pears, almond, apple, cherry, and many subtropical plants such as citrus and avocado .

The removal of ice-nucleating bacteria from frost sensitive plants has obvious immediate economic benefits . This need had spawned a number of technologies that might be used to prevent frost injury to crops. One technology is based upon the removal of the ice gene from bacteria and reintrodueing these genetically engineered microorganisms (GEMs) to crops. When these GEMs colonize on the plants, they displace the natural ice nucleating bacteria thereby providing a measure of protection against frost. Some of the patents dealing with attempts to solve that problem are discussed further below. This invention is one of its important embodiments, suggests an approach to a solution to this problem. There is therefore, an urgent and economic need in the United States and throughout the world to provide the means for controlling damage to plants, and to other biological materials . The treatment of plants with bacterial strains is subject to regulatory and public response in the United States and elsewhere, and the present invention suggests in one of its important embodiments an alternative to applying non-ice nucleation bacterial strains . The invention, as will be described in further detail herein provides a protein which is thought to function on the basis of evidence available, as an antifreeze protein; also the invention contemplates the transformation of plants to render them less susceptible or resistant to low temperature by incorporating the DNA sequence carrying the gene into recipient crop host cells which will then synthesize the antifreeze protein of the invention, or one of similar antifreeze properties.

There is another important area to which this invention relates. There are known instances where proteins produced by recombinant DNA or fermentation techniques are enzymatically degraded at physiological temperatures resulting in modification, diminution or destruction of the desired biological activity of the protein. Furthermore, there is recent evidence that indicates that proteins produced at normal .growth temperatures for E_-_ coli (37°C) can sometimes be folded improperly resulting in a complete or partial loss of the desired property of the proteins (e.g. , biological activity) . This invention in another of its important embodiments, may indicate a solution to these problems by the production of ethe desired protein at temperatures below the normal growth temperature.

Thus , the ability to control a gene encoding a protein of commercial value such that it is produced only after the temperature has been reduced below the normal growth temperature, would allow the expression, of the target protein to proceed at optimal temperature with no ill effects on the desired physiological activity of the protein.

2. Background Art.

With respect to the field of genetic engineering a considerable wealth of literature (including United States and foreign) has been published. When appropriate to assist one skilled in the art, reference shall be made to such literature either within the body of the description or towards the end hereof. A number of patent and literature references are noted at the end of this section of the description under the heading "References" .

All such references are hereby incorporated by reference .

United States Patent No. 4,766, 077 (1988) deals with iee-nucleation deficient (INA-) microorganisms which have induced non-reverting mutations within a genomic DNA sequence (INA gene) which encodes for polypeptide(s) responsible for ice-nucleation activity (INA) . The INA- microorganisms disclosed are applied to a plant part so that they become established prior to the colonization of the plant by the INA^"" microorganisms . Treatment in accordance with the patent, is apparently the subject of a notice of an application for permission with the United States government to release Pseudomonas syringae pv. syringae and Erwinia herbicola carrying in vitro generated deletions of all or part of the genes involved in icemucleation.

U. S. Patent No. 4,375 ,734 (1983) also deals with an ice nucleation- inhibiting composition using non-phytotoxic virulent bacteriophages which are species specific to the ice-nucleating bacteria normally present on plants. A particularly useful strain is a virulent bacteriophage strain, Erh 1, which is species specific to Erwinia herbicola.

U. S. Patent No. 4,464,473 (1984) provides for the isolation of DNA segments encoding for ice nucleation activity, which DNA segments may then be introduced into an appropriate vector. The ice-nucleating microorganisms can be used for preventing super cooling of water in various commercial applications.

U. S. Patent No. 4,161,084 (1979) provides for a method for reducing the temperature at which freezing takes place in plants to reduce frost damage. This is performed by the addition of non-ice-nucleating bacteria to plants prior to the onset of freezing temperature and preferably while the plants are in their seedling stage.

Reference is also made to earlier U. S. Patent No. 4,045,910 (1977) , which describes the treatment of plants with Erwinia herbicola before the onset of freezing temperature.

It can be seen from this review of some of the United States' patent literature that the problem of frost damage to agricultural crops has of course been recognized and several proposals made to alleviate this serious problem. However, none of these patents teach or suggest the subject matter of the present invention.

A review of the technical literature has brought out the following pubheations .

Publications have been noted which deal with proteins which are synthesized in microorganisms when growing cultures are subjected to an increase in heat, yielding what are called "heat-shock" proteins, or to a decrease in growing temperatures yielding what is called a "cold- shock" protein .

Where the full citation does not appear in the text herein, a numeral in parentheses refers to a list of references at the end of this text.

NEIDHART, F. C. , et al, The Genetics and Regulation of Heat- Shock Proteins , Ann. Rev. Genet. , Vol. 18, pp. 295-329, (1984) , discusses the heat-shock response in procaryotic and eucaryotic cells. Heat-shock proteins identified in E^ coll are described.

COWLING, D.W. , et al, Consensus Sequence for Escherichia coli Heat Shock Gene Promoters, Proc. Natl. Acad. Sci. , Vol. 82, pp. 2679-2683 (1985) . The article identifies the consensus sequence for the E^ coli heat- shock promoters and the gene encoding a heat-shock protein. 'Transcription from each promoter is heat-inducible in vivo, and is recognized n vitro by RNA polymerase containing the σ^° factor encoded by rpoH(htpR) but not by RNA polymerase contauiing the major E-_ coli σ^° factor.

The induction of transcription of heat-shock proteins has been reported to be accomplished primarily by an alternate σ subunit of RNA polymerase encoded by rpoH(HtpR) Grossman et al (1) ; Strauss et al (2) .

For a review of heat-shock response in various organisms, see Lindquist, The Heat Shock Response, Ann. Rev. Biochem. , VojU_55_, pp. 151-1101 (1986) ; Neidhardt, et al, The Genetics- and Regulation of Heat Shock Proteins, Ann. Rev. Genet. , Vol. 18, pp. 295-329 (1984) . „

Broeze, et al (24) report the differences in protein synthesis by IL coli and P^ fluorescens after a temperature shift to 5°C. In the mesophilic E-_ coli, protein synthesis was reported to decrease for one hour and then cease. The accumulation of 70s ribosomes that were found after such a temperature shift has been interpreted to indicate a block in initiation of translation. A shift to 10° C, on the other hand, results in a growth lag of 4 hours followed by renewed growth. Ng, et al (4) and Jones, et al, cited above.

For additional background on antifreeze proteins, see Hew, et al (5) and Duman, et al (6) . Such proteins are low molecular weigh^ proteins commonly found in high concentrations in the serum, of pola dwelling marine fishes and in the hemolymph of insects which winter in subfreezing climates .

For background information dealing generally with^.^ontrol of transcription, see for instance Protein-Nucleic Acid Interactions in Transcription: A Molecular Analysis, Hippiel, P.H/, et al,r Ann. Rev. Biochem. , Vol. 53, pp. 389-440 (1984) . For other pubheations to which reference may be made in conjunction with this description, see the list of references at the end hereof. For certain patents in the genetic engineering field which use terminology and techniques also referred to herein, reference may be made to U. S. Patent No. 4,624,926 entitled "Novel Cloning Vehicles for Polypeptide Expression in Microbial Hosts" to Masayori Inouye and Kenzo Nakamura, 1986; U. S. Patent No. 4,666,836 entitled "Novel Cloning Vehicles for Polypeptide Expression in Microbial Hos'ts" to Masayori Inouye and Kenzo Nakamura, 1987; U. S . Patent No. 4,643,969 entitled "Novel Cloning Vehicles for Polypeptide Expression in Microbial Hosts" to Masayori Inouye and Yoshihiro Masui, 1987; and U. S . Patent No. 4,757,013 entitled "Cloning Vehicles for Polypeptide Expression in Microbial Hosts" to Masayori Inouye and Yoshihiro Masui, 1988.

Other publication. Recently, an article has been published which is of interest. JONES, P.G. , et al, Induction of Proteins in Response to Low Temperatures in Escherichia coli, The Journal of Bacteriology, Vol. 169 , pp. 2092-2095 (1987) . This article discusses the synthesis of a set of proteins involved in transcription and translation and possibly mRNA degradation. Proteins are reported to be synthesized during a growth lag when the growth temperature for the bacteria is decreased from 37 to 10° C. About thirteen proteins were noted. Twelve identified proteins are synthesized during the growth lag (after the temperature is decreased from 37° C) ; and five are unidentified; one of the cold-shock proteins (designated F10.6) is detectably synthesized during growth at low temperature. There is no indication that this is a transient synthesis.

BRIEF DESCRIPTION OF THE FIGURES

FIG 1 shows the major cold-shock protein induction. The arrow on the right indicates the induced major cold-shock protein, cs7.4.

FIG 2 (A and B) shows transient induction of cs7.4. The numbers indicated are as follows: 1, pulse-labeled from 0 to 30 minutes after temperature shift; 2, 30 to 60 minutes; 3, 60 to 90 minutes; 4, 90 to 120 minutes; 5, 120 to 150 minutes; 6, 150 to 180 minutes. The arrows are described in FIG 1.

FIG 3 shows the stability of cs7.4. The arrow indicates cs7.4.

FIG 4 shows the 2-dimensional gel utilized in purification of cs7.4.

FIG 5 shows a Southern Blot analysis for cs A.

FIG 6 A shows the DNA sequence of cspA (restriction map and sequencing strategy) .

FIG 6B shows the partial nucleotide sequence of the cloned Hindlll fragment. The region encoding cspA and the corresponding amino acid sequence of cs7.4 are shown in bold type . The underlined AGG is probably the Shine-Delgarno sequence. Regions underlined with half an arrow indicate inverted repeats.

FIG 7 is a schematic representation of a plasmid pJJGOl carrying the cspA gene (shown by arrow) .

FIG 8 is a schematic representation of pJJG12.

FIG 9 is a schematic representation of pJJG04.

SUMMARY DISCLOSURE OF ASPECTS OF THE INVENTION

_*

Methods, systems and compositions are provided for genetically transforming microorganisms, particularly bacteria, to produce genotypical capability, particularly to produce "cold-shock" or "antifreeze" and other proteins. Also provided are segments of DNA ("promoter") that contain signals that direct the proper binding of the RNA polymerase holoenzyme and its subsequent activation to a form capable of initiating specific RNA transcription. The promoter which is described herein is cold-induced and capable of controlling the expression of the cspA gene which encodes a cold- shock or antifreeze or other proteins . Practical applications are referred to hereinafter.- „

Genetic systems are provided for expressing proteins called cold- shock or antifreeze proteins, particularly a cold-shock protein of E^_ coli designated cs7.4.

The invention provides a novel polypeptide which is synthesized in E^ coli in response to a decrease of the temperature below ambient, or physiological growth temperature. The polypeptide (or protein) is a 7.4 kdal protein induced under cold-shock and has been designated as "cs7.4" .

A noteworthy aspect of the polypeptide is that it is stable at temperatures above the cold temperature at which it was induced.

The invention also provides the gene encoding the cs7.4 protein. The invention provides further the cold-induced promoter which controls the expression of the gene encoding cs7.4 and which promoter also is capable of initiating transcription of proteins other than cs7.4 in response to a shift in temperature below the microorganism growth temperatures . The invention also provides a system for expressing the gene encoding the antifreeze protein under the direction of a promoter other than the. promoter of the invention.

The invention further provides various DNA constructs , including cloning vectors, e. g. , plasmids which contain the promoter, the structural gene and other necessary functional DNA elements , and transformed hosts .

The invention also contemplates various applications of the products of the invention in the field of preventing or alleviating the injurious or lethal effects of low temperature, e.g. , freezing of microbiological and plant cells. It is contemplated that the protein of the invention be used as an "antifreeze" compound, for instance on crops; or that an innocuous microorganism transformed with the gene or portions thereof encoding for cs7. protein of the invention be used in agricultural or other applications . It is also contemplated that DNA containing a sequence encoding the cs7.4 protein be transferred to crop host cells to produce there the cs7.4 antifreeze protein, and thus protect the crop from frost injury.

The invention provides a cold-shock induced promoter (the "native" promoter) which is capable of regulating the expression of a cold-shock induced gene encoding an antifreeze protein.

The invention provides further a promoter ("native") which is capable of controlling the expression of a gene encoding an antifreeze protein or another protein at temperature below physiological temperatures . Although cs7.4 is frequently referred to herein, it is contemplated that any protein can be produced by the promoter of the invention.

The invention also provides for the expression of a gene encoding an antifreeze protein under the control of a heterologous (non-native) promoter at physiological temperatures .

The invention further contemplates that having further elucidated the promoter sequence, the DNA sequence of the promoter can be generated synthetically; such promoter will be useful to regulate the expression of proteins at low temperatures, i.e. , temperatures below physiological temperature .

It is a noteworthy aspect of the invention that the promoter can be "uncoupled" in the sense that it can be used without the native structural gene and conversely, the structural gene can be controlled by a heterologous promoter.

Other aspects of the invention will become apparent from the description which follows.

DETAILED DESCRIPTION OF THE FIGURES

Figure 1 (FIG 1) - Major Cold- Shock Protein Induction.

Aliquots of a cell culture growing at 30° C were transferred to 42°C, 30°C, 25°C, and 18°C and immediately pulse-labeled with [^3SS] methionine for 10 minutes . Samples were subjected sodium dodecyl sulf ate - polyacrylamide gel electrophoresis and the autoradiogram is shown here. Molecular weight standard sizes are indicated on the left in kilodaltons . The arrow on the right indicates the induced major cold-shock protein.

Figure 2 A and 2B (FIG 2 A and FIG 2B) - Transient Induction -of cs7.4.

Cell cultures growing at 37°C were transferred to either 10°C or 15°C . Aliquots were then pulse-labeled with [^3SS] methionine for 30 minute time intervals and electrophoresed as described in FIG 1. 2A. Above the autoradiogram shown here, C indicates a control where an aliquot was pulse- labeled for 5 minutes at 37 °C before the temperature shift. The numbers indicated are as follows: 1, pulse-labeled from 0 to 30 minutes after temperature shift; 2, 30 to 60 minutes; 3, 60 to 90 minutes; 4, 90 to 120 minutes; 5 , 120 to 150 minutes; 6, 150 to 180 minutes. The arrows are described in FIG 1. 2B . The autoradiogram in A waβ.subjected to scanning densitometry and the percent methionine-labeled cs7.4 protein in the whole cell was determined for each time interval. Each time point on the graph is the quantitation for the percent methionine-labeled cs7.4 protein at the end of each thirty minute interval. For example, between 30 and 60 minutes (60 minute time point on the ordinate) , cs7.4 accounted for 10% of the total methionine-labeled protein in the cell at 10° C. The 0 time point accounts for the five minute pulse at 37° C, which is described in A. Figure 3 (FIG 3) - Stability of cs7.4.

A cell culture growing at 37°C was transferred to 15°C. After 30 minutes, the culture was pulse-labeled with [^SSS] Translabel for 30 minutes . The culture was then chased with nonradioactive methionine and cysteine for various lengths of time indicated above the autoradiogram shown here. The samples were electrophoresed as described in FIG 1. The 37°C sample was prepared as described in FIG 2. The arrow indicates cs7.4.

Figure 4 (FIG 4) - 2-dimensional Gel Utilized in Purification of cs7.4.

A cell culture growing at 37° C was transferred to 14° C for 4 hours. The culture was then harvested, fractionated, and the cytoplasmic f raction was subjected to 2-dimensional gel electrophoresis . The first dimension is isoelectric focusing and the second dimension is SDS-polyacrylamide gel electrophoresis. The gel was electroblotted onto a PVDF membrane which was stained with Coomassie Blue dye. The arrow indicates cs7.4.

Figure 5 (FIG 5) - Southern Blot Analysis for cspA.

E. coli chromosomal DNA was digested with various restriction enzymes and the DNA was transferred from an agarose gel to nitrocellulose paper. Hybridization was carried out using the degenerate probe described in the text, and the autoradiogram is shown here. The restriction digests are as follows: S, Sail; P, PstI; B , BamHI; E, EcoRI; H, Hindlll. indicates lambda DNA digested with Hindlll, which was used as a size standard. Chromosomal DNA digested with Hindlll was also fractionated by agarose gel electrophoresis, and fractions 1 through 12 are shown.

Figure 6 A and 6B (FIG 6 A and 6B) - DNA Sequence of cspA.

Approximately one half of the 2.4kb Hindlll fragment from clone pJJGOl was sequenced. 6A. Shown here is the restriction map and the sequencing strategy. The restriction enzyme sites are as follows: H, Hindlll; D, Dral; S, Smal; B , Bgll; A, ApaLI; P, PvuII; X, Xmnl. The thick arrow indicates the region encoding cspA. 6B . Shown here is the partial nucleotide sequence of the cloned Hindlll fragment. The region encoding cspA and the corresponding amino acid sequence of cs7.4 is in bold type. The underlined AGG is the probable Shine-Delgarno sequence. Regions underlined with a half arrow indicate inverted repeats . FIGS 7, 8 and 9 are described further below.

DESCRD?TION OF SPECIFIC AND PREFERRED EMBODIMENTS

The invention provides a method for producing a "cόld-shock" protein, a promoter therefor and various constructs. In one embodiment that will be described hereinafter, the gene encoding the cold-shock protein is expressed under the regulation of a heterologous promoter. Eh .another embodiment, the cold-shock induced promoter is used to control the synthesis of a heterologous protein in response to lowering of the growth temperature .

The method of the invention to induce and produce the cs7.4 protein of the invention comprises growing in a nutrient rich medium at an exponential rate an appropriate microorganism, for instance an E-_ coli, to a desired growth density at physiological growth temperature for the particular microorganism. For E^ coli such temperature may be in the range of about 10° to about 50° C, preferably in the range of 20° to about 40° C. Each microorganism is known to have its optimum growth temperature; for E. coli raising the temperature above about 40° C or lowering it below 20° C results in progressively slower growth, until growth ceases, at the maximum temperature of growth, about 49° C , or the minimum, about 8°C .

When the desired degree of growth is attained (monitored by an appropriate method, such as spectrophotometrically) , the tempe ure is rapidly shifted to a lower temperature above about 10° and below about 20° C, preferably below about 20° C and above about 8°C. Lower temperatures generally do not sustain practical growth rates . If desirable , a shift to lower temperature but above the temperature at which no growth of the microorganism takes place may also be performed. The culture is grown in the lower temperature range for the appropriate period of time for optimum production of the polypeptide of the invention. The kinetics of polypeptide induction are followed by appropriate method such as pulse labeling with radioactive methionine, harvesting the culture, processing and separation by two-dimensional gel electrophoresis and determining by autoradiography the amount of protein synthesized .

It was found that the protein of the invention is not synthesized at physiological growth temperature at which the microorganism normally grows, in this case the E-_ coli; the polypeptide is synthesized in the lower temperature range. Sudden induction of the synthesis of the polypeptide takes place within approximately the first 30 minutes after temperature shift to 10°C or 15°C. Maximal induction and rate of synthesis is temperature dependent after temperature shift. After shift to 15° C, maximal synthesis is attained at 30-60 minutes post temperature shift; maximal rate of synthesis is approximately 13.1% of total protein synthesis. See FIGS 2A and 2B . Shift to 10° C gives a maximal rate of the synthesis of approximately 8.5% of total protein synthesis at 60 to 90 minutes post-shift. Adjustment of the temperature therefore allows for adjusting the rate of synthesis and/ or yield of the polypeptide as being suited for the objective of the invention. After the maximum total polypeptide yield has been reached, the rate of synthesis thereof drops off, ultimately reaching a fraction, e. g. , about a fifth of the maximum in the case of the culture shifted to 15° C and about three-fifths of the maximum in the case of the culture shifted to 10° C.

A noteworthy characteristic of the cs7.4 protein of the invention is its stability at temperatures above the temperature range at which it was induced and synthesized. Such physiological temperature may range from about above 15°C to about 40°C, or higher. The data in FIG 3 shows the protein to be stable after synthesis at 15°C for 20 hours, (only about 30% of the protein degraded) , and stable at 37° C (for at least 1.5 hours) .

The stability of the protein of the invention at physiological temperatures has important practical applications. It permits synthesis of the protein at physiological temperatures with a promoter other than the promoter of the invention. It also facilitates applications of the protein in agricultural formulations on crops at ambient temperatures before the protein starts functioning in its freezing or frost damage prevention role. Other elements of the invention will be described hereinafter. The promoter of the invention is believed to be located on the cloned Hindlll fragment between nucleotides 1 and 605. The first 997 bp of the cloned Hindlll fragment contains all the necessary elements of the functional gene for regulated expression including the ribosome binding sites .

There is evidence of a promoter sequence at -35 and -10 upstream of the coding region, at positions 330 and 355, respectively. Another characteristic of the promoter is that it responds to a drop in temperature .

The promoter of the invention is activated at reduced temperature and directs transcription of the gene of the invention.

The promoter of the invention is cold-inducible in vivo and is recognized in vivo by RNA polymerase .

Although the inventors do not wish to be bound to any particular theory or principles of mode of action, or function, several hypotheses are being presently considered. The inventors believe that there could be three possibilities (conceivably not mutually exclusive) for the mechanism of re ulation of the promoter of the invention. First, the possibility exists that a cold activated inducer induces expression from the promoter at lower temperatures. Secondly, a cold sensitive repressor may be inactivated at cold temperatures resulting in expression of the gene. ThhMly, the gene may be controlled by a cold induced alternate (other than a standard Bke the σ^"70 factor) sigma factor which would allow the RNA polymerase to recognize a novel promoter sequence upstream of the structural gene. Other mechanisms may be postulated, especially if one considers that the transformed host need not be a member of the Enterobacteriaceae" family.

The invention further provides a cold-induced cytoplasmic protein, designated cs7.4 which is stable at growth temperature of a microorganism, e. g. , E^ coli. The polypeptide has the following partial amino acid sequence SGKMTG(X)VKWFNADKGFGFI wherein X is leucine or isoleucine. Both isoleucine and leucine have been identified (64% and 36%, respectively) . Thus , the invention includes either and both polypeptides . he polypeptide of the invention is a 70 amino acid residue protein. The calculated molecular weight is 7402 daltons and the calculated pi is 5.92. The polypeptide is very hydrophylic, containing over 20% charged residues. Lysiήe residues make up 10% of the protein. No homology was detected with any other sequence in the NBRF data base.

With respect to secondary structure determination carried out in furtherance of the invention, the rules of Chou and Fasman (1978) (11) did not reveal any predominant secondary structural conformation; however, if the amino acid residues are plotted on a helical net 12 of the 16 charged residues were determined to be adjacent as oppositely charged pairs. Also, folding of the protein into an α-helix would result in juxtaposition of oppositely charged residues for 12 of the 16 charged amino acid residues in the protein. These data suggest that a large portion or essentially all of the protein of the invention may be in an α-helical configuration.

A recent crystallographic study of the secondary structure of an antifreeze polypeptide from the Fish Winter Flounder shows the molecule to be a single α-helix. See, Crystal Structure of an Antifreeze Polypeptide and its Mechanistic Implications, Yang, et al, Nature, Vol. 333, 19 May 1988, pp. 232-237 (25) . A mechanism of antifreeze protein binding is proposed which is based on the fact that all surfaces of ice crystals are densely populated with atoms that can hydrogen bond to the protein surface, and that due to the flexibility of the side chain many patterns of hydrogen bonding can exist. The mechanism suggested requires that, after an antifreeze polypeptide induces local ordering of the ice lattice , the dipole moment from the helical structure dictates the preferential alignment of the peptide to the c-axis of the ice nuclei; shifts of the helical conformation can then take place and torsional movement of the side chains of the hydrophilic amino acids strenghtens the bonding of the protein with the ice surface.

Further evidence of the helical structure of the polypeptide of the invention would clarify whether the polypeptide cs7.4 of the invention is the first antifreeze protein cold-induced in E^ coli that can be produced by genetic engineering methods. Work on the secondary structure of cs7.4 would also open other possibilities . It can be postulated for instance , that the only portion of the polypeptide which has α-helix configuration would be essential for the antifreeze function; and likewise, that only the portion of the nucleotide sequence which encodes such polypeptide fraction would be essential for such antifreeze application. 15

The cloned 2.4 kb Hindlll fragment containing the gene for cs7.4 was isolated from pUC9 by digesting with Hindlll and separating on a 5% polyacrylamide gel. The fragment was then subcloned into M13. DNA sequencing was performed by the chain termination method (Sanger et al, 1977) . DNA sequencing was accomplished using [^3SS] dATP and the enzyme, Sequenase, by the method provided by the manufacturer (United States Biochemical Corporation) .

The partial nucleotide sequence of the cloned Hindlll fragment includes the sequence encoding cs7.4 and the promoter therefor. The nucleotide sequence encoding the polypeptide of the invention cspA includes the following sequence of 210 nucleotides.

ATGTCCGGTi AAATGACTGGTATCGTAAAATGGTT⁽_^-ACGCTGACAAAGGCTTCGGCTTCΑTCaCTCCTGAC GATGGCTCTAAAGATGTGTTCGTA⁽-ΑCTTCTCTGCTATCCAGAACGATGGTTACAAATCTCTGGACGAAGGT CAGAAAGTGTCCTTCACCATCGAAAGCGGCGCTAAAGGCCCGGCAGCTGGTAACGTAACCAGCCTG

The corresponding amino acid sequence encoded by cspA is as follows .

MetSerGlyLγsMetThrGlγIleValLγsTrpPheAsnAlciAspLγsGlyPheGlγPheIleThrPro AspAspGlySerLysAspValPheValHisPheSerAlalleGlnAsnAspGlyTyrLysSerLeuAsp GluGlyGlnLγsValSerPheThrIleGluSerGlγAlaLγsGlγProAlaAlaGlγAsnValTlιrSerLeu

The sequence is shown in FIG 6B , it contains an open reading frame beginning with an ATG codon at nucleotide 617 of the cloned Hindlll fragment and extending for 210 nucleotides ending with a TAA termination codon. This open reading frame is the coding region of the gene herein designated cspA responsible for cs7.4 synthesis. The invention includes within its scope the nucleotide sequence or any partial sequence thereof which codes for the polypeptide cs7.4 or a polypeptide having the properties of cs7.4 (functional equivalent) . The invention also includes any equivalent nucleotide sequence wherein one or more codons have been substituted by certain other codons, which equivalent nucleotide sequence codes for the cs7.4 polypeptide, or a functional equivalent thereof.

In the work in connection with this invention, some evidence ^as adduced that suggests to date that there may be two copies (cspA and cs B) of the gene encoding the cold -induced polypeptide cs7.4. The evidence is further discussed below. The invention includes within its scope such other possible gene which encodes the cs7.4 polypeptide or its functional equivalent. There are examples in molecular biology of multiple genes encoding the same protein in J2-_ coli, such as elongation factor Tu (tufA and tufB) , and the ornithine carbamoyltransf erase, (Arg ArgFArgI) . If there were two genes encoding cs7.4, this would be the first finding of a two- gene cold-induced polypeptide.

In accordance with the invention, it is conceivable that from the 997 bp fragment of the cloned Hindlll fragment, the cspA structural gene can be removed and be replaced by a foreign gene. If necessary, the inverted repeat at the 3' end at 857-866 and 869-878 may be conserved; but if not, the Hindlll fragment would not need to contain the base pairs upstream of the TAA stop codon. The foreign gene (or part thereof) would be inducible by the cold-induced promoter (or its equivalent) and be capable of encoding a target protein.

In another embodiment of the invention the cold-shock protein would be expressed by the gene coding for it under the control of the promoter of the invention.

In yet another embodiment of the invention, a promoter other than the native promoter can regulate expression of the cs7.4 gene at physiological temperatures, i.e. , within the temperatures range at which bacteria exponentially grow. Thus, in accordance with the invention, a heterologous promoter, an E_^ coli lac promoter, has been used to regulate the expression of the cs7.4 gene. The cspA structural gene was subcloned into a high level expression vector, pINIII (lpp^^) (7) . The resulting construct, pJJG12 is schematically shown in FIG 8. Upon addition of isopropylthiogalactoside (IPTG) , expression of the cs7.4 protein at 37° C was detected by SDS polyacrylamide gel electrophoresis of whole cell lysate. The expression of the protein was 5-10 fold less than that obtained from expression regulated by the native promoter at 15° C.

The fact, however, that expression of the protein was obtained at a higher temperature with a promoter other than the native promoter is significant particularly since the protein is normally not expressed at 37°C. This opens a number of intriguing new possibilities . It can be contemplated that promoters other than the lac ¹ promoter might be more , effective _* in controlling expression of the gene. Also, the growth of cells at low temperature (15-10°C) ranges is slower than at optimum growth temperature for the selected microorganisms, e. g. , E-_ coli. Thus, while the yield may be less at optimum growth temperature, the faster growth rate of the bacterium is likely to compensate for a possible lower yield. When a promoter stronger than the lac promoter is used to regulate the expression of the cs7.4 gene, it can be contemplated that high yields of a valuable antifreeze protein like cs7.4 can be obtained witiύn satisfactory time periods on a commercial scale. Thus, large amounts of the antifreeze protein will be made available . The property described above , namely that the protein can be produced and still be active as an antifreeze protein at physiological temperature, is therefore very significant.

As the result of this teaching, one skilled in the art will appreciate that other suitable promoters other than the lac promoter, such as the trp, tac, promoter, lambda pL, ompF, opp, and other promoters may be used to regulate the expression of the gene coding for the desired protein. When other transformed microorganisms such as yeast are used to express the proteins, promoter like GAL10 and others may be suitable.

Furthermore, as described briefly above, the cspA promoter of the invention which is active at low temperatures, can be used to control the expression of a protein other than the cs7.4 cold-shock protein. Thus, this properly opens up yet other possibilities . This may be of particular interest where a particular protein which would be useful but for the fact that it is enzymatically (e.g. , proteolytically) degraded at physiological temperatures , could be expressed at low temperatures at which it is less susceptible to enzyme degradation. A like possibility exists for proteins that could be useful for the fact that they may be improperly folded so that they are not biologically active when produced at physiologically active temperature. It may be advantageous to produce the proteins properly folded and active under the control of the cspA promoter of the invention.

These observations do not apply only to antifreeze proteins but to the expression of any proteins which heretofore could not be expressed in the desired conformation at physiological temperatures ; these proteins , it can be visualized, could be expressed at lower, non-injurious temperatures with the assistance of the promoter of the invention.

In the above-described embodiment of the invention, the cspA promoter of the invention has been used in a classic model to control the expression of β-galactosidase. For this purpose, a plasmid (pKM005) (21) containing the lac Z structural gene without promoter was compared with the plasmid containing the cspA promoter on an 806 bp Hindlll-PvuII fragment (pJJG04) . See FIG 9.

A second plasmid, pJJG08 (see FIG 9) , was constructed which contains a smaller nucleotide fraction of the upstream region of the cspA gene, terminating at the ApaLI site (bp 534) . The results are shown in Table I.

TABLE I RESULTS OF EXPRESSION IN A LAC-STRAIN

Temperatures are in °C; other numerals refer to "Units" of enzyme activity.

The difference in yields between pJJG04 and pJJG05 would tend to suggest that the promoter or other regulating elements are in the 0 to 534 base pair fragment; the region from 534 to the start of the gene may also embody regulatory elements . Likewise , the region downstream of the gene to bp 878 may also embody regulatory elements.

The results show that the cspA promoter is capable of directing a heterologous gene to express a selected protein.

The following Examples are only illustrative of the invention; they are not to be construed as a limitation thereof. One skilled in the art can readily make variations and substitutions to obtain equivalent results. EXAMPLE 1 Induction of cs7.4

Cultures of E^ coli SB 221 (lpp_ hsdR trpE5 lacY recA/F' l d" lac"- pro-") (7) were grown to a density of approximately 2 X 10^Θ cells /ml in a 10 ml culture volume prior to temperature shift. 1.1 ml aliquots of the cell culture growing at 30° C were transferred to beakers at 42° C, 30° C, 25° C and 18° C containing 10 uCi of [^3SS] methionine (Amersham Corp. , >1000 Ci/mmol) or [^3SS] Translabel (ICN Radiochemicals , Irvine, CA) and pulse- labeled for 10 minutes . All samples were collected by centrifugation and the pellets were dried by lyophilization. Samples were then subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 17.5% resolving gel. The gel was dried and exposed to X-ray film.

The resultant autoradiogram indicated a protein of 8 kdal apparent molecular weight produced only after shift to 25° C . No corresponding band was seen in the pre-shift or 43° C shifted cultures. This protein is designated cs7.4.

EXAMPLE 2

Isolation of csp gene

In constructing the plasmid containing the cold-shock protein coding sequence and its regulatory elements , it is siecessary to firstldentify and isolate the locus. In order to prepare an oligonucleotide probe, a partial amino terminal sequence of the protein is obtained. A 10 ml culture of IS-_ coli SB 221 (7) was grown to a density of approximately 2 X 10^s cells /ml at 37° C and transferred to 14° C for 4 hours. Cells were then harvested and fractionated for the soluble fraction as previously described (9) . A trace of protein pulse-labeled for 30 minutes after shift to 15 °C as described above was then mixed with 250 ug of soluble fraction protein. Two-dimensional electrophoresis was then performed with isoelectric focusing in the first dimension (ampholines pH 3-10, 1.5%; pH 6-8, 0.5%) and SDS- polyacrylamide gradient gel electrophoresis (10-18.4% acrylamidβ, 2.7% crosslinking) in the second dimension according to the method of O'Farrell (15) . Separated protein was electrophoretically transferred to a polyvinylidene difluoride (PVDF) membrane (IVIillipore Corp . , Bedford, MA) using a semidry blotter apparatus (Saritorius GmbH, Goettinggen, FRG) and 48mM Tris, 39mM glycine, 1.3mM SDS, 20% (v/v) methanol pH 9.2 as the transfer buffer. The membrane was then stained for protein with Coomassie Blue R-250, dried, and subjected to autoradiography. The autoradiogram clearly identified a heavily labeled protein at approximately the same molecular weight previously observed for cs7.4 (FIG 4) . The autoradiographic spot was used to identify the cs7.4 spot on the stained membrane, which was then excised from the blot. Automated Edman degradation was performed directly on the stained membrane fragment according to the method of Matsudaira (1987) using an Applied Biosystems Model 470 gas -phase sequenator. The amino acid sequence obtained is described above.

A niixed degenerate oligonucleotide probe for Southern blot analysis was made to match a short region of the amino acid sequence as shown below:

. . . K W F N A. . .

5 * -AA^ΛTGGTT^τAA^τGC-3 ' α c c

For Southern blot analysis, chromosomal DNA was prepared from overnight cultures of E_^ coli SB 221 (7) . The cells were collected by centrifugation and washed with lOmM Tris-HCl (pH 8) and lysozyme in 0.25M Tris-HCl (pH 8) was added to a concentration of 3.3 mg/ml. The sample was then incubated at 0°C for 20 minutes followed by the addition of RNaseA to a concentration of 60mM. After 5 more minutes on ice 10% SDS was added to a concentration of approximately 1%. The sample was then mixed rapidly, and the same volume of RNaseA that was added previously was again added along with pronase in 25mM Tris-HCl (pH 8) to a concentration of 0.1 mg/ml. The sample was then incubated at 37°C for 30 minutes followed by phenol extraction, chloroform-isoamyl alcohol (24:1) extraction, and ethanol precipitation. The sample was then further subjected to phenol extraction, ether extractions, and ethanol precipitation. Chromosomal DNA was subjected to drop dialysis using Millipore Type VS 0.025 um filter before restriction enzyme digestion. Chromosomal DNA fractionation was carried out by digesting at least 50 ug DNA with Hindlll, Sail, BamHI, Pstl, and EcoRl and electrophoresing on a 0.7% agarose gel.

Southern transfer of DNA from the agarose gel to nitrocellulose paper was done by the method described in the manual by Maniatis et al (19) with the following exceptions . Acid depurination to partially hydrolyze the DNA was accomplished by washing the gel only once for 15 minutes in 0.25M HC1. Furthermore, the dish in which the transfer was carried out was filled with 20 X SSC instead of 10 X SSC.

Hybridization was carried out according to Maniatis et al (26) with the following exceptions . Both the prehybridization and hybridization solution contained by volume/ml solution: 0.1 ml 50 X Denhardt's, 0.2 ml 30 X NET, 0.5 ml 20% Dextran Sulfate, and 0.05 ml 10% SDS. These solutions are described in Inouye and Inouye, (19) . The oligomer that was used for the probe is shown above. The [³²P] -labeled probe was made according to Inouye and Inouye, (19) , and the prehybridization and the hybridization was carried out at 32° C. The filter was washed and dried according to Inouye and Inouye, (19) .

The autoradiogram from Southern blot hybridization with the mixed oligonucleotide probe indicated at least one distinct band in each digest. In particular, the Hindlll digest yielded one band with a size of 2.4 kb (See FIG 5) . ^* - ^'

The 2.4 kb Hindlll fragment was isolated in the followin manner. A Hindlll digest of chromosomal DNA was fractionated on a 0.7% agarose gel. Gel slices were then excised at every 0.5 cm from the top of the gel. Each gel slice was frozen at -20°C for at least 20 minutes and then centrifαged in an Eppendorf tube for 10 minutes. This was repeated three times', the last time adding some lmM Tris, O.lmM EDTA (pH 7.5) before freezings and the supernatant was collected after each centrifugation. The samples were then phenol extracted three times, ether extracted, and ethanol precipitated.

Each fraction was subjected to Southern blot analysis with the probe. DNA fragments from fractions 7 and 8 clearly hybridized with probe corresponding well with the 2.4 kb Hindlll band in the driginal chromosomal digest . EXAMPLE 3 Cloning of cspA gene

pUC9 plasmid DNA was digested with Hindlll and ligated with fraction 7 of the Hindlll chromosomal digest (see Example 2) using T4 DNA ligase. E^ coli strain JM83 (ara A\ (lac-proAB) rpsL 80 lacM15) (13) was then transformed, and the cells screened on L-agar plates containing 50 ug/ml ampicillin spread with 25ul of 40mg/ml xgal. White colonies were picked onto Whatman filter paper and subjected to a colony hybridization screen as described by Inouye and Inouye, (19) . The probe used was the same one used for Southern blot analysis (see Example 2) . The hybridization temperature was 32° C . A colony which lighted up upon autoradiography was subjected to a second screening by colony hybridization to ensure that the clone had been obtained.

EXAMPLE 4 Use of csp Promoter to Direct Heterologous Protein Synthesis

The csp promoter was used to direct the synthesis of β- galaetosidase in E^ coli from the plasmid pJJG04. This plasmid was constructed as follows. The 2.4 kb Hindlll fragment containing the gene was digested with PvuII. The resultant 806 bp fragment was separated on 0.8% agarose gel, the band excised and the DNA recovered by electroelution using a salt-bridge electroelution apparatus manufactured by IB I, Inc. as per manufacturer's instructions. This fragment was then ligated with T4 DNA ligase into the promoter-proving vector (pKM005 (Masui et al) (21) after treatment of the vector fragment with Xbal restriction enzyme and Klenow fragment of DNA polymerase I. The E^ coli lac deletion strain SB4288 (21) was transformed and cells carrying the recombinant plasmid were selected as blue colonies on L-agar plates containing 50 ug/ml ampicillin and 40 mg/ml Xgal.

Cultures of E^ coli SB4288 harboring plasmid pJJG04 were grown at 37°C and shifted to 10°C or 15°C. β-galactosidase activity before and after the shift using the substrate o-nitrophenyl-β-D-galactoside as described by Miller (22) . The results indicate a 64% increase in β- galactosidase activity upon shift of the culture to 15°C, evidencing induction of transcription from the cloned cspA promoter and subsequent expression of β-galactosidase.

This example illustrates well the versatility of the promoter sequence of the invention . ι ^:

EXAMPLE 5

Expression of cs7.4 Structural Gene at 37° C.

The cspA structural gene was subcloned into a hig . level expression vector, pINIII (lpp³^) (23) using an Xbal site created just upstream of the structural gene using oligonucleotide directed site specific mutagenesis . Upon addition of IPTG , expression of the cs7.4 protein could be detected by SDS-PAGE analysis of whole cell lysates.

For vector that can be used to clone a DNA fragment carrying a promoter and to examine promoter efficacy, see Masui et al, (21) .

It is understood that other competent microorganism hosts (eucaryotic and procaryotic) can be transformed genetically in accordance with the invention. Bacteria which are susceptible to transformation, include members of the Enterobacteriaceae , such as E-_ coli, Salmonella; Bacillaceae, such as subtilis , Pneumococcus ; Streptococcus ; yeasts strains and others.

Of particular interest may be the transformation of yeast cells, such as Saccharomyces cerevisiae with the structural gene of the invention or of all or part of the nucleotide sequence shown in FIG 6. Basic techniques of yeast genetics, appropriate yeast cloning and expression vectors and transformation protocols are discussed in Current Protocols in Molecular Biology, Supplement 5 (1989) (23) which is specifically incorporated herein by reference.

Likewise, vertebrate cell cultures may be transformed, with the structural gene of the invention or part thereof or with part or all of the nucleotide sequence shown in FIG 6. One skilled in the art will select an appropriate cell culture such as a COS-7 line of monkey fibroblasts. Appropriate techniques for the transfection of DNA into eucaryotic cells are described in Current Protocols, Section 9 (also incorporated herein by reference) . Illustrated protocols are shown to work well with such cell ines as HeLa, BLAB/c 3T3, NIH 3T3 and rat embryo fibroblasts.

Additional vectors and sources are listed in Perbal (22) (pages 277-296) including yeast cloning vectors, plant vectors, viral vectors, with scientific appropriate literature references, and cloning vectors from commercial sources.

Numerous suitable microorganisms are available from the American Type Culture Collection, 12301 Parklawn Drive, RockvLUe, MD, 20852-1776.

From the teaching of this disclosure, it will have become apparent to one skilled in the art that the invention contemplates nucleotide sequences which encode a protein which has biological properties of, or similar enough to be eseentially a functional equivalent, of the protein of the invention. Likewise, the invention contemplates a promoter sequence which performs essentially the same function as that described herein. The invention thus intends to cover and covers the functional equivalent of the functional elements described and taught herein.

25

REFERENCES

1. Grossman, A.D.; Erickson, J.W.; and Gross, CA. (1987). The htpR Gene Produce of E. coh is a Sigma Factor for Heat- Shock Promoters. Cell, 38, 383-390.

2. Straus, D.B.; Walter, W.A.; and Grosse, CA. (1987). The Heat Shock Response in E. coli is Regulated by Changes in the Concentration of σ^s=a. Nature, 329, 348-351.

3. Bahl, H.; Echols, H.; Straus, D.B.; Court, D.; Crowl, ; and Georgopoulos , CD. (1987). Induction of the Heat Shock Response of E. coh Through Stabilization of σ ¹³ by the Phage lambda cIII Protein. Genes & Dev . , 1, 57-64. ^"' ,;

4. Ng, H.; Ingraham, J.L.; and Marr, A.G. (1962). Damage and Derepression in Escherichia coli Resulting from Growth at Low Temperatures. J. Bacteriol.84, 331-339.

5. Hew, C.L.; Scott, G.K.; and Davies, P.L. (1986). Molecular Biology of Antifreeze. In Living in the Cold: Physiological and Biochemical Adaptations. H.C Heller, ed. ( Els ier S cience Publishing Co., Inc. N.Y.), pp. 117-123.

6. Duman, J.; and Horwath, K. (1983). The Role of Hemolymph Proteins in the Cold Tolerance of Insects. Ann. Rev. Physiol. , 45, 261-270. . ^s

7. Nakamura, K.; Masui, Y.; and Inouye, M. (1982). Use of Lac Promoter- Operator Fragment as a Transcriptional Control Switch for the Expression of the Constitutive lpp Gene in Escherichia coh. J. Mol. Applied Gen., 1, 289-299.

8. Vlasuk, G.P.; Inouye, S.; Ito, H.; Itakura, K.; and Inouye, M. (1983) . Effects of Complete Removal of Basic Amino Acid Residues from the Signal Peptide on Secretion of Lipoprotein in Escherichia coh. J. Biol. Chem., 258, 7141-7148.

9. Lehnhardt, S.; Pollitt, S.; and 'Inouye, M. (1987). The Differential Effect on Two Hybrid Proteins of Deletion Mutations within the Hydrophobic Region of the Escherichia coh OmpA Signal Peptide. J. Biol. Chem., 262, 1716-1719.

10. Inouye, S.; Soberon, X.; Franceschini, T.; Itakura, K.; and Inouye, M. (1982) . Role of Positive Charge at the Amino Terminal Region of the Signal Peptide for Protein Secretion Across the Membrane. Proc. Natl. Acad. Sci. USA., 79, 3438-3441.

11. Chou, P.Y.; and Fasman, G.D. (1978). Empirical Predictions of Protein Conformation. Ann. Rev. Biochem. , 47, 251-276. 12. Messing, J. ; Crea, R. ; and Seeburg, P.H. (1981) . A System for Shotgun DNA Sequencing. Nucleic Acids Res . , 9, 309-321. 13. Yanisch-Perron, C ; Vieria, J. ; and Messing, J. (1985) . Improved M13 Phage Cloning Vectors and Host Strains : Nucleotide Sequences of the M13mpl8 and pUC19 Vectors. Gene, 33, 103-119.

14. Kreuger, J.H. ; and Walker, G. C (1984) . groEL and dnaK Genes of Escherichia coh and Induced by UV Irradiation and Nalidixic Acid in a htpR^"*"-Dependent Fashion. Proc. Natl. Acad. Sci. USA, 81, 1499-1503.

15. O'Farrell, P.H. (1975) . High Resolution Two-Dimensional Electrophoresis of Proteins. J. Biol. Chem. , 250, 4007-4021.

16. Feeney, R.E. ; and Burcham, T . S. (1986) . Antifreeze Glycoproteins from Polar Fish Blood. Ann. Rev. Biophys. Chem. , 15, 59-78.

17. Inokuchi, K. ; Furukawa, H. ; Nakamura, K. ; and Mzushima, S. (1984) . Characterization by Deletion Mutagenesis in Vitro of the Promoter Region of ompf, a Positively Regulated Gene of Escherichia coh. J. Mol. Bio. , 178, 653-668.

18. DeVries, A.L. (1983) . Antifreeze Peptides and Glycopeptides in Cold-Water Fishes. Ann. Rev. Phvsiol. , 45, 245-60.

19. Inouye, S . ; and Inouye, M. (1987) . Oligonucleotide-Directed Site- Specific Mutagenesis using Double- Stranded Plasmid DNA. In Synthesis and Applications of DNA and RNA Synthesis . S.A. Narang, ed. (Academic Press, Inc. , Orlando) , pp. 181-206.

20. Inouye, S . ; and Inouye, M. (1985) . Up-promoter Mutations in the lpp gene of Escherichia coh. Nucleic Acids Research, Vol. 13 , No. 9, pp. 3101-3110.

21. Masui, Y. ; Coleman, J. ; and Inouye, M. (1983) . Experimental Manipulation of Gene Expression, Academy Press, ed. Inouye.

22. Perbal, B . (1988) . A Practical Guide to Molecular Cloning. John Wiley and Sons, Wiley-Interscience, New York, NY.

23. Ausubel, F.M. et al, eds. (1987) . Current Protocols in Molecular Biology (Current Protocols) , Brooklyn, NY and Wiley and Sons Interscience , New York, NY (Supplements 1-5) .

24. Broeze, R.J. ; Solomon, CJ. ; and Pope, D.H. (1978) . Effects of Low Temperature on In Vivo and In Vitro Protein Synthesis in Escherichia coh and Pseudomonas fluorescens . J. Bacteriol. , 134, 861-874.

25. Yang, et al (1988) . Crystal Structure of an Antifreeze Polypeptide and its Mechanistic Implications. Nature, Vol. 333 , pp. 232-237. 26. Maniatis, T. ; Fritch, E.F. ; and Sambrook, J. (1982) . Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp. 383-389.

Claims

CLAIMS:

1. A protein whose synthesis is inducible in E^ coh at a temperature only below the normal growth temperature of E. coh.

2. The protein of claim 1 which exhibits stability at normal growth temperatures and also below the normal growth temperature of E. coh.

3. The protein of claim 1 which is a cytoplasmic protein.

4. The protein of claim 1 which has a molecular weight of about 7.4 kdal.

5. The protein of claim 1 which is capable of lessening the adverse effect of low temperatures on E-_ coh live cells .

6. The protein of claim 5 which has the following amino acid sequence:

MetSerGlyLysMetThrGlylleValLysTrpPheAsnAlaAspLysGlyP eGlyPhelleThrPro AspAspGlySerLysAspValPheValHisPheSerAlalleGlnAsnAspGlyTyrLysSerLeuAsp GluGlyGlnLysValSerPheThrlleGluSerGlyAlaLysGlyProAlaAlaGlyAsnValThrSerLeu.

7. The protein of claim 6 whose amino acid sequence is free of the initial Met residue.

8. The protein of claim 6 which is highly hydrophilic.

9. The protein of claim 6 which has a secondary configuration which is evidence of an α-helical configuration.

10. A promotor sequence which is capable of initiating transcription of a gene at a temperature below normal growth temperature of E. coh.

11. The promotor of claim 10 which is capable of j-nitiating the transcription of a gene which encodes a protein which is capable of lessening the adverse effects of low temperature on Jλ_ coh live cells .

_

12. The promoter of claim 11 which is capable of initiating the transcription a gene at a temperature below the normal growth temperature of 12-_ coh, which gene encodes a protein capable ,of lessening the adverse effects of low temperature on live E_-_ coh cells .

13. The promoter of claim 12 wherein the transcription of the gene which is initiated at low temperature, is a homologous gene.

14. The promoter of claim 13 wherein the gene is cs7.4

15. The promoter of claim 11 which instead of a homologous gene , is capable alternatively of initiating the transcription of a heterologous gene at normal growth temperature of ] _ coh.

16. The promoter of claim 12 which is located upstream of the gene and between nucleotides 1 and 605 as shown in FIG 7.

17. The DNA fragment shown in FIG 7.

18. The DNA fragment shown in FIG 7 from nucleotides 1 through 997.

19. In the DNA fragment shown in FIG 7 , the nucleotide sequences which include the gene, encoding for a protein which is capable of lessening the adverse effects of low temperature on live E^ coh cells , a promoter which is capable of initiating the transcription of said gene at low temperature and other genetic regulatory elements .

20. A DNA sequence which encodes a protein which lessens the adverse effect of low temperature on a growing E^_ coh cell.

21. The DNA sequence of claim 20 which has the following nucleotide sequence:

ATGTCCGGTAAAATGACTGGTATCGTAAAATGGTTCAACGCTGACAAAGGCTTCGGCTTCATCACTCCTGAC GATGGCTCTAAAGATGTGT CGTACACTTCTCTGCTATCCAGAACGATGGTTACAAATCTCTGGACGAAGGT CAGAAAGTGTCCTTCACCATCGAAAGCGGCGCTAAAGGCCCGGCAGCTGGTAACGTAACCAGCCTG .

22. A gene which is capable encoding a protein, the transcription of the gene being regulatable by a promoter which is cold-inducible in E. coh.

23. The gene of claim 22 which encodes the protein of claim 1.

24. The gene of claim 22 which encodes the protein of claim 4.

25. The gene of claim 22 which encodes the protein of claim 5.

26. The gene of claim 22 which encodes the protein of claim 6.

27. The gene of claim 22 which is designated as cs7.4.

28. The gene of claim 22, the transcription of which is also regulatable by a promoter other than by a cold-inducible promoter.

29. The gene of claim 28 wherein the promoter other than the cold-inducible promoter, is the lac promoter.

30. The gene of claim 29 which encodes a protein a normal growth temperature of E__;_ coh.

31. A recombinant plasmid capable of expressing the protein of claim 1.

32. The plasmid of claim 31 which contains the gene shown in FIG 7.

33. The plasmid of claim 32 which also contains a promoter region sequence which is capable of initiating the transcription of the gene.

34. The plasmid of claim 33 which further comprises a DNA sequence upstream of the promoter region capable of binding a transcriptional regulatory protein.

35. The plasmid of claim 34 which further comprises a regulatory protein binding site.

36. An Enterobacteriaceae cell capable of expressing the protein of claim 1 from an extra- chromosomal element.

37. The cell of claim 36 which an E^ coh.

38. A process for producing a protein which is capable of being induced only at a temperature below the normal growth temperature of E. coh and which protein is capable of lessening the adverse effects of low temperature on growing E^ coh, and for producing a promoter sequence which is capable of initiating transcription of a gene encoding said protein which process comprises growing E^ coh at an exponential rate to a desired growth level at a physiological temperature, lowering the temperature to about not higher than 15° C and continuing the growing of said E^ coh at that temperature thereby causing the synthesis of said protein, discontinuing the growth of said culture and isolating the desired DNA fragment therefrom, which fragment contains at least the gene encoding said protein and the promoter sequence which initiated the transcription of said gene.

39. The process of claim 38 wherein the gene is cs7.4 and the protein is csp7.4.